#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
A1CF	29974	hgsc.bcm.edu;ucsc.edu	37	10	52569667	52569667	+	Silent	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:52569667A>T	ENST00000373993.1	-	10	1664	c.1620T>A	c.(1618-1620)gcT>gcA	p.A540A	A1CF_ENST00000493415.1_5'Flank|A1CF_ENST00000282641.2_Silent_p.A540A|A1CF_ENST00000374001.2_Silent_p.A532A|A1CF_ENST00000373995.3_Silent_p.A540A|A1CF_ENST00000395489.2_Silent_p.A533A|ASAH2B_ENST00000483649.1_Intron|A1CF_ENST00000395495.1_Silent_p.A485A|A1CF_ENST00000373997.3_Silent_p.A532A			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	540					cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						GGAAagcagtagcagcagcag	0.512																																																	0													93.0	85.0	88.0					10																	52569667		2203	4300	6503	SO:0001819	synonymous_variant	29974			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1620T>A	10.37:g.52569667A>T		Somatic		WXS	SOLID	Phase_I	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Silent	SNP	ENST00000373993.1	37	CCDS7242.1																																																																																				0.512	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2		NM_014576	
ABLIM1	3983	hgsc.bcm.edu;ucsc.edu	37	10	116227940	116227940	+	Splice_Site	SNP	T	T	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:116227940T>G	ENST00000277895.5	-	11	1408	c.1311A>C	c.(1309-1311)gaA>gaC	p.E437D	ABLIM1_ENST00000369252.4_Splice_Site_p.E377D|ABLIM1_ENST00000392952.3_Splice_Site_p.E149D|ABLIM1_ENST00000369253.2_Splice_Site_p.E95D|ABLIM1_ENST00000369266.3_Splice_Site_p.E149D|ABLIM1_ENST00000533213.2_Splice_Site_p.E377D	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	437					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TGGTACTTACTTCTGCTGATG	0.343																																																	0													86.0	90.0	89.0					10																	116227940		2203	4300	6503	SO:0001630	splice_region_variant	3983			AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1311+1A>C	10.37:g.116227940T>G		Somatic		WXS	SOLID	Phase_I	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.44|16.44	3.124446|3.124446	0.56613|0.56613	.|.	.|.	ENSG00000099204|ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000392952;ENST00000369257;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369266;ENST00000369256;ENST00000369260;ENST00000277895;ENST00000369253;ENST00000440467;ENST00000428430|ENST00000392955	T;T;T;T;T;T|.	0.70516|.	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49|.	5.62|5.62	0.743|0.743	0.18347|0.18347	.|.	0.226230|.	0.45126|.	D|.	0.000397|.	T|T	0.49389|0.49389	0.1554|0.1554	M|M	0.62723|0.62723	1.935|1.935	0.30020|0.30020	N|N	0.814446|0.814446	B;D;P;P;P;P;B;P;P|.	0.55605|.	0.397;0.972;0.855;0.864;0.803;0.859;0.142;0.944;0.812|.	B;P;P;P;P;P;B;P;P|.	0.52267|.	0.155;0.621;0.615;0.515;0.468;0.535;0.046;0.621;0.694|.	T|T	0.50346|0.50346	-0.8839|-0.8839	9|5	.|.	.|.	.|.	.|.	8.3578|8.3578	0.32340|0.32340	0.0:0.2978:0.0:0.7022|0.0:0.2978:0.0:0.7022	.|.	361;121;377;405;437;149;405;361;95|.	B7Z4H1;B4DQA3;F8W8M4;A6NKJ2;O14639;O14639-5;B3KVH2;C9K0X4;O14639-4|.	.;.;.;.;ABLM1_HUMAN;.;.;.;.|.	D|T	437;377;149;95;405;377;465;361;149;361;361;465;149;102;121|346	ENSP00000358256:E377D;ENSP00000376679:E149D;ENSP00000433629:E377D;ENSP00000358270:E149D;ENSP00000414154:E102D;ENSP00000400934:E121D|.	.|.	E|K	-|-	3|2	2|0	ABLIM1|ABLIM1	116217930|116217930	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.251000|1.251000	0.32862|0.32862	0.093000|0.093000	0.17368|0.17368	0.529000|0.529000	0.55759|0.55759	GAA|AAG		0.343	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3			Missense_Mutation
ACE2	59272	hgsc.bcm.edu	37	X	15585872	15585872	+	Silent	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chrX:15585872T>A	ENST00000252519.3	-	15	2076	c.1974A>T	c.(1972-1974)gtA>gtT	p.V658V	ACE2_ENST00000471548.1_5'Flank|ACE2_ENST00000427411.1_Silent_p.V658V			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	658	Essential for cleavage by ADAM17.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	TCTGATTTTTTACTTTTAAAA	0.378																																																	0													95.0	91.0	92.0					X																	15585872		2203	4300	6503	SO:0001819	synonymous_variant	59272			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.1974A>T	X.37:g.15585872T>A		Somatic		WXS	SOLID	Phase_I	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Silent	SNP	ENST00000252519.3	37	CCDS14169.1																																																																																				0.378	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			
ADH1A	124	hgsc.bcm.edu	37	4	100205662	100205662	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr4:100205662T>A	ENST00000209668.2	-	5	574	c.461A>T	c.(460-462)gAt>gTt	p.D154V	RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'Flank	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	154					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TGCATTTTCATCCACCACTGT	0.517																																																	0													91.0	87.0	88.0					4																	100205662		2203	4300	6503	SO:0001583	missense	124			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.461A>T	4.37:g.100205662T>A	ENSP00000209668:p.Asp154Val	Somatic		WXS	SOLID	Phase_I	A8K3E3|Q17R68	Missense_Mutation	SNP	ENST00000209668.2	37	CCDS3648.1	.	.	.	.	.	.	.	.	.	.	T	5.104	0.204763	0.09704	.	.	ENSG00000187758	ENST00000209668	T	0.05199	3.48	2.59	2.59	0.31030	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.525025	0.20493	N	0.091241	T	0.19005	0.0456	M	0.74389	2.26	0.41537	D	0.988491	D	0.60575	0.988	D	0.66084	0.941	T	0.00865	-1.1535	10	0.49607	T	0.09	-14.4789	8.4397	0.32808	0.0:0.0:0.2153:0.7847	.	154	P07327	ADH1A_HUMAN	V	154	ENSP00000209668:D154V	ENSP00000209668:D154V	D	-	2	0	ADH1A	100424685	0.000000	0.05858	0.969000	0.41365	0.077000	0.17291	0.127000	0.15790	1.174000	0.42811	0.377000	0.23210	GAT		0.517	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1		NM_000667	
AKAP12	9590	hgsc.bcm.edu	37	6	151626918	151626918	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:151626918G>A	ENST00000253332.1	+	2	388	c.199G>A	c.(199-201)Ggc>Agc	p.G67S	AKAP12_ENST00000402676.2_Missense_Mutation_p.G67S			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	67					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CACCATCAATGGCGTAGCTGA	0.498																																					Melanoma(141;1616 1805 10049 24534 51979)												0													71.0	65.0	67.0					6																	151626918		2203	4300	6503	SO:0001583	missense	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.199G>A	6.37:g.151626918G>A	ENSP00000253332:p.Gly67Ser	Somatic		WXS	SOLID	Phase_I	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	ENST00000253332.1	37	CCDS5229.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186711	0.78789	.	.	ENSG00000131016	ENST00000402676;ENST00000253332	T;T	0.12569	2.67;2.67	4.57	3.7	0.42460	.	0.163773	0.29451	N	0.012103	T	0.07007	0.0178	L	0.50333	1.59	0.35807	D	0.82357	P	0.46859	0.885	P	0.46026	0.501	T	0.26916	-1.0089	10	0.23891	T	0.37	.	8.9342	0.35688	0.1049:0.0:0.8951:0.0	.	67	Q02952	AKA12_HUMAN	S	67	ENSP00000384537:G67S;ENSP00000253332:G67S	ENSP00000253332:G67S	G	+	1	0	AKAP12	151668611	0.849000	0.29639	0.398000	0.26321	0.474000	0.32979	1.901000	0.39838	1.065000	0.40693	0.561000	0.74099	GGC		0.498	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			
ANKRD50	57182	hgsc.bcm.edu;ucsc.edu	37	4	125590305	125590305	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr4:125590305A>T	ENST00000504087.1	-	4	5164	c.4127T>A	c.(4126-4128)cTt>cAt	p.L1376H	ANKRD50_ENST00000515641.1_Missense_Mutation_p.L1197H	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1376										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						AACCCTACCAAGAAAAACCTG	0.418																																																	0													208.0	171.0	184.0					4																	125590305		2203	4300	6503	SO:0001583	missense	57182			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.4127T>A	4.37:g.125590305A>T	ENSP00000425658:p.Leu1376His	Somatic		WXS	SOLID	Phase_I	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101299	0.76983	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.71934	-0.61;-0.56	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.68933	0.3055	N	0.24115	0.695	0.51012	D	0.999902	D	0.67145	0.996	P	0.54372	0.75	T	0.71174	-0.4670	10	0.45353	T	0.12	.	15.5138	0.75806	1.0:0.0:0.0:0.0	.	1376	Q9ULJ7	ANR50_HUMAN	H	1376;1197	ENSP00000425658:L1376H;ENSP00000425355:L1197H	ENSP00000425658:L1376H	L	-	2	0	ANKRD50	125809755	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	8.541000	0.90644	2.250000	0.74265	0.454000	0.30748	CTT		0.418	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1		NM_020337	
APLP1	333	hgsc.bcm.edu	37	19	36370071	36370071	+	Silent	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:36370071C>A	ENST00000221891.4	+	16	2001	c.1809C>A	c.(1807-1809)ctC>ctA	p.L603L	RN7SL402P_ENST00000465059.1_RNA|APLP1_ENST00000537454.2_Silent_p.L563L|APLP1_ENST00000586861.1_Silent_p.L596L	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	602					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.L603L(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCATGCTGCTCCTGCGCAGGA	0.647																																																	1	Substitution - coding silent(1)	ovary(1)											58.0	59.0	59.0					19																	36370071		2203	4300	6503	SO:0001819	synonymous_variant	333			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1809C>A	19.37:g.36370071C>A		Somatic		WXS	SOLID	Phase_I	O00113|Q96A92	Silent	SNP	ENST00000221891.4	37	CCDS32997.1																																																																																				0.647	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1		NM_001024807	
ATP1A1	476	hgsc.bcm.edu	37	1	116943758	116943758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:116943758G>T	ENST00000295598.5	+	20	2977	c.2725G>T	c.(2725-2727)Gag>Tag	p.E909*	ATP1A1_ENST00000537345.1_Nonsense_Mutation_p.E909*|ATP1A1_ENST00000369496.4_Nonsense_Mutation_p.E878*	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	909					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TCAGACCTATGAGCAGAGGAA	0.542																																																	0													76.0	66.0	69.0					1																	116943758		2203	4300	6503	SO:0001587	stop_gained	476			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2725G>T	1.37:g.116943758G>T	ENSP00000295598:p.Glu909*	Somatic		WXS	SOLID	Phase_I	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Nonsense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.820054|11.820054	0.99606|0.99606	.|.	.|.	ENSG00000163399|ENSG00000163399	ENST00000295598;ENST00000445896;ENST00000537345;ENST00000369496;ENST00000440951|ENST00000339159	.|.	.|.	.|.	5.1|5.1	4.16|4.16	0.48862|0.48862	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.48840	.|0.1522	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.36138	.|-0.9760	.|5	0.44086|0.24483	T|T	0.13|0.36	.|.	13.8306|13.8306	0.63377|0.63377	0.0764:0.0:0.9236:0.0|0.0764:0.0:0.9236:0.0	.|.	.|.	.|.	.|.	X|I	909;78;909;878;76|640	.|.	ENSP00000295598:E909X|ENSP00000342827:M640I	E|M	+|+	1|3	0|0	ATP1A1|ATP1A1	116745281|116745281	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.964000|0.964000	0.63967|0.63967	7.813000|7.813000	0.86123|0.86123	2.640000|2.640000	0.89533|0.89533	0.591000|0.591000	0.81541|0.81541	GAG|ATG		0.542	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5		NM_001160233	
VRTN	55237	hgsc.bcm.edu	37	14	74825562	74825562	+	Silent	SNP	C	C	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr14:74825562C>G	ENST00000256362.4	+	2	2317	c.2076C>G	c.(2074-2076)gcC>gcG	p.A692A		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	692					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GGAAGCGAGCCCTCTATGACG	0.577																																																	0													51.0	49.0	50.0					14																	74825562		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.2076C>G	14.37:g.74825562C>G		Somatic		WXS	SOLID	Phase_I	Q9NVC7	Silent	SNP	ENST00000256362.4	37	CCDS9830.1																																																																																				0.577	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1		NM_018228	
C16orf70	80262	hgsc.bcm.edu	37	16	67179492	67179492	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr16:67179492T>G	ENST00000219139.3	+	14	1258	c.1070T>G	c.(1069-1071)cTc>cGc	p.L357R	C16orf70_ENST00000569600.1_Missense_Mutation_p.L357R	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	357										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ATCCAGGAGCTCCTGGGCCAC	0.592																																																	0													80.0	67.0	71.0					16																	67179492		2199	4300	6499	SO:0001583	missense	80262			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.1070T>G	16.37:g.67179492T>G	ENSP00000219139:p.Leu357Arg	Somatic		WXS	SOLID	Phase_I	Q9HA86	Missense_Mutation	SNP	ENST00000219139.3	37	CCDS10828.1	.	.	.	.	.	.	.	.	.	.	T	14.61	2.586616	0.46110	.	.	ENSG00000125149	ENST00000219139	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.37128	0.0992	N	0.08118	0	0.58432	D	0.999996	B	0.09022	0.002	B	0.12837	0.008	T	0.25502	-1.0130	9	0.15952	T	0.53	-0.0874	14.8671	0.70425	0.0:0.0:0.0:1.0	.	357	Q9BSU1	CP070_HUMAN	R	357	.	ENSP00000219139:L357R	L	+	2	0	C16orf70	65736993	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.529000	0.81952	2.192000	0.70111	0.477000	0.44152	CTC		0.592	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2		NM_025187	
C2orf16	84226	hgsc.bcm.edu;ucsc.edu	37	2	27801317	27801317	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:27801317T>G	ENST00000408964.2	+	1	1929	c.1878T>G	c.(1876-1878)atT>atG	p.I626M		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	626						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AATCAGGAATTGAAGCAATAA	0.433																																																	0													75.0	70.0	72.0					2																	27801317		1874	4111	5985	SO:0001583	missense	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.1878T>G	2.37:g.27801317T>G	ENSP00000386190:p.Ile626Met	Somatic		WXS	SOLID	Phase_I	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.345358	0.24426	.	.	ENSG00000221843	ENST00000408964	T	0.06371	3.31	4.42	1.92	0.25849	.	.	.	.	.	T	0.08133	0.0203	L	0.27053	0.805	0.09310	N	1	D	0.57571	0.98	P	0.53722	0.733	T	0.29243	-1.0018	9	0.72032	D	0.01	.	5.1333	0.14922	0.1812:0.0:0.1892:0.6296	.	626	Q68DN1	CB016_HUMAN	M	626	ENSP00000386190:I626M	ENSP00000386190:I626M	I	+	3	3	C2orf16	27654821	0.000000	0.05858	0.004000	0.12327	0.127000	0.20565	-0.024000	0.12435	0.279000	0.22186	0.459000	0.35465	ATT		0.433	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1		NM_032266	
CEP85L	387119	hgsc.bcm.edu	37	6	118801654	118801654	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:118801654A>G	ENST00000368491.3	-	9	2389	c.1768T>C	c.(1768-1770)Tgc>Cgc	p.C590R	CEP85L_ENST00000368488.5_Missense_Mutation_p.C593R	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	590						centrosome (GO:0005813)|cytoplasm (GO:0005737)											TCTTCAAGGCATCTTTCTACT	0.323																																																	0													172.0	155.0	160.0					6																	118801654		1835	4078	5913	SO:0001583	missense	0			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1768T>C	6.37:g.118801654A>G	ENSP00000357477:p.Cys590Arg	Somatic		WXS	SOLID	Phase_I	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809382	0.70797	.	.	ENSG00000111860	ENST00000368491;ENST00000368488	T;T	0.09445	2.98;2.98	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00920	-1.1514	10	0.34782	T	0.22	-7.2703	15.1844	0.72989	1.0:0.0:0.0:0.0	.	590	Q5SZL2	CF204_HUMAN	R	590;593	ENSP00000357477:C590R;ENSP00000357474:C593R	ENSP00000357474:C593R	C	-	1	0	C6orf204	118908347	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.864000	0.75494	2.231000	0.72958	0.533000	0.62120	TGC		0.323	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2		NM_001042475	
C7orf71	285941	hgsc.bcm.edu;ucsc.edu	37	7	26678853	26678853	+	Silent	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr7:26678853A>G	ENST00000409974.3	+	2	806	c.90A>G	c.(88-90)acA>acG	p.T30T		NM_001145531.1	NP_001139003.1	A4D174	CG071_HUMAN	chromosome 7 open reading frame 71	30																	actcagagacaagacacatga	0.537																																																	0													68.0	83.0	79.0					7																	26678853		692	1591	2283	SO:0001819	synonymous_variant	285941				CCDS47565.1	7p15.2	2009-09-11			ENSG00000222004	ENSG00000222004			22364	protein-coding gene	gene with protein product							Standard	NM_001145531		Approved		uc003syb.3	A4D174	OTTHUMG00000152860	ENST00000409974.3:c.90A>G	7.37:g.26678853A>G		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000409974.3	37	CCDS47565.1																																																																																				0.537	C7orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328272.1		NM_001145531	
C9orf91	203197	hgsc.bcm.edu	37	9	117396073	117396073	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr9:117396073T>A	ENST00000288502.4	+	6	937	c.500T>A	c.(499-501)cTg>cAg	p.L167Q	C9orf91_ENST00000374049.4_Missense_Mutation_p.L168Q			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	167						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						GACCTGAGGCTGGCAGCTGCC	0.592																																																	0													85.0	74.0	78.0					9																	117396073		2203	4300	6503	SO:0001583	missense	203197			BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.500T>A	9.37:g.117396073T>A	ENSP00000288502:p.Leu167Gln	Somatic		WXS	SOLID	Phase_I	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Missense_Mutation	SNP	ENST00000288502.4	37	CCDS6808.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.413213	0.83449	.	.	ENSG00000157693	ENST00000374049;ENST00000288502	.	.	.	5.83	5.83	0.93111	.	0.074783	0.53938	D	0.000045	T	0.71247	0.3317	L	0.59436	1.845	0.44539	D	0.997494	D;D	0.76494	0.999;0.999	D;D	0.74023	0.974;0.982	T	0.74097	-0.3775	9	0.87932	D	0	-33.6906	12.5943	0.56459	0.0:0.0:0.0:1.0	.	146;167	Q5VZI3-2;Q5VZI3	.;CI091_HUMAN	Q	168;167	.	ENSP00000288502:L167Q	L	+	2	0	C9orf91	116435894	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	4.328000	0.59253	2.231000	0.72958	0.459000	0.35465	CTG		0.592	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053780.1		NM_153045	
CABIN1	23523	hgsc.bcm.edu;ucsc.edu	37	22	24567705	24567705	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr22:24567705C>A	ENST00000398319.2	+	34	6167	c.5782C>A	c.(5782-5784)Cca>Aca	p.P1928T	CABIN1_ENST00000337989.7_Missense_Mutation_p.P353T|CABIN1_ENST00000485008.1_3'UTR|CABIN1_ENST00000405822.2_Missense_Mutation_p.P1849T|CABIN1_ENST00000263119.5_Missense_Mutation_p.P1928T	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1928					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCCCACCACTCCAAAGCACCC	0.637																																																	0													119.0	129.0	126.0					22																	24567705		2203	4300	6503	SO:0001583	missense	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.5782C>A	22.37:g.24567705C>A	ENSP00000381364:p.Pro1928Thr	Somatic		WXS	SOLID	Phase_I	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287754	0.80803	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	4.9	4.9	0.64082	.	0.057551	0.64402	N	0.000001	T	0.36193	0.0958	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.04781	-1.0927	10	0.51188	T	0.08	.	16.4399	0.83896	0.0:1.0:0.0:0.0	.	1849;1928	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	T	1928;1849;1928;353;352	ENSP00000263119:P1928T;ENSP00000384694:P1849T;ENSP00000381364:P1928T;ENSP00000336991:P353T	ENSP00000263119:P1928T	P	+	1	0	CABIN1	22897705	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.412000	0.66392	2.664000	0.90586	0.650000	0.86243	CCA		0.637	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2		NM_012295	
