#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA1	19	broad.mit.edu;hgsc.bcm.edu	37	9	107558674	107558674	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr9:107558674A>C	ENST00000374736.3	-	38	5547	c.5153T>G	c.(5152-5154)aTt>aGt	p.I1718S		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1718					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.I1718S(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GAAGATGATAATGACCAGTGT	0.433																																																	1	Substitution - Missense(1)	kidney(1)											118.0	101.0	107.0					9																	107558674		2203	4300	6503	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5153T>G	9.37:g.107558674A>C	ENSP00000363868:p.Ile1718Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759217	0.69763	.	.	ENSG00000165029	ENST00000374736	D	0.88509	-2.39	5.67	4.52	0.55395	.	0.245187	0.47093	D	0.000252	D	0.90099	0.6907	M	0.75150	2.29	0.80722	D	1	B	0.23377	0.084	B	0.37239	0.244	D	0.88069	0.2799	10	0.87932	D	0	.	11.684	0.51474	0.9305:0.0:0.0695:0.0	.	1718	O95477	ABCA1_HUMAN	S	1718	ENSP00000363868:I1718S	ENSP00000363868:I1718S	I	-	2	0	ABCA1	106598495	1.000000	0.71417	0.910000	0.35882	0.998000	0.95712	7.481000	0.81124	1.074000	0.40909	0.533000	0.62120	ATT		0.433	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1		NM_005502	
ACE	1636	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	61555382	61555382	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr17:61555382G>A	ENST00000290866.4	+	2	364	c.340G>A	c.(340-342)Gac>Aac	p.D114N	ACE_ENST00000584529.1_3'UTR|ACE_ENST00000538928.1_Missense_Mutation_p.D114N|ACE_ENST00000428043.1_Missense_Mutation_p.D114N	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	114	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.D114N(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GAACTTCACGGACCCGCAGCT	0.647																																																	1	Substitution - Missense(1)	kidney(1)											35.0	31.0	32.0					17																	61555382		2201	4300	6501	SO:0001583	missense	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.340G>A	17.37:g.61555382G>A	ENSP00000290866:p.Asp114Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890847	0.33348	.	.	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	T;T;T	0.37235	1.21;1.21;1.21	5.37	3.37	0.38596	.	0.314439	0.36703	N	0.002448	T	0.35248	0.0925	L	0.39514	1.22	0.80722	D	1	B;B;B	0.27971	0.005;0.021;0.196	B;B;B	0.39503	0.005;0.029;0.301	T	0.10359	-1.0633	10	0.30854	T	0.27	-31.9186	12.08	0.53665	0.1408:0.0:0.8592:0.0	.	114;114;114	F5H1K1;B4DU66;P12821	.;.;ACE_HUMAN	N	114	ENSP00000439591:D114N;ENSP00000290866:D114N;ENSP00000397593:D114N	ENSP00000290866:D114N	D	+	1	0	ACE	58909114	0.994000	0.37717	0.318000	0.25279	0.429000	0.31625	2.423000	0.44705	0.747000	0.32809	0.561000	0.74099	GAC		0.647	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			
AQP12A	375318	broad.mit.edu;hgsc.bcm.edu	37	2	241631411	241631411	+	Silent	SNP	C	C	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:241631411C>A	ENST00000337801.4	+	1	150	c.81C>A	c.(79-81)gcC>gcA	p.A27A	AC011298.2_ENST00000407635.2_lincRNA|AQP12A_ENST00000429564.1_Silent_p.A27A	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	27						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.A27A(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CCTCCAAGGCCCTGCTCCCAG	0.687																																																	1	Substitution - coding silent(1)	kidney(1)											41.0	49.0	46.0					2																	241631411		2183	4285	6468	SO:0001819	synonymous_variant	375318			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.81C>A	2.37:g.241631411C>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000337801.4	37																																																																																					0.687	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257185.2		NM_198998	
ATP6V0A4	50617	broad.mit.edu;hgsc.bcm.edu	37	7	138417644	138417644	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr7:138417644T>C	ENST00000310018.2	-	17	2168	c.1886A>G	c.(1885-1887)aAc>aGc	p.N629S	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.N629S|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.N629S	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	629					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)	p.N629S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GAGGGGTGCGTTGGAAGAGTC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											103.0	99.0	100.0					7																	138417644		2203	4300	6503	SO:0001583	missense	50617			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.1886A>G	7.37:g.138417644T>C	ENSP00000308122:p.Asn629Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	T	9.940	1.217136	0.22373	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.84298	-1.83;-1.83;-1.83	5.88	4.73	0.59995	.	0.063541	0.64402	N	0.000005	T	0.77370	0.4120	L	0.37800	1.135	0.31792	N	0.629538	B	0.26363	0.147	B	0.28305	0.088	T	0.71813	-0.4479	10	0.15066	T	0.55	-27.936	11.6624	0.51354	0.0:0.0688:0.0:0.9312	.	629	Q9HBG4	VPP4_HUMAN	S	629	ENSP00000308122:N629S;ENSP00000376774:N629S;ENSP00000253856:N629S	ENSP00000308122:N629S	N	-	2	0	ATP6V0A4	138068184	0.546000	0.26457	0.013000	0.15412	0.013000	0.08279	0.969000	0.29370	1.055000	0.40461	0.533000	0.62120	AAC		0.373	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1		NM_020632	
BNC1	646	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	83935682	83935682	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr15:83935682C>T	ENST00000345382.2	-	3	426	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	BNC1_ENST00000569704.1_Missense_Mutation_p.R107Q|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	114					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R114Q(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						ACTGAAGAGCCGGTCCAGTAG	0.502																																																	1	Substitution - Missense(1)	kidney(1)											125.0	117.0	119.0					15																	83935682		2203	4300	6503	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.341G>A	15.37:g.83935682C>T	ENSP00000307041:p.Arg114Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	C	36	5.872996	0.97049	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03635	3.86	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.00036	-1.2257	10	0.87932	D	0	-26.078	19.614	0.95622	0.0:1.0:0.0:0.0	.	107;114	F5GY04;Q01954	.;BNC1_HUMAN	Q	114;107	ENSP00000307041:R114Q	ENSP00000307041:R114Q	R	-	2	0	BNC1	81726686	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.573000	0.82421	2.873000	0.98535	0.561000	0.74099	CGG		0.502	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1		NM_001717	
BOD1L1	259282	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	13604991	13604992	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr4:13604991_13604992GC>CT	ENST00000040738.5	-	10	3667_3668	c.3532_3533GC>AG	c.(3532-3534)GCt>AGt	p.A1178S		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1178						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A1178T(1)|p.A1178G(1)|p.A1178S(1)									ATAAGCTGGAGCTGTTGCTTTT	0.391																																																	3	Substitution - Missense(3)	kidney(3)																																								SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3532_3533delinsCT	4.37:g.13604991_13604992delinsCT	ENSP00000040738:p.Ala1178Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																				0.391	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1		NM_148894	
