#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA4	24	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	94476403	94476403	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:94476403G>T	ENST00000370225.3	-	40	5753	c.5667C>A	c.(5665-5667)taC>taA	p.Y1889*	ABCA4_ENST00000465352.1_5'UTR|ABCA4_ENST00000535881.1_Nonsense_Mutation_p.Y8*|ABCA4_ENST00000536513.1_Nonsense_Mutation_p.Y159*	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1889					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.Y1889*(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCAGGAGGAAGTACACCACCC	0.582																																																	1	Substitution - Nonsense(1)	kidney(1)											209.0	154.0	172.0					1																	94476403		2203	4300	6503	SO:0001587	stop_gained	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5667C>A	1.37:g.94476403G>T	ENSP00000359245:p.Tyr1889*	Somatic		WXS	Illumina HiSeq	Phase_I	O15112|O60438|O60915|Q0QD48|Q4LE31	Nonsense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	37	6.540510	0.97650	.	.	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513;ENST00000535881	.	.	.	4.74	3.83	0.44106	.	0.508110	0.21998	N	0.066042	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	10.4886	0.44737	0.158:0.0:0.842:0.0	.	.	.	.	X	681;1889;159;8	.	ENSP00000359245:Y1889X	Y	-	3	2	ABCA4	94248991	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.101000	0.31037	1.348000	0.45733	0.585000	0.79938	TAC		0.582	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1		NM_000350	
ABCA4	24	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	94564377	94564377	+	Missense_Mutation	SNP	G	G	T	rs372976742		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:94564377G>T	ENST00000370225.3	-	6	827	c.741C>A	c.(739-741)aaC>aaA	p.N247K	ABCA4_ENST00000535735.1_Missense_Mutation_p.N247K	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	247			N -> S (in STGD1). {ECO:0000269|PubMed:10958763}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.N247K(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AGAAGTCCACGTTGGCATACA	0.562																																																	1	Substitution - Missense(1)	kidney(1)											95.0	91.0	92.0					1																	94564377		2203	4300	6503	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.741C>A	1.37:g.94564377G>T	ENSP00000359245:p.Asn247Lys	Somatic		WXS	Illumina HiSeq	Phase_I	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781186	0.49891	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.92545	-2.85;-3.06	5.83	-0.516	0.11950	.	1.325690	0.04944	N	0.459090	D	0.92097	0.7495	M	0.78456	2.415	0.35315	D	0.784274	P;P	0.51240	0.943;0.61	P;B	0.53549	0.729;0.131	D	0.84472	0.0600	10	0.59425	D	0.04	.	11.6836	0.51472	0.4979:0.0:0.5021:0.0	.	247;247	F5H6E5;P78363	.;ABCA4_HUMAN	K	247	ENSP00000359245:N247K;ENSP00000437682:N247K	ENSP00000359245:N247K	N	-	3	2	ABCA4	94336965	0.267000	0.24122	0.995000	0.50966	0.989000	0.77384	-0.220000	0.09215	-0.096000	0.12329	-0.244000	0.11960	AAC		0.562	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1		NM_000350	
ASS1	445	broad.mit.edu;hgsc.bcm.edu	37	9	133333803	133333803	+	Missense_Mutation	SNP	G	G	T	rs556297791		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr9:133333803G>T	ENST00000372394.1	+	5	671	c.190G>T	c.(190-192)Gtc>Ttc	p.V64F	ASS1_ENST00000372393.3_Missense_Mutation_p.V64F|ASS1_ENST00000352480.5_Missense_Mutation_p.V64F			P00966	ASSY_HUMAN	argininosuccinate synthase 1	64					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)	p.V64F(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CATTGAGGATGTCAGCAGGGA	0.602																																																	1	Substitution - Missense(1)	kidney(1)											103.0	101.0	102.0					9																	133333803		2203	4300	6503	SO:0001583	missense	445			X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.190G>T	9.37:g.133333803G>T	ENSP00000361471:p.Val64Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	ENST00000372394.1	37	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778554	0.49786	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000422569;ENST00000443588	D;D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58;-3.58	4.88	2.01	0.26516	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.485868	0.18812	U	0.130471	D	0.95793	0.8631	M	0.78049	2.395	0.45025	D	0.998043	P;P;P	0.39665	0.682;0.682;0.682	P;P;P	0.54759	0.58;0.76;0.76	D	0.94475	0.7688	10	0.87932	D	0	.	8.6114	0.33804	0.3965:0.0:0.6035:0.0	.	64;64;64	A8KAP9;Q5T6L4;P00966	.;.;ASSY_HUMAN	F	64	ENSP00000253004:V64F;ENSP00000361471:V64F;ENSP00000361469:V64F;ENSP00000394212:V64F;ENSP00000397785:V64F	ENSP00000361470:V64F	V	+	1	0	ASS1	132323624	0.386000	0.25180	0.956000	0.39512	0.668000	0.39293	0.479000	0.22228	0.478000	0.27488	0.650000	0.86243	GTC		0.602	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1		NM_000050	
ADAMTS13	11093	hgsc.bcm.edu;ucsc.edu	37	9	136290647	136290647	+	Splice_Site	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr9:136290647A>G	ENST00000371929.3	+	4	774		c.e4-1		ADAMTS13_ENST00000371911.3_Splice_Site|ADAMTS13_ENST00000355699.2_Splice_Site|ADAMTS13_ENST00000371916.1_Splice_Site|ADAMTS13_ENST00000356589.2_Splice_Site|ADAMTS13_ENST00000485925.1_Splice_Site	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13						cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCCCTTGCACAGGGGGCAGAA	0.637																																																	0													39.0	37.0	38.0					9																	136290647		2203	4300	6503	SO:0001630	splice_region_variant	11093			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.331-1A>G	9.37:g.136290647A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Splice_Site	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	A	15.72	2.917492	0.52546	.	.	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8109	0.57639	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS13	135280468	1.000000	0.71417	0.986000	0.45419	0.563000	0.35712	8.158000	0.89649	1.696000	0.51158	0.378000	0.23410	.		0.637	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1		NM_139025	Intron