CDH15	1013	hgsc.bcm.edu	37	16	89246670	89246670	+	Silent	SNP	T	T	C	rs59865771	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr16:89246670T>C	ENST00000289746.2	+	3	329	c.264T>C	c.(262-264)gaT>gaC	p.D88D	CDH15_ENST00000521087.1_Intron	NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	88	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGGCGTGGATGAGGAGCCCC	0.602													C|||	2158	0.430911	0.3003	0.3141	5008	,	,		19591	0.8224		0.2813	False		,,,				2504	0.4407																0								C		1268,3124	675.8+/-403.1	177,914,1105	47.0	43.0	45.0		264	-6.6	0.7	16	dbSNP_129	45	2213,6387	690.5+/-404.4	303,1607,2390	no	coding-synonymous	CDH15	NM_004933.2		480,2521,3495	CC,CT,TT		25.7326,28.8707,26.7934		88/815	89246670	3481,9511	2196	4300	6496	SO:0001819	synonymous_variant	1013			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.264T>C	16.37:g.89246670T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000289746.2	37	CCDS10976.1																																																																																				0.602	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1		NM_004933	
CDH26	60437	hgsc.bcm.edu;ucsc.edu	37	20	58558000	58558000	+	Missense_Mutation	SNP	G	G	A	rs138324710	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:58558000G>A	ENST00000244047.5	+	5	727	c.416G>A	c.(415-417)cGc>cAc	p.R139H	CDH26_ENST00000348616.4_Missense_Mutation_p.R139H			Q8IXH8	CAD26_HUMAN	cadherin 26	139	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R139H(2)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GTTGTGGAGCGCTCAACAGGA	0.373													G|||	24	0.00479233	0.0	0.0231	5008	,	,		19522	0.0069		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	large_intestine(2)						G	HIS/ARG	5,4401	9.9+/-24.2	0,5,2198	161.0	162.0	162.0		416	-0.7	0.0	20	dbSNP_134	162	0,8600		0,0,4300	yes	missense	CDH26	NM_177980.2	29	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	probably-damaging	139/833	58558000	5,13001	2203	4300	6503	SO:0001583	missense	60437			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.416G>A	20.37:g.58558000G>A	ENSP00000244047:p.Arg139His	Somatic		WXS	SOLID	Phase_I	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		18	0.008241758241758242	0	0.0	12	0.03314917127071823	6	0.01048951048951049	0	0.0	G	11.49	1.654657	0.29425	0.001135	0.0	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.61392	0.11;0.11	4.86	-0.667	0.11395	.	0.515137	0.17680	N	0.165645	T	0.20659	0.0497	M	0.65320	2	0.09310	N	1	P	0.40431	0.717	B	0.36418	0.224	T	0.29488	-1.0010	10	0.72032	D	0.01	.	2.1801	0.03872	0.2128:0.1345:0.5147:0.138	.	139	Q8IXH8-4	.	H	139	ENSP00000244047:R139H;ENSP00000339390:R139H	ENSP00000244047:R139H	R	+	2	0	CDH26	57991395	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.182000	0.09726	-0.126000	0.11682	-0.782000	0.03352	CGC		0.373	CDH26-201	KNOWN	basic	protein_coding	protein_coding			NM_177980	
CEACAM4	1089	hgsc.bcm.edu;ucsc.edu	37	19	42132312	42132312	+	Silent	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:42132312G>A	ENST00000221954.2	-	2	197	c.87C>T	c.(85-87)caC>caT	p.H29H	CEACAM4_ENST00000600925.1_Silent_p.H29H	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	29			H -> D (in dbSNP:rs1126454). {ECO:0000269|PubMed:2050678}.			integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						TGGTGGGCGGGTGCCAGAAGG	0.512																																																	0													60.0	63.0	62.0					19																	42132312		2203	4300	6503	SO:0001819	synonymous_variant	1089			D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.87C>T	19.37:g.42132312G>A		Somatic		WXS	SOLID	Phase_I	Q03715|Q7LDZ7	Silent	SNP	ENST00000221954.2	37	CCDS33033.1																																																																																				0.512	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321148.1		NM_001817	
CLCN6	1185	hgsc.bcm.edu;ucsc.edu	37	1	11896157	11896157	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:11896157G>A	ENST00000346436.6	+	18	1979	c.1927G>A	c.(1927-1929)Gag>Aag	p.E643K	CLCN6_ENST00000376487.3_Missense_Mutation_p.E621K|CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376496.3_Missense_Mutation_p.E643K	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	643	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCGGTAACGAGAAGGAGTT	0.557																																																	0													118.0	96.0	103.0					1																	11896157		2203	4300	6503	SO:0001583	missense	1185			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1927G>A	1.37:g.11896157G>A	ENSP00000234488:p.Glu643Lys	Somatic		WXS	SOLID	Phase_I	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289501	0.80914	.	.	ENSG00000011021	ENST00000346436;ENST00000376487;ENST00000376496	D;D;D	0.91521	-2.85;-2.84;-2.86	5.71	5.71	0.89125	Cystathionine beta-synthase, core (2);	0.000000	0.85682	D	0.000000	T	0.81083	0.4749	N	0.14661	0.345	0.80722	D	1	P;P	0.45348	0.826;0.856	B;B	0.32805	0.145;0.153	T	0.81611	-0.0854	10	0.27082	T	0.32	-33.203	18.8314	0.92141	0.0:0.0:1.0:0.0	.	621;643	F8W9R3;P51797	.;CLCN6_HUMAN	K	643;621;643	ENSP00000234488:E643K;ENSP00000365670:E621K;ENSP00000365679:E643K	ENSP00000234488:E643K	E	+	1	0	CLCN6	11818744	1.000000	0.71417	0.985000	0.45067	0.981000	0.71138	9.476000	0.97823	2.700000	0.92200	0.462000	0.41574	GAG		0.557	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2		NM_001286	
CLN5	1203	hgsc.bcm.edu;ucsc.edu	37	13	77574785	77574785	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr13:77574785A>C	ENST00000377453.3	+	4	2197	c.905A>C	c.(904-906)gAa>gCa	p.E302A	FBXL3_ENST00000477982.1_5'Flank	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	253					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		AAGAACATAGAAACCAACTAT	0.388																																																	0													113.0	116.0	115.0					13																	77574785		2203	4300	6503	SO:0001583	missense	1203				CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.905A>C	13.37:g.77574785A>C	ENSP00000366673:p.Glu302Ala	Somatic		WXS	SOLID	Phase_I	B3KQK7	Missense_Mutation	SNP	ENST00000377453.3	37	CCDS9456.1	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296270	0.40594	.	.	ENSG00000102805	ENST00000377453;ENST00000541907;ENST00000535238	D	0.87966	-2.32	5.95	5.95	0.96441	.	0.143201	0.64402	D	0.000005	D	0.85788	0.5778	M	0.63428	1.95	0.80722	D	1	P	0.47910	0.902	B	0.40864	0.342	D	0.85445	0.1157	10	0.34782	T	0.22	-28.3409	16.4323	0.83853	1.0:0.0:0.0:0.0	.	253	O75503	CLN5_HUMAN	A	302;253;168	ENSP00000366673:E302A	ENSP00000366673:E302A	E	+	2	0	CLN5	76472786	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	3.383000	0.52471	2.281000	0.76405	0.528000	0.53228	GAA		0.388	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1		NM_006493	
CMYA5	202333	hgsc.bcm.edu	37	5	79030663	79030663	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr5:79030663C>G	ENST00000446378.2	+	2	6106	c.6075C>G	c.(6073-6075)aaC>aaG	p.N2025K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2025					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGAAAGCAAACACAGAGCTTT	0.423																																																	0													53.0	52.0	52.0					5																	79030663		1839	4091	5930	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6075C>G	5.37:g.79030663C>G	ENSP00000394770:p.Asn2025Lys	Somatic		WXS	SOLID	Phase_I	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	8.573	0.880536	0.17467	.	.	ENSG00000164309	ENST00000446378	T	0.41758	0.99	5.83	2.92	0.33932	.	0.992344	0.08165	N	0.987879	T	0.29458	0.0734	L	0.29908	0.895	0.09310	N	1	B	0.21381	0.055	B	0.12837	0.008	T	0.26189	-1.0110	10	0.41790	T	0.15	.	4.7681	0.13142	0.2122:0.6196:0.0:0.1682	.	2025	Q8N3K9	CMYA5_HUMAN	K	2025	ENSP00000394770:N2025K	ENSP00000394770:N2025K	N	+	3	2	CMYA5	79066419	0.000000	0.05858	0.007000	0.13788	0.574000	0.36063	0.211000	0.17474	0.273000	0.22049	0.555000	0.69702	AAC		0.423	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1		NM_153610	
CNST	163882	hgsc.bcm.edu;ucsc.edu	37	1	246810937	246810938	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:246810937_246810938insA	ENST00000366513.4	+	9	1703_1704	c.1434_1435insA	c.(1435-1437)aatfs	p.N479fs	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Frame_Shift_Ins_p.N479fs	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	479					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						AACTTGAGAACAATGAATTAAA	0.485																																																	0																																										SO:0001589	frameshift_variant	163882			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1436dupA	1.37:g.246810939_246810939dupA	ENSP00000355470:p.Asn479fs	Somatic		WXS	SOLID	Phase_I	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Frame_Shift_Ins	INS	ENST00000366513.4	37	CCDS1628.1																																																																																				0.485	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1		NM_152609	
COL19A1	1310	hgsc.bcm.edu	37	6	70639451	70639451	+	Silent	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:70639451C>A	ENST00000322773.4	+	6	627	c.525C>A	c.(523-525)ggC>ggA	p.G175G		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	175	Laminin G-like.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						ACAAACTTGGCATTAGTATAC	0.403																																																	0													125.0	118.0	121.0					6																	70639451		2203	4300	6503	SO:0001819	synonymous_variant	1310				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.525C>A	6.37:g.70639451C>A		Somatic		WXS	SOLID	Phase_I	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	37	CCDS4970.1																																																																																				0.403	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			
COL4A3BP	10087	hgsc.bcm.edu	37	5	74685443	74685443	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr5:74685443A>C	ENST00000405807.4	-	12	1679	c.1258T>G	c.(1258-1260)Ttg>Gtg	p.L420V	COL4A3BP_ENST00000261415.7_Missense_Mutation_p.L394V|COL4A3BP_ENST00000380494.5_Missense_Mutation_p.L548V	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	420	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TCTACAACCAACTGCCAATTG	0.413																																																	0													126.0	116.0	120.0					5																	74685443		2203	4300	6503	SO:0001583	missense	10087			AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.1258T>G	5.37:g.74685443A>C	ENSP00000383996:p.Leu420Val	Somatic		WXS	SOLID	Phase_I	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Missense_Mutation	SNP	ENST00000405807.4	37	CCDS4028.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.887437	0.52014	.	.	ENSG00000113163	ENST00000357457;ENST00000405807;ENST00000380494;ENST00000261415	T;T;T	0.80033	-1.33;-1.33;-1.33	5.14	1.06	0.20224	Lipid-binding START (3);START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77611	0.4156	M	0.63843	1.955	0.49483	D	0.999794	P;P;P	0.49862	0.929;0.897;0.912	B;P;B	0.44623	0.385;0.455;0.334	T	0.75725	-0.3217	10	0.66056	D	0.02	-4.5168	10.4415	0.44469	0.3737:0.0:0.6263:0.0	.	420;548;394	Q9Y5P4;Q9Y5P4-3;Q9Y5P4-2	C43BP_HUMAN;.;.	V	25;420;548;394	ENSP00000383996:L420V;ENSP00000369862:L548V;ENSP00000261415:L394V	ENSP00000261415:L394V	L	-	1	2	COL4A3BP	74721199	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	2.378000	0.44309	-0.000000	0.14550	0.460000	0.39030	TTG		0.413	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2		NM_005713	
DDX25	29118	hgsc.bcm.edu;ucsc.edu	37	11	125791252	125791252	+	Silent	SNP	C	C	A	rs201491873		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:125791252C>A	ENST00000263576.6	+	11	1523	c.1368C>A	c.(1366-1368)ctC>ctA	p.L456L	DDX25_ENST00000525943.1_3'UTR|RP11-680F20.9_ENST00000533033.2_RNA	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	456	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TGCCCTCGCTCATGAAAATCC	0.522																																																	0													48.0	47.0	47.0					11																	125791252		1953	4152	6105	SO:0001819	synonymous_variant	29118			AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.1368C>A	11.37:g.125791252C>A		Somatic		WXS	SOLID	Phase_I	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Silent	SNP	ENST00000263576.6	37	CCDS44766.1																																																																																				0.522	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3		NM_013264	
DLG5	9231	hgsc.bcm.edu;ucsc.edu	37	10	79556277	79556277	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:79556277G>T	ENST00000372391.2	-	28	5245	c.5240C>A	c.(5239-5241)cCt>cAt	p.P1747H	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Missense_Mutation_p.P1407H	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1747	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GTCCAGCAAAGGCCCCAGAAT	0.607																																																	0													114.0	95.0	101.0					10																	79556277		2203	4300	6503	SO:0001583	missense	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.5240C>A	10.37:g.79556277G>T	ENSP00000361467:p.Pro1747His	Somatic		WXS	SOLID	Phase_I	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926113	0.92319	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.17854	2.25;2.25;2.25	5.86	5.86	0.93980	Guanylate kinase/L-type calcium channel (1);	0.000000	0.38605	N	0.001621	T	0.52306	0.1726	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.58493	-0.7627	10	0.87932	D	0	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	1747;1407	Q8TDM6;Q8TDM6-2	DLG5_HUMAN;.	H	1747;708;1407	ENSP00000361467:P1747H;ENSP00000394797:P708H;ENSP00000361464:P1407H	ENSP00000361464:P1407H	P	-	2	0	DLG5	79226283	1.000000	0.71417	0.945000	0.38365	0.923000	0.55619	9.476000	0.97823	2.775000	0.95449	0.655000	0.94253	CCT		0.607	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			
DMKN	93099	hgsc.bcm.edu;ucsc.edu	37	19	36002673	36002673	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:36002673T>A	ENST00000339686.3	-	4	903	c.727A>T	c.(727-729)Aac>Tac	p.N243Y	DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.N243Y|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000429837.1_Missense_Mutation_p.N243Y|DMKN_ENST00000424570.2_Missense_Mutation_p.N243Y|DMKN_ENST00000440396.1_Missense_Mutation_p.N243Y|DMKN_ENST00000419602.1_Missense_Mutation_p.N243Y|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.N243Y|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.N243Y	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	243	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			ACCCCAGAGTTGCTGGAGCCT	0.582																																																	0													111.0	103.0	106.0					19																	36002673		2203	4300	6503	SO:0001583	missense	93099			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.727A>T	19.37:g.36002673T>A	ENSP00000342012:p.Asn243Tyr	Somatic		WXS	SOLID	Phase_I	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	T	12.49	1.954369	0.34471	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	4.46	-0.434	0.12283	.	0.848027	0.10073	N	0.719424	T	0.41834	0.1176	M	0.63843	1.955	0.09310	N	1	P;P;P;P;P;P;P	0.49635	0.926;0.926;0.926;0.926;0.815;0.815;0.815	P;P;P;P;B;B;B	0.47528	0.549;0.549;0.549;0.549;0.329;0.329;0.329	T	0.31696	-0.9934	10	0.54805	T	0.06	-0.7289	4.6862	0.12758	0.0:0.1987:0.4071:0.3942	.	243;243;243;243;243;243;243	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	Y	243	ENSP00000342012:N243Y;ENSP00000405503:N243Y;ENSP00000391036:N243Y;ENSP00000394908:N243Y;ENSP00000415277:N243Y;ENSP00000414743:N243Y;ENSP00000388404:N243Y;ENSP00000409513:N243Y	ENSP00000342012:N243Y	N	-	1	0	DMKN	40694513	0.000000	0.05858	0.016000	0.15963	0.397000	0.30659	-1.485000	0.02314	-0.037000	0.13646	0.459000	0.35465	AAC		0.582	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2		NM_033317	
DUSP27	92235	hgsc.bcm.edu;ucsc.edu	37	1	167097707	167097707	+	Silent	SNP	A	A	T	rs138064659		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:167097707A>T	ENST00000361200.2	+	6	3505	c.3339A>T	c.(3337-3339)gcA>gcT	p.A1113A	DUSP27_ENST00000271385.5_Silent_p.A1113A|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Silent_p.A1113A			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1113					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GGAGGTTTGCATCTGGACGGC	0.512																																																	0													47.0	42.0	44.0					1																	167097707		2203	4300	6503	SO:0001819	synonymous_variant	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3339A>T	1.37:g.167097707A>T		Somatic		WXS	SOLID	Phase_I	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1																																																																																				0.512	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1		NM_001080426	
ELFN2	114794	hgsc.bcm.edu	37	22	37769178	37769178	+	Silent	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr22:37769178G>T	ENST00000402918.2	-	3	3182	c.2397C>A	c.(2395-2397)gcC>gcA	p.A799A	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.8_ENST00000609322.1_RNA|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	799					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					CCTCGTCCTTGGCGAACTGGA	0.632																																																	0													98.0	88.0	91.0					22																	37769178		2203	4300	6503	SO:0001819	synonymous_variant	114794			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.2397C>A	22.37:g.37769178G>T		Somatic		WXS	SOLID	Phase_I	Q96PY3	Silent	SNP	ENST00000402918.2	37	CCDS33642.1																																																																																				0.632	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2		NM_052906	
ENOX1	55068	hgsc.bcm.edu;ucsc.edu	37	13	43934148	43934148	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr13:43934148G>T	ENST00000261488.6	-	7	1005	c.428C>A	c.(427-429)aCc>aAc	p.T143N	ENOX1_ENST00000540032.1_5'UTR|ENOX1_ENST00000412891.1_Missense_Mutation_p.T143N|ENOX1_ENST00000482207.1_5'UTR	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	143	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		GACAAACACGGTCTTACACCC	0.393																																																	0													76.0	72.0	74.0					13																	43934148		2203	4300	6503	SO:0001583	missense	55068			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.428C>A	13.37:g.43934148G>T	ENSP00000261488:p.Thr143Asn	Somatic		WXS	SOLID	Phase_I	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661320	0.88154	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	T;T	0.76839	-1.05;-1.05	5.89	5.89	0.94794	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	D	0.90266	0.6956	M	0.87456	2.885	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.90924	0.4785	10	0.87932	D	0	-5.0936	20.248	0.98401	0.0:0.0:1.0:0.0	.	143	Q8TC92	ENOX1_HUMAN	N	143	ENSP00000261488:T143N;ENSP00000415054:T143N	ENSP00000261488:T143N	T	-	2	0	ENOX1	42832148	1.000000	0.71417	0.982000	0.44146	0.982000	0.71751	9.414000	0.97362	2.790000	0.95986	0.655000	0.94253	ACC		0.393	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2		NM_017993	
ENTPD8	377841	hgsc.bcm.edu	37	9	140330189	140330189	+	Silent	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr9:140330189G>A	ENST00000472938.1	-	7	1159	c.1143C>T	c.(1141-1143)tgC>tgT	p.C381C	ENTPD8_ENST00000371506.2_Silent_p.C381C|ENTPD8_ENST00000344119.2_Intron			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	381					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		AGGGCCTCTGGCAAAACTCCC	0.627																																																	0													80.0	87.0	85.0					9																	140330189		1987	4176	6163	SO:0001819	synonymous_variant	377841			AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.1143C>T	9.37:g.140330189G>A		Somatic		WXS	SOLID	Phase_I	A2BG17|Q6UVZ0	Silent	SNP	ENST00000472938.1	37	CCDS43913.1																																																																																				0.627	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355991.1		NM_198585	
