#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ALAS2	212	hgsc.bcm.edu;ucsc.edu	37	X	55051164	55051164	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:55051164C>G	ENST00000330807.5	-	3	428	c.291G>C	c.(289-291)aaG>aaC	p.K97N	ALAS2_ENST00000335854.4_Missense_Mutation_p.K97N|ALAS2_ENST00000396198.3_Missense_Mutation_p.K121N	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	97					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	TCTTGAAAGCCTTCACATCTT	0.502																																																	0													232.0	139.0	171.0					X																	55051164		2203	4300	6503	SO:0001583	missense	212				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.291G>C	X.37:g.55051164C>G	ENSP00000332369:p.Lys97Asn	Somatic		WXS	SOLID	Phase_I	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.37|11.37	1.618509|1.618509	0.28801|0.28801	.|.	.|.	ENSG00000158578|ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854|ENST00000455688	D;D;D|.	0.97016|.	-4.21;-4.2;-4.17|.	4.75|4.75	2.95|2.95	0.34219|0.34219	5-aminolevulinate synthase presequence (1);|.	0.327068|.	0.34628|.	N|.	0.003803|.	T|T	0.34803|0.34803	0.0910|0.0910	L|L	0.39898|0.39898	1.24|1.24	0.28488|0.28488	N|N	0.914612|0.914612	B;B;B|.	0.31256|.	0.154;0.316;0.254|.	B;B;B|.	0.38755|.	0.143;0.281;0.219|.	T|T	0.24835|0.24835	-1.0149|-1.0149	10|5	0.18276|.	T|.	0.48|.	-13.2115|-13.2115	5.3539|5.3539	0.16050|0.16050	0.0:0.639:0.1664:0.1946|0.0:0.639:0.1664:0.1946	.|.	97;121;97|.	A8K6C4;Q5JZF5;P22557|.	.;.;HEM0_HUMAN|.	N|T	97;121;97|49	ENSP00000332369:K97N;ENSP00000379501:K121N;ENSP00000337131:K97N|.	ENSP00000332369:K97N|.	K|R	-|-	3|2	2|0	ALAS2|ALAS2	55067889|55067889	0.913000|0.913000	0.31002|0.31002	0.957000|0.957000	0.39632|0.39632	0.577000|0.577000	0.36160|0.36160	1.061000|1.061000	0.30542|0.30542	0.937000|0.937000	0.37394|0.37394	-0.192000|-0.192000	0.12808|0.12808	AAG|AGG		0.502	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3		NM_000032	
ABCB7	22	hgsc.bcm.edu;ucsc.edu	37	X	74290344	74290344	+	Silent	SNP	A	A	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:74290344A>C	ENST00000373394.3	-	10	1228	c.1221T>G	c.(1219-1221)gtT>gtG	p.V407V	ABCB7_ENST00000534570.1_5'UTR|ABCB7_ENST00000339447.4_Silent_p.V367V|ABCB7_ENST00000253577.3_Silent_p.V408V			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	407	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						CTAGATCTCCAACAGTAAGGG	0.358																																																	0													107.0	103.0	104.0					X																	74290344		2203	4300	6503	SO:0001819	synonymous_variant	22			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1221T>G	X.37:g.74290344A>C		Somatic		WXS	SOLID	Phase_I	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Silent	SNP	ENST00000373394.3	37																																																																																					0.358	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1		NM_004299	
AQR	9716	hgsc.bcm.edu;ucsc.edu	37	15	35174721	35174721	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:35174721C>G	ENST00000156471.5	-	27	3372	c.3147G>C	c.(3145-3147)ttG>ttC	p.L1049F		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1049					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CTAGCTTGACCAAGTCATGTC	0.338																																																	0													70.0	64.0	66.0					15																	35174721		1825	4086	5911	SO:0001583	missense	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.3147G>C	15.37:g.35174721C>G	ENSP00000156471:p.Leu1049Phe	Somatic		WXS	SOLID	Phase_I	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216898	0.39201	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.84516	-1.86	5.73	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.87176	0.6112	M	0.70787	2.145	0.52501	D	0.999957	D	0.64830	0.994	P	0.61477	0.889	D	0.83970	0.0326	10	0.20519	T	0.43	-12.0853	3.4005	0.07321	0.2045:0.5641:0.0:0.2314	.	1049	O60306	AQR_HUMAN	F	1049	ENSP00000156471:L1049F	ENSP00000156471:L1049F	L	-	3	2	AQR	32962013	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	0.414000	0.21164	1.264000	0.44198	0.591000	0.81541	TTG		0.338	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2		NM_014691	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73021667	73021667	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr11:73021667C>A	ENST00000263674.3	+	1	2334	c.1984C>A	c.(1984-1986)Ctg>Atg	p.L662M	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	662					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						ATTTTGCGGCCTGGGTACCAC	0.637																																																	0													80.0	67.0	71.0					11																	73021667		2200	4293	6493	SO:0001583	missense	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1984C>A	11.37:g.73021667C>A	ENSP00000263674:p.Leu662Met	Somatic		WXS	SOLID	Phase_I	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557585	0.27827	.	.	ENSG00000110237	ENST00000263674	T	0.59638	0.25	4.62	1.58	0.23477	.	0.259916	0.27035	N	0.021241	T	0.51092	0.1654	N	0.24115	0.695	0.28026	N	0.934315	D	0.58268	0.982	P	0.55785	0.784	T	0.47535	-0.9110	10	0.72032	D	0.01	-8.2769	7.1496	0.25604	0.0:0.7006:0.1414:0.158	.	662	Q96PE2	ARHGH_HUMAN	M	662	ENSP00000263674:L662M	ENSP00000263674:L662M	L	+	1	2	ARHGEF17	72699315	0.025000	0.19082	0.375000	0.26029	0.200000	0.23975	0.192000	0.17096	0.149000	0.19098	0.561000	0.74099	CTG		0.637	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1		NM_014786	
ASMTL	8623	hgsc.bcm.edu	37	X	1537881	1537881	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:1537881C>T	ENST00000381317.3	-	10	1404	c.1372G>A	c.(1372-1374)Gtg>Atg	p.V458M	ASMTL_ENST00000534940.1_Missense_Mutation_p.V400M|ASMTL_ENST00000416733.2_Missense_Mutation_p.V382M|ASMTL_ENST00000381333.4_Missense_Mutation_p.V442M	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	458	ASMT-like.		V -> M (in dbSNP:rs4503285). {ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCACCTCCCACGTCGCAGGCG	0.612													c|||	1330	0.265575	0.3056	0.3127	5008	,	,		15599	0.2163		0.2247	False		,,,				2504	0.271																0									MET/VAL,MET/VAL,MET/VAL	1063,2945		147,769,1088	30.0	42.0	38.0		1198,1324,1372	0.6	0.3	X	dbSNP_134	38	2099,6171		278,1543,2314	no	missense,missense,missense	ASMTL	NM_001173473.1,NM_001173474.1,NM_004192.3	21,21,21	425,2312,3402	TT,TC,CC		25.3809,26.522,25.7534	possibly-damaging,possibly-damaging,possibly-damaging	400/564,442/606,458/622	1537881	3162,9116	2004	4135	6139	SO:0001583	missense	8623			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1372G>A	X.37:g.1537881C>T	ENSP00000370718:p.Val458Met	Somatic		WXS	SOLID	Phase_I	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	37	CCDS43917.1	563	0.25778388278388276	137	0.2784552845528455	119	0.3287292817679558	129	0.22552447552447552	178	0.23482849604221637	c	5.889	0.348066	0.11126	0.26522	0.253809	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	1.58	0.547	0.17202	O-methyltransferase, family 2 (1);	0.209188	0.30293	U	0.009956	T	0.00012	0.0000	M	0.64170	1.965	0.09310	N	1	D;D;D	0.59357	0.973;0.985;0.973	P;B;B	0.46253	0.509;0.405;0.322	T	0.29336	-1.0015	10	0.66056	D	0.02	.	2.9037	0.05714	0.4205:0.2351:0.3444:0.0	rs4503285;rs17855417;rs4503285	382;442;458	E7ER97;O95671-2;O95671	.;.;ASML_HUMAN	M	382;400;442;458	ENSP00000410578:V382M;ENSP00000446410:V400M;ENSP00000370734:V442M;ENSP00000370718:V458M	ENSP00000370718:V458M	V	-	1	0	ASMTL	1497881	1.000000	0.71417	0.298000	0.25002	0.157000	0.22087	0.547000	0.23299	-0.451000	0.07097	0.100000	0.15512	GTG		0.612	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1		NM_004192	
ATP6AP1	537	hgsc.bcm.edu	37	X	153662580	153662580	+	Silent	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:153662580C>T	ENST00000369762.2	+	7	772	c.711C>T	c.(709-711)gcC>gcT	p.A237A	GDI1_ENST00000447750.2_5'Flank|ATP6AP1_ENST00000484908.1_3'UTR	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	237					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGTGGTGGCCGGAGGGCTAG	0.577																																																	0													96.0	83.0	87.0					X																	153662580		2203	4300	6503	SO:0001819	synonymous_variant	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.711C>T	X.37:g.153662580C>T		Somatic		WXS	SOLID	Phase_I	A6ZKI4|Q8NBT4|Q9H0C7	Silent	SNP	ENST00000369762.2	37	CCDS35451.1																																																																																				0.577	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4		NM_001183	
BAP1	8314	hgsc.bcm.edu	37	3	52440367	52440367	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:52440367T>G	ENST00000460680.1	-	9	1156	c.685A>C	c.(685-687)Aac>Cac	p.N229H	BAP1_ENST00000296288.5_Intron	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GCCATCAGGTTGAAGCGGATG	0.622			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0													96.0	74.0	81.0					3																	52440367		2203	4300	6503	SO:0001583	missense	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.685A>C	3.37:g.52440367T>G	ENSP00000417132:p.Asn229His	Somatic		WXS	SOLID	Phase_I	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.037127	0.93630	.	.	ENSG00000163930	ENST00000460680	T	0.50277	0.75	6.04	6.04	0.98038	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (2);	0.000000	0.85682	D	0.000000	T	0.68805	0.3041	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71842	-0.4470	10	0.87932	D	0	-8.6722	16.5838	0.84722	0.0:0.0:0.0:1.0	.	229	Q92560	BAP1_HUMAN	H	229	ENSP00000417132:N229H	ENSP00000417132:N229H	N	-	1	0	BAP1	52415407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.005000	0.88553	2.319000	0.78375	0.528000	0.53228	AAC		0.622	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
BDP1	55814	hgsc.bcm.edu;ucsc.edu	37	5	70806004	70806004	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr5:70806004A>G	ENST00000358731.4	+	17	3348	c.3085A>G	c.(3085-3087)Att>Gtt	p.I1029V	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1029	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ACCAGAGGTGATTGATGCTAC	0.463																																																	0													74.0	75.0	75.0					5																	70806004		1848	4090	5938	SO:0001583	missense	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.3085A>G	5.37:g.70806004A>G	ENSP00000351575:p.Ile1029Val	Somatic		WXS	SOLID	Phase_I	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	a	4.020	0.001130	0.07819	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.16073	2.37	3.49	-0.314	0.12750	.	2.027030	0.03609	U	0.234518	T	0.08088	0.0202	N	0.12182	0.205	0.09310	N	0.999999	B;B;B	0.14012	0.003;0.009;0.009	B;B;B	0.11329	0.003;0.006;0.002	T	0.24977	-1.0145	10	0.10377	T	0.69	.	2.3315	0.04237	0.5163:0.0:0.2502:0.2335	.	1029;1029;1029	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	V	1029;609	ENSP00000351575:I1029V	ENSP00000351575:I1029V	I	+	1	0	BDP1	70841760	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-0.139000	0.10358	-0.058000	0.13177	0.260000	0.18958	ATT		0.463	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2		NM_018429	
ADGB	79747	hgsc.bcm.edu;ucsc.edu	37	6	147022203	147022203	+	Silent	SNP	T	T	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:147022203T>C	ENST00000397944.3	+	13	1780	c.1704T>C	c.(1702-1704)tcT>tcC	p.S568S	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	568					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.S568S(1)		breast(1)|endometrium(2)|kidney(2)	5						AAGCTACATCTCAGGTGACTA	0.363																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											118.0	99.0	105.0					6																	147022203		692	1591	2283	SO:0001819	synonymous_variant	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.1704T>C	6.37:g.147022203T>C		Somatic		WXS	SOLID	Phase_I	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37																																																																																					0.363	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2		NM_024694	
CACNA1A	773	hgsc.bcm.edu	37	19	13366050	13366050	+	Silent	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr19:13366050G>T	ENST00000360228.5	-	29	4613	c.4614C>A	c.(4612-4614)atC>atA	p.I1538I	CACNA1A_ENST00000574822.1_5'Flank|CACNA1A_ENST00000573710.2_Silent_p.I1539I	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1539					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTTGGCGCTGATGGCGAAAT	0.607																																																	0													47.0	51.0	50.0					19																	13366050		2104	4206	6310	SO:0001819	synonymous_variant	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4614C>A	19.37:g.13366050G>T		Somatic		WXS	SOLID	Phase_I	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																				0.607	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2		NM_000068	
CACNA1A	773	hgsc.bcm.edu;ucsc.edu	37	19	13414666	13414666	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr19:13414666C>A	ENST00000360228.5	-	16	2018	c.2019G>T	c.(2017-2019)atG>atT	p.M673I	CACNA1A_ENST00000573710.2_Missense_Mutation_p.M674I	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	674					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCCGTCGTACATGACCTCGT	0.567																																																	0													157.0	162.0	160.0					19																	13414666		2030	4180	6210	SO:0001583	missense	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2019G>T	19.37:g.13414666C>A	ENSP00000353362:p.Met673Ile	Somatic		WXS	SOLID	Phase_I	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.732617	0.69189	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.98701	-5.08	4.58	4.58	0.56647	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99039	0.9671	M	0.81112	2.525	0.53688	D	0.999978	D;D;P	0.59357	0.985;0.982;0.86	D;D;P	0.72338	0.977;0.961;0.844	D	0.99585	1.0974	10	0.87932	D	0	.	16.302	0.82825	0.0:1.0:0.0:0.0	.	674;674;673	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	I	673;674;674;674	ENSP00000353362:M673I	ENSP00000317661:M674I	M	-	3	0	CACNA1A	13275666	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.536000	0.82023	2.371000	0.80710	0.591000	0.81541	ATG		0.567	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2		NM_000068	
CACNG3	10368	hgsc.bcm.edu;ucsc.edu	37	16	24268095	24268095	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:24268095G>A	ENST00000005284.3	+	1	1222	c.20G>A	c.(19-21)gGt>gAt	p.G7D		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	7					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		TGTGACAGAGGTATCCAGATG	0.522																																																	0													175.0	179.0	178.0					16																	24268095		2197	4300	6497	SO:0001583	missense	10368			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.20G>A	16.37:g.24268095G>A	ENSP00000005284:p.Gly7Asp	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280894	0.80692	.	.	ENSG00000006116	ENST00000005284	D	0.89810	-2.57	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.94935	0.8362	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94670	0.7856	10	0.51188	T	0.08	-7.862	17.6597	0.88188	0.0:0.0:1.0:0.0	.	7	O60359	CCG3_HUMAN	D	7	ENSP00000005284:G7D	ENSP00000005284:G7D	G	+	2	0	CACNG3	24175596	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.756000	0.94617	0.655000	0.94253	GGT		0.522	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1		NM_006539	
CDK9	1025	hgsc.bcm.edu	37	9	130548496	130548496	+	Silent	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr9:130548496C>G	ENST00000373264.4	+	1	169	c.69C>G	c.(67-69)gcC>gcG	p.A23A	CDK9_ENST00000373265.2_Silent_p.A140A|MIR3960_ENST00000583311.1_RNA|CDK9_ENST00000480353.1_3'UTR	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	23	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			lung(1)	1						AGAAGCTCGCCAAGATCGGCC	0.687																																																	0													47.0	49.0	48.0					9																	130548496		2203	4300	6503	SO:0001819	synonymous_variant	1025			L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.69C>G	9.37:g.130548496C>G		Somatic		WXS	SOLID	Phase_I	Q5JU24|Q5JU25|Q5U006|Q96TF1	Silent	SNP	ENST00000373264.4	37	CCDS6879.1																																																																																				0.687	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054235.1			
CREB3L1	90993	hgsc.bcm.edu	37	11	46332690	46332690	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr11:46332690G>C	ENST00000529193.1	+	5	1154	c.703G>C	c.(703-705)Gcg>Ccg	p.A235P	CREB3L1_ENST00000288400.3_Missense_Mutation_p.A235P			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	235					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		CAGGCCCATGGCGCGCTCCTC	0.657			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)			Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	0													23.0	28.0	26.0					11																	46332690		1975	4151	6126	SO:0001583	missense	90993				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.703G>C	11.37:g.46332690G>C	ENSP00000434939:p.Ala235Pro	Somatic		WXS	SOLID	Phase_I	Q8N2D5|Q96CP0	Missense_Mutation	SNP	ENST00000529193.1	37	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026024	0.54683	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415	T;T	0.76709	-1.04;-1.04	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.56062	0.1960	N	0.02721	-0.515	0.45427	D	0.998401	B	0.15719	0.014	B	0.13407	0.009	T	0.54282	-0.8317	10	0.29301	T	0.29	-21.7194	14.4082	0.67096	0.0:0.1474:0.8525:0.0	.	235	Q96BA8	CR3L1_HUMAN	P	235;235;147	ENSP00000434939:A235P;ENSP00000288400:A235P	ENSP00000288400:A235P	A	+	1	0	CREB3L1	46289266	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	6.069000	0.71209	2.452000	0.82932	0.650000	0.86243	GCG		0.657	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1		NM_052854	