BBS1	582	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	66287216	66287216	+	Silent	SNP	C	C	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr11:66287216C>G	ENST00000318312.7	+	8	771	c.720C>G	c.(718-720)gcC>gcG	p.A240A	BBS1_ENST00000455748.2_Intron|BBS1_ENST00000393994.2_Silent_p.A240A|CTD-3074O7.11_ENST00000419755.3_Silent_p.A277A|BBS1_ENST00000537537.1_Silent_p.A128A|BBS1_ENST00000529766.1_3'UTR	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	240					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)	p.A240A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						CCATTTTAGCCAAGGTCAGCG	0.572									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												1	Substitution - coding silent(1)	kidney(1)											64.0	54.0	57.0					11																	66287216		2200	4295	6495	SO:0001819	synonymous_variant	582	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.720C>G	11.37:g.66287216C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q32MM9|Q32MN0|Q96SN4	Silent	SNP	ENST00000318312.7	37	CCDS8142.1																																																																																				0.572	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2			
BDP1	55814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	70785431	70785431	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:70785431G>A	ENST00000358731.4	+	10	1677	c.1414G>A	c.(1414-1416)Gct>Act	p.A472T	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	472					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.A472T(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GCAAGATGGAGCTAATGAACT	0.388																																																	1	Substitution - Missense(1)	kidney(1)											71.0	69.0	70.0					5																	70785431		1889	4100	5989	SO:0001583	missense	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1414G>A	5.37:g.70785431G>A	ENSP00000351575:p.Ala472Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.529965	0.00951	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000451951;ENST00000444711	T	0.57595	0.39	5.26	-3.56	0.04626	.	1.967670	0.01990	N	0.045474	T	0.33990	0.0882	N	0.19112	0.55	0.09310	N	0.999998	B;B;B	0.12630	0.001;0.006;0.003	B;B;B	0.12837	0.002;0.006;0.008	T	0.42865	-0.9426	10	0.02654	T	1	.	11.6316	0.51178	0.7786:0.0:0.2214:0.0	.	472;472;472	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	T	472;472;52;472	ENSP00000351575:A472T	ENSP00000351575:A472T	A	+	1	0	BDP1	70821187	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.581000	0.05820	-0.589000	0.05874	0.462000	0.41574	GCT		0.388	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2		NM_018429	
MPC2	25874	broad.mit.edu;ucsc.edu	37	1	167893736	167893736	+	Splice_Site	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:167893736C>T	ENST00000367846.4	-	2	347	c.149G>A	c.(148-150)tGg>tAg	p.W50*	MPC2_ENST00000271373.4_Splice_Site_p.W50*	NM_015415.3	NP_056230.1	O95563	MPC2_HUMAN	mitochondrial pyruvate carrier 2	50					cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate transmembrane transporter activity (GO:0050833)	p.W50*(1)									AAGACTTACCCATTTCATAAT	0.294																																																	1	Substitution - Nonsense(1)	kidney(1)											21.0	23.0	22.0					1																	167893736		2202	4290	6492	SO:0001630	splice_region_variant	0				CCDS1266.1	1q24	2012-07-30	2012-07-30	2012-07-30	ENSG00000143158	ENSG00000143158			24515	protein-coding gene	gene with protein product		614737	"""brain protein 44"""	BRP44		3022128, 22628558	Standard	NM_015415		Approved	DKFZP564B167	uc001get.3	O95563	OTTHUMG00000034570	ENST00000367846.4:c.150+1G>A	1.37:g.167893736C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K261|Q3SXR6|Q6FIF3	Nonsense_Mutation	SNP	ENST00000367846.4	37	CCDS1266.1	.	.	.	.	.	.	.	.	.	.	C	37	6.029063	0.97216	.	.	ENSG00000143158	ENST00000367846;ENST00000271373;ENST00000458574	.	.	.	5.72	5.72	0.89469	.	0.106321	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.749	17.1582	0.86797	0.0:1.0:0.0:0.0	.	.	.	.	X	50	.	ENSP00000271373:W50X	W	-	2	0	BRP44	166160360	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.164000	0.71885	2.865000	0.98341	0.655000	0.94253	TGG		0.294	MPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083652.1		NM_015415	Nonsense_Mutation
BTN1A1	696	hgsc.bcm.edu;ucsc.edu	37	6	26501821	26501822	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:26501821_26501822insT	ENST00000244513.6	+	2	149_150	c.83_84insT	c.(82-87)ccctttfs	p.F29fs		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	29	Ig-like V-type 1.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						TCGGCAGCTCCCTTTGACGTGA	0.649																																																	0																																										SO:0001589	frameshift_variant	696			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	Exception_encountered	6.37:g.26501821_26501822insT	ENSP00000244513:p.Phe29fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VAN3|Q4VAN4|Q9H458	Frame_Shift_Ins	INS	ENST00000244513.6	37	CCDS4614.1																																																																																				0.649	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043776.1		NM_001732	
FAM227B	196951	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	49868999	49868999	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:49868999A>T	ENST00000299338.6	-	7	788	c.485T>A	c.(484-486)cTa>cAa	p.L162Q	FAM227B_ENST00000560246.1_3'UTR|FAM227B_ENST00000561064.1_Missense_Mutation_p.L162Q|FAM227B_ENST00000558594.1_3'UTR	NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	162								p.L162Q(1)									ATGTCTGGGTAGCTGAGTAAG	0.308																																																	1	Substitution - Missense(1)	kidney(1)											43.0	47.0	46.0					15																	49868999		2196	4294	6490	SO:0001583	missense	0				CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.485T>A	15.37:g.49868999A>T	ENSP00000299338:p.Leu162Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q86WS2	Missense_Mutation	SNP	ENST00000299338.6	37	CCDS32237.1	.	.	.	.	.	.	.	.	.	.	A	17.49	3.403813	0.62288	.	.	ENSG00000166262	ENST00000299338;ENST00000354658	.	.	.	4.79	4.79	0.61399	.	0.000000	0.40064	N	0.001189	T	0.78084	0.4228	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80899	-0.1176	9	0.87932	D	0	-22.8854	10.882	0.46944	1.0:0.0:0.0:0.0	.	162;162	Q96M60-2;Q96M60	.;CO033_HUMAN	Q	162	.	ENSP00000299338:L162Q	L	-	2	0	C15orf33	47656291	1.000000	0.71417	0.941000	0.38009	0.775000	0.43874	4.684000	0.61686	2.131000	0.65755	0.477000	0.44152	CTA		0.308	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1		NM_152647	