FAM136A	84908	hgsc.bcm.edu	37	2	70529055	70529055	+	Splice_Site	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:70529055A>T	ENST00000037869.3	-	1	166		c.e1+1		AC022201.5_ENST00000445084.1_RNA|FAM136A_ENST00000430566.1_Missense_Mutation_p.V30E|FAM136A_ENST00000450256.1_Splice_Site	NM_032822.2	NP_116211.2	Q96C01	F136A_HUMAN	family with sequence similarity 136, member A							cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CAGCCCCGCTACCTGCATCTT	0.682											OREG0014676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	48.0	51.0					2																	70529055		2203	4299	6502	SO:0001630	splice_region_variant	84908			BC014975	CCDS1904.1	2p14	2014-02-12	2007-07-10		ENSG00000035141	ENSG00000035141			25911	protein-coding gene	gene with protein product	"""hypothetical protein FLJ14668"""					12477932	Standard	NM_032822		Approved	FLJ14668	uc002sgq.4	Q96C01	OTTHUMG00000129668	ENST00000037869.3:c.87+1T>A	2.37:g.70529055A>T		Somatic	1123	WXS	SOLID	Phase_I	Q96SS3	Splice_Site	SNP	ENST00000037869.3	37	CCDS1904.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.93|13.93	2.385180|2.385180	0.42308|0.42308	.|.	.|.	ENSG00000035141|ENSG00000035141	ENST00000037869;ENST00000450256|ENST00000430566;ENST00000438759	.|.	.|.	.|.	3.96|3.96	3.96|3.96	0.45880|0.45880	.|.	.|.	.|.	.|.	.|.	.|T	.|0.52581	.|0.1743	.|.	.|.	.|.	0.29047|0.29047	N|N	0.884726|0.884726	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.53892	.|-0.8374	.|5	.|0.87932	.|D	.|0	.|.	11.0761|11.0761	0.48032|0.48032	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	.|E	-1|30;15	.|.	.|ENSP00000397269:V30E	.|V	-|-	.|2	.|0	FAM136A|FAM136A	70382559|70382559	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.438000|0.438000	0.31896|0.31896	6.024000|6.024000	0.70857|0.70857	1.789000|1.789000	0.52484|0.52484	0.164000|0.164000	0.16699|0.16699	.|GTA		0.682	FAM136A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251869.2		NM_032822	Intron
ESPNL	339768	hgsc.bcm.edu	37	2	239033943	239033943	+	Silent	SNP	G	G	A	rs201765703	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:239033943G>A	ENST00000343063.3	+	6	1283	c.1020G>A	c.(1018-1020)ccG>ccA	p.P340P	ESPNL_ENST00000409169.1_Silent_p.P296P|ESPNL_ENST00000409506.1_5'Flank	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	340	Pro-rich.									endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CACCACCACCGTTCCCCCCAC	0.682													G|||	3	0.000599042	0.0	0.0014	5008	,	,		14517	0.0		0.001	False		,,,				2504	0.001																0								G		1,4365		0,1,2182	39.0	34.0	36.0		1020	-6.5	0.0	2		36	1,8565		0,1,4282	no	coding-synonymous	ESPNL	NM_194312.2		0,2,6464	AA,AG,GG		0.0117,0.0229,0.0155		340/1006	239033943	2,12930	2183	4283	6466	SO:0001819	synonymous_variant	339768			AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.1020G>A	2.37:g.239033943G>A		Somatic		WXS	SOLID	Phase_I	Q66K27|Q6ZVG1|Q8IVU2	Silent	SNP	ENST00000343063.3	37	CCDS2525.1																																																																																				0.682	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2		NM_194312	
FDPS	2224	hgsc.bcm.edu;ucsc.edu	37	1	155289628	155289628	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:155289628A>C	ENST00000356657.6	+	10	1130	c.968A>C	c.(967-969)aAa>aCa	p.K323T	RUSC1-AS1_ENST00000450199.1_RNA|FDPS_ENST00000368356.4_Missense_Mutation_p.K323T|RUSC1_ENST00000368352.5_5'Flank|FDPS_ENST00000447866.1_Missense_Mutation_p.K257T|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	323					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	GTGACCGGCAAAATTGGCACT	0.567																																																	0													112.0	111.0	112.0					1																	155289628		2203	4300	6503	SO:0001583	missense	2224			J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.968A>C	1.37:g.155289628A>C	ENSP00000349078:p.Lys323Thr	Somatic		WXS	SOLID	Phase_I	D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	ENST00000356657.6	37	CCDS1110.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150492	0.78001	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	D;D;D	0.84589	-1.87;-1.87;-1.87	4.28	4.28	0.50868	Terpenoid synthase (2);	0.000000	0.46145	D	0.000302	D	0.93494	0.7924	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94681	0.7865	10	0.87932	D	0	-26.7042	11.7487	0.51837	1.0:0.0:0.0:0.0	.	323	P14324	FPPS_HUMAN	T	257;323;323	ENSP00000391755:K257T;ENSP00000357340:K323T;ENSP00000349078:K323T	ENSP00000349078:K323T	K	+	2	0	FDPS	153556252	1.000000	0.71417	0.996000	0.52242	0.586000	0.36452	8.781000	0.91805	2.159000	0.67721	0.459000	0.35465	AAA		0.567	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039053.1		NM_002004	
FAM20B	9917	hgsc.bcm.edu;ucsc.edu	37	1	179013267	179013267	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:179013267A>T	ENST00000263733.4	+	2	621	c.285A>T	c.(283-285)aaA>aaT	p.K95N		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	95						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						CCACCAAGAAAATCATTAAAG	0.502																																																	0													67.0	70.0	69.0					1																	179013267		2203	4300	6503	SO:0001583	missense	9917			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.285A>T	1.37:g.179013267A>T	ENSP00000263733:p.Lys95Asn	Somatic		WXS	SOLID	Phase_I	Q5W0C3|Q5W0C4	Missense_Mutation	SNP	ENST00000263733.4	37	CCDS1328.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.489114	0.44249	.	.	ENSG00000116199	ENST00000440702;ENST00000263733	D	0.88354	-2.37	6.03	3.71	0.42584	.	0.110070	0.64402	D	0.000002	D	0.83133	0.5188	L	0.60455	1.87	0.39451	D	0.967407	B	0.33694	0.421	B	0.25291	0.059	T	0.80480	-0.1364	10	0.40728	T	0.16	-28.4245	7.9987	0.30284	0.7335:0.0:0.2665:0.0	.	95	O75063	XYLK_HUMAN	N	95	ENSP00000263733:K95N	ENSP00000263733:K95N	K	+	3	2	FAM20B	177279890	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	0.443000	0.21644	1.098000	0.41479	0.455000	0.32223	AAA		0.502	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1		NM_014864	
FGF19	9965	hgsc.bcm.edu	37	11	69514321	69514321	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:69514321A>T	ENST00000294312.3	-	3	1125	c.360T>A	c.(358-360)tgT>tgA	p.C120*		NM_005117.2	NP_005108.1	O95750	FGF19_HUMAN	fibroblast growth factor 19	120					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bile acid biosynthetic process (GO:0070858)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of JNK cascade (GO:0046330)	extracellular region (GO:0005576)	fibroblast growth factor receptor binding (GO:0005104)			large_intestine(2)|lung(2)|skin(2)	6	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;3.05e-56)|all cancers(3;2.69e-50)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)			CCTCGAAAGCACAGTCTTCCT	0.572																																																	0													46.0	42.0	43.0					11																	69514321		2200	4294	6494	SO:0001587	stop_gained	9965			AB018122	CCDS8193.1	11q13.1	2008-02-01			ENSG00000162344	ENSG00000162344			3675	protein-coding gene	gene with protein product		603891				9931477, 10525310	Standard	NM_005117		Approved		uc001opf.3	O95750	OTTHUMG00000167886	ENST00000294312.3:c.360T>A	11.37:g.69514321A>T	ENSP00000294312:p.Cys120*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000294312.3	37	CCDS8193.1	.	.	.	.	.	.	.	.	.	.	A	43	10.154619	0.99349	.	.	ENSG00000162344	ENST00000294312	.	.	.	4.9	-0.0942	0.13646	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.254	10.7262	0.46070	0.5503:0.0:0.4497:0.0	.	.	.	.	X	120	.	ENSP00000294312:C120X	C	-	3	2	FGF19	69223502	0.014000	0.17966	0.985000	0.45067	0.964000	0.63967	-1.834000	0.01693	-0.015000	0.14150	0.454000	0.30748	TGT		0.572	FGF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396833.1		NM_005117	
FHL1	2273	hgsc.bcm.edu	37	X	135290019	135290019	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chrX:135290019C>T	ENST00000345434.3	+	4	481	c.400C>T	c.(400-402)Caa>Taa	p.Q134*	FHL1_ENST00000370683.1_Nonsense_Mutation_p.Q150*|FHL1_ENST00000535737.1_Nonsense_Mutation_p.Q134*|FHL1_ENST00000394153.2_Nonsense_Mutation_p.Q134*|FHL1_ENST00000539015.1_Nonsense_Mutation_p.Q163*|FHL1_ENST00000394155.2_Nonsense_Mutation_p.Q134*|FHL1_ENST00000370690.3_Nonsense_Mutation_p.Q134*|FHL1_ENST00000543669.1_Nonsense_Mutation_p.Q134*|FHL1_ENST00000370676.3_Nonsense_Mutation_p.Q150*			Q13642	FHL1_HUMAN	four and a half LIM domains 1	134	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					TAACTGCAAGCAAGTCATCGG	0.512																																																	0													122.0	97.0	105.0					X																	135290019		2203	4300	6503	SO:0001587	stop_gained	2273			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.400C>T	X.37:g.135290019C>T	ENSP00000071281:p.Gln134*	Somatic		WXS	SOLID	Phase_I	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Nonsense_Mutation	SNP	ENST00000345434.3	37	CCDS55507.1	.	.	.	.	.	.	.	.	.	.	C	36	5.647675	0.96714	.	.	ENSG00000022267	ENST00000394155;ENST00000370690;ENST00000536581;ENST00000420362;ENST00000458357;ENST00000535737;ENST00000452016;ENST00000434885;ENST00000543669;ENST00000394153;ENST00000456445;ENST00000456218;ENST00000449474;ENST00000345434;ENST00000539015;ENST00000370683;ENST00000370676;ENST00000542704;ENST00000370674	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	12.4884	0.55886	0.1677:0.8323:0.0:0.0	.	.	.	.	X	134;134;114;134;134;134;134;134;134;134;134;174;134;134;163;150;150;129;134	.	ENSP00000071281:Q134X	Q	+	1	0	FHL1	135117685	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.857000	0.55972	2.029000	0.59856	0.600000	0.82982	CAA		0.512	FHL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058461.1		NM_001449	
G3BP2	9908	hgsc.bcm.edu;ucsc.edu	37	4	76579235	76579235	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr4:76579235T>C	ENST00000359707.4	-	8	1542	c.757A>G	c.(757-759)Aac>Gac	p.N253D	G3BP2_ENST00000357854.3_Intron|G3BP2_ENST00000502654.1_5'Flank|G3BP2_ENST00000395719.3_Missense_Mutation_p.N253D	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	253					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GGAGGCAGGTTTTTACTGGTC	0.448																																																	0													83.0	82.0	82.0					4																	76579235		2203	4300	6503	SO:0001583	missense	9908			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.757A>G	4.37:g.76579235T>C	ENSP00000352738:p.Asn253Asp	Somatic		WXS	SOLID	Phase_I	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	ENST00000359707.4	37	CCDS3571.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.166392	0.78339	.	.	ENSG00000138757	ENST00000395719;ENST00000359707	T;T	0.78126	-1.15;-1.15	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	M	0.70595	2.14	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.82232	-0.0559	10	0.09843	T	0.71	.	16.4323	0.83853	0.0:0.0:0.0:1.0	.	253	Q9UN86	G3BP2_HUMAN	D	253	ENSP00000379069:N253D;ENSP00000352738:N253D	ENSP00000352738:N253D	N	-	1	0	G3BP2	76798259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.281000	0.76405	0.528000	0.53228	AAC		0.448	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2		NM_012297	
GANC	2595	hgsc.bcm.edu;ucsc.edu	37	15	42585003	42585003	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr15:42585003A>C	ENST00000318010.8	+	5	640	c.400A>C	c.(400-402)Atc>Ctc	p.I134L	GANC_ENST00000566442.1_Missense_Mutation_p.I134L	NM_198141.2	NP_937784.2	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	134					carbohydrate metabolic process (GO:0005975)		alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)	Miglitol(DB00491)	GAAGTGCCATATCACAGCAAA	0.428																																																	0													187.0	161.0	170.0					15																	42585003		2203	4299	6502	SO:0001583	missense	2595			AF545045	CCDS10084.1	15q15.2	2012-10-02			ENSG00000214013	ENSG00000214013	3.2.1.20		4139	protein-coding gene	gene with protein product		104180				6995030, 12370436	Standard	NM_198141		Approved		uc001zpi.3	Q8TET4	OTTHUMG00000130487	ENST00000318010.8:c.400A>C	15.37:g.42585003A>C	ENSP00000326227:p.Ile134Leu	Somatic		WXS	SOLID	Phase_I	Q52LQ4|Q8IWZ0|Q8IZM4|Q8IZM5	Missense_Mutation	SNP	ENST00000318010.8	37	CCDS10084.1	.	.	.	.	.	.	.	.	.	.	A	0.946	-0.707992	0.03230	.	.	ENSG00000214013	ENST00000318010	D	0.87103	-2.21	5.18	-1.41	0.08941	Glycoside hydrolase-type carbohydrate-binding (1);	0.455201	0.24590	N	0.037226	T	0.72399	0.3455	N	0.21583	0.68	0.20703	N	0.999866	B;B	0.19073	0.0;0.033	B;B	0.16722	0.004;0.016	T	0.56001	-0.8051	10	0.02654	T	1	-4.0746	12.1761	0.54186	0.5054:0.0:0.4946:0.0	.	134;134	Q8TET4;Q2M2A3	GANC_HUMAN;.	L	134	ENSP00000326227:I134L	ENSP00000326227:I134L	I	+	1	0	GANC	40372295	0.008000	0.16893	0.068000	0.19968	0.713000	0.41058	0.023000	0.13533	-0.429000	0.07329	-0.359000	0.07587	ATC		0.428	GANC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252887.2		NM_198141	
GIGYF2	26058	hgsc.bcm.edu;ucsc.edu	37	2	233680350	233680350	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:233680350G>A	ENST00000409547.1	+	21	2422	c.2111G>A	c.(2110-2112)tGg>tAg	p.W704*	GIGYF2_ENST00000373563.4_Nonsense_Mutation_p.W704*|GIGYF2_ENST00000373566.3_Nonsense_Mutation_p.W726*|GIGYF2_ENST00000409196.3_Nonsense_Mutation_p.W698*|GIGYF2_ENST00000409451.3_Nonsense_Mutation_p.W725*|GIGYF2_ENST00000409480.1_Nonsense_Mutation_p.W726*|GIGYF2_ENST00000452341.2_Nonsense_Mutation_p.W535*	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	704	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CTTACAGTTTGGGAAGGTGGT	0.493																																																	0													223.0	189.0	201.0					2																	233680350		2203	4300	6503	SO:0001587	stop_gained	26058			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2111G>A	2.37:g.233680350G>A	ENSP00000386537:p.Trp704*	Somatic		WXS	SOLID	Phase_I	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Nonsense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	37	6.582686	0.97680	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-8.0727	18.8987	0.92433	0.0:0.0:1.0:0.0	.	.	.	.	X	726;647;704;726;704;704;647;698;725;698;535	.	ENSP00000362664:W704X	W	+	2	0	GIGYF2	233388594	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	9.476000	0.97823	2.458000	0.83093	0.557000	0.71058	TGG		0.493	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2		NM_001103146	
GLB1L3	112937	hgsc.bcm.edu	37	11	134147736	134147736	+	Silent	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:134147736C>A	ENST00000431683.2	+	3	292	c.292C>A	c.(292-294)Cgg>Agg	p.R98R	GLB1L3_ENST00000389887.5_Silent_p.R98R	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	98					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		CCACTATTTCCGGGTGCCCAG	0.592																																																	0													43.0	48.0	46.0					11																	134147736		2200	4297	6497	SO:0001819	synonymous_variant	112937				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.292C>A	11.37:g.134147736C>A		Somatic		WXS	SOLID	Phase_I	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Silent	SNP	ENST00000431683.2	37	CCDS44780.1																																																																																				0.592	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1		NM_138416	
GPR112	139378	hgsc.bcm.edu	37	X	135431960	135431960	+	Missense_Mutation	SNP	C	C	A	rs145052934		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chrX:135431960C>A	ENST00000394143.1	+	6	6386	c.6095C>A	c.(6094-6096)tCc>tAc	p.S2032Y	GPR112_ENST00000370652.1_Missense_Mutation_p.S2032Y|GPR112_ENST00000412101.1_Missense_Mutation_p.S1827Y|GPR112_ENST00000287534.4_Missense_Mutation_p.S1969Y|GPR112_ENST00000394141.1_Missense_Mutation_p.S1827Y	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2032					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S2032F(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GTTATGACTTCCTCTACAGTA	0.448																																																	1	Substitution - Missense(1)	skin(1)											149.0	120.0	130.0					X																	135431960		2203	4300	6503	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6095C>A	X.37:g.135431960C>A	ENSP00000377699:p.Ser2032Tyr	Somatic		WXS	SOLID	Phase_I	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	19.65	3.866648	0.72065	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.38722	1.35;1.35;1.31;1.12;1.31	4.13	4.13	0.48395	.	.	.	.	.	T	0.50769	0.1635	L	0.29908	0.895	0.09310	N	1	D;D;D	0.89917	1.0;0.983;0.971	D;P;P	0.79108	0.992;0.773;0.598	T	0.36529	-0.9744	9	0.54805	T	0.06	.	11.45	0.50147	0.0:1.0:0.0:0.0	.	1969;1827;2032	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	Y	2032;2032;1827;1969;1827	ENSP00000377699:S2032Y;ENSP00000359686:S2032Y;ENSP00000416526:S1827Y;ENSP00000287534:S1969Y;ENSP00000377697:S1827Y	ENSP00000287534:S1969Y	S	+	2	0	GPR112	135259626	0.011000	0.17503	0.053000	0.19242	0.571000	0.35966	2.375000	0.44283	1.824000	0.53156	0.592000	0.82586	TCC		0.448	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			
GPR98	84059	hgsc.bcm.edu;ucsc.edu	37	5	89923473	89923473	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr5:89923473T>G	ENST00000405460.2	+	7	1214	c.1118T>G	c.(1117-1119)cTa>cGa	p.L373R		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	373					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GATGCTGTGCTAATAAGCCCT	0.358																																																	0													129.0	127.0	128.0					5																	89923473		1872	4105	5977	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1118T>G	5.37:g.89923473T>G	ENSP00000384582:p.Leu373Arg	Somatic		WXS	SOLID	Phase_I	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.778369	0.70107	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.34667	1.35	5.85	5.85	0.93711	.	0.066642	0.64402	D	0.000010	T	0.65565	0.2703	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.72067	-0.4402	10	0.72032	D	0.01	.	16.2365	0.82377	0.0:0.0:0.0:1.0	.	373	Q8WXG9	GPR98_HUMAN	R	373	ENSP00000384582:L373R	ENSP00000296619:L373R	L	+	2	0	GPR98	89959229	1.000000	0.71417	0.913000	0.36048	0.492000	0.33523	7.806000	0.86020	2.238000	0.73509	0.477000	0.44152	CTA		0.358	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2		NM_032119	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123477481	123477481	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:123477481T>A	ENST00000529750.1	+	10	1386	c.1059T>A	c.(1057-1059)agT>agA	p.S353R	GRAMD1B_ENST00000322282.7_Missense_Mutation_p.S353R|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.S360R|GRAMD1B_ENST00000450171.2_5'Flank	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	353						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CTGAGCTCAGTGACTCTTCCG	0.498																																																	0													65.0	66.0	65.0					11																	123477481		2001	4162	6163	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1059T>A	11.37:g.123477481T>A	ENSP00000436500:p.Ser353Arg	Somatic		WXS	SOLID	Phase_I	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	T	18.89	3.720281	0.68959	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.60920	1.19;1.19;1.17;1.22;0.15	5.25	-2.75	0.05914	.	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.999;1.0;0.996;0.999	T	0.70795	-0.4775	10	0.62326	D	0.03	.	14.1745	0.65532	0.0:0.6522:0.0:0.3478	.	313;360;353;360	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	R	360;360;353;353;313;349	ENSP00000402457:S360R;ENSP00000325628:S353R;ENSP00000436500:S353R;ENSP00000432987:S313R;ENSP00000434214:S349R	ENSP00000325628:S353R	S	+	3	2	GRAMD1B	122982691	0.047000	0.20315	0.996000	0.52242	0.760000	0.43138	-0.751000	0.04803	-0.257000	0.09459	-0.464000	0.05259	AGT		0.498	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2		XM_370660	