CSRNP1	64651	hgsc.bcm.edu	37	3	39184799	39184799	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:39184799T>A	ENST00000273153.5	-	5	1694	c.1517A>T	c.(1516-1518)gAg>gTg	p.E506V	CSRNP1_ENST00000514182.1_Missense_Mutation_p.E506V	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	506					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CTGGAGTAACTCAAAGGAGTC	0.562																																																	0													56.0	54.0	55.0					3																	39184799		2203	4300	6503	SO:0001583	missense	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.1517A>T	3.37:g.39184799T>A	ENSP00000273153:p.Glu506Val	Somatic		WXS	SOLID	Phase_I	Q69YY5	Missense_Mutation	SNP	ENST00000273153.5	37	CCDS2682.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.952301	0.73787	.	.	ENSG00000144655	ENST00000273153;ENST00000514182;ENST00000318290	T;T	0.55234	0.53;0.53	5.05	3.85	0.44370	.	0.175188	0.34777	N	0.003699	T	0.65780	0.2724	L	0.56769	1.78	0.51767	D	0.999935	D	0.76494	0.999	D	0.68039	0.955	T	0.67741	-0.5592	10	0.87932	D	0	-15.1395	12.0862	0.53698	0.0:0.0:0.1441:0.8559	.	506	Q96S65	CSRN1_HUMAN	V	506;506;164	ENSP00000273153:E506V;ENSP00000422532:E506V	ENSP00000273153:E506V	E	-	2	0	CSRNP1	39159803	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.894000	0.69806	0.841000	0.35020	0.533000	0.62120	GAG		0.562	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1		NM_033027	
CSTF3	1479	hgsc.bcm.edu;ucsc.edu	37	11	33127147	33127147	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr11:33127147T>G	ENST00000323959.4	-	8	690	c.551A>C	c.(550-552)gAa>gCa	p.E184A	TCP11L1_ENST00000324357.9_3'UTR	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	184					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						CCAGAGCTGTTCAATGTTGAT	0.358																																																	0													129.0	127.0	128.0					11																	33127147		2202	4298	6500	SO:0001583	missense	1479			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.551A>C	11.37:g.33127147T>G	ENSP00000315791:p.Glu184Ala	Somatic		WXS	SOLID	Phase_I	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	ENST00000323959.4	37	CCDS7883.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.971831	0.92919	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	T	0.37411	1.2	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.57330	0.2046	M	0.85373	2.75	0.80722	D	1	D	0.56521	0.976	P	0.53861	0.736	T	0.62029	-0.6940	10	0.41790	T	0.15	.	16.1671	0.81777	0.0:0.0:0.0:1.0	.	184	Q12996	CSTF3_HUMAN	A	184;117	ENSP00000315791:E184A	ENSP00000315791:E184A	E	-	2	0	CSTF3	33083723	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.035000	0.88872	2.224000	0.72417	0.528000	0.53228	GAA		0.358	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388801.1		NM_001326	
CWH43	80157	hgsc.bcm.edu;ucsc.edu	37	4	49034691	49034691	+	Silent	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr4:49034691C>T	ENST00000226432.4	+	12	1800	c.1617C>T	c.(1615-1617)ggC>ggT	p.G539G	CWH43_ENST00000513409.1_Silent_p.G512G	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	539					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						ACATTTCGGGCAAGCTGGTGG	0.453																																																	0													198.0	171.0	180.0					4																	49034691		2203	4300	6503	SO:0001819	synonymous_variant	80157				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1617C>T	4.37:g.49034691C>T		Somatic		WXS	SOLID	Phase_I	B2RPD7	Silent	SNP	ENST00000226432.4	37	CCDS3486.1																																																																																				0.453	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2		NM_025087	
CYFIP1	23191	hgsc.bcm.edu;ucsc.edu	37	15	22956552	22956552	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:22956552C>T	ENST00000313077.7	+	16	1914	c.1789C>T	c.(1789-1791)Cga>Tga	p.R597*	CYFIP1_ENST00000435939.2_Nonsense_Mutation_p.R166*|CYFIP1_ENST00000560848.1_Nonsense_Mutation_p.R597*	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		AAAATTTCATCGAGAGTCATT	0.448																																																	0													57.0	52.0	54.0					15																	22956552		2203	4300	6503	SO:0001587	stop_gained	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1789C>T	15.37:g.22956552C>T	ENSP00000324549:p.Arg597*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	C	40	8.059581	0.98632	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	.	.	.	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-11.7987	20.2982	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	597;625;166	.	ENSP00000324549:R597X	R	+	1	2	CYFIP1	20507993	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	4.734000	0.62043	2.873000	0.98535	0.563000	0.77884	CGA		0.448	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2		NM_014608	
DIDO1	11083	hgsc.bcm.edu;ucsc.edu	37	20	61527636	61527636	+	Silent	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr20:61527636G>A	ENST00000266070.4	-	8	2488	c.2163C>T	c.(2161-2163)taC>taT	p.Y721Y	DIDO1_ENST00000395343.1_Silent_p.Y721Y|DIDO1_ENST00000395340.1_Silent_p.Y721Y|DIDO1_ENST00000395335.2_Silent_p.Y721Y	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	721	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ATTTACTCTTGTAGCGATTAT	0.418																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													182.0	163.0	170.0					20																	61527636		2203	4300	6503	SO:0001819	synonymous_variant	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2163C>T	20.37:g.61527636G>A		Somatic		WXS	SOLID	Phase_I	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1																																																																																				0.418	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2		NM_080796	
DTWD1	56986	hgsc.bcm.edu;ucsc.edu	37	15	49917573	49917573	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:49917573A>C	ENST00000251250.6	+	3	416	c.209A>C	c.(208-210)tAt>tCt	p.Y70S	DTWD1_ENST00000329873.5_Missense_Mutation_p.Y70S|DTWD1_ENST00000403028.3_Missense_Mutation_p.Y70S|DTWD1_ENST00000559223.1_3'UTR|DTWD1_ENST00000558653.1_Missense_Mutation_p.Y70S	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	70										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		TTCTACTGCTATACATGTTAT	0.323																																																	0													97.0	90.0	92.0					15																	49917573		2196	4295	6491	SO:0001583	missense	56986			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.209A>C	15.37:g.49917573A>C	ENSP00000251250:p.Tyr70Ser	Somatic		WXS	SOLID	Phase_I	Q567Q3|Q8WVG9|Q9NRU6	Missense_Mutation	SNP	ENST00000251250.6	37	CCDS10132.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.343006	0.82022	.	.	ENSG00000104047	ENST00000403028;ENST00000329873;ENST00000251250	T;T;T	0.54675	1.53;0.56;1.53	5.09	5.09	0.68999	DTW (1);	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82444	-0.0454	9	.	.	.	-10.9074	15.1692	0.72858	1.0:0.0:0.0:0.0	.	70	Q8N5C7	DTWD1_HUMAN	S	70	ENSP00000385399:Y70S;ENSP00000329313:Y70S;ENSP00000251250:Y70S	.	Y	+	2	0	DTWD1	47704865	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.605000	0.90883	2.029000	0.59856	0.482000	0.46254	TAT		0.323	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254431.2		NM_020234	
FAM21A	387680	hgsc.bcm.edu	37	10	51863872	51863872	+	Missense_Mutation	SNP	T	T	C	rs199954057		TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr10:51863872T>C	ENST00000282633.5	+	18	1751	c.1706T>C	c.(1705-1707)tTg>tCg	p.L569S	FAM21A_ENST00000314664.7_Missense_Mutation_p.L569S|FAM21A_ENST00000351071.6_Missense_Mutation_p.L569S|FAM21A_ENST00000399339.2_Missense_Mutation_p.L481S	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	569					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						CTCCCCACGTTGGTTTCCCTG	0.388																																																	0													113.0	96.0	101.0					10																	51863872		1801	3701	5502	SO:0001583	missense	387680			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1706T>C	10.37:g.51863872T>C	ENSP00000282633:p.Leu569Ser	Somatic		WXS	SOLID	Phase_I	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	37	CCDS41527.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.476318	0.00011	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.2	2.29	0.28610	.	0.309608	0.27886	N	0.017458	T	0.04861	0.0131	N	0.00075	-2.25	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.42430	-0.9452	9	0.02654	T	1	-2.7636	8.7263	0.34471	0.0:0.8651:0.0:0.1349	.	569;569;481;569;463	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	S	569;569;463;569;481	.	ENSP00000282633:L569S	L	+	2	0	FAM21A	51533878	.	.	0.019000	0.16419	0.016000	0.09150	.	.	0.058000	0.16222	-2.800000	0.00114	TTG		0.388	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2		NM_001005751	
FAM3D	131177	hgsc.bcm.edu;ucsc.edu	37	3	58620032	58620032	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:58620032C>T	ENST00000358781.2	-	10	959	c.649G>A	c.(649-651)Ggc>Agc	p.G217S	RP11-475O23.3_ENST00000464125.1_RNA	NM_138805.2	NP_620160.1	Q96BQ1	FAM3D_HUMAN	family with sequence similarity 3, member D	217					negative regulation of insulin secretion (GO:0046676)	extracellular region (GO:0005576)	cytokine activity (GO:0005125)			large_intestine(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)		GGCATGCAGCCCTCCATCTCC	0.552																																																	0													83.0	84.0	84.0					3																	58620032		2203	4300	6503	SO:0001583	missense	131177			AF494381	CCDS2893.1	3p21.1	2008-07-18			ENSG00000198643	ENSG00000198643			18665	protein-coding gene	gene with protein product		608619				12160727	Standard	NM_138805		Approved	EF7, OIT1	uc003dkq.3	Q96BQ1	OTTHUMG00000159148	ENST00000358781.2:c.649G>A	3.37:g.58620032C>T	ENSP00000351632:p.Gly217Ser	Somatic		WXS	SOLID	Phase_I	Q547G2	Missense_Mutation	SNP	ENST00000358781.2	37	CCDS2893.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843187	0.91197	.	.	ENSG00000198643	ENST00000358781	T	0.21932	1.98	5.3	5.3	0.74995	.	0.144121	0.48286	D	0.000184	T	0.55242	0.1908	M	0.89840	3.065	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.63967	-0.6517	10	0.72032	D	0.01	-37.1161	16.8015	0.85615	0.0:1.0:0.0:0.0	.	217	Q96BQ1	FAM3D_HUMAN	S	217	ENSP00000351632:G217S	ENSP00000351632:G217S	G	-	1	0	FAM3D	58595072	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	6.830000	0.75319	2.650000	0.89964	0.655000	0.94253	GGC		0.552	FAM3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353494.1		NM_138805	
FAM46A	55603	hgsc.bcm.edu;ucsc.edu	37	6	82459989	82459989	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:82459989A>G	ENST00000320172.6	-	3	1066	c.752T>C	c.(751-753)aTg>aCg	p.M251T	FAM46A_ENST00000369754.3_Missense_Mutation_p.M270T|FAM46A_ENST00000369756.3_Missense_Mutation_p.M332T	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	251					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		TGTCTCAGTCATTGGGTTCTC	0.428																																																	0													66.0	71.0	69.0					6																	82459989		2203	4300	6503	SO:0001583	missense	55603			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.752T>C	6.37:g.82459989A>G	ENSP00000318298:p.Met251Thr	Somatic		WXS	SOLID	Phase_I	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	ENST00000320172.6	37	CCDS34489.1	.	.	.	.	.	.	.	.	.	.	A	11.44	1.639344	0.29157	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.25414	1.8;1.8;1.8	5.95	5.95	0.96441	Domain of unknown function DUF1693 (1);	0.071188	0.85682	N	0.000000	T	0.25121	0.0610	M	0.86953	2.85	0.80722	D	1	P;P	0.46512	0.611;0.879	B;B	0.37047	0.237;0.24	T	0.38950	-0.9637	10	0.72032	D	0.01	-24.333	16.4237	0.83790	1.0:0.0:0.0:0.0	.	251;270	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	T	270;251;332	ENSP00000358769:M270T;ENSP00000318298:M251T;ENSP00000358771:M332T	ENSP00000318298:M251T	M	-	2	0	FAM46A	82516708	1.000000	0.71417	0.999000	0.59377	0.006000	0.05464	9.339000	0.96797	2.279000	0.76181	0.533000	0.62120	ATG		0.428	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1			
FRS2	10818	hgsc.bcm.edu;ucsc.edu	37	12	69965176	69965176	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr12:69965176C>A	ENST00000550389.1	+	5	620	c.374C>A	c.(373-375)aCa>aAa	p.T125K	FRS2_ENST00000397997.2_Missense_Mutation_p.T125K|FRS2_ENST00000549921.1_Missense_Mutation_p.T125K|FRS2_ENST00000299293.2_Missense_Mutation_p.T125K	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	125					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			AATCATCAGACAGAATTGGAA	0.363											OREG0021986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													105.0	96.0	99.0					12																	69965176		1866	4099	5965	SO:0001583	missense	10818			AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.374C>A	12.37:g.69965176C>A	ENSP00000447241:p.Thr125Lys	Somatic	1118	WXS	SOLID	Phase_I	B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	ENST00000550389.1	37	CCDS41809.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817339	0.50633	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000550389;ENST00000397997;ENST00000551325	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.71	5.71	0.89125	.	0.414397	0.25929	N	0.027391	T	0.75064	0.3799	L	0.29908	0.895	0.48452	D	0.999655	B	0.30455	0.28	B	0.22880	0.042	T	0.70360	-0.4893	9	.	.	.	-8.41	19.9325	0.97124	0.0:1.0:0.0:0.0	.	125	Q8WU20	FRS2_HUMAN	K	125	ENSP00000299293:T125K;ENSP00000450048:T125K;ENSP00000447241:T125K;ENSP00000381083:T125K;ENSP00000449432:T125K	.	T	+	2	0	FRS2	68251443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.593000	0.67550	2.720000	0.93068	0.650000	0.86243	ACA		0.363	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403760.1		NM_006654	
FYCO1	79443	hgsc.bcm.edu	37	3	46001032	46001032	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:46001032T>C	ENST00000296137.2	-	12	3645	c.3440A>G	c.(3439-3441)gAc>gGc	p.D1147G	FYCO1_ENST00000438446.1_5'Flank|FYCO1_ENST00000535325.1_Missense_Mutation_p.D1147G	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1147					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		AGCATCCTTGTCCCTGGGACA	0.468																																																	0													53.0	47.0	49.0					3																	46001032		2203	4300	6503	SO:0001583	missense	79443			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3440A>G	3.37:g.46001032T>C	ENSP00000296137:p.Asp1147Gly	Somatic		WXS	SOLID	Phase_I	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.781032	0.90282	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.24908	1.83;1.84	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.47192	0.1432	M	0.64997	1.995	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.987	T	0.47142	-0.9140	10	0.62326	D	0.03	-27.52	12.9017	0.58128	0.0:0.0:0.0:1.0	.	1147;1147	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	G	1147	ENSP00000296137:D1147G;ENSP00000441178:D1147G	ENSP00000296137:D1147G	D	-	2	0	FYCO1	45976036	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.714000	0.84703	1.787000	0.52448	0.533000	0.62120	GAC		0.468	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2		NM_024513	
GABRG3	2567	hgsc.bcm.edu;ucsc.edu	37	15	27772598	27772598	+	Silent	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:27772598C>T	ENST00000333743.6	+	8	1139	c.885C>T	c.(883-885)acC>acT	p.T295T	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	295					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGGTGCTGACCATGACCACCC	0.577																																					NSCLC(114;800 1656 7410 37729 45293)												0													115.0	108.0	111.0					15																	27772598		2186	4292	6478	SO:0001819	synonymous_variant	2567				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.885C>T	15.37:g.27772598C>T		Somatic		WXS	SOLID	Phase_I	G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	C	9.533	1.111348	0.20714	.	.	ENSG00000182256	ENST00000451330	.	.	.	5.48	4.37	0.52481	.	.	.	.	.	T	0.59018	0.2163	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55328	-0.8158	4	.	.	.	.	9.1675	0.37060	0.1488:0.7652:0.0:0.086	.	.	.	.	L	58	.	.	P	+	2	0	GABRG3	25446193	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.747000	0.26290	2.562000	0.86427	0.563000	0.77884	CCA		0.577	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			
GCM1	8521	hgsc.bcm.edu	37	6	52995691	52995691	+	Missense_Mutation	SNP	C	C	G	rs76623467	byFrequency	TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:52995691C>G	ENST00000259803.7	-	5	691	c.480G>C	c.(478-480)aaG>aaC	p.K160N		NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	160					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					CAGCTTCTAACTTGGTTTCTG	0.443																																																	0													399.0	308.0	339.0					6																	52995691		2203	4300	6503	SO:0001583	missense	8521			D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.480G>C	6.37:g.52995691C>G	ENSP00000259803:p.Lys160Asn	Somatic		WXS	SOLID	Phase_I	Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	37	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.145372	0.57044	.	.	ENSG00000137270	ENST00000259803	T	0.80123	-1.34	5.94	2.8	0.32819	.	0.000000	0.85682	D	0.000000	D	0.82797	0.5115	M	0.73430	2.235	0.53688	D	0.999972	D	0.89917	1.0	D	0.91635	0.999	T	0.82756	-0.0300	10	0.54805	T	0.06	0.014	6.4952	0.22138	0.0:0.404:0.0:0.596	.	160	Q9NP62	GCM1_HUMAN	N	160	ENSP00000259803:K160N	ENSP00000259803:K160N	K	-	3	2	GCM1	53103650	0.083000	0.21467	0.883000	0.34634	0.513000	0.34164	0.311000	0.19380	1.310000	0.45006	0.650000	0.86243	AAG		0.443	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			
GLIPR1L2	144321	hgsc.bcm.edu	37	12	75816814	75816815	+	Intron	INS	-	-	ACA	rs199738162|rs397750292|rs144850646|rs59277111	byFrequency	TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr12:75816814_75816815insACA	ENST00000550916.1	+	4	717				GLIPR1L2_ENST00000320460.4_In_Frame_Ins_p.239_240insN|GLIPR1L2_ENST00000435775.1_Intron|GLIPR1L2_ENST00000441218.1_Intron|GLIPR1L2_ENST00000378692.3_Intron	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						TAATGGATTGGACAAGAAAAAT	0.312														1714	0.342252	0.2511	0.2622	5008	,	,		17045	0.4683		0.3767	False		,,,				2504	0.3569																0										1181,3083		163,855,1114						0.0	0.0		dbSNP_130	117	3246,5006		650,1946,1530	no	coding	GLIPR1L2	NM_152436.1		813,2801,2644	A1A1,A1R,RR		39.3359,27.697,35.3707				4427,8089				SO:0001627	intron_variant	144321			BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.670+45->ACA	12.37:g.75816815_75816817dupACA		Somatic		WXS	SOLID	Phase_I	Q6MZS1|Q8N6N0|Q8NA43	In_Frame_Ins	INS	ENST00000550916.1	37	CCDS58258.1																																																																																				0.312	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405718.1		NM_152436	