LRIF1	55791	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	111494385	111494385	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:111494385A>G	ENST00000369763.4	-	2	1511	c.1121T>C	c.(1120-1122)gTt>gCt	p.V374A	LRIF1_ENST00000494675.1_Intron|LRIF1_ENST00000485275.2_Intron|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)		p.V374A(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						TGATGGCAGAACATCTGTCCC	0.393																																																	1	Substitution - Missense(1)	kidney(1)											151.0	154.0	153.0					1																	111494385		2203	4300	6503	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1121T>C	1.37:g.111494385A>G	ENSP00000358778:p.Val374Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	37	CCDS30800.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.854886	0.51376	.	.	ENSG00000121931	ENST00000369763	T	0.35789	1.29	5.7	4.56	0.56223	.	0.410282	0.23644	N	0.045993	T	0.13670	0.0331	L	0.27053	0.805	0.80722	D	1	P	0.36633	0.562	B	0.38500	0.275	T	0.04961	-1.0915	10	0.30078	T	0.28	-0.3956	10.9594	0.47376	0.8367:0.1633:0.0:0.0	.	374	Q5T3J3	LRIF1_HUMAN	A	374	ENSP00000358778:V374A	ENSP00000358778:V374A	V	-	2	0	LRIF1	111295908	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.111000	0.41883	0.979000	0.38497	0.482000	0.46254	GTT		0.393	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2		NM_018372	
LSMEM2	132228	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	50324295	50324295	+	Splice_Site	SNP	T	T	A	rs368039673		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:50324295T>A	ENST00000316436.3	+	3	448		c.e3+2			NM_153215.1	NP_694947.1	Q8N112	LSME2_HUMAN	leucine-rich single-pass membrane protein 2							integral component of membrane (GO:0016021)		p.?(1)									ACCTGAGCGGTATGGACGCAT	0.597																																																	1	Unknown(1)	kidney(1)											58.0	55.0	56.0					3																	50324295		2203	4300	6503	SO:0001630	splice_region_variant	132228			AK095927	CCDS2814.1	3p21.31	2013-03-08	2013-03-08	2013-03-08	ENSG00000179564	ENSG00000179564			26781	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 45"""	C3orf45			Standard	NM_153215		Approved	FLJ38608	uc003cyz.3	Q8N112	OTTHUMG00000156938	ENST00000316436.3:c.361+2T>A	3.37:g.50324295T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Splice_Site	SNP	ENST00000316436.3	37	CCDS2814.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.239558	0.58995	.	.	ENSG00000179564	ENST00000316436	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5299	0.50601	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C3orf45	50299299	0.991000	0.36638	0.965000	0.40720	0.659000	0.38960	1.313000	0.33585	1.974000	0.57490	0.459000	0.35465	.		0.597	LSMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346671.1		NM_153215	Intron
HMCES	56941	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	128998744	128998744	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:128998744C>T	ENST00000383463.4	+	2	258	c.169C>T	c.(169-171)Ctg>Ttg	p.L57L	HMCES_ENST00000417226.2_Silent_p.L57L|HMCES_ENST00000502878.2_Silent_p.L57L|HMCES_ENST00000389735.3_Silent_p.L57L	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	57							DNA binding (GO:0003677)|peptidase activity (GO:0008233)	p.L57L(1)									TCTGTCTCGACTGCACTTTGA	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											99.0	94.0	95.0					3																	128998744		2203	4300	6503	SO:0001819	synonymous_variant	56941			AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.169C>T	3.37:g.128998744C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NJR9|Q96G34|Q9NRP3	Silent	SNP	ENST00000383463.4	37	CCDS33852.1																																																																																				0.567	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355470.2		NM_020187	
STPG2	285555	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	98761954	98761954	+	Missense_Mutation	SNP	G	G	A	rs200220026		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr4:98761954G>A	ENST00000295268.3	-	9	1263	c.1174C>T	c.(1174-1176)Cgg>Tgg	p.R392W	STPG2_ENST00000506482.1_Intron	NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	392								p.R392W(1)									TCTAGGCACCGAGGAGTTGCA	0.363																																																	1	Substitution - Missense(1)	kidney(1)						G	TRP/ARG	5,4401	9.9+/-24.2	0,5,2198	108.0	114.0	112.0		1174	2.3	0.5	4		112	0,8598		0,0,4299	yes	missense	C4orf37	NM_174952.2	101	0,5,6497	AA,AG,GG		0.0,0.1135,0.0384	probably-damaging	392/460	98761954	5,12999	2203	4299	6502	SO:0001583	missense	0			BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.1174C>T	4.37:g.98761954G>A	ENSP00000295268:p.Arg392Trp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815825	0.50527	0.001135	0.0	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.55413	0.52;2.39	5.47	2.34	0.29019	.	0.108006	0.39146	N	0.001451	T	0.67373	0.2886	M	0.71581	2.175	0.25020	N	0.991347	D	0.89917	1.0	D	0.73380	0.98	T	0.59516	-0.7440	10	0.87932	D	0	-9.9652	10.7395	0.46145	0.0:0.107:0.5864:0.3066	.	392	Q8N412	CD037_HUMAN	W	106;392	ENSP00000428346:R106W;ENSP00000295268:R392W	ENSP00000295268:R392W	R	-	1	2	C4orf37	98980977	0.999000	0.42202	0.499000	0.27577	0.791000	0.44710	0.938000	0.28965	0.623000	0.30267	0.585000	0.79938	CGG		0.363	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1		NM_174952	
C6orf47	57827	broad.mit.edu;hgsc.bcm.edu	37	6	31627604	31627604	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:31627604T>A	ENST00000375911.1	-	1	945	c.121A>T	c.(121-123)Agt>Tgt	p.S41C	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	41						cytoplasm (GO:0005737)		p.S41C(1)		NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						TCCCAGTCACTTCCTGAATTC	0.602																																																	1	Substitution - Missense(1)	kidney(1)											43.0	41.0	42.0					6																	31627604		1511	2708	4219	SO:0001583	missense	57827			AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.121A>T	6.37:g.31627604T>A	ENSP00000365076:p.Ser41Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Missense_Mutation	SNP	ENST00000375911.1	37	CCDS34399.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.320332	0.81469	.	.	ENSG00000204439	ENST00000375911;ENST00000538106	T	0.45276	0.9	5.44	5.44	0.79542	.	0.000000	0.53938	D	0.000041	T	0.51160	0.1658	M	0.62723	1.935	0.34447	D	0.700262	D	0.89917	1.0	D	0.87578	0.998	T	0.60301	-0.7290	10	0.87932	D	0	-9.8976	11.8174	0.52218	0.0:0.0:0.0:1.0	.	41	O95873	CF047_HUMAN	C	41	ENSP00000365076:S41C	ENSP00000365076:S41C	S	-	1	0	C6orf47	31735583	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.427000	0.52785	2.288000	0.76882	0.533000	0.62120	AGT		0.602	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1		NM_021184	