HK1	3098	hgsc.bcm.edu;ucsc.edu	37	10	71139760	71139760	+	Missense_Mutation	SNP	G	G	A	rs140290094		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:71139760G>A	ENST00000359426.6	+	9	1278	c.1174G>A	c.(1174-1176)Gcc>Acc	p.A392T	HK1_ENST00000298649.3_Missense_Mutation_p.A391T|HK1_ENST00000360289.2_Missense_Mutation_p.A380T|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000448642.2_Missense_Mutation_p.A427T|HK1_ENST00000404387.2_Missense_Mutation_p.A396T	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	392	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						CACACTGGGCGCCATCTTGAA	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		19588	0.0		0.0	False		,,,				2504	0.001																0								G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	153.0	119.0	131.0		1174,1171,1186,1186,1138	4.5	1.0	10	dbSNP_134	131	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,missense,missense	HK1	NM_000188.2,NM_033496.2,NM_033497.2,NM_033498.2,NM_033500.2	58,58,58,58,58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign,benign,benign	392/918,391/917,396/922,396/922,380/906	71139760	2,13004	2203	4300	6503	SO:0001583	missense	3098			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1174G>A	10.37:g.71139760G>A	ENSP00000352398:p.Ala392Thr	Somatic		WXS	SOLID	Phase_I	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077434	0.55753	0.0	2.33E-4	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	5.39	4.48	0.54585	Hexokinase, C-terminal (1);	0.207799	0.49305	D	0.000154	T	0.44540	0.1298	M	0.79805	2.47	0.52099	D	0.999945	D;D;P;P;P;P	0.71674	0.998;0.998;0.699;0.559;0.504;0.73	P;D;B;B;B;B	0.64144	0.896;0.922;0.22;0.166;0.147;0.036	T	0.41610	-0.9499	10	0.36615	T	0.2	-22.2732	13.2724	0.60167	0.077:0.0:0.923:0.0	.	392;392;391;427;396;380	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	T	380;427;396;391;392;392	ENSP00000353433:A380T;ENSP00000402103:A427T;ENSP00000384774:A396T;ENSP00000298649:A391T;ENSP00000352398:A392T	ENSP00000298649:A391T	A	+	1	0	HK1	70809766	1.000000	0.71417	0.977000	0.42913	0.412000	0.31113	7.975000	0.88055	1.269000	0.44280	0.462000	0.41574	GCC		0.582	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2		NM_000188	
HK1	3098	hgsc.bcm.edu;ucsc.edu	37	10	71144134	71144134	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:71144134G>A	ENST00000359426.6	+	11	1720	c.1616G>A	c.(1615-1617)cGt>cAt	p.R539H	HK1_ENST00000298649.3_Missense_Mutation_p.R538H|HK1_ENST00000360289.2_Missense_Mutation_p.R527H|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000448642.2_Missense_Mutation_p.R574H|HK1_ENST00000404387.2_Missense_Mutation_p.R543H	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	539	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						ACCAATTTCCGTGTGCTGCTG	0.468																																																	0													177.0	169.0	171.0					10																	71144134		2203	4300	6503	SO:0001583	missense	3098			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1616G>A	10.37:g.71144134G>A	ENSP00000352398:p.Arg539His	Somatic		WXS	SOLID	Phase_I	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	36	5.743288	0.96873	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.99724	-6.54;-6.54;-6.54;-6.54;-6.54	5.77	5.77	0.91146	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	H	0.96916	3.905	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.961;1.0;1.0;1.0;0.999;1.0	D	0.96890	0.9652	10	0.87932	D	0	-16.4244	19.5653	0.95390	0.0:0.0:1.0:0.0	.	539;539;538;574;543;527	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	H	527;574;543;538;539;539	ENSP00000353433:R527H;ENSP00000402103:R574H;ENSP00000384774:R543H;ENSP00000298649:R538H;ENSP00000352398:R539H	ENSP00000298649:R538H	R	+	2	0	HK1	70814140	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	7.863000	0.87023	2.729000	0.93468	0.650000	0.86243	CGT		0.468	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2		NM_000188	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32552081	32552081	+	Missense_Mutation	SNP	A	A	G	rs11554462	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:32552081A>G	ENST00000360004.5	-	2	280	c.175T>C	c.(175-177)Tac>Cac	p.Y59H		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	59	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						TTATAGAAGTATCTGTCCAGG	0.607										Multiple Myeloma(14;0.17)			A|||	360	0.071885	0.1672	0.0259	5008	,	,		8628	0.0506		0.0328	False		,,,				2504	0.0378																0			GRCh37	CI075644	HLA-DRB1	I	rs11554462	A	HIS/TYR	708,3668		122,464,1602	34.0	32.0	32.0		175	-7.0	0.0	6	dbSNP_132	32	104,8396		1,102,4147	no	missense	HLA-DRB1	NM_002124.3	83	123,566,5749	GG,GA,AA		1.2235,16.1792,6.3063		59/267	32552081	812,12064	2188	4250	6438	SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.175T>C	6.37:g.32552081A>G	ENSP00000353099:p.Tyr59His	Somatic		WXS	SOLID	Phase_I	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	491	0.22481684981684982	178	0.3617886178861789	68	0.1878453038674033	95	0.1660839160839161	150	0.19788918205804748	.	8.243	0.807350	0.16467	0.161792	0.012235	ENSG00000196126	ENST00000360004	T	0.00327	8.09	3.52	-7.04	0.01578	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	2.114260	0.01732	N	0.028893	T	0.00109	0.0003	N	0.25380	0.74	0.80722	P	0.0	B	0.31241	0.315	P	0.48227	0.571	T	0.21965	-1.0230	9	0.36615	T	0.2	.	8.5032	0.33170	0.2252:0.4649:0.3098:0.0	rs11554462;rs17885215;rs28724098	59	P01911	2B1F_HUMAN	H	59	ENSP00000353099:Y59H	ENSP00000353099:Y59H	Y	-	1	0	HLA-DRB1	32660059	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.662000	0.00850	-3.424000	0.00166	-3.376000	0.00041	TAC		0.607	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3		NM_002124	
IFT52	51098	hgsc.bcm.edu;ucsc.edu	37	20	42242573	42242573	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:42242573G>C	ENST00000373030.3	+	7	699	c.569G>C	c.(568-570)tGc>tCc	p.C190S	IFT52_ENST00000373039.4_Missense_Mutation_p.C190S	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	190					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGTTCTGTCTGCTTCCCACTT	0.383																																																	0													97.0	90.0	93.0					20																	42242573		2203	4300	6503	SO:0001583	missense	51098			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.569G>C	20.37:g.42242573G>C	ENSP00000362121:p.Cys190Ser	Somatic		WXS	SOLID	Phase_I	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	ENST00000373030.3	37	CCDS33470.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657975	0.29425	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.38480	0.1042	N	0.11201	0.11	0.80722	D	1	B	0.21688	0.059	B	0.17098	0.017	T	0.31364	-0.9946	9	0.07644	T	0.81	-11.2604	19.0975	0.93258	0.0:0.0:1.0:0.0	.	190	Q9Y366	IFT52_HUMAN	S	190	.	ENSP00000362121:C190S	C	+	2	0	IFT52	41675987	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.639000	0.98448	2.885000	0.99019	0.655000	0.94253	TGC		0.383	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079317.1		NM_016004	
IFT52	51098	hgsc.bcm.edu;ucsc.edu	37	20	42242577	42242577	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:42242577C>A	ENST00000373030.3	+	7	703	c.573C>A	c.(571-573)ttC>ttA	p.F191L	IFT52_ENST00000373039.4_Missense_Mutation_p.F191L	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	191					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTGTCTGCTTCCCACTTAACA	0.388																																																	0													99.0	91.0	94.0					20																	42242577		2203	4300	6503	SO:0001583	missense	51098			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.573C>A	20.37:g.42242577C>A	ENSP00000362121:p.Phe191Leu	Somatic		WXS	SOLID	Phase_I	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	ENST00000373030.3	37	CCDS33470.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992264	0.54041	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	5.75	1.15	0.20763	.	0.000000	0.85682	D	0.000000	T	0.56615	0.1997	M	0.80422	2.495	0.58432	D	0.999995	B	0.27013	0.166	B	0.19666	0.026	T	0.52646	-0.8548	9	0.40728	T	0.16	-13.8994	6.763	0.23550	0.0:0.4619:0.0:0.5381	.	191	Q9Y366	IFT52_HUMAN	L	191	.	ENSP00000362121:F191L	F	+	3	2	IFT52	41675991	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	0.756000	0.26419	0.456000	0.26937	-0.140000	0.14226	TTC		0.388	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079317.1		NM_016004	
ILK	3611	hgsc.bcm.edu;ucsc.edu	37	11	6631379	6631379	+	Splice_Site	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:6631379C>A	ENST00000396751.2	+	11	1535	c.1079C>A	c.(1078-1080)gCt>gAt	p.A360D	ILK_ENST00000528995.1_Splice_Site_p.A299D|ILK_ENST00000420936.2_Splice_Site_p.A360D|ILK_ENST00000299421.4_Splice_Site_p.A360D|ILK_ENST00000526711.1_3'UTR|RP11-732A19.2_ENST00000527398.1_RNA|TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000537806.1_Splice_Site_p.A226D	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	360	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		ATCTCTCCAGCTCTGCAGAAG	0.537																																																	0													85.0	87.0	87.0					11																	6631379		2201	4296	6497	SO:0001630	splice_region_variant	3611			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.1079-1C>A	11.37:g.6631379C>A		Somatic		WXS	SOLID	Phase_I	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Missense_Mutation	SNP	ENST00000396751.2	37	CCDS7768.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527916	0.64860	.	.	ENSG00000166333	ENST00000299421;ENST00000537806;ENST00000420936;ENST00000528995;ENST00000396751	D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53	5.1	5.1	0.69264	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96294	0.8791	H	0.95437	3.67	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.81914	0.995;0.995	D	0.97120	0.9810	9	.	.	.	.	18.0496	0.89343	0.0:1.0:0.0:0.0	.	299;360	B7Z418;Q13418	.;ILK_HUMAN	D	360;226;360;299;360	ENSP00000299421:A360D;ENSP00000439606:A226D;ENSP00000403487:A360D;ENSP00000435323:A299D;ENSP00000379975:A360D	.	A	+	2	0	ILK	6587955	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.977000	0.76141	2.811000	0.96726	0.557000	0.71058	GCT		0.537	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384519.1		NM_004517	Missense_Mutation
ITGA5	3678	hgsc.bcm.edu	37	12	54792404	54792404	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr12:54792404G>A	ENST00000293379.4	-	28	3181	c.2920C>T	c.(2920-2922)Cag>Tag	p.Q974*	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	974					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TGGGGCAGCTGCCGAGGCAGG	0.587																																																	0													82.0	72.0	75.0					12																	54792404		2203	4300	6503	SO:0001587	stop_gained	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2920C>T	12.37:g.54792404G>A	ENSP00000293379:p.Gln974*	Somatic		WXS	SOLID	Phase_I	Q96HA5	Nonsense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549621	0.86127	.	.	ENSG00000161638	ENST00000293379	.	.	.	5.27	4.35	0.52113	.	0.545245	0.19466	N	0.113578	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	12.4979	0.55940	0.0:0.3225:0.6775:0.0	.	.	.	.	X	974	.	ENSP00000293379:Q974X	Q	-	1	0	ITGA5	53078671	0.660000	0.27420	1.000000	0.80357	0.955000	0.61496	0.554000	0.23407	1.323000	0.45263	0.655000	0.94253	CAG		0.587	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1			
ITGAV	3685	hgsc.bcm.edu;ucsc.edu	37	2	187521116	187521116	+	Silent	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:187521116A>T	ENST00000261023.3	+	17	1981	c.1707A>T	c.(1705-1707)atA>atT	p.I569I	ITGAV_ENST00000374907.3_Silent_p.I533I|ITGAV_ENST00000433736.2_Silent_p.I523I|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	569					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	AGGAATTGATAGCGTATCTGC	0.408																																					Melanoma(58;108 1995 6081)												0													291.0	266.0	274.0					2																	187521116		2203	4300	6503	SO:0001819	synonymous_variant	3685				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1707A>T	2.37:g.187521116A>T		Somatic		WXS	SOLID	Phase_I	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	ENST00000261023.3	37	CCDS2292.1																																																																																				0.408	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2		NM_002210	
JAK3	3718	hgsc.bcm.edu	37	19	17945716	17945716	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:17945716A>G	ENST00000527670.1	-	15	2173	c.2144T>C	c.(2143-2145)gTc>gCc	p.V715A	JAK3_ENST00000458235.1_Missense_Mutation_p.V715A|JAK3_ENST00000534444.1_Missense_Mutation_p.V715A			P52333	JAK3_HUMAN	Janus kinase 3	715	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CACTTCCCAGACCGTGGCGCC	0.627		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													73.0	78.0	77.0					19																	17945716		2203	4300	6503	SO:0001583	missense	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2144T>C	19.37:g.17945716A>G	ENSP00000432511:p.Val715Ala	Somatic		WXS	SOLID	Phase_I	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.121166	0.37436	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	T;T;T	0.62364	0.03;0.03;0.03	4.89	2.78	0.32641	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.482215	0.19642	N	0.109427	T	0.46405	0.1391	N	0.16833	0.445	0.28639	N	0.907258	B;B	0.32324	0.364;0.238	B;B	0.37731	0.209;0.257	T	0.45804	-0.9236	10	0.87932	D	0	-26.5851	7.2232	0.25999	0.8047:0.0:0.1953:0.0	.	715;715	P52333-2;P52333	.;JAK3_HUMAN	A	715	ENSP00000391676:V715A;ENSP00000432511:V715A;ENSP00000436421:V715A	ENSP00000391676:V715A	V	-	2	0	JAK3	17806716	0.989000	0.36119	0.933000	0.37362	0.372000	0.29890	4.906000	0.63293	0.236000	0.21180	-0.451000	0.05528	GTC		0.627	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1		NM_000215	
KCTD1	284252	hgsc.bcm.edu	37	18	24127779	24127779	+	Intron	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr18:24127779T>A	ENST00000408011.3	-	1	545				KCTD1_ENST00000317932.7_Intron|KCTD1_ENST00000580059.1_5'Flank|KCTD1_ENST00000417602.1_Missense_Mutation_p.E241V|KCTD1_ENST00000579973.1_Intron	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			GTACGGGGGCTCATTGAGGTA	0.662																																																	0													79.0	86.0	84.0					18																	24127779		692	1591	2283	SO:0001627	intron_variant	284252			AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.14+1075A>T	18.37:g.24127779T>A		Somatic		WXS	SOLID	Phase_I	A8K1F5	Missense_Mutation	SNP	ENST00000408011.3	37	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.585987	0.66105	.	.	ENSG00000134504	ENST00000417602	T	0.79247	-1.25	4.53	4.53	0.55603	.	.	.	.	.	D	0.82632	0.5079	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.83343	-0.0007	6	0.49607	T	0.09	.	12.723	0.57152	0.0:0.0:0.0:1.0	.	.	.	.	V	241	ENSP00000408405:E241V	ENSP00000408405:E241V	E	-	2	0	KCTD1	22381777	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.116000	0.77119	1.686000	0.51046	0.460000	0.39030	GAG		0.662	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446265.1		XM_209091	
VWA8	23078	hgsc.bcm.edu;ucsc.edu	37	13	42461384	42461384	+	Silent	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr13:42461384G>T	ENST00000379310.3	-	6	833	c.765C>A	c.(763-765)ccC>ccA	p.P255P	VWA8_ENST00000281496.6_Silent_p.P255P	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	255						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										AACGAAGAGGGGGGTCTAATG	0.383																																																	0													58.0	62.0	61.0					13																	42461384		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.765C>A	13.37:g.42461384G>T		Somatic		WXS	SOLID	Phase_I	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																				0.383	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2		NM_015058	
KPNB1	3837	hgsc.bcm.edu	37	17	45745724	45745724	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr17:45745724G>T	ENST00000290158.4	+	10	1579	c.1172G>T	c.(1171-1173)gGt>gTt	p.G391V	KPNB1_ENST00000537679.1_Missense_Mutation_p.G175V|KPNB1_ENST00000535458.2_Missense_Mutation_p.G246V|KPNB1_ENST00000540627.1_Missense_Mutation_p.G246V	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	391	Ran-GTP binding.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						ATGGCTTTTGGTTGTATCTTG	0.443																																																	0													94.0	91.0	92.0					17																	45745724		2203	4300	6503	SO:0001583	missense	3837			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1172G>T	17.37:g.45745724G>T	ENSP00000290158:p.Gly391Val	Somatic		WXS	SOLID	Phase_I	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	ENST00000290158.4	37	CCDS11513.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872766	0.51695	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.54	5.54	0.83059	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85097	0.5619	H	0.97077	3.935	0.47737	D	0.999503	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89874	0.4025	9	0.87932	D	0	-24.8693	19.4882	0.95039	0.0:0.0:1.0:0.0	.	175;391	F5H4R7;Q14974	.;IMB1_HUMAN	V	246;391;246;175	ENSP00000438253:G246V;ENSP00000290158:G391V;ENSP00000438964:G246V;ENSP00000445006:G175V	ENSP00000290158:G391V	G	+	2	0	KPNB1	43100723	1.000000	0.71417	0.983000	0.44433	0.994000	0.84299	9.869000	0.99810	2.620000	0.88729	0.557000	0.71058	GGT		0.443	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2		NM_002265	
LHX8	431707	hgsc.bcm.edu;ucsc.edu	37	1	75608988	75608988	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:75608988G>A	ENST00000294638.5	+	6	1239	c.575G>A	c.(574-576)tGc>tAc	p.C192Y	LHX8_ENST00000356261.3_Missense_Mutation_p.C182Y	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	192	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CATTATGACTGCATGCTGGAT	0.363																																																	0													63.0	64.0	63.0					1																	75608988		2203	4299	6502	SO:0001583	missense	431707			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.575G>A	1.37:g.75608988G>A	ENSP00000294638:p.Cys192Tyr	Somatic		WXS	SOLID	Phase_I	E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064349	0.55432	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.86230	-2.09;-2.07	5.15	5.15	0.70609	Zinc finger, LIM-type (1);	0.043154	0.85682	D	0.000000	D	0.84297	0.5441	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	D	0.88713	0.3224	10	0.66056	D	0.02	.	19.0188	0.92905	0.0:0.0:1.0:0.0	.	192	Q68G74	LHX8_HUMAN	Y	192;182	ENSP00000294638:C192Y;ENSP00000348597:C182Y	ENSP00000294638:C192Y	C	+	2	0	LHX8	75381576	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.425000	0.66470	2.579000	0.87056	0.650000	0.86243	TGC		0.363	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1		NM_001001933	
LRP2	4036	hgsc.bcm.edu;ucsc.edu	37	2	170115607	170115607	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:170115607G>T	ENST00000263816.3	-	17	2726	c.2441C>A	c.(2440-2442)gCt>gAt	p.A814D	LRP2_ENST00000443831.1_Missense_Mutation_p.A677D	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	814					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CGTTTTATCAGCTAGCCTCAT	0.408																																																	0													157.0	154.0	155.0					2																	170115607		2203	4300	6503	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2441C>A	2.37:g.170115607G>T	ENSP00000263816:p.Ala814Asp	Somatic		WXS	SOLID	Phase_I	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477353	0.26511	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.94862	-3.28;-3.54	5.77	1.93	0.25924	Six-bladed beta-propeller, TolB-like (1);	0.100871	0.64402	D	0.000002	D	0.88555	0.6468	N	0.01874	-0.695	0.44366	D	0.997268	D;D	0.61080	0.989;0.985	D;P	0.71656	0.974;0.787	T	0.82581	-0.0386	10	0.10636	T	0.68	.	8.1097	0.30907	0.2281:0.1133:0.6586:0.0	.	677;814	E9PC35;P98164	.;LRP2_HUMAN	D	814;677	ENSP00000263816:A814D;ENSP00000409813:A677D	ENSP00000263816:A814D	A	-	2	0	LRP2	169823853	1.000000	0.71417	0.996000	0.52242	0.192000	0.23643	2.743000	0.47442	0.783000	0.33636	0.591000	0.81541	GCT		0.408	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2		NM_004525	