GOLGA2	2801	hgsc.bcm.edu	37	9	131019438	131019438	+	Missense_Mutation	SNP	G	G	A	rs113640242	byFrequency	TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr9:131019438G>A	ENST00000421699.2	-	26	2929	c.2917C>T	c.(2917-2919)Ccc>Tcc	p.P973S	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Missense_Mutation_p.P961S	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	973					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CGCTCCCGGGGGTTCTGCATC	0.592																																																	0													62.0	69.0	67.0					9																	131019438		2203	4300	6503	SO:0001583	missense	2801			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2917C>T	9.37:g.131019438G>A	ENSP00000416097:p.Pro973Ser	Somatic		WXS	SOLID	Phase_I	Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	ENST00000421699.2	37	CCDS6896.2	.	.	.	.	.	.	.	.	.	.	g	14.20	2.465614	0.43839	.	.	ENSG00000167110	ENST00000421699;ENST00000342583	T	0.27720	1.65	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	M	0.61703	1.905	0.53005	D	0.999966	P;P	0.47604	0.898;0.723	P;P	0.53649	0.731;0.676	T	0.24870	-1.0148	10	0.12766	T	0.61	.	18.1873	0.89796	0.0:0.0:1.0:0.0	.	973;591	Q08379;Q08379-2	GOGA2_HUMAN;.	S	973;257	ENSP00000416097:P973S	ENSP00000342692:P257S	P	-	1	0	GOLGA2	130059259	1.000000	0.71417	0.483000	0.27378	0.094000	0.18550	4.640000	0.61368	2.275000	0.75901	0.460000	0.39030	CCC		0.592	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2		NM_004486	
HCFC1	3054	hgsc.bcm.edu	37	X	153215992	153215992	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:153215992A>T	ENST00000310441.7	-	24	6672	c.5706T>A	c.(5704-5706)agT>agA	p.S1902R	HCFC1_ENST00000369984.4_Missense_Mutation_p.S1947R|HCFC1_ENST00000354233.3_Missense_Mutation_p.S1833R	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1902	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCATCCGGACTCTAGAAGC	0.542																																																	0													36.0	39.0	38.0					X																	153215992		2103	4210	6313	SO:0001583	missense	3054				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5706T>A	X.37:g.153215992A>T	ENSP00000309555:p.Ser1902Arg	Somatic		WXS	SOLID	Phase_I	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.93|14.93	2.683569|2.683569	0.47991|0.47991	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|T	0.58210|0.36340	0.35;0.35;0.35|1.26	5.17|5.17	-2.87|-2.87	0.05700|0.05700	Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	0.038775|0.038775	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.50497|0.50497	0.1619|0.1619	M|M	0.85197|0.85197	2.74|2.74	0.32847|0.32847	D|D	0.506081|0.506081	P|.	0.44877|.	0.845|.	B|.	0.38106|.	0.265|.	T|T	0.59794|0.59794	-0.7387|-0.7387	10|8	0.72032|0.40728	D|T	0.01|0.16	.|.	12.6476|12.6476	0.56744|0.56744	0.4172:0.0:0.5828:0.0|0.4172:0.0:0.5828:0.0	.|.	1902|.	P51610|.	HCFC1_HUMAN|.	R|T	1902;1947;1833|478	ENSP00000309555:S1902R;ENSP00000359001:S1947R;ENSP00000346174:S1833R|ENSP00000399589:S478T	ENSP00000309555:S1902R|ENSP00000399589:S478T	S|S	-|-	3|1	2|0	HCFC1|HCFC1	152869186|152869186	0.915000|0.915000	0.31059|0.31059	0.389000|0.389000	0.26208|0.26208	0.086000|0.086000	0.17979|0.17979	0.096000|0.096000	0.15147|0.15147	-1.077000|-1.077000	0.03121|0.03121	0.424000|0.424000	0.28305|0.28305	AGT|TCC		0.542	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4		NM_005334	
HHAT	55733	hgsc.bcm.edu	37	1	210761285	210761285	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:210761285G>T	ENST00000367010.1	+	10	1314	c.1087G>T	c.(1087-1089)Ggg>Tgg	p.G363W	HHAT_ENST00000391905.3_Missense_Mutation_p.G363W|HHAT_ENST00000545154.1_Missense_Mutation_p.G364W|HHAT_ENST00000545781.1_Missense_Mutation_p.G300W|HHAT_ENST00000413764.2_Missense_Mutation_p.G363W|HHAT_ENST00000367009.1_Missense_Mutation_p.G53W|HHAT_ENST00000537898.1_Missense_Mutation_p.G298W|HHAT_ENST00000308852.6_Missense_Mutation_p.G318W|HHAT_ENST00000261458.3_Missense_Mutation_p.G363W|HHAT_ENST00000541565.1_Missense_Mutation_p.G226W	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	363					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TGGCCTGCTGGGGACACTGTT	0.557																																																	0													85.0	77.0	80.0					1																	210761285		2203	4300	6503	SO:0001583	missense	55733			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.1087G>T	1.37:g.210761285G>T	ENSP00000355977:p.Gly363Trp	Somatic		WXS	SOLID	Phase_I	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	37	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.758267	0.49468	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000367009	T;T;T;T;T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78	5.69	3.78	0.43462	.	0.262962	0.40222	N	0.001157	T	0.65719	0.2718	L	0.54323	1.7	0.34075	D	0.658913	P;P;P;P;P	0.40000	0.51;0.455;0.543;0.698;0.695	B;B;B;B;B	0.38712	0.273;0.178;0.28;0.232;0.223	T	0.73739	-0.3888	10	0.49607	T	0.09	-17.7309	6.1452	0.20280	0.147:0.0:0.696:0.157	.	318;364;226;298;363	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	W	363;226;364;298;363;300;363;318;363;53	ENSP00000416845:G363W;ENSP00000444995:G226W;ENSP00000438468:G364W;ENSP00000442625:G298W;ENSP00000375773:G363W;ENSP00000439229:G300W;ENSP00000261458:G363W;ENSP00000308628:G318W;ENSP00000355977:G363W;ENSP00000355976:G53W	ENSP00000261458:G363W	G	+	1	0	HHAT	208827908	0.975000	0.34042	1.000000	0.80357	0.994000	0.84299	1.255000	0.32909	1.380000	0.46344	0.655000	0.94253	GGG		0.557	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1		NM_018194	
HIST1H4H	8365	hgsc.bcm.edu;ucsc.edu	37	6	26285450	26285450	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:26285450C>T	ENST00000377727.1	-	1	287	c.278G>A	c.(277-279)cGa>cAa	p.R93Q	HIST1H4H_ENST00000289352.1_Missense_Mutation_p.R93Q	NM_003543.3	NP_003534.1	P62805	H4_HUMAN	histone cluster 1, H4h	93					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(2)|ovary(2)|upper_aerodigestive_tract(3)	7						GCGTCCCTGTCGCTTCAGCGC	0.532										HNSCC(76;0.23)																																							0													152.0	128.0	136.0					6																	26285450		2203	4300	6503	SO:0001583	missense	8365			X60487	CCDS4604.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158406	ENSG00000158406		"""Histones / Replication-dependent"""	4788	protein-coding gene	gene with protein product		602828	"""H4 histone family, member H"", ""histone 1, H4h"""	H4FH		9119399, 12408966	Standard	NM_003543		Approved	H4/h	uc003nhm.2	P62805	OTTHUMG00000014454	ENST00000377727.1:c.278G>A	6.37:g.26285450C>T	ENSP00000366956:p.Arg93Gln	Somatic		WXS	SOLID	Phase_I	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377727.1	37	CCDS4604.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.003057	0.74932	.	.	ENSG00000158406	ENST00000289352;ENST00000377727	T;T	0.68765	-0.35;-0.35	4.13	4.13	0.48395	.	0.000000	0.48767	U	0.000169	T	0.66925	0.2839	.	.	.	0.32374	N	0.555496	.	.	.	.	.	.	T	0.70880	-0.4752	7	0.72032	D	0.01	.	14.2671	0.66126	0.0:1.0:0.0:0.0	.	.	.	.	Q	93	ENSP00000289352:R93Q;ENSP00000366956:R93Q	ENSP00000289352:R93Q	R	-	2	0	HIST1H4H	26393429	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	7.702000	0.84576	2.034000	0.60081	0.313000	0.20887	CGA		0.532	HIST1H4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040119.1		NM_003543	
HMG20A	10363	hgsc.bcm.edu;ucsc.edu	37	15	77771582	77771582	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:77771582T>G	ENST00000381714.3	+	10	1397	c.969T>G	c.(967-969)atT>atG	p.I323M	HMG20A_ENST00000336216.4_Missense_Mutation_p.I323M	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	323					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TGCACAGTATTATTTTAGCTA	0.403																																																	0													142.0	144.0	143.0					15																	77771582		2196	4294	6490	SO:0001583	missense	10363			AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.969T>G	15.37:g.77771582T>G	ENSP00000371133:p.Ile323Met	Somatic		WXS	SOLID	Phase_I	A6NHY3|D3DW78|Q53G31|Q9NSF6	Missense_Mutation	SNP	ENST00000381714.3	37	CCDS10295.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.546784	0.45383	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	T;T	0.67523	-0.27;-0.27	6.03	2.5	0.30297	.	0.272311	0.41823	D	0.000814	T	0.41119	0.1145	N	0.05078	-0.115	0.37670	D	0.923092	B	0.26635	0.155	B	0.29862	0.108	T	0.33979	-0.9847	10	0.41790	T	0.15	-13.1323	5.8315	0.18582	0.1305:0.1584:0.0:0.7111	.	323	Q9NP66	HM20A_HUMAN	M	323	ENSP00000336856:I323M;ENSP00000371133:I323M	ENSP00000336856:I323M	I	+	3	3	HMG20A	75558637	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.026000	0.41069	1.062000	0.40625	0.455000	0.32223	ATT		0.403	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2		NM_018200	
HOXC4	3221	hgsc.bcm.edu	37	12	54448106	54448106	+	Missense_Mutation	SNP	A	A	G	rs75256744	byFrequency	TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr12:54448106A>G	ENST00000430889.2	+	1	446	c.400A>G	c.(400-402)Ata>Gta	p.I134V	HOXC4_ENST00000609810.1_Missense_Mutation_p.I134V|HOXC4_ENST00000303406.4_Missense_Mutation_p.I134V	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	134					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						CAAGCAACCCATAGTCTACCC	0.647													A|||	554	0.110623	0.0174	0.0908	5008	,	,		8955	0.0337		0.1769	False		,,,				2504	0.2618																0								A	VAL/ILE,VAL/ILE	184,4222		6,172,2025	25.0	25.0	25.0		400,400	4.3	1.0	12	dbSNP_131	25	1507,7091		132,1243,2924	yes	missense,missense	HOXC4	NM_014620.4,NM_153633.2	29,29	138,1415,4949	GG,GA,AA		17.5273,4.1761,13.0037	benign,benign	134/265,134/265	54448106	1691,11313	2203	4299	6502	SO:0001583	missense	3221				CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.400A>G	12.37:g.54448106A>G	ENSP00000399808:p.Ile134Val	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000430889.2	37	CCDS8873.1	217	0.09935897435897435	24	0.04878048780487805	38	0.10497237569060773	19	0.033216783216783216	136	0.17941952506596306	A	0.226	-1.024613	0.02061	0.041761	0.175273	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.88354	-2.37;-2.37	4.26	4.26	0.50523	.	0.062472	0.64402	D	0.000007	T	0.00210	0.0006	N	0.00258	-1.755	0.26297	P	0.9780349	B	0.06786	0.001	B	0.08055	0.003	T	0.42032	-0.9475	9	0.02654	T	1	.	12.7918	0.57539	1.0:0.0:0.0:0.0	.	134	P09017	HXC4_HUMAN	V	134	ENSP00000305973:I134V;ENSP00000399808:I134V	ENSP00000305973:I134V	I	+	1	0	HOXC4	52734373	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.533000	0.45667	1.918000	0.55548	0.379000	0.24179	ATA		0.647	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1			
HUWE1	10075	hgsc.bcm.edu;ucsc.edu	37	X	53585980	53585980	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:53585980C>T	ENST00000342160.3	-	57	8414	c.7957G>A	c.(7957-7959)Gaa>Aaa	p.E2653K	MIRLET7F2_ENST00000385277.1_RNA|MIR98_ENST00000606724.1_RNA|HUWE1_ENST00000262854.6_Missense_Mutation_p.E2653K			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2653					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTGCATTCTTCTGTCCAGCGG	0.532																																																	0													51.0	35.0	40.0					X																	53585980		2195	4276	6471	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7957G>A	X.37:g.53585980C>T	ENSP00000340648:p.Glu2653Lys	Somatic		WXS	SOLID	Phase_I	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.722700|4.722700	0.89298|0.89298	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.50813|.	0.73;0.73|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.060582|.	0.64402|.	D|.	0.000004|.	T|T	0.55353|0.55353	0.1915|0.1915	L|L	0.27053|0.27053	0.805|0.805	0.52501|0.52501	D|D	0.999952|0.999952	P;P|.	0.40731|.	0.608;0.728|.	B;B|.	0.36092|.	0.076;0.217|.	T|T	0.51687|0.51687	-0.8674|-0.8674	10|5	0.54805|.	T|.	0.06|.	.|.	16.9394|16.9394	0.86213|0.86213	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2653;2653|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	K|K	2653|1686	ENSP00000340648:E2653K;ENSP00000262854:E2653K|.	ENSP00000262854:E2653K|.	E|R	-|-	1|2	0|0	HUWE1|HUWE1	53602705|53602705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.059000|7.059000	0.76684|0.76684	2.261000|2.261000	0.74972|0.74972	0.513000|0.513000	0.50165|0.50165	GAA|AGA		0.532	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1		XM_497119	
IFNAR1	3454	hgsc.bcm.edu;ucsc.edu	37	21	34713364	34713364	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr21:34713364G>A	ENST00000270139.3	+	3	412	c.260G>A	c.(259-261)tGc>tAc	p.C87Y	IFNAR1_ENST00000416947.2_Missense_Mutation_p.C18Y|IFNAR1_ENST00000442357.2_Missense_Mutation_p.C87Y	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	87	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	AGTACCAAATGCAACTTTTCT	0.313																																					Esophageal Squamous(73;817 1211 32990 35667 42746)												0													69.0	72.0	71.0					21																	34713364		2203	4298	6501	SO:0001583	missense	3454				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.260G>A	21.37:g.34713364G>A	ENSP00000270139:p.Cys87Tyr	Somatic		WXS	SOLID	Phase_I	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	ENST00000270139.3	37	CCDS13624.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958130	0.53400	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442071;ENST00000442357	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.49	5.49	0.81192	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93700	0.7987	M	0.87381	2.88	0.40569	D	0.981283	D	0.69078	0.997	D	0.68039	0.955	D	0.94807	0.7975	10	0.87932	D	0	-16.0432	14.8923	0.70617	0.0:0.0:1.0:0.0	.	87	P17181	INAR1_HUMAN	Y	18;87;87;87	ENSP00000395606:C18Y;ENSP00000270139:C87Y;ENSP00000400161:C87Y;ENSP00000407406:C87Y	ENSP00000270139:C87Y	C	+	2	0	IFNAR1	33635234	0.979000	0.34478	0.796000	0.32109	0.645000	0.38454	3.161000	0.50747	2.566000	0.86566	0.563000	0.77884	TGC		0.313	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139823.4			
IMPA2	3613	hgsc.bcm.edu;ucsc.edu	37	18	12030440	12030440	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr18:12030440C>T	ENST00000269159.3	+	8	1092	c.850C>T	c.(850-852)Cgg>Tgg	p.R284W	RP11-703I16.1_ENST00000587619.1_RNA|IMPA2_ENST00000589238.1_Missense_Mutation_p.R95W|IMPA2_ENST00000588927.1_Missense_Mutation_p.R95W	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	284					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	TAACTATGGGCGGGATGATGA	0.637																																																	0													82.0	64.0	70.0					18																	12030440		2203	4300	6503	SO:0001583	missense	3613			AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.850C>T	18.37:g.12030440C>T	ENSP00000269159:p.Arg284Trp	Somatic		WXS	SOLID	Phase_I	B0YJ29|Q9UJT3	Missense_Mutation	SNP	ENST00000269159.3	37	CCDS11855.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083349	0.76642	.	.	ENSG00000141401	ENST00000269159	T	0.35789	1.29	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.55369	0.1916	L	0.55990	1.75	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.83275	0.966;0.996	T	0.57306	-0.7834	10	0.87932	D	0	-22.6148	14.6025	0.68450	0.1465:0.8535:0.0:0.0	.	257;284	O14732-2;O14732	.;IMPA2_HUMAN	W	284	ENSP00000269159:R284W	ENSP00000269159:R284W	R	+	1	2	IMPA2	12020440	0.981000	0.34729	1.000000	0.80357	0.925000	0.55904	2.542000	0.45744	2.471000	0.83476	0.561000	0.74099	CGG		0.637	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254601.1			
INTS7	25896	hgsc.bcm.edu	37	1	212161322	212161322	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:212161322C>G	ENST00000366994.3	-	8	1007	c.903G>C	c.(901-903)caG>caC	p.Q301H	INTS7_ENST00000440600.2_Missense_Mutation_p.Q252H|INTS7_ENST00000366993.3_Missense_Mutation_p.Q301H|INTS7_ENST00000366992.3_Missense_Mutation_p.Q301H|INTS7_ENST00000469606.1_5'UTR	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	301					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		CATAAGGAGTCTGGAGGGCAC	0.393																																																	0													117.0	104.0	108.0					1																	212161322		2203	4300	6503	SO:0001583	missense	25896			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.903G>C	1.37:g.212161322C>G	ENSP00000355961:p.Gln301His	Somatic		WXS	SOLID	Phase_I	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	ENST00000366994.3	37	CCDS1501.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370382	0.24771	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.17	4.94	-0.844	0.10741	Armadillo-like helical (1);Armadillo-type fold (1);	0.376195	0.30410	N	0.009681	T	0.34077	0.0885	N	0.05199	-0.095	0.28183	N	0.928073	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.07252	-1.0782	10	0.37606	T	0.19	-6.607	1.4823	0.02439	0.1185:0.2819:0.2602:0.3393	.	252;301;301;301	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	H	301;301;301;252	ENSP00000355961:Q301H;ENSP00000355960:Q301H;ENSP00000355959:Q301H;ENSP00000388908:Q252H	ENSP00000355959:Q301H	Q	-	3	2	INTS7	210227945	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.193000	0.32162	-0.048000	0.13401	0.591000	0.81541	CAG		0.393	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1		NM_015434	
ITGA8	8516	hgsc.bcm.edu;ucsc.edu	37	10	15714684	15714684	+	Silent	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr10:15714684C>T	ENST00000378076.3	-	7	1094	c.741G>A	c.(739-741)agG>agA	p.R247R		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	247					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						CTGCCAGTTTCCTGAGGATAT	0.403																																																	0													134.0	128.0	130.0					10																	15714684		2203	4300	6503	SO:0001819	synonymous_variant	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.741G>A	10.37:g.15714684C>T		Somatic		WXS	SOLID	Phase_I	B0YJ31|Q5VX94	Silent	SNP	ENST00000378076.3	37	CCDS31155.1																																																																																				0.403	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1		NM_003638	