BTG1	694	hgsc.bcm.edu;ucsc.edu	37	12	92539248	92539249	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr12:92539248_92539249insG	ENST00000256015.3	-	1	424_425	c.63_64insC	c.(61-66)ttcatcfs	p.I22fs	C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|RP11-796E2.4_ENST00000499685.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	22					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				AACTTGGAGATGAAGGACACGG	0.703			T	MYC	BCLL																																			Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	0																																										SO:0001589	frameshift_variant	694				CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.64dupC	12.37:g.92539249_92539249dupG	ENSP00000256015:p.Ile22fs	Somatic		WXS	Illumina HiSeq	Phase_I	P31607	Frame_Shift_Ins	INS	ENST00000256015.3	37	CCDS9043.1																																																																																				0.703	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1			
BZW1	9689	broad.mit.edu;hgsc.bcm.edu	37	2	201682967	201682967	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:201682967C>G	ENST00000409600.1	+	8	1125	c.670C>G	c.(670-672)Caa>Gaa	p.Q224E	BZW1_ENST00000452790.2_Missense_Mutation_p.Q256E|BZW1_ENST00000409226.1_Missense_Mutation_p.Q228E	NM_001207067.1|NM_014670.3	NP_001193996.1|NP_055485.2	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q256E(1)|p.Q224E(1)		breast(1)|kidney(2)|large_intestine(1)|lung(2)	6						TGCCAATAAGCAAAGTGTTGA	0.348																																																	2	Substitution - Missense(2)	kidney(2)											20.0	19.0	19.0					2																	201682967		1786	4051	5837	SO:0001583	missense	9689			D13630	CCDS56154.1, CCDS56155.1, CCDS56156.1	2q33	2010-04-09			ENSG00000082153	ENSG00000082153			18380	protein-coding gene	gene with protein product						10964520, 11524015	Standard	NM_001207067		Approved	BZAP45, KIAA0005	uc021vus.1	Q7L1Q6	OTTHUMG00000154560	ENST00000409600.1:c.670C>G	2.37:g.201682967C>G	ENSP00000386474:p.Gln224Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DLZ8|B4DWF7|Q14281|Q15394|Q9BUY0	Missense_Mutation	SNP	ENST00000409600.1	37	CCDS56156.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582002	0.65992	.	.	ENSG00000082153	ENST00000410110;ENST00000409600;ENST00000431249;ENST00000409226;ENST00000452790	T;T;T;T	0.77750	0.91;-1.09;-1.09;-1.12	5.87	5.87	0.94306	.	0.058066	0.64402	D	0.000001	T	0.74222	0.3688	L	0.44542	1.39	0.58432	D	0.999997	B;B;B	0.30068	0.267;0.19;0.139	B;B;B	0.27500	0.08;0.036;0.05	T	0.71510	-0.4571	10	0.56958	D	0.05	-0.7475	20.5827	0.99408	0.0:1.0:0.0:0.0	.	228;256;224	B4DWF7;B4DLZ8;Q7L1Q6	.;.;BZW1_HUMAN	E	224;224;140;228;256	ENSP00000387086:Q224E;ENSP00000386474:Q224E;ENSP00000386837:Q228E;ENSP00000394316:Q256E	ENSP00000386837:Q228E	Q	+	1	0	BZW1	201391212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.890000	0.69774	2.941000	0.99782	0.655000	0.94253	CAA		0.348	BZW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335975.1		NM_014670	
PROSER3	148137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	36258775	36258775	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:36258775C>A	ENST00000544099.1	+	9	1091	c.1028C>A	c.(1027-1029)cCt>cAt	p.P343H	C19orf55_ENST00000396908.4_Missense_Mutation_p.P343H|AC002398.13_ENST00000589397.1_RNA			Q2NL68	PRSR3_HUMAN		343								p.P343H(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAAGCCACTCCTTCCCCTGGA	0.657																																																	1	Substitution - Missense(1)	kidney(1)											17.0	21.0	20.0					19																	36258775		1947	4137	6084	SO:0001583	missense	148137																														ENST00000544099.1:c.1028C>A	19.37:g.36258775C>A	ENSP00000467267:p.Pro343His	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NDI3|Q8WWC8|Q96NL4	Missense_Mutation	SNP	ENST00000544099.1	37		.	.	.	.	.	.	.	.	.	.	C	15.26	2.779441	0.49891	.	.	ENSG00000167595	ENST00000396908	T	0.48201	0.82	3.46	-0.495	0.12030	.	.	.	.	.	T	0.51363	0.1670	M	0.64997	1.995	0.09310	N	1	D	0.61697	0.99	P	0.53450	0.726	T	0.43814	-0.9368	9	0.87932	D	0	-4.1379	6.0603	0.19835	0.0:0.4144:0.4677:0.1179	.	343	E5RFB9	.	H	343	ENSP00000380116:P343H	ENSP00000380116:P343H	P	+	2	0	C19orf55	40950615	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.260000	0.08708	0.034000	0.15491	0.563000	0.77884	CCT		0.657	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2			
C7orf25	79020	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	42949681	42949681	+	Silent	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr7:42949681C>T	ENST00000350427.4	-	2	1094	c.819G>A	c.(817-819)gaG>gaA	p.E273E	PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000431882.2_Silent_p.E331E|C7orf25_ENST00000438029.1_Silent_p.E273E|C7orf25_ENST00000447342.1_Silent_p.E273E			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	273								p.E273E(1)		endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						TGAGCACTTTCTCTTTGAAAA	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											109.0	106.0	107.0					7																	42949681		2203	4300	6503	SO:0001819	synonymous_variant	79020			BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.819G>A	7.37:g.42949681C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1V2|J3KR36|Q9H779	Silent	SNP	ENST00000350427.4	37	CCDS5466.1																																																																																				0.428	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250814.2		NM_024054	
CDC16	8881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	115007656	115007656	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr13:115007656C>A	ENST00000356221.3	+	6	550	c.442C>A	c.(442-444)Ctg>Atg	p.L148M	CDC16_ENST00000375308.1_Missense_Mutation_p.L54M|CDC16_ENST00000252458.6_Missense_Mutation_p.L54M|CDC16_ENST00000252457.5_Missense_Mutation_p.L147M|CDC16_ENST00000375312.3_Missense_Mutation_p.L54M|CDC16_ENST00000375310.1_Missense_Mutation_p.L54M|MIR548AR_ENST00000582191.1_RNA|CDC16_ENST00000360383.3_Missense_Mutation_p.L148M			Q13042	CDC16_HUMAN	cell division cycle 16	148					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)		p.L147M(1)		endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			TAACCGAACCCTGGCTACCTA	0.398																																																	1	Substitution - Missense(1)	kidney(1)											137.0	138.0	137.0					13																	115007656		2203	4300	6503	SO:0001583	missense	8881			U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.442C>A	13.37:g.115007656C>A	ENSP00000348554:p.Leu148Met	Somatic		WXS	Illumina HiSeq	Phase_I	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	ENST00000356221.3	37	CCDS9542.2	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181064	0.38511	.	.	ENSG00000130177	ENST00000360383;ENST00000375312;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308;ENST00000252458	T;T;T;T;T	0.74315	1.15;-0.83;1.15;1.15;-0.83	5.96	1.79	0.24919	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.76227	0.3958	L	0.35341	1.055	0.46028	D	0.998829	D;D;P;P	0.76494	0.999;0.967;0.936;0.883	D;P;P;P	0.83275	0.996;0.491;0.596;0.718	T	0.71636	-0.4533	9	.	.	.	-23.806	10.7718	0.46327	0.0:0.6526:0.0:0.3474	.	148;147;147;148	B4DK74;Q13042-3;Q13042-2;Q13042	.;.;.;CDC16_HUMAN	M	148;54;148;54;147;54;54	ENSP00000353549:L148M;ENSP00000364461:L54M;ENSP00000348554:L148M;ENSP00000252457:L147M;ENSP00000252458:L54M	.	L	+	1	2	CDC16	114025758	0.705000	0.27846	0.644000	0.29465	0.345000	0.29048	1.366000	0.34193	0.414000	0.25790	-0.140000	0.14226	CTG		0.398	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276737.1		NM_003903	