C9orf84	158401	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	114454520	114454520	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr9:114454520A>T	ENST00000318737.4	-	25	3673	c.3545T>A	c.(3544-3546)gTg>gAg	p.V1182E	C9orf84_ENST00000394779.3_Missense_Mutation_p.V1143E|C9orf84_ENST00000374287.3_Missense_Mutation_p.V1182E|C9orf84_ENST00000394777.4_Missense_Mutation_p.V1108E	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	1182								p.V1182E(1)|p.V1143E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GTATGAAGTCACAGGTGGTAA	0.373																																																	2	Substitution - Missense(2)	kidney(2)											96.0	99.0	98.0					9																	114454520		2203	4300	6503	SO:0001583	missense	158401			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.3545T>A	9.37:g.114454520A>T	ENSP00000322108:p.Val1182Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	A	8.721	0.914316	0.17907	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.04551	3.6;3.61;3.6;3.6	5.53	1.52	0.23074	.	1.135070	0.06617	N	0.756741	T	0.04952	0.0133	N	0.19112	0.55	0.09310	N	1	P;P;P	0.41848	0.763;0.763;0.763	P;P;P	0.44897	0.463;0.463;0.463	T	0.45804	-0.9236	10	0.30854	T	0.27	1.4487	6.3602	0.21425	0.4972:0.0:0.5028:0.0	.	1108;1182;1143	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	E	1143;1108;796;1182;1182	ENSP00000378259:V1143E;ENSP00000378257:V1108E;ENSP00000363405:V1182E;ENSP00000322108:V1182E	ENSP00000322108:V1182E	V	-	2	0	C9orf84	113494341	0.061000	0.20836	0.015000	0.15790	0.355000	0.29361	0.917000	0.28665	0.472000	0.27344	0.460000	0.39030	GTG		0.373	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2		NM_173521	
CAPN3	825	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42695072	42695072	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:42695072C>T	ENST00000397163.3	+	13	1836	c.1617C>T	c.(1615-1617)aaC>aaT	p.N539N	CAPN3_ENST00000318023.7_Silent_p.N539N|CAPN3_ENST00000569136.1_5'Flank|CAPN3_ENST00000561817.1_5'Flank|CAPN3_ENST00000357568.3_Silent_p.N539N|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000337571.4_5'Flank|CAPN3_ENST00000397204.4_5'Flank|CAPN3_ENST00000356316.3_Silent_p.N452N|CAPN3_ENST00000397200.4_Silent_p.N27N|CAPN3_ENST00000349748.3_Silent_p.N491N	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	539	Domain III.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.N539N(1)|p.N452N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CCTACATCAACATGCGGGAGG	0.612																																																	2	Substitution - coding silent(2)	kidney(2)											129.0	102.0	111.0					15																	42695072		2203	4299	6502	SO:0001819	synonymous_variant	825			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.1617C>T	15.37:g.42695072C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Silent	SNP	ENST00000397163.3	37	CCDS45245.1																																																																																				0.612	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1			
CD53	963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	111437650	111437650	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:111437650G>C	ENST00000271324.5	+	5	508	c.396G>C	c.(394-396)aaG>aaC	p.K132N	CD53_ENST00000497404.1_3'UTR|CD53_ENST00000429072.2_Intron	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule	132					positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K132N(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		ATAGCACCAAGGCAGCGTGGG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											205.0	170.0	182.0					1																	111437650		2203	4300	6503	SO:0001583	missense	963			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.396G>C	1.37:g.111437650G>C	ENSP00000271324:p.Lys132Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2R905|Q5U0D6	Missense_Mutation	SNP	ENST00000271324.5	37	CCDS829.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904719	0.33628	.	.	ENSG00000143119	ENST00000271324	T	0.79653	-1.29	5.46	2.61	0.31194	Tetraspanin, EC2 domain (1);	0.901537	0.09794	N	0.755019	T	0.59459	0.2195	L	0.37507	1.11	0.23440	N	0.997675	P	0.49307	0.922	P	0.46299	0.511	T	0.48043	-0.9069	10	0.32370	T	0.25	.	7.7114	0.28679	0.2612:0.0:0.7388:0.0	.	132	P19397	CD53_HUMAN	N	132	ENSP00000271324:K132N	ENSP00000271324:K132N	K	+	3	2	CD53	111239173	0.759000	0.28416	0.038000	0.18304	0.606000	0.37113	1.792000	0.38754	0.290000	0.22444	0.643000	0.83706	AAG		0.517	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032931.1		NM_000560	
CELF5	60680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	3281241	3281241	+	Silent	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:3281241G>A	ENST00000292672.2	+	6	685	c.648G>A	c.(646-648)aaG>aaA	p.K216K	CELF5_ENST00000541430.2_Silent_p.K216K	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	216					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.K216K(1)		kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						ACACGGACAAGGAGCGGACGC	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											84.0	77.0	80.0					19																	3281241		2203	4300	6503	SO:0001819	synonymous_variant	60680			AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.648G>A	19.37:g.3281241G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Silent	SNP	ENST00000292672.2	37	CCDS12106.1																																																																																				0.677	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1		NM_021938	
CHD5	26038	broad.mit.edu;hgsc.bcm.edu	37	1	6212526	6212526	+	Silent	SNP	G	G	A	rs140463225	byFrequency	TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:6212526G>A	ENST00000262450.3	-	6	915	c.816C>T	c.(814-816)gcC>gcT	p.A272A	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.A272A(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		ACTTGAGCCCGGCCGTCTTTT	0.527																																																	1	Substitution - coding silent(1)	kidney(1)						G		1,4405	2.1+/-5.4	0,1,2202	152.0	129.0	137.0		816	-8.8	0.0	1	dbSNP_134	137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CHD5	NM_015557.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		272/1955	6212526	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.816C>T	1.37:g.6212526G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	ENST00000262450.3	37	CCDS57.1																																																																																				0.527	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2		NM_015557	