KDM2A	22992	hgsc.bcm.edu;ucsc.edu	37	11	67021798	67021798	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr11:67021798T>G	ENST00000529006.2	+	20	3662	c.3216T>G	c.(3214-3216)agT>agG	p.S1072R	KDM2A_ENST00000530342.1_Missense_Mutation_p.S633R|KDM2A_ENST00000308783.5_Missense_Mutation_p.S530R|KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1072					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TCGACCTCAGTCACTGCAGCC	0.562																																																	0													168.0	165.0	166.0					11																	67021798		2189	4272	6461	SO:0001583	missense	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3216T>G	11.37:g.67021798T>G	ENSP00000432786:p.Ser1072Arg	Somatic		WXS	SOLID	Phase_I	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.301683	0.60195	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000308783	T;T;T	0.32753	1.44;1.44;1.44	5.17	2.84	0.33178	.	0.095946	0.64402	D	0.000001	T	0.50582	0.1624	M	0.78801	2.425	0.49687	D	0.999812	D;D;D	0.89917	1.0;1.0;0.991	D;D;P	0.83275	0.996;0.942;0.881	T	0.42361	-0.9456	10	0.42905	T	0.14	-13.6786	7.5916	0.28025	0.0:0.3732:0.0:0.6268	.	633;530;1072	E9PIL6;D4QA03;Q9Y2K7	.;.;KDM2A_HUMAN	R	1072;633;530	ENSP00000432786:S1072R;ENSP00000435776:S633R;ENSP00000309302:S530R	ENSP00000309302:S530R	S	+	3	2	KDM2A	66778374	0.988000	0.35896	1.000000	0.80357	0.999000	0.98932	0.197000	0.17197	0.429000	0.26202	0.533000	0.62120	AGT		0.562	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2		NM_012308	
JRKL	8690	hgsc.bcm.edu;ucsc.edu	37	11	96124291	96124291	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr11:96124291C>G	ENST00000332349.4	+	2	725	c.478C>G	c.(478-480)Cga>Gga	p.R160G	JRKL_ENST00000546177.1_Intron|JRKL_ENST00000458427.1_Missense_Mutation_p.R160G|CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000542662.1_5'Flank	NM_001261833.1	NP_001248762.1	Q9Y4A0	JERKL_HUMAN	JRK-like	160					central nervous system development (GO:0007417)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		taataactttcgagattttat	0.363																																																	0													27.0	27.0	27.0					11																	96124291		2201	4297	6498	SO:0001583	missense	8690			AF004715	CCDS8308.1	11q21	2014-03-28	2014-03-28		ENSG00000183340	ENSG00000183340			6200	protein-coding gene	gene with protein product		603211	"""erky (mouse) homolog-like"", ""jerky homolog-like (mouse)"""			9240447	Standard	NM_003772		Approved	HHMJG	uc009ywu.4	Q9Y4A0	OTTHUMG00000154950	ENST00000332349.4:c.478C>G	11.37:g.96124291C>G	ENSP00000333350:p.Arg160Gly	Somatic		WXS	SOLID	Phase_I	A8K3G4|B2RAJ3|Q32MC2	Missense_Mutation	SNP	ENST00000332349.4	37	CCDS8308.1	.	.	.	.	.	.	.	.	.	.	C	5.321	0.244643	0.10077	.	.	ENSG00000183340	ENST00000332349;ENST00000458427	T;T	0.24908	1.83;1.83	4.11	-2.7	0.06004	.	0.000000	0.34411	N	0.003993	T	0.15003	0.0362	L	0.41356	1.27	0.09310	N	1	B	0.19583	0.037	B	0.11329	0.006	T	0.21449	-1.0245	10	0.23891	T	0.37	.	7.5674	0.27887	0.4654:0.4072:0.1273:0.0	.	160	Q9Y4A0	JERKL_HUMAN	G	160	ENSP00000333350:R160G;ENSP00000389989:R160G	ENSP00000333350:R160G	R	+	1	2	JRKL	95763939	0.921000	0.31238	0.098000	0.21074	0.642000	0.38348	0.055000	0.14229	-0.268000	0.09312	-1.781000	0.00649	CGA		0.363	JRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337775.2		NM_003772	
KIAA2018	205717	hgsc.bcm.edu;ucsc.edu	37	3	113377605	113377605	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:113377605T>C	ENST00000478658.1	-	5	2941	c.2924A>G	c.(2923-2925)gAg>gGg	p.E975G	KIAA2018_ENST00000316407.4_Missense_Mutation_p.E975G|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	975						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GATTTCTACCTCAGAAACACA	0.403																																																	0													125.0	115.0	118.0					3																	113377605		1886	4124	6010	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.2924A>G	3.37:g.113377605T>C	ENSP00000420721:p.Glu975Gly	Somatic		WXS	SOLID	Phase_I	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	T	1.719	-0.497170	0.04291	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15017	2.46;2.46	5.05	3.81	0.43845	.	0.579572	0.16859	N	0.196582	T	0.10809	0.0264	L	0.27053	0.805	0.09310	N	1	B	0.25105	0.118	B	0.21917	0.037	T	0.13548	-1.0505	10	0.52906	T	0.07	-11.118	5.0029	0.14273	0.0:0.1527:0.2938:0.5535	.	975	Q68DE3	K2018_HUMAN	G	975	ENSP00000320794:E975G;ENSP00000420721:E975G	ENSP00000320794:E975G	E	-	2	0	KIAA2018	114860295	0.969000	0.33509	0.992000	0.48379	0.011000	0.07611	0.909000	0.28558	1.905000	0.55150	0.528000	0.53228	GAG		0.403	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1		NM_001009899	
KLHL24	54800	hgsc.bcm.edu;ucsc.edu	37	3	183368567	183368567	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:183368567G>C	ENST00000454652.2	+	4	809	c.423G>C	c.(421-423)gaG>gaC	p.E141D	KLHL24_ENST00000476808.1_Missense_Mutation_p.E141D|KLHL24_ENST00000242810.6_Missense_Mutation_p.E141D	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	141						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			ATCTCTTTGAGACATCAAGCC	0.398																																																	0													179.0	160.0	167.0					3																	183368567		2203	4300	6503	SO:0001583	missense	54800				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.423G>C	3.37:g.183368567G>C	ENSP00000395012:p.Glu141Asp	Somatic		WXS	SOLID	Phase_I	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.410853	0.42817	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.68624	-0.34;-0.34;-0.34	5.44	-1.66	0.08265	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.74152	0.3679	L	0.58583	1.82	0.50467	D	0.999874	D;P	0.67145	0.996;0.559	D;B	0.72625	0.978;0.414	T	0.74300	-0.3710	10	0.72032	D	0.01	.	12.2474	0.54578	0.563:0.0:0.437:0.0	.	141;141	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	D	141	ENSP00000242810:E141D;ENSP00000395012:E141D;ENSP00000419010:E141D	ENSP00000242810:E141D	E	+	3	2	KLHL24	184851261	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	0.700000	0.25601	-0.165000	0.10908	-0.384000	0.06662	GAG		0.398	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2		NM_017644	
KRTAP7-1	337878	hgsc.bcm.edu	37	21	32201969	32201969	+	RNA	DEL	G	G	-	rs35359062|rs397778172		TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr21:32201969delG	ENST00000452750.1	-	0	109							Q8IUC3	KRA71_HUMAN	keratin associated protein 7-1 (gene/pseudogene)							intermediate filament (GO:0005882)											TGGTCCCATAGAATAGGGTAT	0.502																																																	0													63.0	65.0	64.0					21																	32201969		692	1591	2283			337878			AJ457063	CCDS74780.1	21q22.1	2014-04-10	2010-03-12		ENSG00000184586	ENSG00000274749		"""Keratin associated proteins"""	18934	protein-coding gene	gene with protein product			"""keratin associated protein 7-1"""			12359730	Standard	NM_181606		Approved	KAP7.1	uc011adj.2	Q8IUC3	OTTHUMG00000188305		21.37:g.32201969delG		Somatic		WXS	SOLID	Phase_I	Q3LI56	Frame_Shift_Del	DEL	ENST00000452750.1	37																																																																																					0.502	KRTAP7-1-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000128248.3		NM_181606	
LCT	3938	hgsc.bcm.edu;ucsc.edu	37	2	136566271	136566271	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr2:136566271G>C	ENST00000264162.2	-	8	3656	c.3646C>G	c.(3646-3648)Cac>Gac	p.H1216D	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1216	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGTGTTTTGTGCTGCACGATT	0.582																																																	0													201.0	172.0	182.0					2																	136566271		2203	4300	6503	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3646C>G	2.37:g.136566271G>C	ENSP00000264162:p.His1216Asp	Somatic		WXS	SOLID	Phase_I	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	g	1.315	-0.600970	0.03744	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.30714	1.52	5.76	0.981	0.19756	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.327450	0.39834	N	0.001251	T	0.30792	0.0776	N	0.13198	0.31	0.09310	N	1	P	0.38440	0.631	P	0.56700	0.804	T	0.35400	-0.9790	10	0.23302	T	0.38	-16.7319	12.0319	0.53401	0.3694:0.0:0.6306:0.0	.	1216	P09848	LPH_HUMAN	D	1216;648	ENSP00000264162:H1216D	ENSP00000264162:H1216D	H	-	1	0	LCT	136282741	0.507000	0.26146	0.001000	0.08648	0.051000	0.14879	1.406000	0.34646	-0.097000	0.12307	-2.393000	0.00227	CAC		0.582	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1		NM_002299	
LONP2	83752	hgsc.bcm.edu;ucsc.edu	37	16	48311325	48311325	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:48311325C>G	ENST00000285737.4	+	8	1411	c.1318C>G	c.(1318-1320)Cta>Gta	p.L440V	LONP2_ENST00000535754.1_Missense_Mutation_p.L396V	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCCAGTGTTCCTATTAGATGA	0.478																																																	0													120.0	107.0	111.0					16																	48311325		2200	4300	6500	SO:0001583	missense	83752			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.1318C>G	16.37:g.48311325C>G	ENSP00000285737:p.Leu440Val	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000285737.4	37	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240919	0.79912	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	D;D;D	0.94000	-3.33;-3.33;-3.33	5.81	5.81	0.92471	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96340	0.8806	M	0.63169	1.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96209	0.9151	10	0.72032	D	0.01	-12.9948	20.0763	0.97746	0.0:1.0:0.0:0.0	.	396;440	B7ZKL7;Q86WA8	.;LONP2_HUMAN	V	440;169;396;396	ENSP00000285737:L440V;ENSP00000445426:L396V;ENSP00000415983:L396V	ENSP00000285737:L440V	L	+	1	2	LONP2	46868826	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	3.129000	0.50500	2.756000	0.94617	0.655000	0.94253	CTA		0.478	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2		NM_031490	
LRIG2	9860	hgsc.bcm.edu;ucsc.edu	37	1	113652931	113652931	+	Silent	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:113652931G>A	ENST00000361127.5	+	13	1743	c.1545G>A	c.(1543-1545)gtG>gtA	p.V515V	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	515	Ig-like C2-type 1.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		GCATGAATGTGACTCTGACGT	0.453																																																	0													155.0	139.0	144.0					1																	113652931		2203	4300	6503	SO:0001819	synonymous_variant	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1545G>A	1.37:g.113652931G>A		Somatic		WXS	SOLID	Phase_I	Q9NSN2	Silent	SNP	ENST00000361127.5	37	CCDS30808.1																																																																																				0.453	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2		NM_014813	
LRRK1	79705	hgsc.bcm.edu;ucsc.edu	37	15	101569276	101569276	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:101569276C>G	ENST00000388948.3	+	20	3161	c.2802C>G	c.(2800-2802)atC>atG	p.I934M	LRRK1_ENST00000284395.5_Missense_Mutation_p.I931M	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGCAGAGGATCTTTAATATTA	0.562																																																	0													69.0	72.0	71.0					15																	101569276		1906	4125	6031	SO:0001583	missense	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2802C>G	15.37:g.101569276C>G	ENSP00000373600:p.Ile934Met	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.282915	0.59867	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.77229	-1.04;-1.08	5.12	2.95	0.34219	.	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.73962	2.25	0.42321	D	0.992251	D	0.89917	1.0	D	0.73708	0.981	D	0.83547	0.0099	10	0.72032	D	0.01	.	6.1186	0.20139	0.0:0.5707:0.0:0.4293	.	934	Q38SD2	LRRK1_HUMAN	M	934;931	ENSP00000373600:I934M;ENSP00000284395:I931M	ENSP00000284395:I931M	I	+	3	3	LRRK1	99386799	0.986000	0.35501	1.000000	0.80357	0.987000	0.75469	0.213000	0.17521	1.100000	0.41517	0.655000	0.94253	ATC		0.562	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2		NM_024652	
MACF1	23499	hgsc.bcm.edu;ucsc.edu	37	1	39889851	39889851	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:39889851G>T	ENST00000372915.3	+	60	16403	c.16316G>T	c.(16315-16317)aGt>aTt	p.S5439I	MACF1_ENST00000564288.1_Missense_Mutation_p.S5434I|MACF1_ENST00000289893.4_Missense_Mutation_p.S3874I|MACF1_ENST00000545844.1_Missense_Mutation_p.S3372I|MACF1_ENST00000539005.1_Missense_Mutation_p.S3351I|MACF1_ENST00000317713.7_Missense_Mutation_p.S3372I|MACF1_ENST00000567887.1_Missense_Mutation_p.S5471I|MACF1_ENST00000361689.2_Missense_Mutation_p.S3372I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5439					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAACTACTCAGTAAGGCAGCA	0.443																																																	0													82.0	83.0	83.0					1																	39889851		2203	4300	6503	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16316G>T	1.37:g.39889851G>T	ENSP00000362006:p.Ser5439Ile	Somatic		WXS	SOLID	Phase_I	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.44|14.44	2.534914|2.534914	0.45073|0.45073	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000482035	.|T;T;T;T;T;T;T	.|0.51817	.|0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.48|5.48	1.49|1.49	0.22878|0.22878	.|.	.|0.518810	.|0.20551	.|N	.|0.090107	T|T	0.40473|0.40473	0.1118|0.1118	N|N	0.22421|0.22421	0.69|0.69	0.46149|0.46149	D|D	0.99889|0.99889	.|P;D;B	.|0.57257	.|0.74;0.979;0.179	.|B;P;B	.|0.54544	.|0.418;0.755;0.086	T|T	0.21280|0.21280	-1.0250|-1.0250	5|10	.|0.51188	.|T	.|0.08	.|.	5.3947|5.3947	0.16263|0.16263	0.2896:0.1365:0.5738:0.0|0.2896:0.1365:0.5738:0.0	.|.	.|5439;3372;3316	.|Q9UPN3;F8W8Q1;Q9UPN3-3	.|MACF1_HUMAN;.;.	H|I	2484|3372;5439;3372;3372;3351;3874;188	.|ENSP00000439537:S3372I;ENSP00000362006:S5439I;ENSP00000354573:S3372I;ENSP00000313438:S3372I;ENSP00000444364:S3351I;ENSP00000289893:S3874I;ENSP00000433104:S188I	.|ENSP00000289893:S3874I	Q|S	+|+	3|2	2|0	MACF1|MACF1	39662438|39662438	0.240000|0.240000	0.23847|0.23847	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	0.565000|0.565000	0.23578|0.23578	0.268000|0.268000	0.21939|0.21939	0.655000|0.655000	0.94253|0.94253	CAG|AGT		0.443	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1		NM_033044	
MICAL1	64780	hgsc.bcm.edu;ucsc.edu	37	6	109771217	109771217	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:109771217C>A	ENST00000358807.3	-	9	1574	c.1263G>T	c.(1261-1263)aaG>aaT	p.K421N	MICAL1_ENST00000483856.1_5'Flank|MICAL1_ENST00000358577.3_Missense_Mutation_p.K335N|MICAL1_ENST00000368952.4_Missense_Mutation_p.K440N	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	421	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CTGCCCACCGCTTCACCATCC	0.612																																																	0													189.0	186.0	187.0					6																	109771217		2203	4300	6503	SO:0001583	missense	64780			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1263G>T	6.37:g.109771217C>A	ENSP00000351664:p.Lys421Asn	Somatic		WXS	SOLID	Phase_I	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063464	0.55432	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577	T;T;T	0.65916	-0.18;-0.18;-0.18	4.57	3.71	0.42584	Calponin homology domain (1);	0.116797	0.56097	D	0.000028	T	0.61311	0.2337	L	0.54323	1.7	0.35443	D	0.795023	P;D;D	0.89917	0.951;0.999;1.0	P;D;D	0.73380	0.735;0.961;0.98	T	0.66594	-0.5884	10	0.62326	D	0.03	.	7.1925	0.25834	0.0:0.8014:0.0:0.1986	.	440;335;421	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	N	421;440;335	ENSP00000351664:K421N;ENSP00000357948:K440N;ENSP00000351385:K335N	ENSP00000351385:K335N	K	-	3	2	MICAL1	109877910	0.999000	0.42202	1.000000	0.80357	0.866000	0.49608	0.618000	0.24373	1.284000	0.44531	-0.145000	0.13849	AAG		0.612	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2		NM_022765	
MTHFSD	64779	hgsc.bcm.edu;ucsc.edu	37	16	86585687	86585687	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:86585687T>A	ENST00000360900.6	-	3	214	c.189A>T	c.(187-189)aaA>aaT	p.K63N	MTHFSD_ENST00000568037.1_Intron|MTHFSD_ENST00000381214.5_Intron|MTHFSD_ENST00000546093.1_Intron|MTHFSD_ENST00000543303.2_Intron|MTHFSD_ENST00000322911.6_Missense_Mutation_p.K62N	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	63							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						CAGGGTCCACTTTAACTTCCT	0.522																																																	0													205.0	208.0	207.0					16																	86585687		1919	4144	6063	SO:0001583	missense	64779			AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.189A>T	16.37:g.86585687T>A	ENSP00000354152:p.Lys63Asn	Somatic		WXS	SOLID	Phase_I	A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Missense_Mutation	SNP	ENST00000360900.6	37	CCDS54047.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.364681	0.82463	.	.	ENSG00000103248	ENST00000543303;ENST00000360900;ENST00000322911	T;T	0.47528	0.84;0.84	5.93	1.17	0.20885	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70833	0.3269	M	0.91038	3.17	0.51482	D	0.999927	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.73375	-0.4002	10	0.72032	D	0.01	-7.9643	10.4815	0.44695	0.0:0.3332:0.0:0.6668	.	63;62	Q2M296;Q2M296-2	MTHSD_HUMAN;.	N	61;63;62	ENSP00000354152:K63N;ENSP00000326777:K62N	ENSP00000326777:K62N	K	-	3	2	MTHFSD	85143188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.676000	0.25247	0.166000	0.19597	0.533000	0.62120	AAA		0.522	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432182.1		NM_022764	