LRRC70	100130733	hgsc.bcm.edu;ucsc.edu	37	5	61877084	61877084	+	Missense_Mutation	SNP	G	G	A	rs147839866	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr5:61877084G>A	ENST00000334994.5	+	2	2058	c.1819G>A	c.(1819-1821)Gtt>Att	p.V607I	IPO11_ENST00000409296.3_Intron|IPO11_ENST00000325324.6_Intron|IPO11_ENST00000409534.1_Intron|LRRC70_ENST00000448151.2_3'UTR	NM_181506.4	NP_852607.3	Q7Z2Q7	LRR70_HUMAN	leucine rich repeat containing 70	607						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						TAAACAAATTGTTCCTGAAAA	0.363													G|||	12	0.00239617	0.0076	0.0014	5008	,	,		16083	0.0		0.0	False		,,,				2504	0.001																0								G	,,ILE/VAL	10,1374		0,10,682	108.0	85.0	92.0		,,1819	3.3	1.0	5	dbSNP_134	92	0,3180		0,0,1590	no	intron,intron,missense	IPO11,LRRC70	NM_001134779.1,NM_016338.4,NM_181506.4	,,29	0,10,2272	AA,AG,GG		0.0,0.7225,0.2191	,,possibly-damaging	,,607/623	61877084	10,4554	692	1590	2282	SO:0001583	missense	100130733				CCDS47218.1	5q12.1	2008-12-18			ENSG00000186105	ENSG00000186105			35155	protein-coding gene	gene with protein product	"""synleurin"""						Standard	NM_181506		Approved	SLRN, LOC100130733	uc011cqs.1	Q7Z2Q7	OTTHUMG00000154401	ENST00000334994.5:c.1819G>A	5.37:g.61877084G>A	ENSP00000399441:p.Val607Ile	Somatic		WXS	SOLID	Phase_I	Q6ZWI5	Missense_Mutation	SNP	ENST00000334994.5	37	CCDS47218.1	3	0.0013736263736263737	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	0	0.0	G	12.71	2.020724	0.35606	0.007225	0.0	ENSG00000186105	ENST00000334994	T	0.51325	0.71	5.21	3.28	0.37604	.	.	.	.	.	T	0.16171	0.0389	N	0.08118	0	0.80722	D	1	B	0.30584	0.286	B	0.21360	0.034	T	0.05435	-1.0885	8	.	.	.	.	9.5954	0.39571	0.2385:0.0:0.7615:0.0	.	607	Q7Z2Q7	LRR70_HUMAN	I	607	ENSP00000399441:V607I	.	V	+	1	0	LRRC70	61912840	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.896000	0.28377	1.424000	0.47217	0.655000	0.94253	GTT		0.363	LRRC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335067.3		XR_042302	
LYPD4	147719	hgsc.bcm.edu	37	19	42341417	42341417	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:42341417A>G	ENST00000330743.3	-	5	1752	c.541T>C	c.(541-543)Ttt>Ctt	p.F181L	LYPD4_ENST00000343055.4_Missense_Mutation_p.F146L|LYPD4_ENST00000601246.1_Missense_Mutation_p.F146L|AC020956.3_ENST00000593354.1_lincRNA	NM_173506.4	NP_775777.3	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4	181	UPAR/Ly6.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)	12						GTATTGAGAAACCCTGTAAGG	0.488																																																	0													110.0	108.0	109.0					19																	42341417		2203	4300	6503	SO:0001583	missense	147719			AY358726	CCDS12587.1	19q13.2	2008-02-05				ENSG00000273111			28659	protein-coding gene	gene with protein product						12975309	Standard	XM_005278383		Approved	MGC42718	uc002orp.1	Q6UWN0		ENST00000330743.3:c.541T>C	19.37:g.42341417A>G	ENSP00000328737:p.Phe181Leu	Somatic		WXS	SOLID	Phase_I	Q8IYW0	Missense_Mutation	SNP	ENST00000330743.3	37	CCDS12587.1	.	.	.	.	.	.	.	.	.	.	A	4.430	0.079614	0.08533	.	.	ENSG00000183103	ENST00000330743;ENST00000343055	T;T	0.69435	-0.4;-0.4	2.94	-4.29	0.03721	CD59 antigen (1);	2.054550	0.02451	N	0.085583	T	0.46367	0.1389	N	0.16478	0.41	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.23476	-1.0187	10	0.49607	T	0.09	8.3106	3.5228	0.07748	0.2634:0.0:0.3849:0.3517	.	146;181	Q6UWN0-2;Q6UWN0	.;LYPD4_HUMAN	L	181;146	ENSP00000328737:F181L;ENSP00000339568:F146L	ENSP00000328737:F181L	F	-	1	0	LYPD4	47033257	0.000000	0.05858	0.001000	0.08648	0.313000	0.28021	-1.419000	0.02460	-1.161000	0.02800	0.454000	0.30748	TTT		0.488	LYPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463039.1		NM_173506	
MCF2L2	23101	hgsc.bcm.edu	37	3	182923678	182923678	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr3:182923678T>C	ENST00000328913.3	-	25	3167	c.2870A>G	c.(2869-2871)cAa>cGa	p.Q957R	MCF2L2_ENST00000473233.1_Missense_Mutation_p.Q957R|MCF2L2_ENST00000468976.1_5'UTR	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	957							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GATATTATTTTGTTGTTCCAT	0.378																																																	0													80.0	83.0	82.0					3																	182923678		2202	4298	6500	SO:0001583	missense	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2870A>G	3.37:g.182923678T>C	ENSP00000328118:p.Gln957Arg	Somatic		WXS	SOLID	Phase_I	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	T	0.396	-0.920790	0.02396	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.09073	3.02;3.02	4.42	1.87	0.25490	Pleckstrin homology-type (1);	0.292616	0.28203	N	0.016216	T	0.07908	0.0198	L	0.60455	1.87	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.17410	-1.0370	10	0.56958	D	0.05	.	3.2315	0.06750	0.2049:0.1102:0.0:0.685	.	957	Q86YR7	MF2L2_HUMAN	R	957	ENSP00000328118:Q957R;ENSP00000420070:Q957R	ENSP00000328118:Q957R	Q	-	2	0	MCF2L2	184406372	0.901000	0.30685	0.972000	0.41901	0.149000	0.21700	0.746000	0.26275	0.852000	0.35287	0.460000	0.39030	CAA		0.378	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1		NM_015078	
MDN1	23195	hgsc.bcm.edu;ucsc.edu	37	6	90499925	90499925	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:90499925G>T	ENST00000369393.3	-	6	1166	c.1051C>A	c.(1051-1053)Cct>Act	p.P351T	MDN1_ENST00000428876.1_Missense_Mutation_p.P351T			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	351					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGCTGAGGAGGCTTTGTTCTA	0.423																																																	0													151.0	156.0	154.0					6																	90499925		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.1051C>A	6.37:g.90499925G>T	ENSP00000358400:p.Pro351Thr	Somatic		WXS	SOLID	Phase_I	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396668	0.25205	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.53423	0.62;0.62;0.62	5.21	3.39	0.38822	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.186041	0.47852	D	0.000208	T	0.24160	0.0585	L	0.49126	1.545	0.40276	D	0.978344	B;B	0.24132	0.098;0.08	B;B	0.26310	0.068;0.065	T	0.04495	-1.0947	10	0.16420	T	0.52	.	11.8427	0.52364	0.1298:0.0:0.8702:0.0	.	351;351	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	T	351	ENSP00000358400:P351T;ENSP00000413970:P351T;ENSP00000409664:P351T	ENSP00000358400:P351T	P	-	1	0	MDN1	90556646	0.989000	0.36119	0.998000	0.56505	0.947000	0.59692	2.012000	0.40932	2.426000	0.82243	0.655000	0.94253	CCT		0.423	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			
MED12L	116931	hgsc.bcm.edu;ucsc.edu	37	3	150903129	150903129	+	Missense_Mutation	SNP	G	G	C	rs376895313		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr3:150903129G>C	ENST00000474524.1	+	11	1545	c.1507G>C	c.(1507-1509)Gat>Cat	p.D503H	MED12L_ENST00000422248.2_Missense_Mutation_p.D503H|MED12L_ENST00000309237.4_Missense_Mutation_p.D503H|MED12L_ENST00000273432.4_Missense_Mutation_p.D363H|RNA5SP145_ENST00000363124.1_RNA	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	503						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGCGCCCAACGATGAAGCTGT	0.527																																																	0													119.0	98.0	106.0					3																	150903129		2203	4300	6503	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1507G>C	3.37:g.150903129G>C	ENSP00000417235:p.Asp503His	Somatic		WXS	SOLID	Phase_I	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610825	0.66558	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.51	5.51	0.81932	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.000000	0.85682	D	0.000000	T	0.74884	0.3775	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.89917	0.985;1.0;1.0;1.0	P;D;D;D	0.91635	0.899;0.999;0.999;0.999	T	0.77691	-0.2493	10	0.87932	D	0	-17.3017	19.0129	0.92881	0.0:0.0:1.0:0.0	.	363;503;503;503	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	H	503;503;503;363	ENSP00000403308:D503H;ENSP00000310760:D503H;ENSP00000417235:D503H;ENSP00000273432:D363H	ENSP00000273432:D363H	D	+	1	0	MED12L	152385819	1.000000	0.71417	0.906000	0.35671	0.125000	0.20455	8.874000	0.92363	2.589000	0.87451	0.591000	0.81541	GAT		0.527	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2		NM_053002	
MGA	23269	hgsc.bcm.edu;ucsc.edu	37	15	41988561	41988561	+	Silent	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr15:41988561A>G	ENST00000570161.1	+	2	1353	c.1353A>G	c.(1351-1353)tcA>tcG	p.S451S	MGA_ENST00000389936.4_Silent_p.S451S|MGA_ENST00000545763.1_Silent_p.S451S|MGA_ENST00000568630.1_3'UTR|MGA_ENST00000219905.7_Silent_p.S451S|MGA_ENST00000566586.1_Silent_p.S451S			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCAGCCCATCAGGTGTTGCTA	0.423																																																	0													70.0	66.0	67.0					15																	41988561		1863	4100	5963	SO:0001819	synonymous_variant	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1353A>G	15.37:g.41988561A>G		Somatic		WXS	SOLID	Phase_I	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	37	CCDS55959.1																																																																																				0.423	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1		NM_001164273.1	
MGRN1	23295	hgsc.bcm.edu	37	16	4721421	4721421	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr16:4721421G>T	ENST00000399577.5	+	9	849	c.756G>T	c.(754-756)gaG>gaT	p.E252D	MGRN1_ENST00000415496.1_Missense_Mutation_p.E253D|MGRN1_ENST00000588994.1_Missense_Mutation_p.E252D|MGRN1_ENST00000262370.7_Missense_Mutation_p.E252D|MGRN1_ENST00000586183.1_Missense_Mutation_p.E252D|MGRN1_ENST00000588015.1_3'UTR	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	252					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						TCCTGCAGGAGATCTATGGCA	0.592																																																	0													87.0	89.0	88.0					16																	4721421		2092	4237	6329	SO:0001583	missense	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.756G>T	16.37:g.4721421G>T	ENSP00000382487:p.Glu252Asp	Somatic		WXS	SOLID	Phase_I	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	g	20.8	4.053407	0.75960	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.09	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.55401	0.1918	M	0.85859	2.78	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;0.997;0.999	D;D;D;D;D;D	0.91635	0.995;0.999;0.997;0.997;0.946;0.997	T	0.58526	-0.7621	10	0.51188	T	0.08	-30.0453	9.7501	0.40470	0.1804:0.0:0.8196:0.0	.	252;252;252;253;252;252	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	D	252;252;253;252	ENSP00000262370:E252D;ENSP00000382487:E252D;ENSP00000393311:E253D;ENSP00000443810:E252D	ENSP00000262370:E252D	E	+	3	2	MGRN1	4661422	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.248000	0.58760	2.359000	0.80004	0.558000	0.71614	GAG		0.592	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2			
MIOS	54468	hgsc.bcm.edu;ucsc.edu	37	7	7612146	7612146	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr7:7612146C>G	ENST00000340080.4	+	4	461	c.40C>G	c.(40-42)Cat>Gat	p.H14D	MIOS_ENST00000405785.1_Missense_Mutation_p.H14D	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	14						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGCACCACACCATGTTGATAG	0.373																																																	0													104.0	92.0	96.0					7																	7612146		1879	4107	5986	SO:0001583	missense	54468				CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.40C>G	7.37:g.7612146C>G	ENSP00000339881:p.His14Asp	Somatic		WXS	SOLID	Phase_I	B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	ENST00000340080.4	37	CCDS43554.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.202853	0.58234	.	.	ENSG00000164654	ENST00000340080;ENST00000405785;ENST00000433635;ENST00000456533;ENST00000433056;ENST00000445169	T;T	0.42513	0.97;0.97	5.85	5.85	0.93711	.	0.168742	0.53938	D	0.000050	T	0.55832	0.1945	L	0.50333	1.59	0.47905	D	0.999546	P	0.52692	0.955	P	0.56343	0.796	T	0.38265	-0.9669	10	0.32370	T	0.25	-3.4921	20.5471	0.99284	0.0:1.0:0.0:0.0	.	14	Q9NXC5	MIO_HUMAN	D	14	ENSP00000339881:H14D;ENSP00000384088:H14D	ENSP00000339881:H14D	H	+	1	0	MIOS	7578671	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.382000	0.79729	2.941000	0.99782	0.655000	0.94253	CAT		0.373	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1		NM_019005	
MS4A15	219995	hgsc.bcm.edu	37	11	60531258	60531258	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:60531258A>C	ENST00000405633.3	+	2	131	c.52A>C	c.(52-54)Aac>Cac	p.N18H	MS4A15_ENST00000337911.4_Intron|MS4A15_ENST00000528170.1_Missense_Mutation_p.N18H	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	18						integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(3)	6						CCCGCCAAACAACGCCAGTGG	0.572																																																	0													103.0	102.0	102.0					11																	60531258		2047	4191	6238	SO:0001583	missense	219995			AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.52A>C	11.37:g.60531258A>C	ENSP00000386022:p.Asn18His	Somatic		WXS	SOLID	Phase_I	A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	ENST00000405633.3	37	CCDS44617.1	.	.	.	.	.	.	.	.	.	.	A	10.41	1.343342	0.24339	.	.	ENSG00000166961	ENST00000528170;ENST00000405633	T;T	0.18960	2.18;2.88	5.21	4.07	0.47477	.	.	.	.	.	T	0.30665	0.0772	L	0.29908	0.895	0.09310	N	0.999992	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	T	0.07868	-1.0750	9	0.41790	T	0.15	-18.3491	7.8754	0.29590	0.9042:0.0:0.0958:0.0	.	18;18	F2Z2J5;Q8N5U1	.;M4A15_HUMAN	H	18	ENSP00000434165:N18H;ENSP00000386022:N18H	ENSP00000386022:N18H	N	+	1	0	MS4A15	60287834	0.982000	0.34865	0.256000	0.24389	0.009000	0.06853	1.997000	0.40786	0.797000	0.33971	0.379000	0.24179	AAC		0.572	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395618.1			
MYBL2	4605	hgsc.bcm.edu	37	20	42340166	42340166	+	Silent	SNP	G	G	T	rs538589567		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:42340166G>T	ENST00000217026.4	+	11	1771	c.1644G>T	c.(1642-1644)gtG>gtT	p.V548V	MYBL2_ENST00000396863.4_Silent_p.V524V	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	548					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGAAGGAGGTGCTGCGTTCTG	0.632																																																	0													70.0	57.0	62.0					20																	42340166		2203	4300	6503	SO:0001819	synonymous_variant	4605				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1644G>T	20.37:g.42340166G>T		Somatic		WXS	SOLID	Phase_I	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Silent	SNP	ENST00000217026.4	37	CCDS13322.1																																																																																				0.632	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1		NM_002466	
NPC1L1	29881	hgsc.bcm.edu	37	7	44579792	44579792	+	Silent	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr7:44579792A>C	ENST00000289547.4	-	2	259	c.204T>G	c.(202-204)ggT>ggG	p.G68G	NPC1L1_ENST00000546276.1_Silent_p.G68G|NPC1L1_ENST00000423141.1_Silent_p.G68G|NPC1L1_ENST00000381160.3_Silent_p.G68G	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	68					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	TCAGGTGATCACCTGTGATCT	0.577																																																	0													63.0	63.0	63.0					7																	44579792		2203	4300	6503	SO:0001819	synonymous_variant	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.204T>G	7.37:g.44579792A>C		Somatic		WXS	SOLID	Phase_I	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1																																																																																				0.577	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1		NM_013389	
OPN1SW	611	hgsc.bcm.edu;ucsc.edu	37	7	128415817	128415817	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr7:128415817A>G	ENST00000249389.2	-	1	27	c.28T>C	c.(28-30)Tat>Cat	p.Y10H		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	10					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						TTGAACAGATAAAACTCTTCC	0.527																																																	0													45.0	49.0	48.0					7																	128415817		2203	4300	6503	SO:0001583	missense	611			U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.28T>C	7.37:g.128415817A>G	ENSP00000249389:p.Tyr10His	Somatic		WXS	SOLID	Phase_I	Q13877	Missense_Mutation	SNP	ENST00000249389.2	37	CCDS5806.1	.	.	.	.	.	.	.	.	.	.	A	8.102	0.776860	0.16120	.	.	ENSG00000128617	ENST00000249389	T	0.37915	1.17	4.94	2.55	0.30701	.	0.771864	0.12337	N	0.477834	T	0.49133	0.1539	M	0.76574	2.34	0.38349	D	0.944271	D	0.56521	0.976	P	0.54238	0.746	T	0.50381	-0.8835	10	0.59425	D	0.04	.	7.7924	0.29127	0.8249:0.0:0.1751:0.0	.	10	P03999	OPSB_HUMAN	H	10	ENSP00000249389:Y10H	ENSP00000249389:Y10H	Y	-	1	0	OPN1SW	128203053	0.993000	0.37304	0.552000	0.28243	0.192000	0.23643	1.941000	0.40233	0.373000	0.24621	0.459000	0.35465	TAT		0.527	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350655.1		NM_001708	
OR8B8	26493	hgsc.bcm.edu	37	11	124310505	124310505	+	Silent	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:124310505G>A	ENST00000328064.2	-	1	549	c.477C>T	c.(475-477)caC>caT	p.H159H		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	159					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TGCACGCTGTGTGGGCCATGG	0.522																																																	0													126.0	109.0	115.0					11																	124310505		2201	4299	6500	SO:0001819	synonymous_variant	26493			AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.477C>T	11.37:g.124310505G>A		Somatic		WXS	SOLID	Phase_I	A1L446|Q96RC8	Silent	SNP	ENST00000328064.2	37	CCDS8446.1																																																																																				0.522	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1		NM_012378	
PBRM1	55193	hgsc.bcm.edu	37	3	52598178	52598179	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr3:52598178_52598179insA	ENST00000296302.7	-	23	3763_3764	c.3762_3763insT	c.(3760-3765)attctgfs	p.L1255fs	PBRM1_ENST00000337303.4_Frame_Shift_Ins_p.L1255fs|PBRM1_ENST00000409114.3_Frame_Shift_Ins_p.L1270fs|PBRM1_ENST00000356770.4_Frame_Shift_Ins_p.L1223fs|PBRM1_ENST00000409057.1_Frame_Shift_Ins_p.L1255fs|PBRM1_ENST00000409767.1_Frame_Shift_Ins_p.L1270fs|PBRM1_ENST00000410007.1_Frame_Shift_Ins_p.L1230fs|PBRM1_ENST00000394830.3_Frame_Shift_Ins_p.L1230fs|SMIM4_ENST00000476842.1_Intron			Q86U86	PB1_HUMAN	polybromo 1	1255	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCACAAAGCAGAATGTCATTTT	0.396			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0																																										SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3763dupT	3.37:g.52598180_52598180dupA	ENSP00000296302:p.Leu1255fs	Somatic		WXS	SOLID	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Ins	INS	ENST00000296302.7	37																																																																																					0.396	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PHF20	51230	hgsc.bcm.edu;ucsc.edu	37	20	34458954	34458954	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:34458954A>G	ENST00000374012.3	+	8	1129	c.1000A>G	c.(1000-1002)Aat>Gat	p.N334D	PHF20_ENST00000439301.1_3'UTR|PHF20_ENST00000481202.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	334					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					GCTGTCCACTAATGGGACCCA	0.433																																																	0													160.0	143.0	149.0					20																	34458954		2203	4300	6503	SO:0001583	missense	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1000A>G	20.37:g.34458954A>G	ENSP00000363124:p.Asn334Asp	Somatic		WXS	SOLID	Phase_I	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	A	11.70	1.717303	0.30413	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	T;T;T	0.49139	1.45;0.79;0.8	5.41	4.32	0.51571	.	0.512797	0.22172	N	0.063636	T	0.30166	0.0756	L	0.29908	0.895	0.80722	D	1	B;B	0.23937	0.016;0.094	B;B	0.20767	0.014;0.031	T	0.05305	-1.0893	10	0.10111	T	0.7	.	7.9778	0.30166	0.8336:0.0:0.1664:0.0	.	334;334	Q9BVI0;Q66K49	PHF20_HUMAN;.	D	334	ENSP00000363124:N334D;ENSP00000341900:N334D;ENSP00000363112:N334D	ENSP00000341900:N334D	N	+	1	0	PHF20	33922368	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.182000	0.42556	0.904000	0.36572	0.482000	0.46254	AAT		0.433	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2		NM_016436	