FAM134B	54463	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	16475310	16475310	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr5:16475310C>A	ENST00000306320.9	-	9	1120	c.1034G>T	c.(1033-1035)aGa>aTa	p.R345I	FAM134B_ENST00000399793.2_Missense_Mutation_p.R204I	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	345					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R345I(1)|p.R204I(1)		breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						TGAAAGATCTCTAGAGAAAAC	0.388																																																	2	Substitution - Missense(2)	kidney(2)											57.0	54.0	55.0					5																	16475310		1848	4089	5937	SO:0001583	missense	54463			BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.1034G>T	5.37:g.16475310C>A	ENSP00000304642:p.Arg345Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	37	CCDS43304.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803271	0.90623	.	.	ENSG00000154153	ENST00000399793;ENST00000306320	T;T	0.53423	0.69;0.62	6.03	6.03	0.97812	.	0.243006	0.40554	N	0.001061	T	0.70911	0.3278	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71656	0.942;0.974	T	0.71361	-0.4616	10	0.72032	D	0.01	-4.8177	20.5568	0.99304	0.0:1.0:0.0:0.0	rs34790415	345;204	Q9H6L5;Q9H6L5-2	F134B_HUMAN;.	I	204;345	ENSP00000382691:R204I;ENSP00000304642:R345I	ENSP00000304642:R345I	R	-	2	0	FAM134B	16528310	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.479000	0.53165	2.861000	0.98227	0.655000	0.94253	AGA		0.388	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1		NM_001034850	
FBLN1	2192	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	45960802	45960802	+	Intron	SNP	G	G	A	rs564987976		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr22:45960802G>A	ENST00000327858.6	+	15	1792				FBLN1_ENST00000442170.2_Missense_Mutation_p.G579E|FBLN1_ENST00000348697.2_Missense_Mutation_p.G579E	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1						embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.G579E(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ACCCCAGCGGGATCAAGTAAA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											118.0	103.0	108.0					22																	45960802		2203	4300	6503	SO:0001627	intron_variant	2192				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1698-9589G>A	22.37:g.45960802G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	4.934	0.173525	0.09391	.	.	ENSG00000077942	ENST00000348697;ENST00000442170	D;D	0.82526	-1.52;-1.62	1.58	0.469	0.16741	.	.	.	.	.	T	0.62986	0.2473	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44726	-0.9309	9	0.18710	T	0.47	.	3.21	0.06678	0.7285:0.0:0.2715:0.0	.	579	B1AHL4	.	E	579	ENSP00000262723:G579E;ENSP00000393812:G579E	ENSP00000262723:G579E	G	+	2	0	FBLN1	44339466	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.059000	0.14322	0.087000	0.17167	-0.373000	0.07131	GGA		0.532	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1		NM_006486	
INPP5A	3632	broad.mit.edu;ucsc.edu	37	10	134523924	134523924	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr10:134523924G>A	ENST00000368594.3	+	8	888	c.611G>A	c.(610-612)gGa>gAa	p.G204E	INPP5A_ENST00000487614.1_3'UTR|INPP5A_ENST00000368593.3_Missense_Mutation_p.G204E	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	204					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)	p.G204E(2)		cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GTGTACTCGGGAATCCGGCAC	0.572																																					Pancreas(63;823 1267 11107 20380 51626)												2	Substitution - Missense(2)	kidney(2)											86.0	67.0	73.0					10																	134523924		2203	4300	6503	SO:0001583	missense	3632			X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.611G>A	10.37:g.134523924G>A	ENSP00000357583:p.Gly204Glu	Somatic		WXS	Illumina GAIIx	Phase_I	D3DXI3|Q14640|Q5JSF1	Missense_Mutation	SNP	ENST00000368594.3	37	CCDS7669.2	.	.	.	.	.	.	.	.	.	.	G	15.08	2.728008	0.48833	.	.	ENSG00000068383	ENST00000368594;ENST00000368593;ENST00000416326;ENST00000536599;ENST00000432898;ENST00000423490	T;T;T	0.80653	-1.4;-1.4;1.47	4.56	4.56	0.56223	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.172208	0.50627	D	0.000105	T	0.81772	0.4893	L	0.31207	0.915	0.58432	D	0.999992	P;D;D	0.89917	0.594;1.0;0.961	B;D;P	0.85130	0.39;0.997;0.768	T	0.75485	-0.3301	10	0.02654	T	1	-10.2444	17.7848	0.88534	0.0:0.0:1.0:0.0	.	204;204;204	F5GWM1;Q14642;Q5T1B5	.;I5P1_HUMAN;.	E	204;204;204;141;121;127	ENSP00000357583:G204E;ENSP00000357582:G204E;ENSP00000390936:G127E	ENSP00000357582:G204E	G	+	2	0	INPP5A	134373914	1.000000	0.71417	0.866000	0.34008	0.976000	0.68499	4.685000	0.61693	2.281000	0.76405	0.650000	0.86243	GGA		0.572	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051085.1		NM_005539	
ITPRIPL1	150771	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	96993809	96993809	+	Silent	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:96993809C>T	ENST00000439118.2	+	3	1691	c.1440C>T	c.(1438-1440)ttC>ttT	p.F480F	ITPRIPL1_ENST00000361124.4_Silent_p.F488F|ITPRIPL1_ENST00000542887.1_Silent_p.F472F|ITPRIPL1_ENST00000536814.1_Silent_p.F472F	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	480						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.F488F(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCTCTGGTTCTTGGGCCGTG	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											87.0	86.0	86.0					2																	96993809		2203	4300	6503	SO:0001819	synonymous_variant	150771				CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.1440C>T	2.37:g.96993809C>T		Somatic		WXS	Illumina HiSeq	Phase_I	F5H1L8|Q8NE61	Silent	SNP	ENST00000439118.2	37	CCDS46360.1	.	.	.	.	.	.	.	.	.	.	C	5.354	0.250589	0.10130	.	.	ENSG00000198885	ENST00000420728	.	.	.	5.49	2.76	0.32466	.	.	.	.	.	T	0.53738	0.1815	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43750	-0.9372	4	.	.	.	-19.8919	5.6201	0.17453	0.0:0.6222:0.1435:0.2343	.	.	.	.	F	512	.	.	S	+	2	0	ITPRIPL1	96357536	0.933000	0.31639	0.991000	0.47740	0.996000	0.88848	0.806000	0.27126	0.450000	0.26774	0.655000	0.94253	TCT		0.527	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338896.1		NM_178495	
JAK3	3718	hgsc.bcm.edu	37	19	17954641	17954642	+	Frame_Shift_Ins	INS	-	-	C	rs139738701	byFrequency	TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:17954641_17954642insC	ENST00000527670.1	-	2	281_282	c.252_253insG	c.(250-255)ccgagcfs	p.S85fs	JAK3_ENST00000534444.1_Frame_Shift_Ins_p.S85fs|JAK3_ENST00000458235.1_Frame_Shift_Ins_p.S85fs|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	85	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	AAGATGTGGCTCGGGGGGAACC	0.589		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0																																										SO:0001589	frameshift_variant	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.253dupG	19.37:g.17954642_17954642dupC	ENSP00000432511:p.Ser85fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Frame_Shift_Ins	INS	ENST00000527670.1	37	CCDS12366.1																																																																																				0.589	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1		NM_000215	
CLUH	23277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	2596082	2596082	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr17:2596082G>A	ENST00000570628.2	-	20	3292	c.3187C>T	c.(3187-3189)Cag>Tag	p.Q1063*	CLUH_ENST00000538975.1_Nonsense_Mutation_p.Q1063*|CLUH_ENST00000435359.1_Nonsense_Mutation_p.Q1063*			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1063					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)		p.Q1064*(2)									ACGTATTCCTGGATGGTGTTG	0.697																																																	2	Substitution - Nonsense(2)	kidney(2)											44.0	50.0	48.0					17																	2596082		2116	4218	6334	SO:0001587	stop_gained	0			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3187C>T	17.37:g.2596082G>A	ENSP00000458986:p.Gln1063*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Nonsense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	G	42	9.796768	0.99266	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	17.9685	0.89106	0.0:0.0:1.0:0.0	.	.	.	.	X	1063;1064;1063	.	ENSP00000320468:Q1064X	Q	-	1	0	KIAA0664	2542832	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.004000	0.88535	2.494000	0.84150	0.561000	0.74099	CAG		0.697	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2		NM_015229	