MYH6	4624	hgsc.bcm.edu	37	14	23855332	23855332	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:23855332C>G	ENST00000356287.3	-	33	4997	c.4968G>C	c.(4966-4968)caG>caC	p.Q1656H	MYH6_ENST00000405093.3_Missense_Mutation_p.Q1656H|MIR208A_ENST00000362287.1_RNA			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1656					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CCAGCTGGATCTGGGTGTCCT	0.632																																																	0													66.0	53.0	57.0					14																	23855332		2203	4300	6503	SO:0001583	missense	4624			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4968G>C	14.37:g.23855332C>G	ENSP00000348634:p.Gln1656His	Somatic		WXS	SOLID	Phase_I	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	16.42	3.118738	0.56505	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.81821	-1.54;-1.54	4.2	3.28	0.37604	Myosin tail (1);	.	.	.	.	D	0.90120	0.6913	M	0.88450	2.955	0.50632	D	0.99988	D	0.76494	0.999	D	0.91635	0.999	D	0.91728	0.5394	9	0.87932	D	0	.	12.7637	0.57380	0.0:0.9143:0.0:0.0857	.	1656	P13533	MYH6_HUMAN	H	1656	ENSP00000386041:Q1656H;ENSP00000348634:Q1656H	ENSP00000348634:Q1656H	Q	-	3	2	MYH6	22925172	0.006000	0.16342	0.994000	0.49952	0.664000	0.39144	0.174000	0.16743	2.048000	0.60808	0.561000	0.74099	CAG		0.632	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			
MYO1F	4542	hgsc.bcm.edu	37	19	8612963	8612963	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr19:8612963T>A	ENST00000338257.8	-	12	1493	c.1226A>T	c.(1225-1227)aAg>aTg	p.K409M	AC092316.2_ENST00000581156.1_RNA|AC092316.1_ENST00000598703.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	409	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						TTGCTGCAGCTTCTCATTGAC	0.542																																																	0													133.0	128.0	129.0					19																	8612963		1909	4133	6042	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1226A>T	19.37:g.8612963T>A	ENSP00000344871:p.Lys409Met	Somatic		WXS	SOLID	Phase_I	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.515136	0.85389	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.90004	-2.6	4.92	4.92	0.64577	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.95765	0.8622	H	0.94183	3.505	0.58432	D	0.999995	D	0.76494	0.999	D	0.76575	0.988	D	0.96806	0.9593	10	0.87932	D	0	.	13.7499	0.62901	0.0:0.0:0.0:1.0	.	409	O00160	MYO1F_HUMAN	M	454;409	ENSP00000344871:K409M	ENSP00000304899:K454M	K	-	2	0	MYO1F	8518963	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.005000	0.88553	1.851000	0.53745	0.460000	0.39030	AAG		0.542	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2			
KAT6B	23522	hgsc.bcm.edu;ucsc.edu	37	10	76788380	76788380	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr10:76788380G>C	ENST00000287239.4	+	18	4287	c.3798G>C	c.(3796-3798)aaG>aaC	p.K1266N	KAT6B_ENST00000372725.1_Missense_Mutation_p.K974N|KAT6B_ENST00000372714.1_Missense_Mutation_p.K974N|KAT6B_ENST00000372724.1_Missense_Mutation_p.K974N|KAT6B_ENST00000372711.1_Missense_Mutation_p.K1083N	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1266					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										AAGAGAGGAAGACCGGATTTA	0.463																																																	0													87.0	83.0	84.0					10																	76788380		2203	4300	6503	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3798G>C	10.37:g.76788380G>C	ENSP00000287239:p.Lys1266Asn	Somatic		WXS	SOLID	Phase_I	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629365	0.46944	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.82167	-1.54;-1.54;-1.58;-1.54;-1.55	5.05	4.15	0.48705	.	0.000000	0.51477	D	0.000099	D	0.83562	0.5281	L	0.29908	0.895	0.47441	D	0.999428	D;D;D	0.89917	1.0;0.999;0.993	D;D;D	0.83275	0.996;0.996;0.977	T	0.83295	-0.0031	10	0.87932	D	0	-13.9122	6.6605	0.23011	0.2561:0.0:0.7439:0.0	.	1083;974;1266	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	N	974;974;1266;974;1083	ENSP00000361810:K974N;ENSP00000361809:K974N;ENSP00000287239:K1266N;ENSP00000361799:K974N;ENSP00000361796:K1083N	ENSP00000287239:K1266N	K	+	3	2	KAT6B	76458386	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.570000	0.45981	1.132000	0.42129	0.313000	0.20887	AAG		0.463	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1		NM_012330	
NCAM2	4685	hgsc.bcm.edu;ucsc.edu	37	21	22652947	22652947	+	Silent	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr21:22652947A>G	ENST00000400546.1	+	2	354	c.105A>G	c.(103-105)ggA>ggG	p.G35G	NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000535285.1_Silent_p.G60G	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	35	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TTAGTGTTGGAGAATCTAAAT	0.303																																																	0													69.0	66.0	67.0					21																	22652947		1805	4075	5880	SO:0001819	synonymous_variant	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.105A>G	21.37:g.22652947A>G		Somatic		WXS	SOLID	Phase_I	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	37	CCDS42910.1																																																																																				0.303	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1		NM_004540	
NEK3	4752	hgsc.bcm.edu;ucsc.edu	37	13	52707349	52707349	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr13:52707349C>A	ENST00000400357.2	-	14	2692	c.1399G>T	c.(1399-1401)Gaa>Taa	p.E467*	NEK3_ENST00000452082.2_Nonsense_Mutation_p.E488*|NEK3_ENST00000339406.3_Nonsense_Mutation_p.E484*|NEK3_ENST00000378101.2_Nonsense_Mutation_p.E484*			P51956	NEK3_HUMAN	NIMA-related kinase 3	484					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TTGTCATCTTCCTCCTCAAAG	0.478																																																	0													55.0	53.0	54.0					13																	52707349		2006	4189	6195	SO:0001587	stop_gained	4752			AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.1399G>T	13.37:g.52707349C>A	ENSP00000383210:p.Glu467*	Somatic		WXS	SOLID	Phase_I	A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Nonsense_Mutation	SNP	ENST00000400357.2	37	CCDS53871.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811821	0.90707	.	.	ENSG00000136098	ENST00000339406;ENST00000378101;ENST00000400357;ENST00000452082;ENST00000547422	.	.	.	5.02	5.02	0.67125	.	0.049735	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	15.6114	0.76721	0.0:1.0:0.0:0.0	.	.	.	.	X	484;484;467;488;461	.	ENSP00000339429:E484X	E	-	1	0	NEK3	51605350	0.999000	0.42202	0.931000	0.37212	0.102000	0.19082	4.425000	0.59875	2.480000	0.83734	0.563000	0.77884	GAA		0.478	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3			
NOS1	4842	hgsc.bcm.edu;ucsc.edu	37	12	117710228	117710228	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr12:117710228G>A	ENST00000338101.4	-	9	1805	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.R601C			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CAGTAGTCGCGGACACCAATC	0.597																																					Esophageal Squamous(162;1748 2599 51982 52956)												0													71.0	80.0	77.0					12																	117710228		2197	4299	6496	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1801C>T	12.37:g.117710228G>A	ENSP00000337459:p.Arg601Cys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459172	0.84317	.	.	ENSG00000089250	ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.62498	0.02;0.02	4.7	4.7	0.59300	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	D	0.86360	0.5914	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91316	0.5078	10	0.87932	D	0	-22.3921	17.8477	0.88736	0.0:0.0:1.0:0.0	.	601	P29475	NOS1_HUMAN	C	601	ENSP00000320758:R601C;ENSP00000337459:R601C	ENSP00000320758:R601C	R	-	1	0	NOS1	116194611	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.950000	0.63603	2.437000	0.82529	0.655000	0.94253	CGC		0.597	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			
NRXN3	9369	hgsc.bcm.edu	37	14	80130119	80130119	+	Splice_Site	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:80130119A>G	ENST00000557594.1	+	3	1382		c.e3-1		NRXN3_ENST00000281127.7_Splice_Site|NRXN3_ENST00000428277.2_Splice_Site|NRXN3_ENST00000554719.1_Splice_Site|NRXN3_ENST00000556003.1_Splice_Site|NRXN3_ENST00000335750.5_Splice_Site|RP11-242P2.1_ENST00000553322.1_RNA	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3						adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCTTTATTATAGGAACAGGGG	0.428																																																	0													77.0	77.0	77.0					14																	80130119		2203	4300	6503	SO:0001630	splice_region_variant	9369			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.430-1A>G	14.37:g.80130119A>G		Somatic		WXS	SOLID	Phase_I	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Splice_Site	SNP	ENST00000557594.1	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.453775	0.84209	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3426	0.83092	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NRXN3	79199872	1.000000	0.71417	0.884000	0.34674	0.976000	0.68499	9.271000	0.95698	2.317000	0.78254	0.460000	0.39030	.		0.428	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1		NM_001105250	Intron
OPLAH	26873	hgsc.bcm.edu	37	8	145107992	145107992	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr8:145107992A>C	ENST00000426825.1	-	21	2993	c.2912T>G	c.(2911-2913)tTt>tGt	p.F971C	OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000561181.1_RNA|CTD-3065J16.6_ENST00000528912.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	971					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGAGGTTCCAAAGGCACGCAA	0.672																																																	0													29.0	33.0	31.0					8																	145107992		2143	4242	6385	SO:0001583	missense	26873			AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2912T>G	8.37:g.145107992A>C	ENSP00000475943:p.Phe971Cys	Somatic		WXS	SOLID	Phase_I	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	A	7.949	0.744526	0.15710	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.68897	0.3051	.	.	.	0.48571	D	0.999679	D	0.61697	0.99	P	0.57152	0.814	T	0.79629	-0.1724	7	0.72032	D	0.01	.	12.3241	0.55001	1.0:0.0:0.0:0.0	.	971	O14841	OPLA_HUMAN	C	971	.	ENSP00000412071:F971C	F	-	2	0	OPLAH	145179980	0.994000	0.37717	0.992000	0.48379	0.060000	0.15804	3.460000	0.53028	1.802000	0.52723	0.368000	0.22195	TTT		0.672	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_017570	
PADI6	353238	hgsc.bcm.edu;ucsc.edu	37	1	17708507	17708507	+	RNA	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:17708507G>T	ENST00000434762.2	+	0	649							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CAAGGCCCCAGCTGTATCTTA	0.498																																																	0													85.0	85.0	85.0					1																	17708507		1911	4117	6028			353238			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17708507G>T		Somatic		WXS	SOLID	Phase_I	Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37																																																																																					0.498	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4		NM_207421	
PCSK9	255738	hgsc.bcm.edu	37	1	55512295	55512295	+	Missense_Mutation	SNP	C	C	G	rs137878146		TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:55512295C>G	ENST00000302118.5	+	3	789	c.499C>G	c.(499-501)Cgg>Ggg	p.R167G	PCSK9_ENST00000452118.2_Missense_Mutation_p.R167G|PCSK9_ENST00000543384.1_Intron	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	167					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						TCCACGGTACCGGGCGGATGA	0.622																																					Pancreas(137;1454 1827 5886 22361 42375)												0													63.0	62.0	62.0					1																	55512295		2203	4300	6503	SO:0001583	missense	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.499C>G	1.37:g.55512295C>G	ENSP00000303208:p.Arg167Gly	Somatic		WXS	SOLID	Phase_I	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	ENST00000302118.5	37	CCDS603.1	.	.	.	.	.	.	.	.	.	.	C	10.48	1.360666	0.24598	.	.	ENSG00000169174	ENST00000302118;ENST00000452118	T;T	0.74526	-0.85;-0.57	4.55	2.3	0.28687	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	1.726230	0.03275	N	0.185375	T	0.56307	0.1976	N	0.08118	0	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.44190	-0.9344	10	0.22706	T	0.39	-5.7805	8.2587	0.31771	0.4711:0.4224:0.1066:0.0	.	167	Q8NBP7	PCSK9_HUMAN	G	167	ENSP00000303208:R167G;ENSP00000401598:R167G	ENSP00000303208:R167G	R	+	1	2	PCSK9	55284883	0.000000	0.05858	0.055000	0.19348	0.249000	0.25844	-0.032000	0.12266	0.807000	0.34208	0.561000	0.74099	CGG		0.622	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1		NM_174936	
PIK3CA	5290	hgsc.bcm.edu;ucsc.edu	37	3	178916854	178916854	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:178916854G>A	ENST00000263967.3	+	2	398	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	81	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E81K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGAAAGGGAAGAATTTTTTGA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	endometrium(4)|large_intestine(3)|breast(1)											107.0	101.0	103.0					3																	178916854		1820	4081	5901	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.241G>A	3.37:g.178916854G>A	ENSP00000263967:p.Glu81Lys	Somatic		WXS	SOLID	Phase_I	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983574	0.93044	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.77620	-1.11;-1.11	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.89305	0.6677	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89493	0.3758	9	.	.	.	-5.0909	19.2635	0.93977	0.0:0.0:1.0:0.0	.	81	P42336	PK3CA_HUMAN	K	81	ENSP00000263967:E81K;ENSP00000417479:E81K	.	E	+	1	0	PIK3CA	180399548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.571000	0.82399	2.547000	0.85894	0.555000	0.69702	GAA		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			
PITRM1	10531	hgsc.bcm.edu	37	10	3187802	3187802	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr10:3187802G>T	ENST00000224949.4	-	21	2477	c.2443C>A	c.(2443-2445)Cca>Aca	p.P815T	PITRM1_ENST00000464395.1_5'UTR|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1-AS1_ENST00000441377.1_RNA|PITRM1_ENST00000380994.1_Missense_Mutation_p.P373T|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000451104.2_Missense_Mutation_p.P717T|PITRM1_ENST00000380989.2_Missense_Mutation_p.P816T			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	815					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						ACCGTGTGTGGGCGCACAGGC	0.557																																																	0													46.0	49.0	48.0					10																	3187802		1832	3833	5665	SO:0001583	missense	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2443C>A	10.37:g.3187802G>T	ENSP00000224949:p.Pro815Thr	Somatic		WXS	SOLID	Phase_I	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.210|6.210	0.406982|0.406982	0.11754|0.11754	.|.	.|.	ENSG00000107959|ENSG00000107959	ENST00000451454|ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104;ENST00000424714	.|T;T;T;T;T	.|0.60171	.|3.78;3.78;3.15;3.65;0.21	5.02|5.02	4.11|4.11	0.48088|0.48088	.|Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.160973|0.160973	0.56097|0.56097	D|D	0.000031|0.000031	T|T	0.51584|0.51584	0.1683|0.1683	L|L	0.43923|0.43923	1.385|1.385	0.43924|0.43924	D|D	0.996575|0.996575	.|B;B;B;B;B	.|0.28470	.|0.02;0.213;0.014;0.014;0.014	.|B;B;B;B;B	.|0.33960	.|0.003;0.173;0.017;0.017;0.017	T|T	0.47484|0.47484	-0.9114|-0.9114	6|10	.|0.30078	.|T	.|0.28	-21.3369|-21.3369	13.8938|13.8938	0.63757|0.63757	0.0747:0.0:0.9253:0.0|0.0747:0.0:0.9253:0.0	.|.	.|808;717;816;815;808	.|E9PDX6;E7ES23;C9JSL2;Q5JRX3;B4DH07	.|.;.;.;PREP_HUMAN;.	H|T	148|815;808;816;373;717;34	.|ENSP00000224949:P815T;ENSP00000370377:P816T;ENSP00000370382:P373T;ENSP00000401201:P717T;ENSP00000402072:P34T	.|ENSP00000224949:P815T	P|P	-|-	2|1	0|0	PITRM1|PITRM1	3177802|3177802	1.000000|1.000000	0.71417|0.71417	0.015000|0.015000	0.15790|0.15790	0.006000|0.006000	0.05464|0.05464	3.658000|3.658000	0.54482|0.54482	1.238000|1.238000	0.43771|0.43771	0.462000|0.462000	0.41574|0.41574	CCC|CCA		0.557	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2			
PLG	5340	hgsc.bcm.edu;ucsc.edu	37	6	161135849	161135849	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:161135849G>T	ENST00000308192.9	+	6	634	c.571G>T	c.(571-573)Gaa>Taa	p.E191*		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	191	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TTGCAGTGGAGAAAACTATGA	0.458																																																	0													73.0	72.0	72.0					6																	161135849		2203	4300	6503	SO:0001587	stop_gained	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.571G>T	6.37:g.161135849G>T	ENSP00000308938:p.Glu191*	Somatic		WXS	SOLID	Phase_I	Q15146|Q5TEH4|Q6PA00	Nonsense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	G	35	5.520292	0.96416	.	.	ENSG00000122194	ENST00000308192	.	.	.	5.77	5.77	0.91146	.	0.000000	0.40385	U	0.001103	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	18.7629	0.91860	0.0:0.0:1.0:0.0	.	.	.	.	X	191	.	ENSP00000308938:E191X	E	+	1	0	PLG	161055839	1.000000	0.71417	0.986000	0.45419	0.333000	0.28666	7.484000	0.81180	2.723000	0.93209	0.655000	0.94253	GAA		0.458	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2		NM_000301	
PODNL1	79883	hgsc.bcm.edu	37	19	14046562	14046562	+	Missense_Mutation	SNP	G	G	C	rs151337979		TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr19:14046562G>C	ENST00000339560.5	-	5	760	c.487C>G	c.(487-489)Ctc>Gtc	p.L163V	PODNL1_ENST00000538517.2_Intron|PODNL1_ENST00000538371.2_Missense_Mutation_p.L161V|PODNL1_ENST00000254320.3_Missense_Mutation_p.L81V	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	163	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			CCAAAGGTGAGGGGGAAGATC	0.632																																																	0													26.0	29.0	28.0					19																	14046562		2202	4298	6500	SO:0001583	missense	79883			AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.487C>G	19.37:g.14046562G>C	ENSP00000345175:p.Leu163Val	Somatic		WXS	SOLID	Phase_I	B7Z564|Q9H5G9	Missense_Mutation	SNP	ENST00000339560.5	37	CCDS12300.1	.	.	.	.	.	.	.	.	.	.	G	5.548	0.285961	0.10513	.	.	ENSG00000132000	ENST00000538371;ENST00000339560;ENST00000254320	T;T;T	0.24908	1.83;5.48;1.85	4.97	4.97	0.65823	.	0.000000	0.44688	D	0.000438	T	0.30448	0.0765	L	0.43152	1.355	0.28956	N	0.890115	D;B;P	0.59767	0.986;0.104;0.945	P;B;P	0.55391	0.775;0.024;0.621	T	0.08046	-1.0741	10	0.17369	T	0.5	.	9.4551	0.38750	0.0988:0.0:0.9012:0.0	.	161;81;163	F5H7F9;B7Z3M0;Q6PEZ8	.;.;PONL1_HUMAN	V	161;163;81	ENSP00000442553:L161V;ENSP00000345175:L163V;ENSP00000254320:L81V	ENSP00000254320:L81V	L	-	1	0	PODNL1	13907562	0.995000	0.38212	0.959000	0.39883	0.186000	0.23388	2.602000	0.46257	2.298000	0.77334	0.479000	0.44913	CTC		0.632	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1		NM_024825	