CHML	1122	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	241797696	241797696	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:241797696A>T	ENST00000366553.1	-	1	1536	c.1373T>A	c.(1372-1374)gTa>gAa	p.V458E	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	458					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.V458E(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TGTAATGAGTACTGCCCTAGA	0.403																																																	1	Substitution - Missense(1)	kidney(1)											117.0	115.0	116.0					1																	241797696		2203	4299	6502	SO:0001583	missense	1122			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1373T>A	1.37:g.241797696A>T	ENSP00000355511:p.Val458Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.186305	0.57909	.	.	ENSG00000203668	ENST00000366553	D	0.87256	-2.23	5.08	5.08	0.68730	.	0.061990	0.64402	U	0.000005	D	0.92993	0.7770	.	.	.	0.53005	D	0.999965	D	0.89917	1.0	D	0.77557	0.99	D	0.93743	0.7052	9	0.87932	D	0	-9.1022	13.1474	0.59470	1.0:0.0:0.0:0.0	.	458	P26374	RAE2_HUMAN	E	458	ENSP00000355511:V458E	ENSP00000355511:V458E	V	-	2	0	CHML	239864319	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	2.855000	0.48333	2.281000	0.76405	0.533000	0.62120	GTA		0.403	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1		NM_001821	
COBLL1	22837	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	165557144	165557144	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:165557144C>T	ENST00000392717.2	-	11	1583	c.1579G>A	c.(1579-1581)Gat>Aat	p.D527N	COBLL1_ENST00000194871.6_Missense_Mutation_p.D555N|COBLL1_ENST00000342193.4_Missense_Mutation_p.D489N|COBLL1_ENST00000491126.2_5'UTR|COBLL1_ENST00000409184.3_Missense_Mutation_p.D488N|COBLL1_ENST00000375458.2_Missense_Mutation_p.D450N			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	527						extracellular vesicular exosome (GO:0070062)		p.D489N(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TTTATTATATCAGTAGATACA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											132.0	134.0	133.0					2																	165557144		2203	4300	6503	SO:0001583	missense	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1579G>A	2.37:g.165557144C>T	ENSP00000376478:p.Asp527Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.	.	.	.	.	.	.	.	.	.	C	14.03	2.415095	0.42817	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.42	3.6	0.41247	.	0.505718	0.20506	N	0.090988	T	0.40645	0.1125	L	0.32530	0.975	0.21147	N	0.999777	D;D;D	0.63046	0.983;0.992;0.98	P;P;P	0.58210	0.722;0.835;0.811	T	0.13415	-1.0510	9	0.66056	D	0.02	-11.8402	9.6259	0.39750	0.0:0.7762:0.0:0.2238	.	527;555;488	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	N	450;489;488;527;555	.	ENSP00000194871:D555N	D	-	1	0	COBLL1	165265390	0.960000	0.32886	0.963000	0.40424	0.061000	0.15899	0.857000	0.27831	1.430000	0.47334	0.655000	0.94253	GAT		0.363	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_014900	
COL11A1	1301	broad.mit.edu;hgsc.bcm.edu	37	1	103405991	103405991	+	Splice_Site	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:103405991C>A	ENST00000370096.3	-	43	3589		c.e43-1		COL11A1_ENST00000512756.1_Splice_Site|COL11A1_ENST00000358392.2_Splice_Site|COL11A1_ENST00000353414.4_Splice_Site	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.?(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTTTTTCTCCCTGTATTGAAT	0.458																																																	2	Unknown(2)	kidney(2)											38.0	44.0	42.0					1																	103405991		2203	4300	6503	SO:0001630	splice_region_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3277-1G>T	1.37:g.103405991C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Splice_Site	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270803	0.80469	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9157	0.92505	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A1	103178579	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.792000	0.85828	2.467000	0.83353	0.650000	0.86243	.		0.458	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1		NM_080630	Intron
COL6A6	131873	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	130285927	130285927	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:130285927A>G	ENST00000358511.6	+	4	1695	c.1664A>G	c.(1663-1665)gAg>gGg	p.E555G	COL6A6_ENST00000453409.2_Missense_Mutation_p.E555G	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	555	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.E555G(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AGCATCTTGGAGCCTGCAAAC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											121.0	124.0	123.0					3																	130285927		1996	4180	6176	SO:0001583	missense	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1664A>G	3.37:g.130285927A>G	ENSP00000351310:p.Glu555Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	A	10.16	1.273508	0.23221	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.83591	-1.74;-1.74	5.24	2.88	0.33553	von Willebrand factor, type A (3);	0.301496	0.28476	N	0.015205	T	0.75576	0.3868	L	0.52011	1.625	0.22489	N	0.999052	B	0.13145	0.007	B	0.12156	0.007	T	0.62110	-0.6923	10	0.35671	T	0.21	.	8.2135	0.31496	0.8272:0.0:0.1728:0.0	.	555	A6NMZ7	CO6A6_HUMAN	G	555	ENSP00000351310:E555G;ENSP00000399236:E555G	ENSP00000351310:E555G	E	+	2	0	COL6A6	131768617	0.535000	0.26370	0.656000	0.29637	0.628000	0.37860	0.605000	0.24179	0.332000	0.23536	0.459000	0.35465	GAG		0.473	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5		NM_001102608	
CTCFL	140690	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	56090853	56090853	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr20:56090853C>T	ENST00000608263.1	-	5	1758	c.1097G>A	c.(1096-1098)gGg>gAg	p.G366E	CTCFL_ENST00000422869.2_Missense_Mutation_p.G366E|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000371196.2_Missense_Mutation_p.G366E|CTCFL_ENST00000608440.1_Missense_Mutation_p.G366E|CTCFL_ENST00000539382.1_Missense_Mutation_p.G161E|CTCFL_ENST00000429804.3_Missense_Mutation_p.G366E|CTCFL_ENST00000502686.2_Missense_Mutation_p.G104E|CTCFL_ENST00000243914.3_Missense_Mutation_p.G366E|CTCFL_ENST00000608903.1_Missense_Mutation_p.G104E|CTCFL_ENST00000423479.3_Missense_Mutation_p.G366E|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000608425.1_Missense_Mutation_p.G366E|CTCFL_ENST00000609232.1_Missense_Mutation_p.G366E|CTCFL_ENST00000433949.3_Missense_Mutation_p.G161E	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	366					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.G366E(1)		NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GGGGCGCTCCCCAGTGTGGGA	0.468																																																	1	Substitution - Missense(1)	kidney(1)											160.0	153.0	156.0					20																	56090853		2203	4300	6503	SO:0001583	missense	140690				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1097G>A	20.37:g.56090853C>T	ENSP00000476783:p.Gly366Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	37	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482639	0.84747	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000422109;ENST00000426658;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.24	5.24	0.73138	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45361	D	0.000377	T	0.47377	0.1442	L	0.49571	1.57	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.39881	-0.9592	10	0.62326	D	0.03	-48.5072	17.9608	0.89084	0.0:1.0:0.0:0.0	.	