KIAA1033	23325	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	105538583	105538583	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr12:105538583A>C	ENST00000332180.5	+	22	2354	c.2267A>C	c.(2266-2268)aAc>aCc	p.N756T		NM_015275.1	NP_056090.1			KIAA1033									p.N756T(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GAGATGAGAAACTTAGCTACT	0.388																																																	1	Substitution - Missense(1)	kidney(1)											138.0	131.0	133.0					12																	105538583		1917	4139	6056	SO:0001583	missense	23325			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2267A>C	12.37:g.105538583A>C	ENSP00000328062:p.Asn756Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000332180.5	37	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.376429	0.61735	.	.	ENSG00000136051	ENST00000332180	T	0.43688	0.94	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	L	0.53561	1.675	0.80722	D	1	B;B	0.15930	0.015;0.015	B;B	0.12837	0.008;0.008	T	0.19745	-1.0296	10	0.40728	T	0.16	.	15.9674	0.79985	1.0:0.0:0.0:0.0	.	757;756	B7ZKT9;Q2M389	.;WASH7_HUMAN	T	756	ENSP00000328062:N756T	ENSP00000328062:N756T	N	+	2	0	KIAA1033	104062713	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	9.283000	0.95860	2.170000	0.68504	0.477000	0.44152	AAC		0.388	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4		NM_015275	
MMP25	64386	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	3100517	3100517	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr16:3100517G>A	ENST00000336577.4	+	4	868	c.631G>A	c.(631-633)Gat>Aat	p.D211N	MMP25_ENST00000570755.1_3'UTR|RP11-473M20.7_ENST00000573130.1_RNA|RP11-473M20.7_ENST00000576250.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	220					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D135N(1)|p.D211N(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	TCACTTTGACGATGAGGAGAC	0.532																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												2	Substitution - Missense(2)	kidney(2)											43.0	46.0	45.0					16																	3100517		2197	4300	6497	SO:0001583	missense	64386			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.631G>A	16.37:g.3100517G>A	ENSP00000337816:p.Asp211Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q96F04|Q96TE2	Missense_Mutation	SNP	ENST00000336577.4	37	CCDS10492.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016733	0.75161	.	.	ENSG00000008516	ENST00000336577;ENST00000325800	T	0.23950	1.88	5.08	4.11	0.48088	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.125962	0.35525	N	0.003156	T	0.46889	0.1416	M	0.67953	2.075	0.42892	D	0.994207	D;P	0.89917	1.0;0.846	D;B	0.77004	0.989;0.379	T	0.47535	-0.9110	10	0.66056	D	0.02	.	11.5972	0.50981	0.0899:0.0:0.9101:0.0	.	135;211	O43923;Q9NPA2	.;MMP25_HUMAN	N	211;138	ENSP00000337816:D211N	ENSP00000324953:D138N	D	+	1	0	MMP25	3040518	0.053000	0.20554	0.974000	0.42286	0.986000	0.74619	2.216000	0.42871	1.115000	0.41800	0.655000	0.94253	GAT		0.532	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437116.1		NM_022468	
MTAP	4507	broad.mit.edu;hgsc.bcm.edu	37	9	21818193	21818193	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr9:21818193C>G	ENST00000460874.2	+	4	615	c.390C>G	c.(388-390)ttC>ttG	p.F130L	MTAP_ENST00000380172.4_Missense_Mutation_p.F113L|MTAP_ENST00000427788.2_3'UTR|RP11-145E5.5_ENST00000404796.2_Missense_Mutation_p.F113L|MTAP_ENST00000580900.1_Missense_Mutation_p.F113L					methylthioadenosine phosphorylase									p.F113L(1)|p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		TTGATCAGTTCATTGACAGGT	0.488																																																	3	Whole gene deletion(2)|Substitution - Missense(1)	lung(2)|kidney(1)											80.0	71.0	74.0					9																	21818193		2203	4300	6503	SO:0001583	missense	4507			AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.390C>G	9.37:g.21818193C>G	ENSP00000461932:p.Phe130Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000460874.2	37		.	.	.	.	.	.	.	.	.	.	C	17.24	3.339273	0.60963	.	.	ENSG00000099810	ENST00000380172	D	0.86366	-2.11	5.1	2.84	0.33178	Nucleoside phosphorylase domain (1);	0.136544	0.64402	D	0.000002	D	0.83225	0.5208	L	0.41961	1.31	0.80722	D	1	B;P;B	0.50528	0.241;0.936;0.242	B;P;B	0.48189	0.209;0.57;0.191	T	0.81351	-0.0972	10	0.48119	T	0.1	-7.5744	7.2994	0.26411	0.0:0.6805:0.0:0.3195	.	130;113;113	B4DUC8;F2Z2F3;Q13126	.;.;MTAP_HUMAN	L	113	ENSP00000369519:F113L	ENSP00000369519:F113L	F	+	3	2	MTAP	21808193	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	2.340000	0.43974	1.275000	0.44379	0.557000	0.71058	TTC		0.488	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000051929.2		NM_002451	
MYL5	4636	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	674308	674308	+	Silent	SNP	C	C	T	rs367674993		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr4:674308C>T	ENST00000400159.2	+	5	408	c.303C>T	c.(301-303)gcC>gcT	p.A101A	MYL5_ENST00000505477.1_Silent_p.A60A|MYL5_ENST00000506838.1_Silent_p.A60A|MYL5_ENST00000511290.1_Silent_p.A60A	NM_002477.1	NP_002468.1	Q02045	MYL5_HUMAN	myosin, light chain 5, regulatory	101	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of muscle contraction (GO:0006937)	muscle myosin complex (GO:0005859)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.A101A(1)		endometrium(1)|kidney(1)|lung(1)	3						GTACCGACGCCGAGGAGACCA	0.657																																																	1	Substitution - coding silent(1)	kidney(1)						C		1,3897		0,1,1948	72.0	79.0	77.0		303	-7.0	0.0	4		77	1,8271		0,1,4135	no	coding-synonymous	MYL5	NM_002477.1		0,2,6083	TT,TC,CC		0.0121,0.0257,0.0164		101/174	674308	2,12168	1949	4136	6085	SO:0001819	synonymous_variant	4636				CCDS43197.1	4p16	2013-01-10	2006-09-29		ENSG00000215375	ENSG00000215375		"""Myosins / Light chain"", ""EF-hand domain containing"""	7586	protein-coding gene	gene with protein product		160782	"""myosin, light polypeptide 5, regulatory"""			1284596	Standard	NM_002477		Approved		uc003gav.3	Q02045	OTTHUMG00000159971	ENST00000400159.2:c.303C>T	4.37:g.674308C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IXL8	Silent	SNP	ENST00000400159.2	37	CCDS43197.1																																																																																				0.657	MYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358570.2		NM_002477	
MYO1F	4542	broad.mit.edu;hgsc.bcm.edu	37	19	8606866	8606866	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:8606866C>T	ENST00000338257.8	-	15	1801	c.1534G>A	c.(1534-1536)Gac>Aac	p.D512N		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	512	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D512N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CCGCTGACGTCGTAGGAGACC	0.612																																																	1	Substitution - Missense(1)	kidney(1)											44.0	48.0	47.0					19																	8606866		2082	4226	6308	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1534G>A	19.37:g.8606866C>T	ENSP00000344871:p.Asp512Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	C	9.796	1.179359	0.21787	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.95171	-3.63	4.95	1.59	0.23543	Myosin head, motor domain (2);	0.208574	0.38959	N	0.001506	D	0.84665	0.5522	N	0.16016	0.355	0.48341	D	0.999635	B	0.15473	0.013	B	0.15052	0.012	T	0.70385	-0.4886	10	0.21014	T	0.42	.	4.7157	0.12894	0.1493:0.6008:0.0:0.2499	.	512	O00160	MYO1F_HUMAN	N	557;512	ENSP00000344871:D512N	ENSP00000304899:D557N	D	-	1	0	MYO1F	8512866	0.941000	0.31946	0.760000	0.31359	0.984000	0.73092	2.090000	0.41682	0.139000	0.18822	0.462000	0.41574	GAC		0.612	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2			