POLE2	5427	hgsc.bcm.edu;ucsc.edu	37	14	50131848	50131848	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:50131848C>G	ENST00000216367.5	-	8	709	c.610G>C	c.(610-612)Gtc>Ctc	p.V204L	POLE2_ENST00000554396.1_Missense_Mutation_p.V204L|POLE2_ENST00000556584.1_5'UTR|POLE2_ENST00000539565.2_Missense_Mutation_p.V178L	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	204					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TCTAGTTGGACTGTTCCAGTA	0.279																																																	0													46.0	46.0	46.0					14																	50131848		2200	4294	6494	SO:0001583	missense	5427			AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.610G>C	14.37:g.50131848C>G	ENSP00000216367:p.Val204Leu	Somatic		WXS	SOLID	Phase_I	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	ENST00000216367.5	37	CCDS32073.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368644	0.82463	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.41400	1.42;1.42;1.0	5.28	4.39	0.52855	.	0.051323	0.85682	D	0.000000	T	0.45796	0.1360	M	0.70842	2.15	0.80722	D	1	P	0.49090	0.919	B	0.42851	0.4	T	0.52823	-0.8524	10	0.52906	T	0.07	-19.3024	14.2274	0.65868	0.0:0.928:0.0:0.072	.	204	P56282	DPOE2_HUMAN	L	204;178;204	ENSP00000216367:V204L;ENSP00000446313:V178L;ENSP00000451621:V204L	ENSP00000216367:V204L	V	-	1	0	POLE2	49201598	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.656000	0.61483	1.380000	0.46344	0.555000	0.69702	GTC		0.279	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1		NM_002692	
PPM1J	333926	hgsc.bcm.edu	37	1	113252813	113252813	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:113252813G>C	ENST00000309276.6	-	10	1665	c.1490C>G	c.(1489-1491)cCc>cGc	p.P497R	RP11-426L16.10_ENST00000606505.1_Intron|RP11-426L16.10_ENST00000471038.2_Intron|RHOC_ENST00000369642.3_5'Flank|PPM1J_ENST00000359994.4_Missense_Mutation_p.P291R|PPM1J_ENST00000464951.1_Missense_Mutation_p.P291R|RHOC_ENST00000339083.7_5'Flank	NM_005167.5	NP_005158.5	Q5JR12	PPM1J_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1J	497	PP2C-like.				protein dephosphorylation (GO:0006470)		protein serine/threonine phosphatase activity (GO:0004722)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	14	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCTCCCAGGGGGATGACGAA	0.612																																																	0													61.0	65.0	64.0					1																	113252813		2203	4300	6503	SO:0001583	missense	333926			AK093270	CCDS855.2	1p13.1	2012-04-17	2010-03-05		ENSG00000155367	ENSG00000155367	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	20785	protein-coding gene	gene with protein product	"""protein phosphatase 2C zeta"""	609957	"""protein phosphatase 1J (PP2C domain containing)"""			12633878	Standard	NM_005167		Approved	FLJ35951, MGC19531, DKFZp434P1514, PP2Czeta, PPP2CZ	uc001ect.1	Q5JR12	OTTHUMG00000012019	ENST00000309276.6:c.1490C>G	1.37:g.113252813G>C	ENSP00000308926:p.Pro497Arg	Somatic		WXS	SOLID	Phase_I	B3KSB7|Q6DKJ7|Q96EZ7|Q9UF84	Missense_Mutation	SNP	ENST00000309276.6	37	CCDS855.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406440	0.83230	.	.	ENSG00000155367	ENST00000309276;ENST00000359994	T;T	0.08282	3.11;3.11	5.77	5.77	0.91146	Protein phosphatase 2C-like (3);	0.000000	0.85682	D	0.000000	T	0.17534	0.0421	L	0.43923	1.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.00731	-1.1590	10	0.87932	D	0	-16.6862	19.5912	0.95511	0.0:0.0:1.0:0.0	.	497;291	Q5JR12;Q5JR12-2	PPM1J_HUMAN;.	R	497;291	ENSP00000308926:P497R;ENSP00000353088:P291R	ENSP00000308926:P497R	P	-	2	0	PPM1J	113054336	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.431000	0.97494	2.744000	0.94065	0.561000	0.74099	CCC		0.612	PPM1J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033251.1		NM_005167	
PREP	5550	hgsc.bcm.edu	37	6	105800846	105800846	+	Splice_Site	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:105800846C>T	ENST00000369110.3	-	7	1016		c.e7+1			NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase						proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	AAATAACTCACCCGCGATGCC	0.403																																																	0													150.0	153.0	152.0					6																	105800846		2203	4300	6503	SO:0001630	splice_region_variant	5550				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.823+1G>A	6.37:g.105800846C>T		Somatic		WXS	SOLID	Phase_I	Q8N6D4	Splice_Site	SNP	ENST00000369110.3	37	CCDS5053.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056681	0.76074	.	.	ENSG00000085377	ENST00000369110	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6602	0.91469	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PREP	105907539	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	5.826000	0.69293	2.775000	0.95449	0.655000	0.94253	.		0.403	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1			Intron
RAB40C	57799	hgsc.bcm.edu	37	16	675459	675459	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:675459A>G	ENST00000248139.3	+	4	495	c.292A>G	c.(292-294)Aac>Gac	p.N98D	RAB40C_ENST00000539661.1_Missense_Mutation_p.N98D|RAB40C_ENST00000535977.1_Missense_Mutation_p.N98D|RAB40C_ENST00000538492.1_Missense_Mutation_p.N98D	NM_021168.4	NP_066991.3	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family	98					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	6		Hepatocellular(780;0.0218)				TGACATCACCAACCGCTGGTC	0.632																																					Melanoma(123;1631 1690 28262 44104 44957)												0													101.0	77.0	85.0					16																	675459		2201	4299	6500	SO:0001583	missense	57799			Z84779	CCDS10413.1	16p13.3	2008-07-28	2003-10-14		ENSG00000197562	ENSG00000197562		"""RAB, member RAS oncogene"""	18285	protein-coding gene	gene with protein product			"""RAS-like, family 8, member C"""	RASL8C		11697911, 18485483	Standard	NM_021168		Approved	RARL	uc021szv.1	Q96S21	OTTHUMG00000047854	ENST00000248139.3:c.292A>G	16.37:g.675459A>G	ENSP00000248139:p.Asn98Asp	Somatic		WXS	SOLID	Phase_I	A2IDE2|D3DU54|O60795|Q4TT41|Q5PXE8|Q6PIU5	Missense_Mutation	SNP	ENST00000248139.3	37	CCDS10413.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.469843	0.84533	.	.	ENSG00000197562	ENST00000535977;ENST00000539661;ENST00000538492;ENST00000248139	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.06	5.06	0.68205	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.75953	0.3920	N	0.11698	0.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.73180	-0.4064	10	0.17832	T	0.49	.	14.2709	0.66152	1.0:0.0:0.0:0.0	.	98;98	Q96S21;Q5PXE8	RB40C_HUMAN;.	D	98	ENSP00000438492:N98D;ENSP00000445050:N98D;ENSP00000438382:N98D;ENSP00000248139:N98D	ENSP00000248139:N98D	N	+	1	0	RAB40C	615460	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.173000	0.94815	2.028000	0.59812	0.533000	0.62120	AAC		0.632	RAB40C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109079.4		NM_021168	
RAB5A	5868	hgsc.bcm.edu;ucsc.edu	37	3	20017171	20017171	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:20017171G>A	ENST00000273047.4	+	3	778	c.242G>A	c.(241-243)cGa>cAa	p.R81Q	RAB5A_ENST00000422242.1_Missense_Mutation_p.R67Q	NM_004162.4	NP_004153.2	P20339	RAB5A_HUMAN	RAB5A, member RAS oncogene family	81				R -> G (in Ref. 1; AAA60245). {ECO:0000305}.	blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|nervous system development (GO:0007399)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of endosome size (GO:0051036)|regulation of filopodium assembly (GO:0051489)|regulation of synaptic vesicle exocytosis (GO:2000300)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytoplasmic side of early endosome membrane (GO:0098559)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|somatodendritic compartment (GO:0036477)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			lung(1)|urinary_tract(1)	2						GGTCAAGAACGATACCATAGC	0.388																																																	0													126.0	112.0	117.0					3																	20017171		2203	4300	6503	SO:0001583	missense	5868				CCDS2633.1	3p24-p22	2008-07-18			ENSG00000144566	ENSG00000144566		"""RAB, member RAS oncogene"""	9783	protein-coding gene	gene with protein product	"""RAS-associated protein RAB5A"""	179512		RAB5		1999336	Standard	NM_004162		Approved		uc003cbn.3	P20339	OTTHUMG00000129889	ENST00000273047.4:c.242G>A	3.37:g.20017171G>A	ENSP00000273047:p.Arg81Gln	Somatic		WXS	SOLID	Phase_I	B4DJA5|Q6FI44	Missense_Mutation	SNP	ENST00000273047.4	37	CCDS2633.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633358	0.87660	.	.	ENSG00000144566	ENST00000273047;ENST00000422242	T;T	0.78364	-1.17;-1.17	5.09	5.09	0.68999	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.80369	0.4610	L	0.58969	1.84	0.80722	D	1	P;D	0.58620	0.829;0.983	B;P	0.48738	0.213;0.588	T	0.80315	-0.1434	9	.	.	.	-8.7935	18.85	0.92224	0.0:0.0:1.0:0.0	.	67;81	B4DJA5;P20339	.;RAB5A_HUMAN	Q	81;67	ENSP00000273047:R81Q;ENSP00000411941:R67Q	.	R	+	2	0	RAB5A	19992175	1.000000	0.71417	0.874000	0.34290	0.998000	0.95712	9.766000	0.98957	2.541000	0.85698	0.563000	0.77884	CGA		0.388	RAB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252137.2		NM_004162	
RNASE9	390443	hgsc.bcm.edu;ucsc.edu	37	14	21024785	21024785	+	Silent	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:21024785A>G	ENST00000557068.1	-	4	2169	c.444T>C	c.(442-444)ttT>ttC	p.F148F	RNASE9_ENST00000553541.1_Silent_p.F148F|RNASE9_ENST00000557209.1_Silent_p.F153F|RNASE9_ENST00000553706.1_Silent_p.F153F|RNASE9_ENST00000556208.1_Silent_p.F153F|RNASE9_ENST00000404716.3_Silent_p.F153F|RNASE9_ENST00000555230.1_Silent_p.F148F|RNASE9_ENST00000554964.1_Silent_p.F148F|RNASE9_ENST00000429244.2_Silent_p.F148F|RNASE9_ENST00000338904.3_Silent_p.F148F			P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)	148			F -> S (in dbSNP:rs12590446). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:18992174, ECO:0000269|Ref.3}.			extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|ovary(2)|urinary_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		CTGGTATTTCAAATGCTTCTG	0.358																																																	0													90.0	78.0	82.0					14																	21024785		2203	4300	6503	SO:0001819	synonymous_variant	390443			AY665804	CCDS32036.1, CCDS53883.1, CCDS55904.1	14q11.2	2006-10-31				ENSG00000188655		"""Ribonucleases, RNase A"""	20673	protein-coding gene	gene with protein product		614014				15676279, 12920233	Standard	NM_001001673		Approved	h461	uc010ahu.3	P60153		ENST00000557068.1:c.444T>C	14.37:g.21024785A>G		Somatic		WXS	SOLID	Phase_I	A2RQR8|A8QJS1|Q5GAN7|Q6KG53	Silent	SNP	ENST00000557068.1	37	CCDS32036.1																																																																																				0.358	RNASE9-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411094.1		NM_001001673	
RNASE1	6035	hgsc.bcm.edu	37	14	21270086	21270086	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:21270086T>G	ENST00000397967.4	-	2	648	c.142A>C	c.(142-144)Agc>Cgc	p.S48R	RNASE1_ENST00000412779.2_Missense_Mutation_p.S48R|RNASE1_ENST00000555698.1_Missense_Mutation_p.S8R|RNASE1_ENST00000397970.4_Missense_Mutation_p.S48R|RNASE1_ENST00000340900.3_Missense_Mutation_p.S48R	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	48					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	GAGCTGCTGCTGGGGGAACTG	0.582																																																	0													78.0	73.0	74.0					14																	21270086		2203	4300	6503	SO:0001583	missense	6035			BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.142A>C	14.37:g.21270086T>G	ENSP00000381057:p.Ser48Arg	Somatic		WXS	SOLID	Phase_I	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Missense_Mutation	SNP	ENST00000397967.4	37	CCDS9559.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015389	0.54468	.	.	ENSG00000129538	ENST00000397967;ENST00000340900;ENST00000412779;ENST00000555698;ENST00000397970	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.02	-5.32	0.02722	Ribonuclease A, domain (4);	1.825280	0.02210	N	0.063120	T	0.66790	0.2825	H	0.94385	3.53	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.64931	-0.6291	10	0.62326	D	0.03	-2.5206	1.287	0.02052	0.2695:0.3562:0.1381:0.2362	.	48	P07998	RNAS1_HUMAN	R	48;48;48;8;48	ENSP00000381057:S48R;ENSP00000344193:S48R;ENSP00000399493:S48R;ENSP00000451058:S8R;ENSP00000381060:S48R	ENSP00000344193:S48R	S	-	1	0	RNASE1	20339926	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.474000	0.02337	-0.457000	0.07033	-0.466000	0.05196	AGC		0.582	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3			
RYR2	6262	hgsc.bcm.edu;ucsc.edu	37	1	237801753	237801753	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:237801753A>G	ENST00000366574.2	+	45	7206	c.6889A>G	c.(6889-6891)Aga>Gga	p.R2297G	RYR2_ENST00000542537.1_Missense_Mutation_p.R2281G|RYR2_ENST00000360064.6_Missense_Mutation_p.R2295G	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2297	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGAAGGAGAGAGATATCTTGA	0.408																																																	0													315.0	305.0	308.0					1																	237801753		1878	4123	6001	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6889A>G	1.37:g.237801753A>G	ENSP00000355533:p.Arg2297Gly	Somatic		WXS	SOLID	Phase_I	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531572	0.64972	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96300	-3.97;-3.97;-3.97	5.31	1.25	0.21368	Intracellular calcium-release channel (1);	0.000000	0.64402	D	0.000008	D	0.97754	0.9263	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.97445	1.0024	10	0.87932	D	0	-14.463	16.7774	0.85555	0.3728:0.6271:0.0:0.0	.	2297	Q92736	RYR2_HUMAN	G	2297;2295;2281	ENSP00000355533:R2297G;ENSP00000353174:R2295G;ENSP00000443798:R2281G	ENSP00000353174:R2295G	R	+	1	2	RYR2	235868376	0.035000	0.19736	0.998000	0.56505	0.934000	0.57294	-0.088000	0.11198	-0.007000	0.14345	0.459000	0.35465	AGA		0.408	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		NM_001035	
SDK1	221935	hgsc.bcm.edu;ucsc.edu	37	7	3678698	3678698	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr7:3678698G>C	ENST00000404826.2	+	3	660	c.521G>C	c.(520-522)aGa>aCa	p.R174T	SDK1_ENST00000389531.3_Missense_Mutation_p.R174T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	174	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTGCGAAACAGAATGGGAGCA	0.428																																																	0													78.0	68.0	72.0					7																	3678698		2203	4300	6503	SO:0001583	missense	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.521G>C	7.37:g.3678698G>C	ENSP00000385899:p.Arg174Thr	Somatic		WXS	SOLID	Phase_I	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820055	0.71028	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56776	0.44;0.44	4.89	4.01	0.46588	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.46145	D	0.000318	T	0.63046	0.2478	L	0.52823	1.66	0.45899	D	0.998748	D	0.76494	0.999	D	0.74674	0.984	T	0.58504	-0.7625	10	0.20519	T	0.43	.	11.5106	0.50490	0.0854:0.0:0.9146:0.0	.	174	Q7Z5N4	SDK1_HUMAN	T	174	ENSP00000385899:R174T;ENSP00000374182:R174T	ENSP00000374182:R174T	R	+	2	0	SDK1	3645224	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	8.665000	0.91144	1.174000	0.42811	0.563000	0.77884	AGA		0.428	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1		NM_152744	
SGPL1	8879	hgsc.bcm.edu;ucsc.edu	37	10	72610956	72610956	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr10:72610956A>G	ENST00000373202.3	+	4	450	c.250A>G	c.(250-252)Att>Gtt	p.I84V		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	84					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						GATGCCCATTATTGGTCGTAA	0.323																																					Colon(151;1054 2458 6676 40971)												0													190.0	179.0	183.0					10																	72610956		2203	4300	6503	SO:0001583	missense	8879			AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.250A>G	10.37:g.72610956A>G	ENSP00000362298:p.Ile84Val	Somatic		WXS	SOLID	Phase_I	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	ENST00000373202.3	37	CCDS31216.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.771228	0.00645	.	.	ENSG00000166224	ENST00000373202;ENST00000299297	T;T	0.38887	1.13;1.11	5.41	-0.919	0.10478	Pyridoxal phosphate-dependent transferase, major domain (1);	0.432276	0.28026	N	0.016893	T	0.13970	0.0338	N	0.08118	0	0.34320	D	0.686496	B	0.02656	0.0	B	0.06405	0.002	T	0.37454	-0.9705	10	0.02654	T	1	-1.8829	4.5235	0.11971	0.5416:0.0:0.3182:0.1402	.	84	O95470	SGPL1_HUMAN	V	84;67	ENSP00000362298:I84V;ENSP00000299297:I67V	ENSP00000299297:I67V	I	+	1	0	SGPL1	72280962	0.099000	0.21834	0.004000	0.12327	0.000000	0.00434	-0.104000	0.10923	-0.108000	0.12066	-1.155000	0.01812	ATT		0.323	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048533.1		NM_003901	
SLC14A2	8170	hgsc.bcm.edu;ucsc.edu	37	18	43249307	43249307	+	Silent	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr18:43249307C>T	ENST00000255226.6	+	16	2889	c.2073C>T	c.(2071-2073)agC>agT	p.S691S	SLC14A2_ENST00000589658.1_Silent_p.S168S|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000586448.1_Silent_p.S691S	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	691					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCATCTTCAGCAAGTGGGACC	0.552																																																	0													179.0	166.0	171.0					18																	43249307		2203	4300	6503	SO:0001819	synonymous_variant	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2073C>T	18.37:g.43249307C>T		Somatic		WXS	SOLID	Phase_I	A8K8Q7|Q2TBD6|Q96PH5	Silent	SNP	ENST00000255226.6	37	CCDS11924.1																																																																																				0.552	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			