POLR1C	9533	hgsc.bcm.edu	37	6	43488991	43488991	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:43488991A>C	ENST00000372389.3	+	9	1082	c.994A>C	c.(994-996)Aag>Cag	p.K332Q	RP3-337H4.9_ENST00000607571.1_RNA|POLR1C_ENST00000372344.2_Missense_Mutation_p.K282Q|POLR1C_ENST00000304004.3_Intron	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	332					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			ACTGATGGGGAAGTGCCGGCG	0.527																																																	0													112.0	109.0	110.0					6																	43488991		2203	4300	6503	SO:0001583	missense	9533			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.994A>C	6.37:g.43488991A>C	ENSP00000361465:p.Lys332Gln	Somatic		WXS	SOLID	Phase_I	O75395|Q5JTE3	Missense_Mutation	SNP	ENST00000372389.3	37	CCDS4901.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.688307	0.88639	.	.	ENSG00000171453	ENST00000372389;ENST00000372373;ENST00000372344	D;D	0.85629	-2.01;-2.01	5.09	5.09	0.68999	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.048704	0.85682	D	0.000000	D	0.94295	0.8167	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96158	0.9113	10	0.87932	D	0	-18.1446	14.8517	0.70300	1.0:0.0:0.0:0.0	.	332	O15160	RPAC1_HUMAN	Q	332;196;282	ENSP00000361465:K332Q;ENSP00000361419:K282Q	ENSP00000361419:K282Q	K	+	1	0	POLR1C	43596969	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.799000	0.91895	1.912000	0.55364	0.477000	0.44152	AAG		0.527	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040652.3		NM_004875	
PPA2	27068	hgsc.bcm.edu;ucsc.edu	37	4	106370542	106370542	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr4:106370542C>T	ENST00000341695.5	-	4	316	c.286G>A	c.(286-288)Gta>Ata	p.V96I	PPA2_ENST00000432483.2_Intron|PPA2_ENST00000357415.4_Missense_Mutation_p.V111I|PPA2_ENST00000310267.7_Missense_Mutation_p.V17I|PPA2_ENST00000354147.3_Intron|PPA2_ENST00000348706.5_Missense_Mutation_p.V96I|PPA2_ENST00000509426.1_5'UTR|PPA2_ENST00000380004.2_Intron	NM_176869.2	NP_789845.1	Q9H2U2	IPYR2_HUMAN	pyrophosphatase (inorganic) 2	96					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	11		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		GGTATTTCTACAATCATATTA	0.284																																																	0													45.0	47.0	46.0					4																	106370542		2202	4291	6493	SO:0001583	missense	27068				CCDS3667.1, CCDS3668.2, CCDS3669.2, CCDS34043.1	4q25	2005-10-07			ENSG00000138777	ENSG00000138777			28883	protein-coding gene	gene with protein product		609988				11042152	Standard	NM_176869		Approved	FLJ20459	uc003hxl.3	Q9H2U2	OTTHUMG00000128781	ENST00000341695.5:c.286G>A	4.37:g.106370542C>T	ENSP00000343885:p.Val96Ile	Somatic		WXS	SOLID	Phase_I	B4DLP7|F8WDN9|I6L9B6|Q4W5E9|Q6PG51|Q8TBW0|Q96E55|Q9H0T0|Q9NX37|Q9P033|Q9ULX0	Missense_Mutation	SNP	ENST00000341695.5	37	CCDS3667.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528257	0.85706	.	.	ENSG00000138777	ENST00000341695;ENST00000348706;ENST00000357415;ENST00000310267;ENST00000504028;ENST00000502596	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	5.65	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.53514	0.1801	L	0.42632	1.34	0.80722	D	1	P;D;D	0.64830	0.861;0.994;0.986	P;P;P	0.60345	0.626;0.873;0.81	T	0.53851	-0.8380	10	0.46703	T	0.11	-0.7667	16.4565	0.84019	0.0:0.8686:0.1314:0.0	.	17;96;96	B4DFH3;Q9H2U2-3;Q9H2U2	.;.;IPYR2_HUMAN	I	96;96;111;17;91;17	ENSP00000343885:V96I;ENSP00000313061:V96I;ENSP00000349996:V111I;ENSP00000311150:V17I;ENSP00000421177:V91I;ENSP00000426347:V17I	ENSP00000311150:V17I	V	-	1	0	PPA2	106589991	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.520000	0.81821	1.343000	0.45638	0.650000	0.86243	GTA		0.284	PPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250704.4		NM_176869	
PPP1R15B	84919	hgsc.bcm.edu;ucsc.edu	37	1	204379755	204379755	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:204379755T>C	ENST00000367188.4	-	1	1164	c.785A>G	c.(784-786)gAg>gGg	p.E262G	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	262					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			ACAATGGTCCTCTCTCAGGCA	0.537																																																	0													88.0	89.0	89.0					1																	204379755		2203	4300	6503	SO:0001583	missense	84919			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.785A>G	1.37:g.204379755T>C	ENSP00000356156:p.Glu262Gly	Somatic		WXS	SOLID	Phase_I	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.684879	0.47991	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.26223	1.75	5.2	4.1	0.47936	Protein phosphatase 1, regulatory subunit 15B, N-terminal (1);	0.507884	0.16623	N	0.206413	T	0.27900	0.0687	L	0.59436	1.845	0.09310	N	1	B	0.34181	0.44	B	0.38378	0.272	T	0.23404	-1.0189	10	0.72032	D	0.01	-10.2259	8.1964	0.31398	0.0:0.0:0.2692:0.7308	.	262	Q5SWA1	PR15B_HUMAN	G	262;172	ENSP00000356156:E262G	ENSP00000356156:E262G	E	-	2	0	PPP1R15B	202646378	0.001000	0.12720	0.060000	0.19600	0.018000	0.09664	0.725000	0.25970	1.951000	0.56629	0.533000	0.62120	GAG		0.537	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1		NM_032833	
PRKCQ	5588	hgsc.bcm.edu;ucsc.edu	37	10	6525533	6525533	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:6525533A>C	ENST00000263125.5	-	11	1147	c.1048T>G	c.(1048-1050)Ttg>Gtg	p.L350V	PRKCQ_ENST00000539722.1_Missense_Mutation_p.L225V|PRKCQ_ENST00000397176.2_Missense_Mutation_p.L350V	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	350					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	ACCTCATCCAACGGAGACTCC	0.413																																					Ovarian(50;572 1126 10530 25349 30594)												0													95.0	93.0	94.0					10																	6525533		2203	4300	6503	SO:0001583	missense	5588			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1048T>G	10.37:g.6525533A>C	ENSP00000263125:p.Leu350Val	Somatic		WXS	SOLID	Phase_I	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	.	6.623	0.483436	0.12581	.	.	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	T;T;T	0.68181	-0.31;-0.24;-0.31	5.24	-5.67	0.02444	.	1.070280	0.07145	N	0.848082	T	0.29389	0.0732	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.15492	-1.0435	10	0.15952	T	0.53	.	1.7974	0.03064	0.1494:0.3047:0.3187:0.2273	.	225;122;350;350	B4DF52;Q5JUN8;Q04759-2;Q04759	.;.;.;KPCT_HUMAN	V	350;350;225	ENSP00000263125:L350V;ENSP00000380361:L350V;ENSP00000441752:L225V	ENSP00000263125:L350V	L	-	1	2	PRKCQ	6565539	0.002000	0.14202	0.040000	0.18447	0.106000	0.19336	0.156000	0.16382	-0.580000	0.05944	-0.340000	0.08031	TTG		0.413	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1		NM_006257	
PTPRF	5792	hgsc.bcm.edu	37	1	44086831	44086831	+	Silent	SNP	C	C	T	rs1143702	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:44086831C>T	ENST00000359947.4	+	33	5923	c.5583C>T	c.(5581-5583)taC>taT	p.Y1861Y	PTPRF_ENST00000422171.2_Silent_p.Y1220Y|PTPRF_ENST00000438120.1_Silent_p.Y1852Y|PTPRF_ENST00000372413.3_Silent_p.Y1852Y|PTPRF_ENST00000372414.3_Silent_p.Y1861Y|PTPRF_ENST00000496447.1_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1861	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCATGCGCTACGAGGGCGTGG	0.617													c|||	2857	0.570487	0.5507	0.5014	5008	,	,		22363	0.6855		0.6441	False		,,,				2504	0.4519																0								T	,	2561,1845	634.9+/-396.3	749,1063,391	85.0	67.0	73.0		5583,5556	-9.5	0.2	1	dbSNP_86	73	5727,2873	672.1+/-402.9	1938,1851,511	no	coding-synonymous,coding-synonymous	PTPRF	NM_002840.3,NM_130440.2	,	2687,2914,902	TT,TC,CC		33.407,41.8747,36.2756	,	1861/1908,1852/1899	44086831	8288,4718	2203	4300	6503	SO:0001819	synonymous_variant	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.5583C>T	1.37:g.44086831C>T		Somatic		WXS	SOLID	Phase_I	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	1276|1276	0.5842490842490843|0.5842490842490843	270|270	0.5487804878048781|0.5487804878048781	199|199	0.5497237569060773|0.5497237569060773	357|357	0.6241258741258742|0.6241258741258742	450|450	0.5936675461741425|0.5936675461741425	c|c	7.649|7.649	0.682443|0.682443	0.14907|0.14907	0.581253|0.581253	0.66593|0.66593	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895	.|.	.|.	.|.	4.76|4.76	-9.52|-9.52	0.00578|0.00578	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00012	.|0.0000	.|.	.|.	.|.	0.09310|0.09310	P|P	1.0|1.0	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.01202	.|-1.1420	.|3	.|.	.|.	.|.	.|.	15.3071|15.3071	0.74001|0.74001	0.0:0.3821:0.0:0.6179|0.0:0.3821:0.0:0.6179	rs1143702;rs7517450;rs17849120;rs1143702|rs1143702;rs7517450;rs17849120;rs1143702	.|.	.|.	.|.	X|M	1245;1286|1507	.|.	.|.	R|T	+|+	1|2	2|0	PTPRF|PTPRF	43859418|43859418	0.000000|0.000000	0.05858|0.05858	0.150000|0.150000	0.22450|0.22450	0.932000|0.932000	0.56968|0.56968	-2.838000|-2.838000	0.00739|0.00739	-2.452000|-2.452000	0.00542|0.00542	-2.203000|-2.203000	0.00303|0.00303	CGA|ACG		0.617	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			
PTCH2	8643	hgsc.bcm.edu	37	1	45292921	45292921	+	Missense_Mutation	SNP	C	C	A	rs112613379	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:45292921C>A	ENST00000372192.3	-	16	2562	c.2432G>T	c.(2431-2433)cGc>cTc	p.R811L	PTCH2_ENST00000447098.2_Missense_Mutation_p.R811L	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	811					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)	p.R811H(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					AGAGCCATTGCGGTACGAGTG	0.622									Basal Cell Nevus syndrome																																								1	Substitution - Missense(1)	large_intestine(1)											69.0	77.0	74.0					1																	45292921		2203	4300	6503	SO:0001583	missense	8643	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.2432G>T	1.37:g.45292921C>A	ENSP00000361266:p.Arg811Leu	Somatic		WXS	SOLID	Phase_I	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344047	0.41498	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.84146	-1.81;-1.81	4.93	4.93	0.64822	.	0.131649	0.35320	N	0.003285	T	0.80177	0.4575	L	0.35854	1.095	0.54753	D	0.999984	B;B	0.15473	0.011;0.013	B;B	0.15870	0.013;0.014	T	0.74287	-0.3714	10	0.25751	T	0.34	-17.3707	18.5308	0.90992	0.0:1.0:0.0:0.0	.	811;811	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	L	811	ENSP00000389703:R811L;ENSP00000361266:R811L	ENSP00000361266:R811L	R	-	2	0	PTCH2	45065508	0.997000	0.39634	1.000000	0.80357	0.979000	0.70002	1.403000	0.34612	2.445000	0.82738	0.557000	0.71058	CGC		0.622	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4		NM_003738	
RASGRP4	115727	hgsc.bcm.edu;ucsc.edu	37	19	38904103	38904103	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:38904103G>T	ENST00000587738.1	-	10	1312	c.1242C>A	c.(1240-1242)gaC>gaA	p.D414E	RASGRP4_ENST00000293062.9_Missense_Mutation_p.D317E|RASGRP4_ENST00000587753.1_Missense_Mutation_p.D345E|RASGRP4_ENST00000586305.1_Missense_Mutation_p.D400E|RASGRP4_ENST00000426920.2_Missense_Mutation_p.D225E|RASGRP4_ENST00000433821.2_Missense_Mutation_p.D322E|RASGRP4_ENST00000454404.2_Missense_Mutation_p.D380E			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	414	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGTAGAAGAGGTCCAGGGAGA	0.617																																																	0													29.0	37.0	35.0					19																	38904103		2023	4169	6192	SO:0001583	missense	115727			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1242C>A	19.37:g.38904103G>T	ENSP00000465772:p.Asp414Glu	Somatic		WXS	SOLID	Phase_I	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	ENST00000587738.1	37	CCDS46068.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544151	0.65198	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000405332;ENST00000454404	T;T;T	0.66280	-0.2;-0.2;-0.2	5.25	3.19	0.36642	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.094050	0.64402	D	0.000001	T	0.71341	0.3328	L	0.56769	1.78	0.43559	D	0.995873	D;P;D;D;D;D;D	0.89917	0.999;0.55;1.0;0.999;0.999;1.0;0.999	D;P;D;D;D;D;D	0.97110	0.991;0.573;0.998;0.991;0.991;1.0;0.991	T	0.68704	-0.5338	10	0.54805	T	0.06	-19.6276	7.4051	0.26985	0.8162:0.0:0.1838:0.0	.	225;317;322;380;345;400;414	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	E	322;317;225;414;414	ENSP00000411878:D322E;ENSP00000293062:D317E;ENSP00000445966:D225E	ENSP00000293062:D317E	D	-	3	2	RASGRP4	43595943	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.059000	0.30517	0.469000	0.27268	-0.302000	0.09304	GAC		0.617	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1		NM_170604	
SCAF8	22828	hgsc.bcm.edu	37	6	155145481	155145481	+	Silent	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:155145481A>G	ENST00000367178.3	+	17	2616	c.2040A>G	c.(2038-2040)agA>agG	p.R680R	SCAF8_ENST00000417268.1_Silent_p.R680R|RNU6-824P_ENST00000363724.1_RNA|SCAF8_ENST00000367186.4_Silent_p.R746R	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	680	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						CTTTTTTAAGAGCAAGTTTTA	0.413																																																	0													173.0	172.0	172.0					6																	155145481		2203	4300	6503	SO:0001819	synonymous_variant	0			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2040A>G	6.37:g.155145481A>G		Somatic		WXS	SOLID	Phase_I	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	CCDS5247.1																																																																																				0.413	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1		NM_014892	
RBM23	55147	hgsc.bcm.edu	37	14	23371268	23371268	+	Silent	SNP	A	A	G	rs56708790	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr14:23371268A>G	ENST00000359890.3	-	12	1362	c.1167T>C	c.(1165-1167)gcT>gcC	p.A389A	RBM23_ENST00000346528.5_Silent_p.A355A|RBM23_ENST00000399922.2_Silent_p.A373A|RBM23_ENST00000542016.2_Silent_p.A219A|RBM23_ENST00000555209.1_Silent_p.A139A	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	389	Ala-rich.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		cggcggcggcagcagcagcag	0.552													A|||	195	0.0389377	0.0053	0.0778	5008	,	,		16698	0.0179		0.0676	False		,,,				2504	0.0491																0								A	,,	54,3898		1,52,1923	34.0	35.0	35.0		1167,1065,1119	-2.4	0.4	14	dbSNP_129	35	529,7793		7,515,3639	yes	coding-synonymous,coding-synonymous,coding-synonymous	RBM23	NM_001077351.1,NM_001077352.1,NM_018107.4	,,	8,567,5562	GG,GA,AA		6.3566,1.3664,4.7499	,,	389/440,355/406,373/424	23371268	583,11691	1976	4161	6137	SO:0001819	synonymous_variant	55147			AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.1167T>C	14.37:g.23371268A>G		Somatic		WXS	SOLID	Phase_I	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Silent	SNP	ENST00000359890.3	37	CCDS41921.1	252	0.11538461538461539	8	0.016260162601626018	50	0.13812154696132597	73	0.12762237762237763	121	0.15963060686015831	A	0.768	-0.766868	0.02974	0.013664	0.063566	ENSG00000100461	ENST00000553884	.	.	.	3.36	-2.38	0.06622	.	.	.	.	.	T	0.00300	0.0009	.	.	.	0.53005	D	0.999961	.	.	.	.	.	.	T	0.04294	-1.0962	4	.	.	.	.	8.3885	0.32514	0.37:0.0:0.63:0.0	rs56708790;rs61730800	.	.	.	R	164	.	.	C	-	1	0	RBM23	22441108	0.115000	0.22152	0.443000	0.26883	0.195000	0.23768	0.047000	0.14056	-0.453000	0.07076	0.402000	0.26972	TGC		0.552	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3			
RINL	126432	hgsc.bcm.edu	37	19	39361237	39361237	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:39361237C>A	ENST00000591812.1	-	8	1083	c.997G>T	c.(997-999)Ggg>Tgg	p.G333W	RINL_ENST00000602238.1_5'UTR|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000340740.3_Missense_Mutation_p.G219W|RINL_ENST00000598904.1_Missense_Mutation_p.G219W			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	333					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						TTGGGGAGCCCAGGACCCCTG	0.597																																																	0													47.0	46.0	47.0					19																	39361237		2203	4300	6503	SO:0001583	missense	126432			AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.997G>T	19.37:g.39361237C>A	ENSP00000467107:p.Gly333Trp	Somatic		WXS	SOLID	Phase_I	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637575	0.29157	.	.	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.29655	1.56	5.09	-1.32	0.09201	.	0.755486	0.12778	N	0.439920	T	0.29652	0.0740	L	0.29908	0.895	0.09310	N	1	D;D	0.63046	0.992;0.992	P;P	0.58577	0.841;0.841	T	0.13764	-1.0497	10	0.46703	T	0.11	-15.6663	4.328	0.11050	0.0:0.3299:0.359:0.311	.	333;219	B4DPG5;Q6ZS11	.;RINL_HUMAN	W	219	ENSP00000340369:G219W	ENSP00000340369:G219W	G	-	1	0	RINL	44053077	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.038000	0.12144	0.031000	0.15407	0.484000	0.47621	GGG		0.597	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1		NM_198445	
RPL7L1	285855	hgsc.bcm.edu	37	6	42853798	42853798	+	Missense_Mutation	SNP	A	A	G	rs368319057		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:42853798A>G	ENST00000493763.1	+	5	812	c.509A>G	c.(508-510)aAt>aGt	p.N170S	RPL7L1_ENST00000304734.5_Missense_Mutation_p.N170S|RPL7L1_ENST00000602561.1_Missense_Mutation_p.N170S|RPL7L1_ENST00000424341.2_Intron|RPL7L1_ENST00000397415.3_3'UTR	NM_198486.2	NP_940888.2	Q6DKI1	RL7L_HUMAN	ribosomal protein L7-like 1	170						ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6	Colorectal(47;0.196)		Colorectal(64;0.00237)|all cancers(41;0.00288)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.088)			CTGACAGACAATACAGTGATT	0.453																																																	0								A	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	54.0	55.0	54.0		509	5.9	1.0	6		54	0,8600		0,0,4300	no	missense	RPL7L1	NM_198486.2	46	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging	170/247	42853798	1,13005	2203	4300	6503	SO:0001583	missense	285855				CCDS4873.1	6p21.1	2011-01-14			ENSG00000146223	ENSG00000146223		"""L ribosomal proteins"""	21370	protein-coding gene	gene with protein product							Standard	NM_198486		Approved	dJ475N16.4	uc003osq.1	Q6DKI1	OTTHUMG00000014710	ENST00000493763.1:c.509A>G	6.37:g.42853798A>G	ENSP00000418221:p.Asn170Ser	Somatic		WXS	SOLID	Phase_I	A8K7D4|B7Z652|Q5TFZ5|Q6PEK3	Missense_Mutation	SNP	ENST00000493763.1	37	CCDS4873.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.052526	0.75960	2.27E-4	0.0	ENSG00000146223	ENST00000493763;ENST00000304734	.	.	.	5.87	5.87	0.94306	Ribosomal protein L30, ferredoxin-like fold domain (1);	0.000000	0.85682	D	0.000000	T	0.60183	0.2249	M	0.94021	3.485	0.80722	D	1	P	0.38617	0.64	B	0.29716	0.106	T	0.73764	-0.3880	9	0.87932	D	0	.	14.5226	0.67863	1.0:0.0:0.0:0.0	.	170	Q6DKI1	RL7L_HUMAN	S	170	.	ENSP00000346063:N170S	N	+	2	0	RPL7L1	42961776	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.801000	0.91905	2.371000	0.80710	0.533000	0.62120	AAT		0.453	RPL7L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314417.1		XM_209769	
SCN8A	6334	hgsc.bcm.edu	37	12	52162982	52162982	+	Missense_Mutation	SNP	A	A	G	rs538883540		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr12:52162982A>G	ENST00000354534.6	+	17	3413	c.3235A>G	c.(3235-3237)Att>Gtt	p.I1079V	SCN8A_ENST00000545061.1_Missense_Mutation_p.I1079V	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1079					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GAAGTACATCATTGATGAGGA	0.527													A|||	1	0.000199681	0.0	0.0	5008	,	,		21948	0.0		0.001	False		,,,				2504	0.0																0													85.0	83.0	84.0					12																	52162982		2203	4299	6502	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3235A>G	12.37:g.52162982A>G	ENSP00000346534:p.Ile1079Val	Somatic		WXS	SOLID	Phase_I	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	A	9.261	1.043306	0.19748	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.83591	-1.74;-1.74;-1.74	5.09	5.09	0.68999	Sodium ion transport-associated (1);	0.136685	0.52532	D	0.000074	T	0.77061	0.4075	L	0.41124	1.26	0.58432	D	0.999997	B;B	0.24823	0.068;0.112	B;B	0.25140	0.051;0.058	T	0.72523	-0.4267	10	0.26408	T	0.33	.	15.3346	0.74241	1.0:0.0:0.0:0.0	.	1079;1079	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	V	1079;1079;1079;992	ENSP00000346534:I1079V;ENSP00000440360:I1079V;ENSP00000347255:I1079V	ENSP00000346534:I1079V	I	+	1	0	SCN8A	50449249	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.385000	0.79763	2.272000	0.75746	0.460000	0.39030	ATT		0.527	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3		NM_014191	