366;366;366;366;366	A6XGM9;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	E	366;366;366;366;366;104;366;366;161;366	ENSP00000415579:G366E;ENSP00000243914:G366E;ENSP00000360239:G366E;ENSP00000415329:G366E;ENSP00000392034:G366E;ENSP00000437999:G104E;ENSP00000413713:G366E;ENSP00000403369:G366E;ENSP00000439998:G161E;ENSP00000399061:G366E	ENSP00000243914:G366E	G	-	2	0	CTCFL	55524259	1.000000	0.71417	0.701000	0.30321	0.493000	0.33554	7.493000	0.81493	2.608000	0.88229	0.650000	0.86243	GGG		0.468	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1		NM_080618	
DIS3	22894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	73335571	73335571	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr13:73335571T>C	ENST00000377767.4	-	19	2700	c.2600A>G	c.(2599-2601)tAt>tGt	p.Y867C	DIS3_ENST00000377780.4_Missense_Mutation_p.Y837C|DIS3_ENST00000545453.1_Missense_Mutation_p.Y705C	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	867					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.Y867C(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TTCTAAACCATACTTTGGAAT	0.313										Multiple Myeloma(4;0.011)																																							1	Substitution - Missense(1)	kidney(1)											100.0	104.0	103.0					13																	73335571		2203	4300	6503	SO:0001583	missense	22894			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2600A>G	13.37:g.73335571T>C	ENSP00000366997:p.Tyr867Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.354130	0.61293	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.26223	1.75;1.75;1.76	5.96	5.96	0.96718	.	0.051741	0.85682	D	0.000000	T	0.51736	0.1692	M	0.80847	2.515	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.94	T	0.56631	-0.7947	10	0.72032	D	0.01	.	11.5191	0.50541	0.1336:0.0:0.0:0.8664	.	837;867	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	C	867;837;705	ENSP00000366997:Y867C;ENSP00000367011:Y837C;ENSP00000440058:Y705C	ENSP00000366997:Y867C	Y	-	2	0	DIS3	72233572	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.899000	0.56288	2.285000	0.76669	0.533000	0.62120	TAT		0.313	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2		NM_014953	
DMKN	93099	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	36003325	36003325	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:36003325C>T	ENST00000339686.3	-	3	858	c.682G>A	c.(682-684)Ggg>Agg	p.G228R	DMKN_ENST00000451297.2_Missense_Mutation_p.G228R|DMKN_ENST00000429837.1_Missense_Mutation_p.G228R|DMKN_ENST00000440396.1_Missense_Mutation_p.G228R|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.G228R|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.G228R|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000419602.1_Missense_Mutation_p.G228R|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.G228R|DMKN_ENST00000462126.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	228	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G228R(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCTCTTACCCCTTCATTCTGG	0.567																																																	2	Substitution - Missense(2)	kidney(2)											45.0	49.0	47.0					19																	36003325		2203	4300	6503	SO:0001583	missense	93099			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.682G>A	19.37:g.36003325C>T	ENSP00000342012:p.Gly228Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.443879	0.43429	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	4.91	4.91	0.64330	.	0.377447	0.19368	N	0.115967	T	0.58595	0.2133	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D;D	0.63046	0.992;0.992;0.992;0.992;0.979;0.979;0.979	D;P;D;D;P;P;P	0.63381	0.914;0.886;0.914;0.914;0.816;0.816;0.816	T	0.60141	-0.7321	10	0.66056	D	0.02	-1.0907	13.4834	0.61351	0.0:1.0:0.0:0.0	.	228;228;228;228;228;228;228	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	R	228	ENSP00000342012:G228R;ENSP00000405503:G228R;ENSP00000391036:G228R;ENSP00000394908:G228R;ENSP00000415277:G228R;ENSP00000414743:G228R;ENSP00000388404:G228R;ENSP00000409513:G228R	ENSP00000342012:G228R	G	-	1	0	DMKN	40695165	0.676000	0.27567	0.613000	0.29037	0.089000	0.18198	1.960000	0.40422	2.536000	0.85505	0.655000	0.94253	GGG		0.567	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2		NM_033317	
DNA2	1763	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	70227941	70227941	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr10:70227941C>T	ENST00000358410.3	-	3	430	c.380G>A	c.(379-381)gGc>gAc	p.G127D	DNA2_ENST00000399180.2_Missense_Mutation_p.G213D|DNA2_ENST00000399179.2_Missense_Mutation_p.G127D	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	127	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)	p.G213D(1)|p.G127D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TATGCTGGTGCCAGAAATCAG	0.388																																																	2	Substitution - Missense(2)	kidney(2)											98.0	91.0	93.0					10																	70227941		1845	4097	5942	SO:0001583	missense	1763			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.380G>A	10.37:g.70227941C>T	ENSP00000351185:p.Gly127Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.	.	.	.	.	.	.	.	.	.	C	27.4	4.824988	0.90955	.	.	ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410	D;D;D	0.94650	-2.98;-3.48;-2.95	5.4	5.4	0.78164	DNA replication factor Dna2 (1);	0.000000	0.85682	D	0.000000	D	0.97405	0.9151	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97386	0.9986	10	0.51188	T	0.08	.	18.7691	0.91883	0.0:1.0:0.0:0.0	.	127;127	F8VR31;P51530	.;DNA2L_HUMAN	D	127;213;127;127	ENSP00000382133:G213D;ENSP00000382132:G127D;ENSP00000351185:G127D	ENSP00000351185:G127D	G	-	2	0	DNA2	69897947	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.149000	0.71795	2.537000	0.85549	0.491000	0.48974	GGC		0.388	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2			