MYOM3	127294	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	24419478	24419478	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr1:24419478G>A	ENST00000374434.3	-	10	1211	c.1049C>T	c.(1048-1050)cCc>cTc	p.P350L	MYOM3_ENST00000329601.7_Missense_Mutation_p.P350L|MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000330966.7_Missense_Mutation_p.P351L	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	350	Ig-like C2-type 2.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)	p.P350L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GGGTCCGAAGGGCGAGGGCAC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											29.0	34.0	32.0					1																	24419478		1986	4139	6125	SO:0001583	missense	127294			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.1049C>T	1.37:g.24419478G>A	ENSP00000363557:p.Pro350Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	CCDS41281.1	.	.	.	.	.	.	.	.	.	.	G	5.916	0.353105	0.11182	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.66815	-0.23;-0.23;-0.23	5.36	5.36	0.76844	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.863614	0.10789	N	0.633947	T	0.55242	0.1908	L	0.27053	0.805	0.09310	N	0.999999	B;B;B	0.11235	0.004;0.0;0.002	B;B;B	0.10450	0.005;0.005;0.002	T	0.42085	-0.9472	10	0.39692	T	0.17	.	11.6706	0.51399	0.0:0.0:0.8231:0.1769	.	7;350;350	Q6ZU56;Q5VTT5-2;Q5VTT5	.;.;MYOM3_HUMAN	L	350;351;350	ENSP00000363557:P350L;ENSP00000332670:P351L;ENSP00000328415:P350L	ENSP00000328415:P350L	P	-	2	0	MYOM3	24292065	0.185000	0.23213	0.016000	0.15963	0.003000	0.03518	2.455000	0.44988	2.512000	0.84698	0.650000	0.86243	CCC		0.647	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2		NM_152372	
NOD2	64127	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	50733767	50733767	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr16:50733767C>T	ENST00000300589.2	+	2	547	c.442C>T	c.(442-444)Cat>Tat	p.H148Y	NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	148	CARD 2. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)	p.H148Y(1)		cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				GCTCCACAGCCATGTGGAGAA	0.612																																																	1	Substitution - Missense(1)	kidney(1)											60.0	56.0	57.0					16																	50733767		2198	4300	6498	SO:0001583	missense	64127			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.442C>T	16.37:g.50733767C>T	ENSP00000300589:p.His148Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876181	0.51801	.	.	ENSG00000167207	ENST00000526417;ENST00000531674;ENST00000300589	T;T	0.20200	2.44;2.09	5.29	5.29	0.74685	DEATH-like (2);Caspase Recruitment (2);	0.119241	0.37304	N	0.002142	T	0.42944	0.1225	L	0.59436	1.845	0.35652	D	0.811819	D	0.76494	0.999	D	0.83275	0.996	T	0.53599	-0.8416	10	0.72032	D	0.01	.	14.4281	0.67230	0.0:1.0:0.0:0.0	.	148	Q9HC29	NOD2_HUMAN	Y	121;121;148	ENSP00000431681:H121Y;ENSP00000300589:H148Y	ENSP00000300589:H148Y	H	+	1	0	NOD2	49291268	0.975000	0.34042	0.998000	0.56505	0.410000	0.31052	2.400000	0.44504	2.482000	0.83794	0.591000	0.81541	CAT		0.612	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2		NM_022162	
PCDHA12	56137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140257019	140257019	+	Silent	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr5:140257019C>T	ENST00000398631.2	+	1	1962	c.1962C>T	c.(1960-1962)caC>caT	p.H654H	PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	654	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H654H(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAGGACCACGGTGAGCCCG	0.692																																					Pancreas(113;759 1672 13322 24104 50104)												1	Substitution - coding silent(1)	kidney(1)											90.0	91.0	90.0					5																	140257019		2203	4299	6502	SO:0001819	synonymous_variant	56137			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1962C>T	5.37:g.140257019C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	CCDS47285.1																																																																																				0.692	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2		NM_018903	
PDIA6	10130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	10931989	10931989	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:10931989C>G	ENST00000272227.3	-	6	663	c.516G>C	c.(514-516)aaG>aaC	p.K172N	PDIA6_ENST00000381611.4_Missense_Mutation_p.K177N|PDIA6_ENST00000404371.2_Missense_Mutation_p.K224N|PDIA6_ENST00000404824.2_Missense_Mutation_p.K220N|PDIA6_ENST00000540494.1_Missense_Mutation_p.K169N	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	172	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)	p.K172N(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		CCAGAACATTCTTATCAAAGC	0.403																																					GBM(73;509 1219 34219 41343 41551)												1	Substitution - Missense(1)	kidney(1)											279.0	207.0	231.0					2																	10931989		2203	4300	6503	SO:0001583	missense	10130			BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.516G>C	2.37:g.10931989C>G	ENSP00000272227:p.Lys172Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	ENST00000272227.3	37	CCDS1675.1	.	.	.	.	.	.	.	.	.	.	C	9.126	1.010170	0.19277	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.63	2.53	0.30540	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.515963	0.23120	N	0.051704	T	0.30603	0.0770	L	0.28344	0.845	0.49582	D	0.999807	B;B;B;B	0.19200	0.009;0.034;0.015;0.014	B;B;B;B	0.31245	0.037;0.091;0.091;0.126	T	0.08785	-1.0705	10	0.56958	D	0.05	.	7.0862	0.25259	0.0:0.6298:0.1398:0.2304	.	169;220;224;172	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	N	172;224;220;169;177	ENSP00000272227:K172N;ENSP00000385385:K224N;ENSP00000384459:K220N;ENSP00000438778:K169N;ENSP00000371024:K177N	ENSP00000272227:K172N	K	-	3	2	PDIA6	10849440	1.000000	0.71417	0.033000	0.17914	0.083000	0.17756	1.505000	0.35736	0.340000	0.23745	-0.150000	0.13652	AAG		0.403	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1		NM_005742	
PEAK1	79834	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	77406695	77406695	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr15:77406695G>A	ENST00000560626.2	-	7	5519	c.5044C>T	c.(5044-5046)Cct>Tct	p.P1682S	PEAK1_ENST00000312493.4_Missense_Mutation_p.P1682S			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1682					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.P1682S(2)									ACTAGGCTAGGGCAGGCGGTG	0.552																																																	2	Substitution - Missense(2)	kidney(2)											89.0	92.0	91.0					15																	77406695		1934	4127	6061	SO:0001583	missense	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.5044C>T	15.37:g.77406695G>A	ENSP00000452796:p.Pro1682Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	G	0.545	-0.852028	0.02651	.	.	ENSG00000173517	ENST00000312493	T	0.67345	-0.26	5.57	-1.53	0.08611	.	0.391858	0.22617	U	0.057742	T	0.19765	0.0475	N	0.00436	-1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	10	0.11182	T	0.66	-3.372	0.4347	0.00477	0.2199:0.2874:0.219:0.2737	.	1682	Q9H792	PEAK1_HUMAN	S	1682	ENSP00000309230:P1682S	ENSP00000309230:P1682S	P	-	1	0	AC087465.1	75193750	0.691000	0.27709	0.018000	0.16275	0.056000	0.15407	0.180000	0.16860	-0.001000	0.14495	-0.314000	0.08810	CCT		0.552	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3			