SLC6A16	28968	hgsc.bcm.edu;ucsc.edu	37	19	49793633	49793633	+	Missense_Mutation	SNP	C	C	T	rs368464579		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:49793633C>T	ENST00000335875.4	-	12	2199	c.1958G>A	c.(1957-1959)cGa>cAa	p.R653Q	SLC6A16_ENST00000454748.3_3'UTR	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	653					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		TGGGTATGGTCGAAGCACCTC	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		19731	0.0		0.001	False		,,,				2504	0.0																0								C	GLN/ARG	0,3894		0,0,1947	63.0	61.0	61.0		1958	0.2	0.0	19		61	2,8294		0,2,4146	no	missense	SLC6A16	NM_014037.2	43	0,2,6093	TT,TC,CC		0.0241,0.0,0.0164	possibly-damaging	653/737	49793633	2,12188	1947	4148	6095	SO:0001583	missense	28968			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1958G>A	19.37:g.49793633C>T	ENSP00000338627:p.Arg653Gln	Somatic		WXS	SOLID	Phase_I	Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.784116	0.31593	0.0	2.41E-4	ENSG00000063127	ENST00000335875	T	0.74315	-0.83	5.1	0.211	0.15236	.	0.655328	0.14301	N	0.328256	T	0.49372	0.1553	N	0.21617	0.685	0.09310	N	1	P	0.50272	0.933	B	0.37780	0.258	T	0.43572	-0.9383	10	0.22109	T	0.4	.	3.7789	0.08673	0.1683:0.5579:0.0:0.2738	.	653	Q9GZN6	S6A16_HUMAN	Q	653	ENSP00000338627:R653Q	ENSP00000338627:R653Q	R	-	2	0	SLC6A16	54485445	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.007000	0.13174	0.386000	0.24997	-0.208000	0.12717	CGA		0.488	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2		NM_014037	
SMU1	55234	hgsc.bcm.edu	37	9	33073680	33073680	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr9:33073680T>C	ENST00000397149.3	-	2	201	c.151A>G	c.(151-153)Att>Gtt	p.I51V	SMU1_ENST00000536631.1_Intron	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	51	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		CCACTGTTAATGTCAGCCACA	0.468																																																	0													143.0	122.0	129.0					9																	33073680		2203	4300	6503	SO:0001583	missense	55234			AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.151A>G	9.37:g.33073680T>C	ENSP00000380336:p.Ile51Val	Somatic		WXS	SOLID	Phase_I	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Missense_Mutation	SNP	ENST00000397149.3	37	CCDS6534.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.681391	0.47991	.	.	ENSG00000122692	ENST00000397149	T	0.45668	0.89	5.35	5.35	0.76521	CTLH, C-terminal LisH motif (2);	0.000000	0.85682	D	0.000000	T	0.35566	0.0936	L	0.39633	1.23	0.80722	D	1	B;B	0.28470	0.213;0.213	B;B	0.31442	0.13;0.13	T	0.12451	-1.0547	10	0.21540	T	0.41	-0.5175	13.5871	0.61937	0.0:0.0:0.0:1.0	.	51;51	A0MNN4;Q2TAY7	.;SMU1_HUMAN	V	51	ENSP00000380336:I51V	ENSP00000380336:I51V	I	-	1	0	SMU1	33063680	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.103000	0.71492	2.151000	0.67156	0.460000	0.39030	ATT		0.468	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052022.1		NM_018225	
SNCAIP	9627	hgsc.bcm.edu	37	5	121758633	121758633	+	Silent	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr5:121758633T>C	ENST00000261368.8	+	4	463	c.201T>C	c.(199-201)gcT>gcC	p.A67A	SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000504884.2_Intron|SNCAIP_ENST00000379533.2_Silent_p.A114A|SNCAIP_ENST00000261367.7_Silent_p.A114A|SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000379536.2_Silent_p.A67A|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000503116.2_Silent_p.A114A	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	67					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		CAGGAATCGCTGATGTGTACA	0.418																																																	0													63.0	65.0	64.0					5																	121758633		2203	4300	6503	SO:0001819	synonymous_variant	9627			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.201T>C	5.37:g.121758633T>C		Somatic		WXS	SOLID	Phase_I	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	ENST00000261368.8	37	CCDS4131.1																																																																																				0.418	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1			
SOS1	6654	hgsc.bcm.edu	37	2	39285899	39285899	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:39285899A>T	ENST00000426016.1	-	4	346	c.260T>A	c.(259-261)aTa>aAa	p.I87K	SOS1_ENST00000395038.2_Missense_Mutation_p.I87K|SOS1_ENST00000428721.2_Missense_Mutation_p.I30K|SOS1_ENST00000402219.2_Missense_Mutation_p.I87K			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	87					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GGCATCAGCTATTGCCCATTT	0.338									Noonan syndrome																																								0													77.0	79.0	78.0					2																	39285899		2203	4300	6503	SO:0001583	missense	6654	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.260T>A	2.37:g.39285899A>T	ENSP00000387784:p.Ile87Lys	Somatic		WXS	SOLID	Phase_I	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	A	32	5.111233	0.94339	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721;ENST00000451331	D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84	5.75	5.75	0.90469	Histone-fold (2);	0.000000	0.85682	D	0.000000	D	0.92090	0.7493	M	0.79805	2.47	0.80722	D	1	P	0.51537	0.946	D	0.63703	0.917	D	0.93054	0.6468	10	0.87932	D	0	.	16.0707	0.80928	1.0:0.0:0.0:0.0	.	87	Q07889	SOS1_HUMAN	K	87;87;87;87;30;30	ENSP00000387784:I87K;ENSP00000384675:I87K;ENSP00000378479:I87K;ENSP00000399992:I30K;ENSP00000393899:I30K	ENSP00000263879:I87K	I	-	2	0	SOS1	39139403	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.210000	0.95106	2.194000	0.70268	0.533000	0.62120	ATA		0.338	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3		NM_005633	
SPTBN2	6712	hgsc.bcm.edu	37	11	66466957	66466957	+	Silent	SNP	C	C	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:66466957C>T	ENST00000533211.1	-	18	4027	c.3696G>A	c.(3694-3696)ctG>ctA	p.L1232L	SPTBN2_ENST00000309996.2_Silent_p.L1232L|SPTBN2_ENST00000529997.1_Silent_p.L1232L			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1232					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GGCCAGCCTCCAGGAGCCCGT	0.562																																																	0													93.0	89.0	90.0					11																	66466957		2200	4295	6495	SO:0001819	synonymous_variant	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3696G>A	11.37:g.66466957C>T		Somatic		WXS	SOLID	Phase_I	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																				0.562	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2		NM_006946	
SPTBN2	6712	hgsc.bcm.edu;ucsc.edu	37	11	66483325	66483325	+	Silent	SNP	G	G	A	rs34117933	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:66483325G>A	ENST00000533211.1	-	4	616	c.285C>T	c.(283-285)ctC>ctT	p.L95L	RN7SL12P_ENST00000473849.2_RNA|SPTBN2_ENST00000309996.2_Silent_p.L95L|SPTBN2_ENST00000529997.1_Silent_p.L95L			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	95	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						AGAGCACCTCGAGGAGCCTCA	0.627													G|||	54	0.0107827	0.0393	0.0029	5008	,	,		16670	0.0		0.0	False		,,,				2504	0.0																0								G		131,4269	93.9+/-132.6	5,121,2074	57.0	52.0	53.0		285	-1.9	1.0	11	dbSNP_126	53	1,8589	1.2+/-3.3	0,1,4294	no	coding-synonymous	SPTBN2	NM_006946.2		5,122,6368	AA,AG,GG		0.0116,2.9773,1.0162		95/2391	66483325	132,12858	2200	4295	6495	SO:0001819	synonymous_variant	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.285C>T	11.37:g.66483325G>A		Somatic		WXS	SOLID	Phase_I	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																				0.627	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2		NM_006946	
SRP72	6731	hgsc.bcm.edu;ucsc.edu	37	4	57366826	57366826	+	Silent	SNP	G	G	C	rs143643243	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr4:57366826G>C	ENST00000342756.5	+	18	2524	c.1803G>C	c.(1801-1803)ggG>ggC	p.G601G	SRP72_ENST00000510663.1_Silent_p.G540G	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	601					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					TTGGAAAAGGGACCCAGGGAG	0.453																																																	0													51.0	50.0	50.0					4																	57366826		2203	4300	6503	SO:0001819	synonymous_variant	6731			AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.1803G>C	4.37:g.57366826G>C		Somatic		WXS	SOLID	Phase_I	G5E9Z8|Q7Z3C0	Silent	SNP	ENST00000342756.5	37	CCDS3506.1																																																																																				0.453	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7			
SRPK2	6733	hgsc.bcm.edu	37	7	104783695	104783695	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr7:104783695T>C	ENST00000393651.3	-	10	983	c.896A>G	c.(895-897)cAg>cGg	p.Q299R	SRPK2_ENST00000357311.3_Missense_Mutation_p.Q288R|SRPK2_ENST00000489828.1_Missense_Mutation_p.Q288R	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						TTCTATCTCCTGCAGGCGCTT	0.403																																																	0													95.0	89.0	91.0					7																	104783695		2203	4300	6503	SO:0001583	missense	6733			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.896A>G	7.37:g.104783695T>C	ENSP00000377262:p.Gln299Arg	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000393651.3	37	CCDS34724.1	.	.	.	.	.	.	.	.	.	.	T	16.83	3.230794	0.58777	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828	T;T;T	0.21734	1.99;1.99;1.99	5.68	5.68	0.88126	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.147331	0.47093	D	0.000242	T	0.18087	0.0434	L	0.41124	1.26	0.41806	D	0.989944	P;B	0.41265	0.744;0.396	B;B	0.35114	0.196;0.067	T	0.03306	-1.1050	10	0.28530	T	0.3	-18.3957	15.9347	0.79694	0.0:0.0:0.0:1.0	.	299;288	P78362-2;P78362	.;SRPK2_HUMAN	R	299;288;288	ENSP00000377262:Q299R;ENSP00000349863:Q288R;ENSP00000419791:Q288R	ENSP00000349863:Q288R	Q	-	2	0	SRPK2	104570931	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.366000	0.59492	2.167000	0.68274	0.454000	0.30748	CAG		0.403	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348723.1		NM_182691	
SSR2	6746	hgsc.bcm.edu	37	1	155979424	155979424	+	Silent	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:155979424A>G	ENST00000295702.4	-	6	530	c.459T>C	c.(457-459)ttT>ttC	p.F153F	SSR2_ENST00000480567.1_Silent_p.F153F|SSR2_ENST00000496742.1_Missense_Mutation_p.L84S|SSR2_ENST00000529008.1_Missense_Mutation_p.L91S	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	153					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCATGACCCCAAAGGCTGCCC	0.493																																																	0													98.0	91.0	94.0					1																	155979424		2203	4300	6503	SO:0001819	synonymous_variant	6746			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.459T>C	1.37:g.155979424A>G		Somatic		WXS	SOLID	Phase_I	B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Silent	SNP	ENST00000295702.4	37	CCDS1126.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109831	0.77096	.	.	ENSG00000163479	ENST00000529008;ENST00000496742	.	.	.	6.07	-7.31	0.01441	.	.	.	.	.	T	0.51024	0.1650	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66536	-0.5899	5	0.34782	T	0.22	-19.4507	15.6967	0.77506	0.8155:0.0:0.1845:0.0	.	.	.	.	S	91;84	.	ENSP00000436201:L84S	L	-	2	0	SSR2	154246048	0.989000	0.36119	0.721000	0.30653	0.993000	0.82548	0.202000	0.17295	-1.512000	0.01791	-0.290000	0.09829	TTG		0.493	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046172.2		NM_003145	
SYCP3	50511	hgsc.bcm.edu;ucsc.edu	37	12	102125403	102125403	+	Silent	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr12:102125403T>C	ENST00000392927.3	-	7	626	c.495A>G	c.(493-495)agA>agG	p.R165R	SYCP3_ENST00000266743.2_Silent_p.R165R|SYCP3_ENST00000392924.1_Silent_p.R165R	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	165	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TCTGAACAATTCTAGATTGTT	0.264																																																	0													62.0	61.0	61.0					12																	102125403		2202	4278	6480	SO:0001819	synonymous_variant	50511			AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.495A>G	12.37:g.102125403T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000392927.3	37	CCDS9087.1																																																																																				0.264	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2		NM_153694	
TGM3	7053	hgsc.bcm.edu	37	20	2291724	2291724	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:2291724C>G	ENST00000381458.5	+	4	552	c.489C>G	c.(487-489)atC>atG	p.I163M		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	163			I -> L (in dbSNP:rs6048066). {ECO:0000269|Ref.3}.		cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	CCGGCATCATCTTTGTGGGAA	0.453																																																	0													155.0	146.0	149.0					20																	2291724		2203	4300	6503	SO:0001583	missense	7053			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.489C>G	20.37:g.2291724C>G	ENSP00000370867:p.Ile163Met	Somatic		WXS	SOLID	Phase_I	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	ENST00000381458.5	37	CCDS33435.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.236233	0.39498	.	.	ENSG00000125780	ENST00000381458;ENST00000420960	D	0.89552	-2.53	5.71	-0.378	0.12497	.	0.243134	0.42821	N	0.000652	D	0.92538	0.7630	M	0.88181	2.935	0.42409	D	0.992591	D	0.76494	0.999	D	0.91635	0.999	D	0.88006	0.2759	10	0.87932	D	0	.	1.4732	0.02420	0.2551:0.4047:0.1134:0.2267	.	163	Q08188	TGM3_HUMAN	M	163	ENSP00000370867:I163M	ENSP00000370867:I163M	I	+	3	3	TGM3	2239724	0.991000	0.36638	0.472000	0.27241	0.435000	0.31806	0.331000	0.19733	0.069000	0.16605	-0.315000	0.08773	ATC		0.453	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2		NM_003245	
TMC2	117532	hgsc.bcm.edu;ucsc.edu	37	20	2577832	2577832	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:2577832G>A	ENST00000358864.1	+	10	1127	c.1112G>A	c.(1111-1113)gGg>gAg	p.G371E		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	371					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						ACAGGCGAAGGGGAGAGTGAC	0.522																																																	0													139.0	105.0	117.0					20																	2577832		2203	4300	6503	SO:0001583	missense	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1112G>A	20.37:g.2577832G>A	ENSP00000351732:p.Gly371Glu	Somatic		WXS	SOLID	Phase_I	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642374	0.47153	.	.	ENSG00000149488	ENST00000358864	T	0.53640	0.61	5.43	4.48	0.54585	.	0.049676	0.85682	N	0.000000	T	0.51941	0.1704	M	0.69823	2.125	0.58432	D	0.999999	B;B;B;B	0.34147	0.058;0.017;0.326;0.438	B;B;B;B	0.39419	0.076;0.016;0.299;0.242	T	0.57670	-0.7771	10	0.72032	D	0.01	-15.6317	12.5458	0.56199	0.0821:0.0:0.9179:0.0	.	202;203;371;371	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	E	371	ENSP00000351732:G371E	ENSP00000351732:G371E	G	+	2	0	TMC2	2525832	1.000000	0.71417	0.990000	0.47175	0.930000	0.56654	5.820000	0.69250	1.433000	0.47394	0.655000	0.94253	GGG		0.522	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2			
CATSPERD	257062	hgsc.bcm.edu	37	19	5727334	5727334	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:5727334A>T	ENST00000381624.3	+	3	243	c.182A>T	c.(181-183)aAa>aTa	p.K61I	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	61					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CCTTGCGAGAAAAATATAGCA	0.323																																																	0													99.0	93.0	95.0					19																	5727334		1818	4075	5893	SO:0001583	missense	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.182A>T	19.37:g.5727334A>T	ENSP00000371037:p.Lys61Ile	Somatic		WXS	SOLID	Phase_I	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	A	8.839	0.941752	0.18281	.	.	ENSG00000174898	ENST00000381624	T	0.24350	1.86	3.0	-0.36	0.12568	.	.	.	.	.	T	0.30603	0.0770	L	0.57536	1.79	0.19300	N	0.999971	D	0.57899	0.981	P	0.51550	0.673	T	0.15694	-1.0428	9	0.59425	D	0.04	.	5.7853	0.18331	0.5316:0.0:0.4684:0.0	.	61	Q86XM0	TM146_HUMAN	I	61	ENSP00000371037:K61I	ENSP00000371037:K61I	K	+	2	0	TMEM146	5678334	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	0.622000	0.24433	-0.139000	0.11414	-0.456000	0.05471	AAA		0.323	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2		NM_152784	
TMEM74	157753	hgsc.bcm.edu;ucsc.edu	37	8	109796776	109796776	+	Silent	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr8:109796776G>A	ENST00000297459.3	-	2	730	c.552C>T	c.(550-552)ttC>ttT	p.F184F	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	184					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			CAGTGACCAAGAACAAGATGG	0.517																																																	0													109.0	99.0	102.0					8																	109796776		2203	4300	6503	SO:0001819	synonymous_variant	157753			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.552C>T	8.37:g.109796776G>A		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000297459.3	37	CCDS6310.1																																																																																				0.517	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1		NM_153015	
TSHZ2	128553	hgsc.bcm.edu	37	20	51872581	51872581	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr20:51872581T>C	ENST00000371497.5	+	2	3471	c.2584T>C	c.(2584-2586)Tcg>Ccg	p.S862P	TSHZ2_ENST00000329613.6_Missense_Mutation_p.S859P|TSHZ2_ENST00000603338.2_Missense_Mutation_p.S859P|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	862					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CCAGTTTGCCTCGAGCCTCTT	0.488																																																	0													59.0	60.0	60.0					20																	51872581		2203	4300	6503	SO:0001583	missense	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2584T>C	20.37:g.51872581T>C	ENSP00000360552:p.Ser862Pro	Somatic		WXS	SOLID	Phase_I	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.800054	0.50208	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.21932	1.98;1.98	5.52	5.52	0.82312	Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.40791	0.1131	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.23440	-1.0188	10	0.87932	D	0	1.1679	15.657	0.77144	0.0:0.0:0.0:1.0	.	862	Q9NRE2	TSH2_HUMAN	P	862;859;388	ENSP00000360552:S862P;ENSP00000333114:S859P	ENSP00000333114:S859P	S	+	1	0	TSHZ2	51305988	1.000000	0.71417	0.996000	0.52242	0.478000	0.33099	7.693000	0.84214	2.096000	0.63516	0.523000	0.50628	TCG		0.488	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6		NM_173485	
TSPAN9	10867	hgsc.bcm.edu;ucsc.edu	37	12	3388212	3388212	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr12:3388212T>A	ENST00000011898.5	+	5	471	c.310T>A	c.(310-312)Ttc>Atc	p.F104I	TSPAN9_ENST00000492305.1_3'UTR|TSPAN9_ENST00000407263.1_Missense_Mutation_p.F104I|TSPAN9_ENST00000537971.1_Missense_Mutation_p.F104I	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	104						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			ACTCATCCTCTTCTTTGTCTA	0.537																																																	0													203.0	160.0	175.0					12																	3388212		2203	4300	6503	SO:0001583	missense	10867			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.310T>A	12.37:g.3388212T>A	ENSP00000011898:p.Phe104Ile	Somatic		WXS	SOLID	Phase_I	D3DUQ7|Q53FV2|Q6FGJ8	Missense_Mutation	SNP	ENST00000011898.5	37	CCDS8520.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.893972	0.91889	.	.	ENSG00000011105	ENST00000537971;ENST00000011898;ENST00000407263	T;T;T	0.78126	-1.15;-1.15;-1.15	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.77791	0.4183	L	0.47078	1.49	0.80722	D	1	P	0.44429	0.835	P	0.49477	0.612	T	0.76602	-0.2899	9	.	.	.	.	13.1487	0.59478	0.0:0.0:0.0:1.0	.	104	O75954	TSN9_HUMAN	I	104	ENSP00000444799:F104I;ENSP00000011898:F104I;ENSP00000384488:F104I	.	F	+	1	0	TSPAN9	3258473	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.990000	0.88215	1.997000	0.58415	0.379000	0.24179	TTC		0.537	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317606.2		NM_006675	