DNAJC13	23317	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	132193851	132193851	+	Silent	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:132193851A>G	ENST00000260818.6	+	22	2615	c.2367A>G	c.(2365-2367)gaA>gaG	p.E789E		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	789					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.E172E(1)|p.E789E(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						ATACTCTTGAATCTGAAATGA	0.363																																																	2	Substitution - coding silent(2)	kidney(2)											112.0	118.0	116.0					3																	132193851		2203	4300	6503	SO:0001819	synonymous_variant	23317			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.2367A>G	3.37:g.132193851A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	ENST00000260818.6	37	CCDS33857.1																																																																																				0.363	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2		NM_015268	
ELAVL2	1993	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	23705049	23705049	+	Silent	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr9:23705049A>G	ENST00000397312.2	-	4	628	c.354T>C	c.(352-354)agT>agC	p.S118S	ELAVL2_ENST00000223951.6_Silent_p.S118S|ELAVL2_ENST00000380117.1_Silent_p.S118S|ELAVL2_ENST00000544538.1_Silent_p.S118S|ELAVL2_ENST00000380110.4_Silent_p.S147S	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	118					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S118S(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TAGAAGCTGAACTTGGGCGAG	0.403																																																	1	Substitution - coding silent(1)	kidney(1)											93.0	93.0	93.0					9																	23705049		2203	4300	6503	SO:0001819	synonymous_variant	1993			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.354T>C	9.37:g.23705049A>G		Somatic		WXS	Illumina HiSeq	Phase_I	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Silent	SNP	ENST00000397312.2	37	CCDS6515.1																																																																																				0.403	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2		NM_004432	
ENTPD1	953	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	97607250	97607250	+	Silent	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr10:97607250T>C	ENST00000371205.4	+	7	1144	c.861T>C	c.(859-861)taT>taC	p.Y287Y	ENTPD1_ENST00000371203.5_Silent_p.Y149Y|ENTPD1_ENST00000371207.3_Silent_p.Y299Y|ENTPD1_ENST00000539125.1_Silent_p.Y149Y|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000453258.2_Silent_p.Y294Y|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000543964.1_Silent_p.Y179Y			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	287					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.Y287Y(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		ATCCTGGATATAAGAAGGTAG	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											125.0	122.0	123.0					10																	97607250		2203	4300	6503	SO:0001819	synonymous_variant	953			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.861T>C	10.37:g.97607250T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Silent	SNP	ENST00000371205.4	37	CCDS7444.1																																																																																				0.413	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1		NM_001776	
EP300	2033	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	41572994	41572994	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr22:41572994A>G	ENST00000263253.7	+	31	6498	c.5279A>G	c.(5278-5280)aAg>aGg	p.K1760R	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1760	Binding region for E1A adenovirus.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.K1760R(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TCCTGCCAGAAGATGAAGCGG	0.577			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	1	Substitution - Missense(1)	kidney(1)											90.0	74.0	79.0					22																	41572994		2203	4300	6503	SO:0001583	missense	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5279A>G	22.37:g.41572994A>G	ENSP00000263253:p.Lys1760Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.401190	0.62288	.	.	ENSG00000100393	ENST00000263253	D	0.82984	-1.67	5.75	5.75	0.90469	Zinc finger, TAZ-type (5);	0.000000	0.50627	D	0.000107	D	0.88654	0.6495	L	0.49126	1.545	0.49687	D	0.999816	D	0.69078	0.997	D	0.80764	0.994	D	0.88893	0.3347	10	0.52906	T	0.07	-12.2442	16.0573	0.80814	1.0:0.0:0.0:0.0	.	1760	Q09472	EP300_HUMAN	R	1760	ENSP00000263253:K1760R	ENSP00000263253:K1760R	K	+	2	0	EP300	39902940	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.334000	0.96470	2.191000	0.70037	0.528000	0.53228	AAG		0.577	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1		NM_001429	
EYS	346007	broad.mit.edu;hgsc.bcm.edu	37	6	66112428	66112428	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:66112428G>A	ENST00000370621.3	-	7	1653	c.1127C>T	c.(1126-1128)tCa>tTa	p.S376L	EYS_ENST00000393380.2_Missense_Mutation_p.S376L|EYS_ENST00000503581.1_Missense_Mutation_p.S376L|EYS_ENST00000370618.3_Missense_Mutation_p.S376L|EYS_ENST00000342421.5_Missense_Mutation_p.S376L|EYS_ENST00000370616.2_Missense_Mutation_p.S376L			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	376	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S376L(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CAAAGGAAATGACTCACATGA	0.284																																																	2	Substitution - Missense(2)	kidney(2)											57.0	57.0	57.0					6																	66112428		2202	4287	6489	SO:0001583	missense	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1127C>T	6.37:g.66112428G>A	ENSP00000359655:p.Ser376Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	10.57	1.387766	0.25031	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	4.68	0.789	0.18607	.	.	.	.	.	T	0.64616	0.2614	L	0.53780	1.695	0.09310	N	1	B;B;B	0.22909	0.017;0.077;0.046	B;B;B	0.23275	0.033;0.045;0.02	T	0.58707	-0.7589	9	0.87932	D	0	.	3.8437	0.08925	0.3789:0.0:0.4598:0.1613	.	376;376;376	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	L	376	ENSP00000424243:S376L;ENSP00000359655:S376L;ENSP00000359650:S376L;ENSP00000377042:S376L;ENSP00000341818:S376L;ENSP00000359652:S376L	ENSP00000341818:S376L	S	-	2	0	EYS	66169149	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.112000	0.15479	-0.160000	0.11002	0.591000	0.81541	TCA		0.284	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3		XM_294050	