PNKP	11284	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	50364761	50364761	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:50364761C>G	ENST00000322344.3	-	16	1502	c.1393G>C	c.(1393-1395)Gag>Cag	p.E465Q	AC018766.5_ENST00000599259.1_RNA|AC018766.4_ENST00000596624.1_RNA|PNKP_ENST00000600910.1_Missense_Mutation_p.R428T|AC018766.5_ENST00000601893.1_RNA|AC018766.5_ENST00000593654.1_RNA|PNKP_ENST00000600573.1_Missense_Mutation_p.E434Q|PNKP_ENST00000596014.1_Missense_Mutation_p.E465Q	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	465	Kinase. {ECO:0000250}.				dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)	p.E465Q(2)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TCCGTCATCTCTCGAAACTGT	0.657								Other BER factors																																									2	Substitution - Missense(2)	kidney(2)											78.0	73.0	75.0					19																	50364761		2203	4300	6503	SO:0001583	missense	11284			AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.1393G>C	19.37:g.50364761C>G	ENSP00000323511:p.Glu465Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Missense_Mutation	SNP	ENST00000322344.3	37	CCDS12783.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727617	0.48833	.	.	ENSG00000039650	ENST00000322344	T	0.45276	0.9	4.18	4.18	0.49190	.	0.314836	0.28504	N	0.015120	T	0.48370	0.1496	L	0.59436	1.845	0.58432	D	0.999997	P;D	0.52996	0.839;0.957	P;P	0.52159	0.599;0.691	T	0.40515	-0.9559	10	0.33940	T	0.23	-18.7202	12.1991	0.54315	0.0:1.0:0.0:0.0	.	426;465	Q9BUL2;Q96T60	.;PNKP_HUMAN	Q	465	ENSP00000323511:E465Q	ENSP00000323511:E465Q	E	-	1	0	PNKP	55056573	0.928000	0.31464	0.999000	0.59377	0.056000	0.15407	1.833000	0.39161	2.345000	0.79718	0.563000	0.77884	GAG		0.657	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465830.1		NM_007254	
PRSS37	136242	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	141540818	141540818	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr7:141540818G>A	ENST00000350549.3	-	1	403	c.32C>T	c.(31-33)gCt>gTt	p.A11V	PRSS37_ENST00000438520.1_Missense_Mutation_p.A11V	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	11					binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)	p.A11V(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						GTACATACCAGCGAGGACACC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											168.0	140.0	150.0					7																	141540818		2203	4300	6503	SO:0001583	missense	136242				CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.32C>T	7.37:g.141540818G>A	ENSP00000297767:p.Ala11Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPB5	Missense_Mutation	SNP	ENST00000350549.3	37	CCDS34764.1	.	.	.	.	.	.	.	.	.	.	G	8.663	0.900969	0.17760	.	.	ENSG00000165076	ENST00000350549;ENST00000438520	D;D	0.92495	-3.05;-3.05	4.68	2.9	0.33743	Peptidase S1/S6, chymotrypsin/Hap (1);	0.713363	0.13383	N	0.391996	D	0.84669	0.5523	N	0.22421	0.69	0.25531	N	0.987273	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.75903	-0.3153	10	0.62326	D	0.03	.	7.3014	0.26422	0.1891:0.0:0.8109:0.0	.	11;11	B7ZMK3;A4D1T9	.;PRS37_HUMAN	V	11	ENSP00000297767:A11V;ENSP00000414461:A11V	ENSP00000297767:A11V	A	-	2	0	PRSS37	141187287	0.999000	0.42202	0.995000	0.50966	0.028000	0.11728	1.381000	0.34362	0.906000	0.36621	0.655000	0.94253	GCT		0.473	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347763.1		NM_001008270	
RHEB	6009	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	151188050	151188050	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr7:151188050A>T	ENST00000262187.5	-	2	515	c.103T>A	c.(103-105)Tac>Aac	p.Y35N	RHEB_ENST00000496004.1_5'UTR|RHEB_ENST00000472642.1_5'UTR	NM_005614.3	NP_005605.1	Q15382	RHEB_HUMAN	Ras homolog enriched in brain	35					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|positive regulation of TOR signaling (GO:0032008)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.Y35N(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)	14			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		GTTGGATCGTAGGAGTCCACA	0.358																																					Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)												1	Substitution - Missense(1)	kidney(1)											103.0	100.0	101.0					7																	151188050		2203	4300	6503	SO:0001583	missense	6009			D78132	CCDS5927.1	7q36	2014-05-09	2003-07-14	2003-07-14	ENSG00000106615	ENSG00000106615			10011	protein-coding gene	gene with protein product		601293	"""Ras homolog enriched in brain 2"""	RHEB2		8661031	Standard	NM_005614		Approved		uc003wkh.1	Q15382	OTTHUMG00000157330	ENST00000262187.5:c.103T>A	7.37:g.151188050A>T	ENSP00000262187:p.Tyr35Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWN6|D3DX13|Q53Y56|Q99444	Missense_Mutation	SNP	ENST00000262187.5	37	CCDS5927.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.708820	0.89018	.	.	ENSG00000106615	ENST00000262187	T	0.81247	-1.47	5.42	5.42	0.78866	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91841	0.7418	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93659	0.6980	10	0.87932	D	0	.	13.3975	0.60863	1.0:0.0:0.0:0.0	.	35	Q15382	RHEB_HUMAN	N	35	ENSP00000262187:Y35N	ENSP00000262187:Y35N	Y	-	1	0	RHEB	150818983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.143000	0.89621	2.051000	0.60960	0.533000	0.62120	TAC		0.358	RHEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348468.2		NM_005614	
RNF130	55819	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	179382657	179382657	+	Silent	SNP	A	A	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr5:179382657A>G	ENST00000521389.1	-	9	1672	c.1257T>C	c.(1255-1257)ttT>ttC	p.F419F	RNF130_ENST00000520564.1_5'UTR|RNF130_ENST00000261947.4_3'UTR|RNF130_ENST00000522208.2_Intron	NM_018434.4	NP_060904.2			ring finger protein 130									p.F419F(1)		breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTTCTTCAAAACCATTCTA	0.338																																					GBM(24;432 554 38471 39699 51728)												1	Substitution - coding silent(1)	kidney(1)											65.0	68.0	67.0					5																	179382657		2202	4300	6502	SO:0001819	synonymous_variant	55819			AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000521389.1:c.1257T>C	5.37:g.179382657A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000521389.1	37	CCDS4451.1																																																																																				0.338	RNF130-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253499.3		NM_018434	
SH3RF3	344558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	110053415	110053415	+	Silent	SNP	G	G	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:110053415G>T	ENST00000309415.6	+	7	1641	c.1641G>T	c.(1639-1641)ggG>ggT	p.G547G		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	547							zinc ion binding (GO:0008270)	p.G547G(1)		endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						TGGCCAAAGGGATAACCACAA	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											45.0	61.0	55.0					2																	110053415		2106	4212	6318	SO:0001819	synonymous_variant	344558			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1641G>T	2.37:g.110053415G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0SDZ7|A8MPR1|Q8NDU1	Silent	SNP	ENST00000309415.6	37																																																																																					0.637	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001099289	