SLC15A4	121260	hgsc.bcm.edu;ucsc.edu	37	12	129278856	129278856	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr12:129278856G>A	ENST00000266771.5	-	8	1658	c.1619C>T	c.(1618-1620)gCt>gTt	p.A540V	SLC15A4_ENST00000545031.1_Missense_Mutation_p.A57V|SLC15A4_ENST00000544112.1_Missense_Mutation_p.A203V	NM_145648.3	NP_663623.1	Q8N697	S15A4_HUMAN	solute carrier family 15 (oligopeptide transporter), member 4	540					ion transport (GO:0006811)|oligopeptide transport (GO:0006857)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	L-histidine transmembrane transporter activity (GO:0005290)|symporter activity (GO:0015293)			endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|skin(1)	22	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		TTGAATAGCAGCCAGAAGAAA	0.438																																																	0													85.0	96.0	92.0					12																	129278856		2203	4300	6503	SO:0001583	missense	121260			AY038999	CCDS9264.1	12q24.32	2013-07-18	2013-07-18		ENSG00000139370	ENSG00000139370		"""Solute carriers"""	23090	protein-coding gene	gene with protein product		615806	"""solute carrier family 15, member 4"""			11741232	Standard	NM_145648		Approved	PHT1, PTR4	uc001uhu.2	Q8N697	OTTHUMG00000168415	ENST00000266771.5:c.1619C>T	12.37:g.129278856G>A	ENSP00000266771:p.Ala540Val	Somatic		WXS	SOLID	Phase_I	A6H8Y9|B3KTK1|Q71M34|Q7Z5F8|Q8TAH0	Missense_Mutation	SNP	ENST00000266771.5	37	CCDS9264.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392014	0.83011	.	.	ENSG00000139370	ENST00000266771;ENST00000545031;ENST00000544112	T;T;T	0.81415	0.02;-1.49;0.02	5.68	5.68	0.88126	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.90232	0.6946	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.90388	0.4393	10	0.62326	D	0.03	.	19.7966	0.96487	0.0:0.0:1.0:0.0	.	540	Q8N697	S15A4_HUMAN	V	540;57;203	ENSP00000266771:A540V;ENSP00000444276:A57V;ENSP00000439946:A203V	ENSP00000266771:A540V	A	-	2	0	SLC15A4	127844809	1.000000	0.71417	0.980000	0.43619	0.192000	0.23643	8.704000	0.91351	2.670000	0.90874	0.655000	0.94253	GCT		0.438	SLC15A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399663.1		NM_145648	
SPATA17	128153	hgsc.bcm.edu;ucsc.edu	37	1	217955528	217955528	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:217955528G>A	ENST00000366933.4	+	8	791	c.736G>A	c.(736-738)Gat>Aat	p.D246N	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	246						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		GCCCTTCCGAGATATCACCGA	0.453																																																	0													73.0	76.0	75.0					1																	217955528		2203	4300	6503	SO:0001583	missense	128153			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.736G>A	1.37:g.217955528G>A	ENSP00000355900:p.Asp246Asn	Somatic		WXS	SOLID	Phase_I	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753496	0.49362	.	.	ENSG00000162814	ENST00000366933	T	0.46451	0.87	4.73	1.62	0.23740	.	0.537282	0.19584	N	0.110782	T	0.42720	0.1215	M	0.76838	2.35	0.09310	N	1	B	0.19706	0.038	B	0.20767	0.031	T	0.41893	-0.9483	10	0.56958	D	0.05	-0.8762	9.7037	0.40203	0.0751:0.3186:0.6063:0.0	.	246	Q96L03	SPT17_HUMAN	N	246	ENSP00000355900:D246N	ENSP00000355900:D246N	D	+	1	0	SPATA17	216022151	0.721000	0.28007	0.011000	0.14972	0.374000	0.29953	1.423000	0.34837	0.098000	0.17522	0.650000	0.86243	GAT		0.453	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2		NM_138796	
SRSF5	6430	hgsc.bcm.edu;ucsc.edu	37	14	70234985	70234985	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:70234985G>C	ENST00000553521.1	+	3	1565	c.112G>C	c.(112-114)Ggc>Cgc	p.G38R	SRSF5_ENST00000553635.1_Missense_Mutation_p.G38R|SRSF5_ENST00000554021.1_Missense_Mutation_p.G38R|SRSF5_ENST00000556587.1_3'UTR|SRSF5_ENST00000451983.2_Missense_Mutation_p.G38R|SRSF5_ENST00000555349.1_Missense_Mutation_p.G38R|SRSF5_ENST00000553548.1_Missense_Mutation_p.G38R|SRSF5_ENST00000557154.1_Missense_Mutation_p.G38R|SRSF5_ENST00000394366.2_Missense_Mutation_p.G38R			Q13243	SRSF5_HUMAN	serine/arginine-rich splicing factor 5	38	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of cell cycle (GO:0051726)|response to wounding (GO:0009611)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|liver(1)	2						TCTGAAAAGAGGCTTTGGTTT	0.428																																																	0													205.0	230.0	221.0					14																	70234985		2203	4300	6503	SO:0001583	missense	6430			AF020307	CCDS32109.1	14q24	2013-02-12	2010-06-22	2010-06-22	ENSG00000100650	ENSG00000100650		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10787	protein-coding gene	gene with protein product	"""SR splicing factor 5"""	600914	"""splicing factor, arginine/serine-rich 5"""	SFRS5		7686911, 20516191	Standard	XM_005267998		Approved	SRP40, HRS	uc001xlp.3	Q13243		ENST00000553521.1:c.112G>C	14.37:g.70234985G>C	ENSP00000452123:p.Gly38Arg	Somatic		WXS	SOLID	Phase_I	O14797|Q16662|Q49AD6|Q6FGE0	Missense_Mutation	SNP	ENST00000553521.1	37	CCDS32109.1	.	.	.	.	.	.	.	.	.	.	G	33	5.210381	0.95069	.	.	ENSG00000100650	ENST00000553521;ENST00000394366;ENST00000553548;ENST00000553369;ENST00000557154;ENST00000451983;ENST00000553635;ENST00000555349;ENST00000554021	T;T;D;D;T;D;T;D;D	0.83250	2.48;2.48;-1.7;-1.7;2.48;-1.7;2.48;-1.7;-1.7	5.86	5.86	0.93980	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.91673	0.7368	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	0.988;0.998;1.0	D;D;D	0.97110	0.916;0.976;1.0	D	0.91111	0.4922	10	0.54805	T	0.06	.	20.1772	0.98182	0.0:0.0:1.0:0.0	.	38;38;38	Q13243-3;Q6FGE0;Q13243	.;.;SRSF5_HUMAN	R	38	ENSP00000452123:G38R;ENSP00000377892:G38R;ENSP00000452400:G38R;ENSP00000452449:G38R;ENSP00000451088:G38R;ENSP00000402734:G38R;ENSP00000451391:G38R;ENSP00000452090:G38R;ENSP00000450918:G38R	ENSP00000377892:G38R	G	+	1	0	SRSF5	69304738	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.013000	0.88655	2.778000	0.95560	0.655000	0.94253	GGC		0.428	SRSF5-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412456.1		NM_001039465	
STK11IP	114790	hgsc.bcm.edu	37	2	220478482	220478482	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr2:220478482C>T	ENST00000456909.1	+	21	2636	c.2546C>T	c.(2545-2547)cCa>cTa	p.P849L	STK11IP_ENST00000295641.10_Missense_Mutation_p.P860L			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	860					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGTGAGCCTCCAGCTAGCTGG	0.632																																																	0													51.0	58.0	55.0					2																	220478482		2153	4265	6418	SO:0001583	missense	114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2546C>T	2.37:g.220478482C>T	ENSP00000389383:p.Pro849Leu	Somatic		WXS	SOLID	Phase_I	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37		.	.	.	.	.	.	.	.	.	.	c	15.07	2.725227	0.48833	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	T;T	0.07800	3.16;3.16	4.62	3.75	0.43078	.	0.132789	0.52532	N	0.000071	T	0.12305	0.0299	M	0.72894	2.215	0.58432	D	0.999993	B	0.20887	0.049	B	0.25140	0.058	T	0.02758	-1.1114	10	0.87932	D	0	-5.8931	9.9794	0.41804	0.0:0.905:0.0:0.095	.	860	Q8N1F8	S11IP_HUMAN	L	849;860	ENSP00000389383:P849L;ENSP00000295641:P860L	ENSP00000295641:P860L	P	+	2	0	STK11IP	220186726	0.970000	0.33590	0.876000	0.34364	0.749000	0.42624	2.416000	0.44644	1.184000	0.42957	-0.260000	0.10688	CCA		0.632	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1		NM_052902	
TACC1	6867	hgsc.bcm.edu;ucsc.edu	37	8	38704295	38704295	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr8:38704295G>T	ENST00000317827.4	+	12	2686	c.2307G>T	c.(2305-2307)gaG>gaT	p.E769D	TACC1_ENST00000443286.2_Missense_Mutation_p.E756D|RP11-723D22.3_ENST00000459965.2_RNA|TACC1_ENST00000330691.6_Missense_Mutation_p.E343D|TACC1_ENST00000520615.1_Missense_Mutation_p.E574D|TACC1_ENST00000520611.1_Missense_Mutation_p.E206D|TACC1_ENST00000348567.4_Missense_Mutation_p.E331D|TACC1_ENST00000518415.1_Missense_Mutation_p.E695D|TACC1_ENST00000276520.8_Missense_Mutation_p.E359D|TACC1_ENST00000520973.1_Missense_Mutation_p.E545D|TACC1_ENST00000379931.3_Missense_Mutation_p.E781D|TACC1_ENST00000519416.1_Missense_Mutation_p.E573D	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	769	Interaction with CH-TOG.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			TCCGCAAAGAGCAGATGAAGG	0.522																																																	0													72.0	69.0	70.0					8																	38704295		2203	4300	6503	SO:0001583	missense	6867			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.2307G>T	8.37:g.38704295G>T	ENSP00000321703:p.Glu769Asp	Somatic		WXS	SOLID	Phase_I	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	ENST00000317827.4	37	CCDS6109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.129127|4.129127	0.77549|0.77549	.|.	.|.	ENSG00000147526|ENSG00000147526	ENST00000519416;ENST00000520615;ENST00000443286;ENST00000518415;ENST00000330691;ENST00000348567;ENST00000317827;ENST00000379931;ENST00000276520;ENST00000520973;ENST00000520611|ENST00000521866;ENST00000518809	T;T;T;T;T;T;T;T;T;T;T|.	0.52983|.	0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64|.	5.47|5.47	-0.436|-0.436	0.12275|0.12275	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71039|0.71039	0.3293|0.3293	M|M	0.81802|0.81802	2.56|2.56	0.51767|0.51767	D|D	0.999933|0.999933	D;D;D;D;D;D;D;D|.	0.89917|.	0.991;0.996;1.0;0.999;0.992;0.988;0.996;0.997|.	D;D;D;D;D;P;D;D|.	0.87578|.	0.965;0.983;0.998;0.996;0.993;0.79;0.965;0.996|.	T|T	0.69632|0.69632	-0.5093|-0.5093	10|5	0.72032|.	D|.	0.01|.	-17.2658|-17.2658	10.7211|10.7211	0.46040|0.46040	0.4567:0.0:0.5433:0.0|0.4567:0.0:0.5433:0.0	.|.	545;545;756;781;769;359;573;695|.	E7EVI4;B4DH49;B4E302;O75410-2;O75410;O75410-6;E7ET87;O75410-7|.	.;.;.;.;TACC1_HUMAN;.;.;.|.	D|I	573;574;756;695;343;331;769;781;359;545;206|526;418	ENSP00000428687:E573D;ENSP00000428450:E574D;ENSP00000393647:E756D;ENSP00000428706:E695D;ENSP00000332794:E343D;ENSP00000327818:E331D;ENSP00000321703:E769D;ENSP00000369263:E781D;ENSP00000276520:E359D;ENSP00000430959:E545D;ENSP00000429418:E206D|.	ENSP00000276520:E359D|.	E|S	+|+	3|2	2|0	TACC1|TACC1	38823452|38823452	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.965000|0.965000	0.64279|0.64279	1.193000|1.193000	0.32162|0.32162	-0.167000|-0.167000	0.10871|0.10871	-1.008000|-1.008000	0.02478|0.02478	GAG|AGC		0.522	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1		NM_006283	
TAF1C	9013	hgsc.bcm.edu;ucsc.edu	37	16	84216708	84216708	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:84216708C>G	ENST00000567759.1	-	6	638	c.456G>C	c.(454-456)caG>caC	p.Q152H	TAF1C_ENST00000541676.1_Missense_Mutation_p.Q85H|TAF1C_ENST00000566732.1_Missense_Mutation_p.Q152H|TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000341690.6_Missense_Mutation_p.Q85H|TAF1C_ENST00000378541.4_Missense_Mutation_p.Q152H|TAF1C_ENST00000570117.1_Intron	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	152					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CACCGAGGTCCTGGAGCAGCT	0.577																																																	0													195.0	173.0	181.0					16																	84216708		2200	4300	6500	SO:0001583	missense	9013			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.456G>C	16.37:g.84216708C>G	ENSP00000455265:p.Gln152His	Somatic		WXS	SOLID	Phase_I	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	37	CCDS32496.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.546903	0.27652	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000537450	T;T;T	0.04502	3.69;3.61;3.61	4.63	3.66	0.41972	.	0.505555	0.16730	N	0.201890	T	0.11707	0.0285	M	0.67953	2.075	0.33864	D	0.634087	P;B;B;B	0.52061	0.95;0.004;0.01;0.004	P;B;B;B	0.53809	0.735;0.007;0.01;0.007	T	0.04961	-1.0915	10	0.59425	D	0.04	-7.7008	7.9962	0.30269	0.0:0.8877:0.0:0.1123	.	152;152;152;85	F5H7W6;Q15572-6;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	H	152;85;85;152	ENSP00000367802:Q152H;ENSP00000437900:Q85H;ENSP00000345305:Q85H	ENSP00000345305:Q85H	Q	-	3	2	TAF1C	82774209	0.933000	0.31639	0.991000	0.47740	0.319000	0.28217	0.724000	0.25954	2.283000	0.76528	0.563000	0.77884	CAG		0.577	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2		NM_139353	
TMC3	342125	hgsc.bcm.edu;ucsc.edu	37	15	81644159	81644159	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr15:81644159A>G	ENST00000359440.5	-	10	1094	c.959T>C	c.(958-960)aTt>aCt	p.I320T	TMC3_ENST00000558726.1_Missense_Mutation_p.I320T|RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						GTTGGCAATAATCCTCAGGCA	0.532																																																	0													62.0	62.0	62.0					15																	81644159		2067	4214	6281	SO:0001583	missense	342125			AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.959T>C	15.37:g.81644159A>G	ENSP00000352413:p.Ile320Thr	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000359440.5	37	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496931	0.44352	.	.	ENSG00000188869	ENST00000359440	D	0.87966	-2.32	5.31	5.31	0.75309	.	0.113307	0.64402	D	0.000015	D	0.86477	0.5942	L	0.58101	1.795	0.80722	D	1	B;P	0.42556	0.382;0.783	B;B	0.42625	0.246;0.393	D	0.88126	0.2835	10	0.87932	D	0	-13.7684	14.4468	0.67356	1.0:0.0:0.0:0.0	.	320;320	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	T	320	ENSP00000352413:I320T	ENSP00000352413:I320T	I	-	2	0	TMC3	79431214	1.000000	0.71417	0.588000	0.28705	0.273000	0.26683	8.519000	0.90563	2.005000	0.58758	0.455000	0.32223	ATT		0.532	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3		NM_181841	
TMC5	79838	hgsc.bcm.edu;ucsc.edu	37	16	19451434	19451434	+	Missense_Mutation	SNP	G	G	A	rs567263952		TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:19451434G>A	ENST00000396229.2	+	3	823	c.74G>A	c.(73-75)cGt>cAt	p.R25H	TMC5_ENST00000381414.4_Missense_Mutation_p.R25H|TMC5_ENST00000541464.1_Missense_Mutation_p.R25H|TMC5_ENST00000542583.2_Missense_Mutation_p.R25H	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	25					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TCTCAGAACCGTACGCAGGGG	0.498													g|||	1	0.000199681	0.0	0.0	5008	,	,		18124	0.0		0.0	False		,,,				2504	0.001																0													99.0	96.0	97.0					16																	19451434		1872	4118	5990	SO:0001583	missense	79838			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.74G>A	16.37:g.19451434G>A	ENSP00000379531:p.Arg25His	Somatic		WXS	SOLID	Phase_I	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	g	5.338	0.247637	0.10130	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583	T;T;T;T	0.65916	-0.18;0.03;-0.17;-0.17	4.89	-9.78	0.00496	.	16.045300	0.00166	N	0.000000	T	0.33556	0.0867	N	0.04880	-0.145	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22347	-1.0219	10	0.14252	T	0.57	7.6197	8.6355	0.33945	0.5689:0.2845:0.1466:0.0	.	25;25;25	F5GYU8;Q6UXY8;Q6UXY8-2	.;TMC5_HUMAN;.	H	25	ENSP00000441227:R25H;ENSP00000370822:R25H;ENSP00000379531:R25H;ENSP00000446274:R25H	ENSP00000370822:R25H	R	+	2	0	TMC5	19358935	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.790000	0.01759	-2.537000	0.00488	-0.119000	0.15052	CGT		0.498	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1		NM_024780	
TNR	7143	hgsc.bcm.edu	37	1	175355249	175355249	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:175355249G>T	ENST00000367674.2	-	8	2404	c.1696C>A	c.(1696-1698)Cct>Act	p.P566T	TNR_ENST00000263525.2_Missense_Mutation_p.P566T			Q92752	TENR_HUMAN	tenascin R	566	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.P566S(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CGGGAGCCAGGCCGCAGGGCC	0.607																																																	1	Substitution - Missense(1)	pancreas(1)											62.0	60.0	61.0					1																	175355249		2203	4300	6503	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1696C>A	1.37:g.175355249G>T	ENSP00000356646:p.Pro566Thr	Somatic		WXS	SOLID	Phase_I	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916492	0.73098	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.68479	-0.33;-0.33	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84991	0.5595	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87170	0.2220	10	0.87932	D	0	.	19.1714	0.93580	0.0:0.0:1.0:0.0	.	566	Q92752	TENR_HUMAN	T	566	ENSP00000356646:P566T;ENSP00000263525:P566T	ENSP00000263525:P566T	P	-	1	0	TNR	173621872	1.000000	0.71417	0.993000	0.49108	0.325000	0.28411	8.911000	0.92721	2.613000	0.88420	0.650000	0.86243	CCT		0.607	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4		NM_003285	
TMEM206	55248	hgsc.bcm.edu	37	1	212548582	212548582	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:212548582A>G	ENST00000261455.4	-	7	981	c.844T>C	c.(844-846)Ttt>Ctt	p.F282L	TMEM206_ENST00000535273.1_Missense_Mutation_p.F343L	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	282						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		AAGACCACAAAAAACAATTGA	0.358																																																	0													83.0	82.0	82.0					1																	212548582		2203	4300	6503	SO:0001583	missense	55248			AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.844T>C	1.37:g.212548582A>G	ENSP00000261455:p.Phe282Leu	Somatic		WXS	SOLID	Phase_I	B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	37	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	A	36	5.605310	0.96626	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.68128	0.2967	L	0.34521	1.04	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.987	T	0.70927	-0.4739	9	0.87932	D	0	-23.5978	16.8222	0.85835	1.0:0.0:0.0:0.0	.	343;282	B7Z4D6;Q9H813	.;TM206_HUMAN	L	282;343	.	ENSP00000261455:F282L	F	-	1	0	TMEM206	210615205	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.931000	0.87625	2.371000	0.80710	0.533000	0.62120	TTT		0.358	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1		NM_018252	