TTC21B	79809	hgsc.bcm.edu;ucsc.edu	37	2	166788344	166788344	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr2:166788344A>C	ENST00000243344.7	-	8	955	c.818T>G	c.(817-819)tTg>tGg	p.L273W	AC010127.5_ENST00000443032.1_RNA|AC010127.5_ENST00000440322.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	273					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TGTATTTCCCAAGTTTTCCAG	0.378																																																	0													138.0	125.0	129.0					2																	166788344		2203	4300	6503	SO:0001583	missense	79809			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.818T>G	2.37:g.166788344A>C	ENSP00000243344:p.Leu273Trp	Somatic		WXS	SOLID	Phase_I	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	37	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.136640	0.56936	.	.	ENSG00000123607	ENST00000243344	T	0.52526	0.66	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.73651	0.3614	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.79759	-0.1668	10	0.87932	D	0	-7.5671	15.2362	0.73432	1.0:0.0:0.0:0.0	.	273;273	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	W	273	ENSP00000243344:L273W	ENSP00000243344:L273W	L	-	2	0	TTC21B	166496590	1.000000	0.71417	0.950000	0.38849	0.104000	0.19210	4.698000	0.61789	2.066000	0.61787	0.533000	0.62120	TTG		0.378	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1		NM_024753	
UBE2O	63893	hgsc.bcm.edu;ucsc.edu	37	17	74398736	74398736	+	Silent	SNP	C	C	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr17:74398736C>T	ENST00000319380.7	-	4	697	c.633G>A	c.(631-633)ggG>ggA	p.G211G		NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	211					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						CGTAGACCTTCCCCAGCCAGC	0.557																																																	0													193.0	163.0	174.0					17																	74398736		2203	4300	6503	SO:0001819	synonymous_variant	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.633G>A	17.37:g.74398736C>T		Somatic		WXS	SOLID	Phase_I	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Silent	SNP	ENST00000319380.7	37	CCDS32742.1																																																																																				0.557	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1		NM_022066	
USP9X	8239	hgsc.bcm.edu	37	X	41025293	41025293	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chrX:41025293C>A	ENST00000324545.8	+	16	2787	c.2154C>A	c.(2152-2154)gaC>gaA	p.D718E	USP9X_ENST00000378308.2_Missense_Mutation_p.D718E	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	718					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TTAATAAGGACTTCTTTGAAA	0.388																																					Ovarian(172;1807 2695 35459 49286)												0													143.0	136.0	138.0					X																	41025293		2203	4300	6503	SO:0001583	missense	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.2154C>A	X.37:g.41025293C>A	ENSP00000316357:p.Asp718Glu	Somatic		WXS	SOLID	Phase_I	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530323	0.27387	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03004	4.08;4.08	5.02	2.26	0.28386	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.02494	0.0076	L	0.27053	0.805	0.51012	D	0.9999	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.002	T	0.41179	-0.9523	10	0.06494	T	0.89	.	9.2475	0.37536	0.0:0.6882:0.0:0.3118	.	718;718	Q93008-1;Q93008	.;USP9X_HUMAN	E	718	ENSP00000367558:D718E;ENSP00000316357:D718E	ENSP00000316357:D718E	D	+	3	2	USP9X	40910237	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.580000	0.46068	0.467000	0.27218	-0.853000	0.03031	GAC		0.388	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4		NM_004652	
VHL	7428	hgsc.bcm.edu	37	3	10188235	10188236	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr3:10188235_10188236insG	ENST00000256474.2	+	2	1218_1219	c.378_379insG	c.(379-381)gggfs	p.G127fs	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	127	Involved in binding to CCT complex.				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L128fs*31(2)|p.D126fs*4(2)|p.H125fs*27(1)|p.D126fs*5(1)|p.D126fs*32(1)|p.D126fs*33(1)|p.G127fs*5(1)|p.L128fs*4(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GGACACACGATGGGCTTCTGGT	0.5		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	10	Deletion - Frameshift(8)|Insertion - Frameshift(2)	kidney(10)																																								SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.381dupG	3.37:g.10188238_10188238dupG	ENSP00000256474:p.Gly127fs	Somatic		WXS	SOLID	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Ins	INS	ENST00000256474.2	37	CCDS2597.1																																																																																				0.500	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS13B	157680	hgsc.bcm.edu;ucsc.edu	37	8	100514007	100514007	+	Silent	SNP	T	T	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr8:100514007T>G	ENST00000358544.2	+	26	4074	c.3963T>G	c.(3961-3963)cgT>cgG	p.R1321R	VPS13B_ENST00000395996.1_Silent_p.R1321R|VPS13B_ENST00000357162.2_Silent_p.R1321R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1321					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCAGTGGACGTGTTAGTTTAT	0.423																																					Colon(161;2205 2542 7338 31318)												0													170.0	167.0	168.0					8																	100514007		2203	4300	6503	SO:0001819	synonymous_variant	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3963T>G	8.37:g.100514007T>G		Somatic		WXS	SOLID	Phase_I	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																				0.423	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	
VPS13C	54832	hgsc.bcm.edu;ucsc.edu	37	15	62173973	62173973	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr15:62173973G>C	ENST00000261517.5	-	70	9752	c.9679C>G	c.(9679-9681)Cct>Gct	p.P3227A	VPS13C_ENST00000249837.3_Missense_Mutation_p.P3184A|VPS13C_ENST00000558919.1_5'Flank|VPS13C_ENST00000395898.3_Missense_Mutation_p.P3184A|VPS13C_ENST00000395896.4_Missense_Mutation_p.P3227A	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GATTTTGGAGGGGCAACAGGA	0.294																																																	0													52.0	55.0	54.0					15																	62173973		2203	4297	6500	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.9679C>G	15.37:g.62173973G>C	ENSP00000261517:p.Pro3227Ala	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118081	0.77323	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.80033	-1.33;-1.33;-1.33	5.55	4.63	0.57726	.	0.055373	0.64402	N	0.000001	D	0.89897	0.6848	M	0.82823	2.61	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.78314	0.986;0.986;0.991;0.968	D	0.90102	0.4185	10	0.41790	T	0.15	.	16.4732	0.84124	0.0:0.1312:0.8688:0.0	.	3184;3227;3184;3227	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	A	3184;3227;3227;3227	ENSP00000249837:P3184A;ENSP00000261517:P3227A;ENSP00000379233:P3227A	ENSP00000249837:P3184A	P	-	1	0	VPS13C	59961265	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.617000	0.83032	1.328000	0.45358	0.557000	0.71058	CCT		0.294	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1		NM_017684	
WDFY4	57705	hgsc.bcm.edu;ucsc.edu	37	10	49983817	49983817	+	Silent	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr10:49983817A>T	ENST00000325239.5	+	14	2856	c.2829A>T	c.(2827-2829)tcA>tcT	p.S943S	WDFY4_ENST00000413659.2_Silent_p.S943S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	943						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TCCTTGATTCATCTCACACAC	0.448																																																	0													183.0	156.0	164.0					10																	49983817		692	1591	2283	SO:0001819	synonymous_variant	57705			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2829A>T	10.37:g.49983817A>T		Somatic		WXS	SOLID	Phase_I	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	A	4.912	0.169442	0.09339	.	.	ENSG00000128815	ENST00000312002	.	.	.	4.51	-2.47	0.06442	.	.	.	.	.	T	0.21427	0.0516	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28490	-1.0042	4	.	.	.	.	4.4582	0.11654	0.4816:0.0:0.3665:0.1518	.	.	.	.	F	34	.	.	I	+	1	0	WDFY4	49653823	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.426000	0.07008	-0.547000	0.06207	-0.250000	0.11733	ATC		0.448	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			XM_033379	
WDR17	116966	hgsc.bcm.edu	37	4	177094493	177094493	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr4:177094493A>T	ENST00000280190.4	+	27	3593	c.3437A>T	c.(3436-3438)gAa>gTa	p.E1146V	WDR17_ENST00000508596.1_Missense_Mutation_p.E1107V|WDR17_ENST00000507824.2_Missense_Mutation_p.E1121V|WDR17_ENST00000393643.2_Missense_Mutation_p.E1122V			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1146										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ATTCGTACTGAAAAATTACTC	0.338																																																	0													87.0	82.0	83.0					4																	177094493		2203	4300	6503	SO:0001583	missense	116966			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3437A>T	4.37:g.177094493A>T	ENSP00000280190:p.Glu1146Val	Somatic		WXS	SOLID	Phase_I	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.5|21.5	4.158437|4.158437	0.78114|0.78114	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	T;T;T|.	0.59083|.	0.32;0.35;0.29|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.123814|.	0.53938|.	D|.	0.000059|.	T|.	0.71634|.	0.3363|.	M|M	0.62723|0.62723	1.935|1.935	0.54753|0.54753	D|D	0.999983|0.999983	D;D;D|.	0.63880|.	0.987;0.987;0.993|.	P;P;P|.	0.54965|.	0.765;0.765;0.765|.	T|.	0.70757|.	-0.4785|.	10|.	0.72032|.	D|.	0.01|.	-25.8616|-25.8616	15.7271|15.7271	0.77770|0.77770	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1122;1107;1146|.	E7EP77;E7EQX0;Q8IZU2|.	.;.;WDR17_HUMAN|.	V|C	1107;1122;1146;1122|380	ENSP00000422763:E1107V;ENSP00000377258:E1122V;ENSP00000280190:E1146V|.	ENSP00000280190:E1146V|.	E|X	+|+	2|3	0|0	WDR17|WDR17	177331487|177331487	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.650000|0.650000	0.38633|0.38633	8.384000|8.384000	0.90160|0.90160	2.123000|2.123000	0.65237|0.65237	0.477000|0.477000	0.44152|0.44152	GAA|TGA		0.338	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2			
ZFYVE9	9372	hgsc.bcm.edu	37	1	52703736	52703736	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr1:52703736T>A	ENST00000371591.1	+	3	778	c.647T>A	c.(646-648)tTg>tAg	p.L216*	ZFYVE9_ENST00000287727.3_Nonsense_Mutation_p.L216*|ZFYVE9_ENST00000357206.2_Nonsense_Mutation_p.L216*	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	216					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						ATGGATCCATTGAATAGACCG	0.368																																																	0													78.0	81.0	80.0					1																	52703736		2203	4300	6503	SO:0001587	stop_gained	9372			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.647T>A	1.37:g.52703736T>A	ENSP00000360647:p.Leu216*	Somatic		WXS	SOLID	Phase_I	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Nonsense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.391661	0.62066	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	.	.	.	4.82	3.71	0.42584	.	0.410893	0.20183	N	0.097480	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4025	0.16303	0.0:0.1694:0.0:0.8306	.	.	.	.	X	216	.	ENSP00000287727:L216X	L	+	2	0	ZFYVE9	52476324	0.372000	0.25064	0.760000	0.31359	0.740000	0.42216	1.294000	0.33365	2.146000	0.66826	0.533000	0.62120	TTG		0.368	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1		NM_007324	
Unknown	0	hgsc.bcm.edu	37	6	28239931	28239932	+	IGR	INS	-	-	T	rs61622742		TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr6:28239931_28239932insT								NKAPL (11195 upstream) : PGBD1 (9381 downstream)																							TCTGTCAACAGTGCTACAGCCC	0.564																																																	0																																										SO:0001628	intergenic_variant	0																															6.37:g.28239932_28239932dupT		Somatic		WXS	SOLID	Phase_I		Frame_Shift_Ins	INS		37																																																																																				0	0.564									
ZNF195	7748	hgsc.bcm.edu;ucsc.edu	37	11	3380733	3380733	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr11:3380733A>G	ENST00000399602.4	-	6	1631	c.1505T>C	c.(1504-1506)aTc>aCc	p.I502T	ZNF195_ENST00000343338.7_Missense_Mutation_p.I434T|ZNF195_ENST00000354599.6_Missense_Mutation_p.I430T|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000526601.1_Missense_Mutation_p.I483T|ZNF195_ENST00000005082.9_Missense_Mutation_p.I479T|ZNF195_ENST00000429541.2_Missense_Mutation_p.I434T	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTGCTTAAAGATGTTGCCACA	0.418																																																	0													172.0	173.0	173.0					11																	3380733		2050	4216	6266	SO:0001583	missense	7748				CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1505T>C	11.37:g.3380733A>G	ENSP00000382511:p.Ile502Thr	Somatic		WXS	SOLID	Phase_I	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	ENST00000399602.4	37	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	a	13.81	2.348131	0.41599	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601	T;T;T;T;T;T	0.34859	1.34;2.48;1.34;1.34;2.48;2.48	1.27	-1.37	0.09056	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18087	0.0434	N	0.00246	-1.78	0.09310	N	1	B;B;D;B;D;B	0.54772	0.393;0.004;0.96;0.003;0.968;0.003	P;B;D;B;D;B	0.67900	0.677;0.002;0.923;0.001;0.954;0.001	T	0.16808	-1.0390	9	0.52906	T	0.07	.	5.0646	0.14576	0.5813:0.0:0.4187:0.0	.	483;361;479;434;502;430	O14628-6;Q59EZ7;O14628-5;O14628-7;O14628;O14628-4	.;.;.;.;ZN195_HUMAN;.	T	430;502;434;434;479;483	ENSP00000346613:I430T;ENSP00000382511:I502T;ENSP00000344483:I434T;ENSP00000387998:I434T;ENSP00000005082:I479T;ENSP00000435828:I483T	ENSP00000005082:I479T	I	-	2	0	ZNF195	3337309	0.000000	0.05858	0.000000	0.03702	0.944000	0.59088	-1.156000	0.03160	-0.276000	0.09206	0.254000	0.18369	ATC		0.418	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			
ZNF699	374879	hgsc.bcm.edu;ucsc.edu	37	19	9407410	9407410	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:9407410G>A	ENST00000591998.1	-	6	898	c.670C>T	c.(670-672)Cag>Tag	p.Q224*	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Nonsense_Mutation_p.Q224*			Q32M78	ZN699_HUMAN	zinc finger protein 699	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCCTTGCACTGATAGGGTTTG	0.438																																																	0													142.0	134.0	137.0					19																	9407410		2064	4227	6291	SO:0001587	stop_gained	374879			BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.670C>T	19.37:g.9407410G>A	ENSP00000467723:p.Gln224*	Somatic		WXS	SOLID	Phase_I	Q8N9A1	Nonsense_Mutation	SNP	ENST00000591998.1	37	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.757100	0.31137	.	.	ENSG00000196110	ENST00000308650	.	.	.	3.51	-1.63	0.08345	.	0.787438	0.10417	N	0.677187	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	3.7881	0.08709	0.1027:0.4718:0.2657:0.1598	.	.	.	.	X	224	.	ENSP00000311596:Q224X	Q	-	1	0	ZNF699	9268410	0.000000	0.05858	0.006000	0.13384	0.278000	0.26855	-3.293000	0.00523	-0.155000	0.11098	0.555000	0.69702	CAG		0.438	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1		NM_198535	
ZNF717	100131827	hgsc.bcm.edu	37	3	75788130	75788130	+	Missense_Mutation	SNP	C	C	T	rs113708852	byFrequency	TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr3:75788130C>T	ENST00000478296.1	-	4	770	c.494G>A	c.(493-495)gGg>gAg	p.G165E	ZNF717_ENST00000477374.1_Intron|MIR4273_ENST00000582824.1_RNA|ZNF717_ENST00000422325.1_Missense_Mutation_p.G215E|ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000400845.3_Missense_Mutation_p.G208E			Q9BY31	ZN717_HUMAN	zinc finger protein 717	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G215V(1)		autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						GAAGGTTTTCCCTTGTTCATT	0.373																																																	1	Substitution - Missense(1)	autonomic_ganglia(1)											28.0	24.0	25.0					3																	75788130		564	1391	1955	SO:0001583	missense	100131827			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.494G>A	3.37:g.75788130C>T	ENSP00000419377:p.Gly165Glu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000478296.1	37		.	.	.	.	.	.	.	.	.	.	.	13.55	2.270697	0.40194	.	.	ENSG00000227124	ENST00000478296;ENST00000422325;ENST00000400845	T;T;T	0.64803	-0.12;-0.12;-0.12	1.94	-1.54	0.08584	.	.	.	.	.	T	0.47173	0.1431	L	0.60067	1.865	0.80722	P	0.0	P	0.47841	0.901	B	0.37422	0.249	T	0.47045	-0.9147	8	0.40728	T	0.16	.	3.1306	0.06421	0.2071:0.5015:0.0:0.2914	.	215	C9JSV9	.	E	165;215;208	ENSP00000419377:G165E;ENSP00000409514:G215E;ENSP00000383643:G208E	ENSP00000383643:G208E	G	-	2	0	ZNF717	75870820	.	.	0.000000	0.03702	0.004000	0.04260	.	.	-0.359000	0.08150	-0.424000	0.05967	GGG		0.373	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2		NM_001128223	
ZNF763	284390	hgsc.bcm.edu;ucsc.edu	37	19	12089194	12089194	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr19:12089194C>T	ENST00000358987.3	+	4	582	c.455C>T	c.(454-456)gCc>gTc	p.A152V	ZNF763_ENST00000592625.1_3'UTR|ZNF763_ENST00000545530.1_Missense_Mutation_p.A30V|ZNF763_ENST00000538752.1_Missense_Mutation_p.A172V|ZNF763_ENST00000590798.1_Missense_Mutation_p.A172V|ZNF763_ENST00000343949.5_Missense_Mutation_p.A155V			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						CCTAAGAAAGCCTTCAGATAT	0.403																																																	0													139.0	143.0	141.0					19																	12089194		2199	4300	6499	SO:0001583	missense	284390			AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.455C>T	19.37:g.12089194C>T	ENSP00000402017:p.Ala152Val	Somatic		WXS	SOLID	Phase_I	B3KRU3|B4DRE7	Missense_Mutation	SNP	ENST00000358987.3	37		.	.	.	.	.	.	.	.	.	.	c	9.374	1.071276	0.20147	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	1.68	0.561	0.17285	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14399	0.0348	L	0.50847	1.595	0.09310	N	1	B;B;B	0.15141	0.004;0.012;0.003	B;B;B	0.16722	0.011;0.016;0.001	T	0.30416	-0.9979	9	0.59425	D	0.04	.	3.9959	0.09558	0.0:0.5707:0.0:0.4293	.	172;152;155	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	V	172;155;30;152	ENSP00000438117:A172V;ENSP00000369774:A155V;ENSP00000446166:A30V;ENSP00000402017:A152V	ENSP00000369774:A155V	A	+	2	0	ZNF763	11950194	0.000000	0.05858	0.002000	0.10522	0.062000	0.15995	-0.730000	0.04915	0.036000	0.15547	0.195000	0.17529	GCC		0.403	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1		NM_001012753	
ZNF80	7634	hgsc.bcm.edu	37	3	113955638	113955638	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4875-01A-01D-1373-10	TCGA-CJ-4875-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03121d77-7273-499f-8405-6bf3a76d30bf	97a9f656-3230-4832-91d5-6827503e146d	g.chr3:113955638G>A	ENST00000482457.2	-	1	787	c.284C>T	c.(283-285)cCc>cTc	p.P95L	RP11-553L6.2_ENST00000493033.1_RNA|RP11-553L6.2_ENST00000481773.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	95				P -> H (in Ref. 1; CAA46340). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				AATCCTCATGGGTCGAACGAA	0.542																																					GBM(23;986 1114 21716)												0													62.0	55.0	57.0					3																	113955638		2203	4300	6503	SO:0001583	missense	7634			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.284C>T	3.37:g.113955638G>A	ENSP00000417192:p.Pro95Leu	Somatic		WXS	SOLID	Phase_I	Q6NSW4|Q6NT14	Missense_Mutation	SNP	ENST00000482457.2	37	CCDS2979.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.068032	0.76301	.	.	ENSG00000174255	ENST00000482457	T	0.27720	1.65	2.99	1.82	0.25136	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19406	0.0466	L	0.28192	0.835	0.26531	N	0.974257	B	0.02656	0.0	B	0.06405	0.002	T	0.23013	-1.0200	9	0.87932	D	0	.	4.5483	0.12092	0.0:0.1149:0.1975:0.6876	.	95	P51504	ZNF80_HUMAN	L	95	ENSP00000417192:P95L	ENSP00000309812:P95L	P	-	2	0	ZNF80	115438328	1.000000	0.71417	0.005000	0.12908	0.181000	0.23173	5.121000	0.64691	0.104000	0.17725	-0.976000	0.02587	CCC		0.542	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2		NM_007136	