SLC13A3	64849	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	45239178	45239178	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr20:45239178T>C	ENST00000279027.4	-	3	466	c.448A>G	c.(448-450)Atg>Gtg	p.M150V	SLC13A3_ENST00000495082.1_Missense_Mutation_p.M103V|SLC13A3_ENST00000417157.2_Missense_Mutation_p.M103V|SLC13A3_ENST00000413164.2_Missense_Mutation_p.M150V|SLC13A3_ENST00000472148.1_Missense_Mutation_p.M103V|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000372121.1_Missense_Mutation_p.M150V|SLC13A3_ENST00000396360.1_Missense_Mutation_p.M103V|SLC13A3_ENST00000339636.3_Missense_Mutation_p.M150V|SLC13A3_ENST00000290317.5_Missense_Mutation_p.M103V	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	150					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.M150V(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GGAAGCATCATGGCAGTGGAG	0.547																																																	2	Substitution - Missense(2)	kidney(2)											195.0	177.0	183.0					20																	45239178		2203	4300	6503	SO:0001583	missense	64849			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.448A>G	20.37:g.45239178T>C	ENSP00000279027:p.Met150Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624257	0.66901	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121;ENST00000417157;ENST00000339636	T;T;T;T;T;T;T;T;T;T;T	0.03035	4.07;4.07;4.07;4.07;4.07;4.07;4.07;4.07;4.07;4.07;4.07	5.63	5.63	0.86233	.	0.039081	0.85682	D	0.000000	T	0.19485	0.0468	M	0.79258	2.445	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.991;0.999	D;D;D;D;D	0.85130	0.996;0.994;0.997;0.989;0.996	T	0.00149	-1.1987	10	0.87932	D	0	-35.3871	16.1297	0.81418	0.0:0.0:0.0:1.0	.	150;103;103;103;150	B4DIR8;Q8WWT9-3;F6WI18;C9J4A3;Q8WWT9	.;.;.;.;S13A3_HUMAN	V	103;103;150;103;150;103;103;113;150;103;150	ENSP00000290317:M103V;ENSP00000379648:M103V;ENSP00000279027:M150V;ENSP00000420177:M103V;ENSP00000415852:M150V;ENSP00000419621:M103V;ENSP00000417784:M103V;ENSP00000395095:M113V;ENSP00000361193:M150V;ENSP00000397955:M103V;ENSP00000344912:M150V	ENSP00000279027:M150V	M	-	1	0	SLC13A3	44672585	1.000000	0.71417	1.000000	0.80357	0.319000	0.28217	7.997000	0.88414	2.270000	0.75569	0.460000	0.39030	ATG		0.547	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2			
SMARCA4	6597	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	11143976	11143976	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:11143976C>G	ENST00000429416.3	+	27	3838	c.3557C>G	c.(3556-3558)gCg>gGg	p.A1186G	SMARCA4_ENST00000450717.3_Missense_Mutation_p.A1186G|SMARCA4_ENST00000358026.2_Missense_Mutation_p.A1186G|SMARCA4_ENST00000590574.1_Missense_Mutation_p.A1186G|SMARCA4_ENST00000444061.3_Missense_Mutation_p.A1186G|SMARCA4_ENST00000344626.4_Missense_Mutation_p.A1186G|SMARCA4_ENST00000589677.1_Missense_Mutation_p.A1186G|SMARCA4_ENST00000413806.3_Missense_Mutation_p.A1186G|SMARCA4_ENST00000541122.2_Missense_Mutation_p.A1186G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1186	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.A1186G(2)|p.A1186V(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GACCTGCAAGCGCAGGACCGA	0.622			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	4	Substitution - Missense(3)|Unknown(1)	kidney(2)|large_intestine(1)|lung(1)											46.0	47.0	47.0					19																	11143976		2203	4300	6503	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3557C>G	19.37:g.11143976C>G	ENSP00000395654:p.Ala1186Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302270	0.81136	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	4.74	4.74	0.60224	Helicase, C-terminal (3);	0.124305	0.53938	D	0.000056	D	0.93530	0.7935	H	0.99525	4.61	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;1.0;1.0;0.997	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.986;0.996;1.0;0.986	D	0.96338	0.9249	10	0.87932	D	0	-24.4926	16.7067	0.85374	0.0:1.0:0.0:0.0	.	1186;1186;1186;1186;1186;406;1186	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	G	1186;1186;1250;1186;1186;1186;1186;1186	ENSP00000395654:A1186G;ENSP00000350720:A1186G;ENSP00000343896:A1186G;ENSP00000445036:A1186G;ENSP00000392837:A1186G;ENSP00000397783:A1186G;ENSP00000414727:A1186G	ENSP00000343896:A1186G	A	+	2	0	SMARCA4	11004976	1.000000	0.71417	0.904000	0.35570	0.891000	0.51852	7.383000	0.79741	2.488000	0.83962	0.558000	0.71614	GCG		0.622	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2		NM_003072	
TAF1B	9014	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	10051037	10051037	+	Silent	SNP	C	C	T	rs369161786		TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:10051037C>T	ENST00000263663.5	+	10	1316	c.1128C>T	c.(1126-1128)ttC>ttT	p.F376F	TAF1B_ENST00000396242.3_Silent_p.F121F	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	376					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)	p.F376F(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGACAGTTTCGAGTGGTAAG	0.328																																																	1	Substitution - coding silent(1)	kidney(1)											174.0	135.0	148.0					2																	10051037		2203	4300	6503	SO:0001819	synonymous_variant	9014			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1128C>T	2.37:g.10051037C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DI42|F8WD72|Q15574|Q8WVC3	Silent	SNP	ENST00000263663.5	37	CCDS33143.1																																																																																				0.328	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2		NM_005680	
WAC	51322	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	28906668	28906668	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr10:28906668C>A	ENST00000354911.4	+	13	1990	c.1829C>A	c.(1828-1830)tCt>tAt	p.S610Y	WAC_ENST00000347934.4_Missense_Mutation_p.S507Y|WAC_ENST00000375664.4_Missense_Mutation_p.S565Y|WAC_ENST00000375646.1_Missense_Mutation_p.S458Y	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	610					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)	p.S610Y(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AATTTAAGATCTTTAGTCCGA	0.318																																																	1	Substitution - Missense(1)	kidney(1)											33.0	35.0	34.0					10																	28906668		2203	4298	6501	SO:0001583	missense	51322			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1829C>A	10.37:g.28906668C>A	ENSP00000346986:p.Ser610Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	37	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	C	32	5.113250	0.94339	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.75496	0.3857	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.995	D;D;D	0.83275	0.994;0.996;0.986	T	0.77011	-0.2746	10	0.87932	D	0	-10.7596	19.5403	0.95271	0.0:1.0:0.0:0.0	.	565;507;610	Q9BTA9-2;Q9BTA9-5;Q9BTA9	.;.;WAC_HUMAN	Y	565;458;507;610	ENSP00000364816:S565Y;ENSP00000364797:S458Y;ENSP00000311106:S507Y;ENSP00000346986:S610Y	ENSP00000311106:S507Y	S	+	2	0	WAC	28946674	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.619000	0.88677	0.655000	0.94253	TCT		0.318	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1		NM_100264	
ZNF407	55628	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	72346181	72346181	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr18:72346181A>C	ENST00000299687.5	+	1	3206	c.3206A>C	c.(3205-3207)aAg>aCg	p.K1069T	ZNF407_ENST00000582337.1_Missense_Mutation_p.K1069T|ZNF407_ENST00000577538.1_Missense_Mutation_p.K1069T|ZNF407_ENST00000309902.6_Missense_Mutation_p.K1069T	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1069					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K1069T(2)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GCAACAGAGAAGCACAAAATG	0.428																																																	2	Substitution - Missense(2)	kidney(2)											73.0	72.0	72.0					18																	72346181		2036	4206	6242	SO:0001583	missense	55628			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.3206A>C	18.37:g.72346181A>C	ENSP00000299687:p.Lys1069Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.311999	0.81358	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.27104	1.78;1.69	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.062073	0.64402	D	0.000008	T	0.42449	0.1203	L	0.32530	0.975	0.40056	D	0.975834	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.02037	-1.1225	10	0.33940	T	0.23	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	1069;1069;1069	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	T	1069	ENSP00000299687:K1069T;ENSP00000310359:K1069T	ENSP00000299687:K1069T	K	+	2	0	ZNF407	70475169	1.000000	0.71417	0.973000	0.42090	0.934000	0.57294	7.165000	0.77544	-0.633000	0.05545	-1.148000	0.01847	AAG		0.428	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1		NM_017757	