TTF1	7270	hgsc.bcm.edu	37	9	135277682	135277682	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr9:135277682G>A	ENST00000334270.2	-	2	566	c.527C>T	c.(526-528)gCa>gTa	p.A176V		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	176	N-terminal region (NRD). {ECO:0000250}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.A176V(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CTCCCAGGATGCAGCTTTCCT	0.493																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											48.0	45.0	46.0					9																	135277682		2203	4300	6503	SO:0001583	missense	7270			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.527C>T	9.37:g.135277682G>A	ENSP00000333920:p.Ala176Val	Somatic		WXS	SOLID	Phase_I	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718612	0.30503	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.11495	2.77	4.85	1.39	0.22231	.	.	.	.	.	T	0.08582	0.0213	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.14578	0.011	T	0.31364	-0.9946	9	0.41790	T	0.15	.	5.1258	0.14884	0.1022:0.0:0.4577:0.4401	.	176	Q15361	TTF1_HUMAN	V	176	ENSP00000333920:A176V	ENSP00000245588:A176V	A	-	2	0	TTF1	134267503	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.130000	0.10498	0.558000	0.29135	-0.136000	0.14681	GCA		0.493	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2		NM_007344	
TUBA3D	113457	hgsc.bcm.edu	37	2	132237983	132237983	+	Silent	SNP	A	A	G	rs6423208	byFrequency	TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr2:132237983A>G	ENST00000321253.6	+	4	824	c.717A>G	c.(715-717)acA>acG	p.T239T		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	239					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		CCTCCATCACAGCCTCCCTGC	0.557																																					Ovarian(137;2059 2432 35543 39401)												0													102.0	133.0	123.0					2																	132237983		1926	4246	6172	SO:0001819	synonymous_variant	113457			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.717A>G	2.37:g.132237983A>G		Somatic		WXS	SOLID	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000321253.6	37	CCDS33290.1																																																																																				0.557	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2		NM_080386	
TTLL4	9654	hgsc.bcm.edu;ucsc.edu	37	2	219618334	219618334	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr2:219618334A>G	ENST00000392102.1	+	19	3626	c.3286A>G	c.(3286-3288)Atc>Gtc	p.I1096V	TTLL4_ENST00000457313.1_Missense_Mutation_p.I931V|TTLL4_ENST00000442769.1_Missense_Mutation_p.I1032V|TTLL4_ENST00000258398.4_Missense_Mutation_p.I1096V	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	1096					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		ACTTCTGACTATCTCAAAGGA	0.537																																					GBM(172;1818 2053 15407 20943 49753)												0													210.0	201.0	204.0					2																	219618334		2203	4300	6503	SO:0001583	missense	9654				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.3286A>G	2.37:g.219618334A>G	ENSP00000375951:p.Ile1096Val	Somatic		WXS	SOLID	Phase_I	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.004|0.004	-2.379883|-2.379883	0.00205|0.00205	.|.	.|.	ENSG00000135912|ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398|ENST00000436668	T;T;T;T|.	0.03635|.	4.07;4.32;3.86;4.32|.	5.27|5.27	-3.48|-3.48	0.04739|0.04739	.|.	2.556040|.	0.01013|.	N|.	0.003860|.	T|T	0.12347|0.12347	0.0300|0.0300	N|N	0.03115|0.03115	-0.41|-0.41	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.01281|.	0.0;0.0;0.0|.	T|T	0.28650|0.28650	-1.0037|-1.0037	10|5	0.02654|.	T|.	1|.	.|.	7.0815|7.0815	0.25234|0.25234	0.5093:0.2387:0.252:0.0|0.5093:0.2387:0.252:0.0	.|.	931;1032;1096|.	E9PH58;E7EX20;Q14679|.	.;.;TTLL4_HUMAN|.	V|C	931;1096;1032;1096|198	ENSP00000393332:I931V;ENSP00000375951:I1096V;ENSP00000396555:I1032V;ENSP00000258398:I1096V|.	ENSP00000258398:I1096V|.	I|Y	+|+	1|2	0|0	TTLL4|TTLL4	219326578|219326578	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.024000|0.024000	0.10985|0.10985	-0.461000|-0.461000	0.06712|0.06712	-1.053000|-1.053000	0.03218|0.03218	-0.132000|-0.132000	0.14878|0.14878	ATC|TAT		0.537	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1		NM_014640	
UBA7	7318	hgsc.bcm.edu	37	3	49850746	49850746	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:49850746T>C	ENST00000333486.3	-	3	454	c.296A>G	c.(295-297)aAc>aGc	p.N99S	UBA7_ENST00000494212.1_5'UTR	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	99	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GACAGCTCTGTTGAGCTGAGC	0.587																																																	0													75.0	74.0	74.0					3																	49850746		2203	4300	6503	SO:0001583	missense	7318			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.296A>G	3.37:g.49850746T>C	ENSP00000333266:p.Asn99Ser	Somatic		WXS	SOLID	Phase_I	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.192646	0.78902	.	.	ENSG00000182179	ENST00000333486	T	0.65178	-0.14	5.01	3.85	0.44370	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.81088	0.4750	M	0.92026	3.265	0.54753	D	0.999988	D	0.76494	0.999	D	0.79108	0.992	T	0.83001	-0.0177	10	0.87932	D	0	-16.8319	10.1495	0.42784	0.0:0.0796:0.0:0.9204	.	99	P41226	UBA7_HUMAN	S	99	ENSP00000333266:N99S	ENSP00000333266:N99S	N	-	2	0	UBA7	49825750	1.000000	0.71417	0.714000	0.30535	0.803000	0.45373	3.743000	0.55104	0.863000	0.35553	0.379000	0.24179	AAC		0.587	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1		NM_003335	
VGLL3	389136	hgsc.bcm.edu;ucsc.edu	37	3	87027696	87027696	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:87027696C>A	ENST00000398399.2	-	2	746	c.383G>T	c.(382-384)gGg>gTg	p.G128V	VGLL3_ENST00000383698.3_Missense_Mutation_p.G128V	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		GGGGGTTAGCCCCATCTTGCT	0.502																																																	0													120.0	115.0	116.0					3																	87027696		1906	4135	6041	SO:0001583	missense	389136			AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.383G>T	3.37:g.87027696C>A	ENSP00000381436:p.Gly128Val	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000398399.2	37	CCDS43110.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705900	0.68615	.	.	ENSG00000206538	ENST00000398399;ENST00000383698	T;T	0.48201	0.84;0.82	5.28	5.28	0.74379	.	0.218769	0.39475	N	0.001351	T	0.64789	0.2630	M	0.67953	2.075	0.80722	D	1	D	0.69078	0.997	P	0.58520	0.84	T	0.68484	-0.5396	10	0.72032	D	0.01	-10.6469	18.901	0.92443	0.0:1.0:0.0:0.0	.	128	A8MV65	VGLL3_HUMAN	V	128	ENSP00000381436:G128V;ENSP00000373199:G128V	ENSP00000373199:G128V	G	-	2	0	VGLL3	87110386	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.060000	0.71141	2.463000	0.83235	0.561000	0.74099	GGG		0.502	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1		NM_016206	
ZBTB38	253461	hgsc.bcm.edu;ucsc.edu	37	3	141163202	141163202	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr3:141163202G>T	ENST00000514251.1	+	4	2251	c.1972G>T	c.(1972-1974)Gag>Tag	p.E658*	ZBTB38_ENST00000441582.2_Nonsense_Mutation_p.E658*|ZBTB38_ENST00000321464.5_Nonsense_Mutation_p.E659*					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						ATGGGGAGAGGAGGCATTGAA	0.468																																																	0													97.0	95.0	96.0					3																	141163202		1908	4136	6044	SO:0001587	stop_gained	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1972G>T	3.37:g.141163202G>T	ENSP00000426387:p.Glu658*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	G	35	5.593986	0.96602	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	.	.	.	5.55	1.44	0.22558	.	0.776380	0.11451	N	0.562810	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.7629	6.5636	0.22499	0.2114:0.2451:0.5435:0.0	.	.	.	.	X	658;658;658;659	.	.	E	+	1	0	ZBTB38	142645892	0.854000	0.29725	0.900000	0.35374	0.929000	0.56500	2.620000	0.46410	0.254000	0.21573	0.650000	0.86243	GAG		0.468	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			
ZFP36L1	677	hgsc.bcm.edu;ucsc.edu	37	14	69257206	69257207	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr14:69257206_69257207insA	ENST00000439696.2	-	2	361_362	c.60_61insT	c.(58-63)ggtaacfs	p.N21fs	ZFP36L1_ENST00000555997.1_Stop_Codon_Ins|ZFP36L1_ENST00000336440.3_Frame_Shift_Ins_p.N21fs	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	21					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AGCATCTTGTTACCCTGGAGAG	0.574											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001589	frameshift_variant	677			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.61dupT	14.37:g.69257207_69257207dupA	ENSP00000388402:p.Asn21fs	Somatic	1113	WXS	SOLID	Phase_I	Q13851	Frame_Shift_Ins	INS	ENST00000439696.2	37	CCDS9791.1																																																																																				0.574	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			
ZSCAN31	64288	hgsc.bcm.edu;ucsc.edu	37	6	28293947	28293947	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr6:28293947G>A	ENST00000414429.1	-	8	2120	c.1217C>T	c.(1216-1218)cCa>cTa	p.P406L	ZSCAN31_ENST00000439158.1_Missense_Mutation_p.P406L|ZSCAN31_ENST00000396838.2_Missense_Mutation_p.P406L|ZSCAN31_ENST00000481934.1_5'UTR|ZSCAN31_ENST00000446474.1_Missense_Mutation_p.P247L|ZSCAN31_ENST00000344279.6_Missense_Mutation_p.P406L			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31	406					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCACCCTTATGGTCTCTCTCC	0.428																																																	0													303.0	318.0	313.0					6																	28293947		2203	4300	6503	SO:0001583	missense	0				CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.1217C>T	6.37:g.28293947G>A	ENSP00000390076:p.Pro406Leu	Somatic		WXS	SOLID	Phase_I	Q6P178|Q8WWS5	Missense_Mutation	SNP	ENST00000414429.1	37	CCDS4649.1	.	.	.	.	.	.	.	.	.	.	g	5.859	0.342759	0.11069	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000446474;ENST00000344279	T;T;T;T;T	0.02280	4.36;4.36;4.36;4.36;4.36	2.46	-4.93	0.03066	Zinc finger, C2H2 (1);	.	.	.	.	T	0.02304	0.0071	M	0.63208	1.945	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.17806	-1.0357	9	0.87932	D	0	.	1.9896	0.03443	0.4726:0.2821:0.1066:0.1387	.	406	Q96LW9	ZN323_HUMAN	L	406;406;406;247;406	ENSP00000380050:P406L;ENSP00000413705:P406L;ENSP00000390076:P406L;ENSP00000402937:P247L;ENSP00000345339:P406L	ENSP00000345339:P406L	P	-	2	0	ZNF323	28401926	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.006000	0.13152	-1.579000	0.01646	-2.148000	0.00335	CCA		0.428	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346804.1		NM_030899	
ZNF572	137209	hgsc.bcm.edu;ucsc.edu	37	8	125990031	125990031	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr8:125990031G>T	ENST00000319286.5	+	3	1675	c.1521G>T	c.(1519-1521)tgG>tgT	p.W507C		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	507					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CTCATGAATGGACTTGGAAAA	0.448										HNSCC(60;0.17)																																							0													75.0	83.0	80.0					8																	125990031		2203	4300	6503	SO:0001583	missense	137209			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1521G>T	8.37:g.125990031G>T	ENSP00000319305:p.Trp507Cys	Somatic		WXS	SOLID	Phase_I	A1L4F1|Q8N1Q0	Missense_Mutation	SNP	ENST00000319286.5	37	CCDS6354.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.425356	0.25639	.	.	ENSG00000180938	ENST00000319286	T	0.08008	3.14	5.0	3.11	0.35812	.	0.555420	0.15456	N	0.261383	T	0.06645	0.0170	N	0.24115	0.695	0.40686	D	0.982351	D	0.54047	0.964	B	0.43754	0.43	T	0.42085	-0.9472	10	0.44086	T	0.13	-0.4662	7.8093	0.29221	0.0867:0.0:0.7528:0.1605	.	507	Q7Z3I7	ZN572_HUMAN	C	507	ENSP00000319305:W507C	ENSP00000319305:W507C	W	+	3	0	ZNF572	126059212	0.001000	0.12720	0.068000	0.19968	0.692000	0.40212	0.485000	0.22324	0.623000	0.30267	0.563000	0.77884	TGG		0.448	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1		NM_152412	
ZFP69	339559	hgsc.bcm.edu;ucsc.edu	37	1	40954792	40954792	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr1:40954792C>G	ENST00000372706.1	+	4	1258	c.252C>G	c.(250-252)gaC>gaG	p.D84E	ZFP69_ENST00000372705.3_Missense_Mutation_p.D84E			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	84	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TATCTATTGACTTCACCCAGG	0.463																																																	0													67.0	68.0	67.0					1																	40954792		2203	4300	6503	SO:0001583	missense	0			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.252C>G	1.37:g.40954792C>G	ENSP00000361791:p.Asp84Glu	Somatic		WXS	SOLID	Phase_I	Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	ENST00000372706.1	37	CCDS30686.1	.	.	.	.	.	.	.	.	.	.	.	13.71	2.319311	0.41096	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.01981	4.52;4.52	3.62	2.65	0.31530	Krueppel-associated box (4);	0.000000	0.36234	N	0.002715	T	0.01765	0.0056	L	0.39467	1.215	0.27422	N	0.954264	P	0.44344	0.833	B	0.32583	0.148	T	0.49341	-0.8950	10	0.41790	T	0.15	-6.7041	6.4827	0.22071	0.0:0.8579:0.0:0.1421	.	84	Q49AA0	ZN642_HUMAN	E	84	ENSP00000361791:D84E;ENSP00000361790:D84E	ENSP00000361790:D84E	D	+	3	2	ZNF642	40727379	0.999000	0.42202	1.000000	0.80357	0.919000	0.55068	0.258000	0.18387	1.038000	0.40049	0.655000	0.94253	GAC		0.463	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1		NM_198494	
ZNF711	7552	hgsc.bcm.edu	37	X	84526278	84526278	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chrX:84526278T>C	ENST00000373165.3	+	9	2036	c.1730T>C	c.(1729-1731)cTt>cCt	p.L577P	ZNF711_ENST00000542798.1_Missense_Mutation_p.L419P|ZNF711_ENST00000395402.1_Missense_Mutation_p.L585P|ZNF711_ENST00000360700.4_Missense_Mutation_p.L623P|ZNF711_ENST00000276123.3_Missense_Mutation_p.L577P	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	577				L -> P (in Ref. 3; BAG61766). {ECO:0000305}.	positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						GAGAGGGAGCTTCAACGCCAT	0.408																																																	0													79.0	63.0	68.0					X																	84526278		2201	4298	6499	SO:0001583	missense	7552			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1730T>C	X.37:g.84526278T>C	ENSP00000362260:p.Leu577Pro	Somatic		WXS	SOLID	Phase_I	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	T	11.34	1.609816	0.28712	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72	5.3	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.189536	0.25529	N	0.030048	T	0.41604	0.1166	H	0.96208	3.785	0.80722	D	1	B;B	0.18968	0.032;0.0	B;B	0.21360	0.034;0.001	T	0.45498	-0.9257	10	0.87932	D	0	-2.2071	8.5625	0.33520	0.0:0.1589:0.0:0.8411	.	623;577	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	P	585;577;577;623;419	ENSP00000378798:L585P;ENSP00000362260:L577P;ENSP00000276123:L577P;ENSP00000353922:L623P;ENSP00000442071:L419P	ENSP00000276123:L577P	L	+	2	0	ZNF711	84412934	1.000000	0.71417	0.971000	0.41717	0.986000	0.74619	5.060000	0.64312	0.678000	0.31325	0.417000	0.27973	CTT		0.408	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2		NM_021998	
ZNF781	163115	hgsc.bcm.edu;ucsc.edu	37	19	38160410	38160410	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr19:38160410G>A	ENST00000590008.1	-	5	1492	c.640C>T	c.(640-642)Cac>Tac	p.H214Y	ZNF781_ENST00000593040.1_5'Flank|ZNF781_ENST00000358582.4_Missense_Mutation_p.H214Y|ZFP30_ENST00000586732.1_Intron			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						AGTAAGATGTGCACTTTGCCT	0.348																																																	0													70.0	69.0	70.0					19																	38160410		2203	4300	6503	SO:0001583	missense	163115			AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.640C>T	19.37:g.38160410G>A	ENSP00000466370:p.His214Tyr	Somatic		WXS	SOLID	Phase_I	Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	37	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	G	7.466	0.645737	0.14451	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.07444	3.19	2.4	1.34	0.21922	.	.	.	.	.	T	0.10637	0.0260	M	0.67397	2.05	0.09310	N	1	D	0.56521	0.976	P	0.44359	0.447	T	0.25606	-1.0127	9	0.66056	D	0.02	3.109	4.4176	0.11465	0.1442:0.0:0.6312:0.2246	.	214	Q8N8C0	ZN781_HUMAN	Y	214	ENSP00000351391:H214Y	ENSP00000351391:H214Y	H	-	1	0	ZNF781	42852250	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	1.084000	0.30828	1.327000	0.45338	0.543000	0.68304	CAC		0.348	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2		NM_152605	
ZNF821	55565	hgsc.bcm.edu	37	16	71893982	71893982	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4352-01A-01D-1366-10	TCGA-BP-4352-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b976a492-5792-42d3-bec3-5bbb7292cac5	9461b657-9b8f-4cf6-a0eb-27cb3ae9923a	g.chr16:71893982A>C	ENST00000565601.1	-	7	1585	c.1178T>G	c.(1177-1179)tTg>tGg	p.L393W	ZNF821_ENST00000313565.6_Missense_Mutation_p.L351W|ZNF821_ENST00000446827.2_Missense_Mutation_p.L351W|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000425432.1_Missense_Mutation_p.L393W|ZNF821_ENST00000564134.1_3'UTR	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						CTGGCTGTCCAACTCCACCCC	0.562																																																	0													70.0	56.0	61.0					16																	71893982		2198	4300	6498	SO:0001583	missense	55565			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.1178T>G	16.37:g.71893982A>C	ENSP00000455648:p.Leu393Trp	Somatic		WXS	SOLID	Phase_I	A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	ENST00000565601.1	37	CCDS56006.1	.	.	.	.	.	.	.	.	.	.	A	19.24	3.788981	0.70337	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.02301	5.93;4.35;4.35	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000018	T	0.06645	0.0170	N	0.19112	0.55	0.46185	D	0.998918	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.73380	0.97;0.98;0.97	T	0.46652	-0.9176	10	0.87932	D	0	-7.746	16.8061	0.85666	1.0:0.0:0.0:0.0	.	393;351;393	B4DKK4;O75541-2;O75541	.;.;ZN821_HUMAN	W	393;351;351	ENSP00000398089:L393W;ENSP00000313822:L351W;ENSP00000405908:L351W	ENSP00000313822:L351W	L	-	2	0	ZNF821	70451483	.	.	0.984000	0.44739	0.994000	0.84299	.	.	2.367000	0.80283	0.528000	0.53228	TTG		0.562	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1		NM_017530	