ZNF473	25888	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	50550275	50550275	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:50550275C>G	ENST00000595661.1	+	6	3070	c.2575C>G	c.(2575-2577)Cgc>Ggc	p.R859G	ZNF473_ENST00000270617.3_Missense_Mutation_p.R859G|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000391821.2_Missense_Mutation_p.R859G|ZNF473_ENST00000445728.3_Missense_Mutation_p.R847G			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	859					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R859G(1)|p.R859C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		GAGCCTCAGCCGCCATCAGCG	0.532											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - Missense(2)	kidney(1)|skin(1)											36.0	39.0	38.0					19																	50550275		2177	4277	6454	SO:0001583	missense	25888			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2575C>G	19.37:g.50550275C>G	ENSP00000472808:p.Arg859Gly	Somatic	970	WXS	Illumina HiSeq	Phase_I	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.715093	0.30413	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.30714	1.52;1.52;1.52	4.38	-3.87	0.04218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.191019	0.25047	N	0.033560	T	0.21590	0.0520	L	0.60845	1.875	0.09310	N	1	B	0.26602	0.154	B	0.16289	0.015	T	0.25257	-1.0137	10	0.21540	T	0.41	-7.3368	10.2893	0.43586	0.7169:0.1751:0.108:0.0	.	859	Q8WTR7	ZN473_HUMAN	G	859;859;847	ENSP00000270617:R859G;ENSP00000375697:R859G;ENSP00000388961:R847G	ENSP00000270617:R859G	R	+	1	0	ZNF473	55242087	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.903000	0.00703	-0.533000	0.06323	0.655000	0.94253	CGC		0.532	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1		XM_046390	
FKBP15	23307	broad.mit.edu	37	9	115973865	115973865	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr9:115973865A>C	ENST00000238256.3	-	2	178	c.61T>G	c.(61-63)Ttg>Gtg	p.L21V		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	21					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)		p.L21V(1)|p.L46V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						AGTGAGGCCAATCTGGCACTG	0.423																																																	2	Substitution - Missense(2)	kidney(2)											60.0	57.0	58.0					9																	115973865		1863	4114	5977	SO:0001583	missense	23307			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.61T>G	9.37:g.115973865A>C	ENSP00000238256:p.Leu21Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Missense_Mutation	SNP	ENST00000238256.3	37	CCDS48007.1	.	.	.	.	.	.	.	.	.	.	A	17.01	3.278531	0.59758	.	.	ENSG00000119321	ENST00000446284;ENST00000238256;ENST00000414250	T;T;T	0.72615	-0.43;-0.41;-0.67	5.23	2.92	0.33932	.	.	.	.	.	T	0.81983	0.4938	M	0.83603	2.65	0.35616	D	0.80901	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.994	T	0.83229	-0.0064	9	0.87932	D	0	-5.7272	6.586	0.22620	0.7306:0.0:0.2694:0.0	.	21;21;21	Q5T1M5-2;Q5T1M5-3;Q5T1M5	.;.;FKB15_HUMAN	V	46;21;46	ENSP00000416158:L46V;ENSP00000238256:L21V;ENSP00000415733:L46V	ENSP00000238256:L21V	L	-	1	2	FKBP15	115013686	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	0.873000	0.28052	0.345000	0.23873	0.460000	0.39030	TTG		0.423	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_015258	
KCNN1	3780	broad.mit.edu	37	19	18104303	18104303	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:18104303C>T	ENST00000222249.9	+	10	1631	c.1312C>T	c.(1312-1314)Cgg>Tgg	p.R438W		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	438	Calmodulin-binding. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.R455W(2)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CCACAGGCTCCGGAGTGTGAA	0.647																																																	2	Substitution - Missense(2)	kidney(2)											36.0	38.0	37.0					19																	18104303		1917	4121	6038	SO:0001583	missense	3780			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1312C>T	19.37:g.18104303C>T	ENSP00000476519:p.Arg438Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q5KR10|Q6DJU4	Missense_Mutation	SNP	ENST00000222249.9	37		.	.	.	.	.	.	.	.	.	.	C	18.57	3.652665	0.67472	.	.	ENSG00000105642	ENST00000222249	.	.	.	4.52	2.19	0.27852	Calmodulin-binding domain (2);	0.057260	0.64402	D	0.000002	T	0.78892	0.4355	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80888	-0.1181	9	0.87932	D	0	-24.5256	10.471	0.44638	0.4004:0.5996:0.0:0.0	.	438	Q92952	KCNN1_HUMAN	W	455	.	ENSP00000222249:R455W	R	+	1	2	KCNN1	17965303	0.192000	0.23301	0.998000	0.56505	0.866000	0.49608	0.082000	0.14847	0.850000	0.35239	0.462000	0.41574	CGG		0.647	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2		NM_002248	
MICALCL	84953	broad.mit.edu	37	11	12316358	12316358	+	Silent	SNP	T	T	C			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr11:12316358T>C	ENST00000256186.2	+	3	1671	c.1380T>C	c.(1378-1380)ccT>ccC	p.P460P		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	460	Poly-Pro.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.P460P(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		ctcctcctcctcctcctcctc	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											11.0	12.0	12.0					11																	12316358		1930	4076	6006	SO:0001819	synonymous_variant	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1380T>C	11.37:g.12316358T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	37	CCDS41620.1																																																																																				0.587	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1		NM_032867	
MIR515-1	574462	broad.mit.edu	37	19	54182305	54182305	+	RNA	SNP	C	C	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr19:54182305C>T	ENST00000384884.1	+	0	49				MIR519E_ENST00000385075.1_RNA	NR_030184.1|NR_030187.1				microRNA 515-1																		TGTCTGAAAGCAGAGTGCCTT	0.403																																																	0													64.0	61.0	62.0					19																	54182305		1568	3579	5147			574462					19q13.42	2011-09-12		2008-12-18	ENSG00000207616	ENSG00000207616		"""ncRNAs / Micro RNAs"""	32094	non-coding RNA	RNA, micro				MIRN515-1			Standard	NR_030184		Approved	hsa-mir-515-1	uc010ydz.2				19.37:g.54182305C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000384884.1	37																																																																																					0.403	MIR515-1-201	KNOWN	basic	miRNA	miRNA			NR_030184	
TET3	200424	broad.mit.edu	37	2	74328533	74328533	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4992-01A-01D-1462-08	TCGA-BP-4992-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	39df0e80-84d8-4ed8-9273-4743b14ee408	576f56ed-b2c7-4c79-ab0a-5bdc6b472431	g.chr2:74328533G>T	ENST00000409262.3	+	9	4213	c.4213G>T	c.(4213-4215)Ggg>Tgg	p.G1405W		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1405					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.G682W(1)|p.G1405W(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCTGGGGGCAGGGGATTTCAA	0.637																																																	2	Substitution - Missense(2)	kidney(2)											29.0	35.0	33.0					2																	74328533		1879	4104	5983	SO:0001583	missense	200424				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.4213G>T	2.37:g.74328533G>T	ENSP00000386869:p.Gly1405Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	G	8.327	0.825556	0.16749	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.12361	2.69	4.24	3.35	0.38373	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.369547	0.26079	N	0.026468	T	0.11793	0.0287	L	0.36672	1.1	0.09310	N	1	P	0.46020	0.871	B	0.43536	0.423	T	0.11542	-1.0583	10	0.62326	D	0.03	.	7.682	0.28520	0.097:0.1706:0.7324:0.0	.	1405	O43151	TET3_HUMAN	W	1405	ENSP00000386869:G1405W	ENSP00000233310:G1405W	G	+	1	0	TET3	74182041	0.992000	0.36948	0.867000	0.34043	0.537000	0.34900	2.216000	0.42871	2.382000	0.81193	0.655000	0.94253	GGG		0.637	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4			