AMER2	219287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	25743823	25743823	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr13:25743823C>T	ENST00000515384.1	-	1	2602	c.1935G>A	c.(1933-1935)ctG>ctA	p.L645L	AMER2_ENST00000357816.2_Silent_p.L526L|AMER2_ENST00000381853.3_Silent_p.L526L			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	645					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.L526L(1)|p.L645L(1)									CTCTGCGGACCAGCACTTTGG	0.577																																																	2	Substitution - coding silent(2)	kidney(2)											77.0	78.0	78.0					13																	25743823		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1935G>A	13.37:g.25743823C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5RL80|Q5VX56|Q8N593|Q96NN5	Silent	SNP	ENST00000515384.1	37	CCDS53859.1																																																																																				0.577	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1		NM_152704	
FAM196A	642938	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	128974169	128974169	+	Missense_Mutation	SNP	G	G	A	rs551807342		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr10:128974169G>A	ENST00000522781.1	-	4	1046	c.491C>T	c.(490-492)gCg>gTg	p.A164V	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Missense_Mutation_p.A164V	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	164								p.A164V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CACCCGCCCCGCGCCACATGG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		16789	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											75.0	74.0	74.0					10																	128974169		2203	4300	6503	SO:0001583	missense	642938				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.491C>T	10.37:g.128974169G>A	ENSP00000429763:p.Ala164Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNT4|B7ZME7	Missense_Mutation	SNP	ENST00000522781.1	37	CCDS31312.1	.	.	.	.	.	.	.	.	.	.	G	9.853	1.194153	0.22037	.	.	ENSG00000188916	ENST00000522781;ENST00000424811	T;T	0.44881	0.91;0.91	4.17	2.04	0.26737	.	0.505390	0.23069	N	0.052294	T	0.36026	0.0952	M	0.63428	1.95	0.30881	N	0.731409	B;B	0.31640	0.333;0.054	B;B	0.25506	0.061;0.011	T	0.41998	-0.9477	10	0.56958	D	0.05	.	9.7222	0.40311	0.0849:0.1378:0.7773:0.0	.	164;164	B7ZME7;Q6ZSG2	.;F196A_HUMAN	V	164	ENSP00000429763:A164V;ENSP00000428730:A164V	ENSP00000428730:A164V	A	-	2	0	FAM196A	128864159	0.021000	0.18746	0.026000	0.17262	0.186000	0.23388	1.280000	0.33202	0.570000	0.29347	0.563000	0.77884	GCG		0.547	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2		NM_001039762	
FBN3	84467	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	8194141	8194141	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:8194141G>C	ENST00000600128.1	-	17	2567	c.2153C>G	c.(2152-2154)tCa>tGa	p.S718*	FBN3_ENST00000270509.2_Nonsense_Mutation_p.S718*|FBN3_ENST00000601739.1_Nonsense_Mutation_p.S718*			Q75N90	FBN3_HUMAN	fibrillin 3	718	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.S718*(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GTCCTTGCCTGAGGCACCTGC	0.637																																																	1	Substitution - Nonsense(1)	kidney(1)											49.0	46.0	47.0					19																	8194141		2203	4300	6503	SO:0001587	stop_gained	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2153C>G	19.37:g.8194141G>C	ENSP00000470498:p.Ser718*	Somatic		WXS	Illumina HiSeq	Phase_I	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Nonsense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	g	39	7.739938	0.98462	.	.	ENSG00000142449	ENST00000270509	.	.	.	4.4	-0.631	0.11526	.	0.561572	0.17527	U	0.171028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	3.6922	0.08350	0.0769:0.2647:0.3864:0.272	.	.	.	.	X	718	.	ENSP00000270509:S718X	S	-	2	0	FBN3	8100141	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.141000	0.31528	-0.282000	0.09128	-0.399000	0.06403	TCA		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2		NM_032447	
FZD1	8321	broad.mit.edu;hgsc.bcm.edu	37	7	90895797	90895797	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr7:90895797G>T	ENST00000287934.2	+	1	2015	c.1602G>T	c.(1600-1602)atG>atT	p.M534I		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	534					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.M534I(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			AGAAGCTCATGGTGCGCATTG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											140.0	112.0	122.0					7																	90895797		2203	4300	6503	SO:0001583	missense	8321			AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.1602G>T	7.37:g.90895797G>T	ENSP00000287934:p.Met534Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	ENST00000287934.2	37	CCDS5620.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459658	0.84317	.	.	ENSG00000157240	ENST00000287934	D	0.83506	-1.73	5.03	5.03	0.67393	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.89691	0.6788	M	0.68593	2.085	0.80722	D	1	D	0.60575	0.988	D	0.63877	0.919	D	0.90412	0.4410	10	0.66056	D	0.02	.	18.5476	0.91053	0.0:0.0:1.0:0.0	.	534	Q9UP38	FZD1_HUMAN	I	534	ENSP00000287934:M534I	ENSP00000287934:M534I	M	+	3	0	FZD1	90733733	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.643000	0.98464	2.607000	0.88179	0.655000	0.94253	ATG		0.597	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2		NM_003505	
GALNT13	114805	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	155099221	155099221	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:155099221G>T	ENST00000392825.3	+	6	1056	c.489G>T	c.(487-489)aaG>aaT	p.K163N	GALNT13_ENST00000409237.1_Missense_Mutation_p.K163N	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	163	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K163N(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						ATTTTCTCAAGTTGACATTAG	0.333																																																	1	Substitution - Missense(1)	kidney(1)											24.0	27.0	26.0					2																	155099221		2201	4299	6500	SO:0001583	missense	114805			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.489G>T	2.37:g.155099221G>T	ENSP00000376570:p.Lys163Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677415	0.68042	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.61392	0.11;0.11	5.98	4.19	0.49359	Glycosyl transferase, family 2 (1);	0.044595	0.85682	D	0.000000	T	0.75095	0.3803	M	0.88450	2.955	0.58432	D	0.999998	D;D	0.57571	0.98;0.977	P;P	0.62740	0.906;0.756	T	0.76868	-0.2800	10	0.62326	D	0.03	.	9.1463	0.36935	0.2192:0.0:0.7808:0.0	.	163;163	Q08ER7;Q8IUC8	.;GLT13_HUMAN	N	163	ENSP00000376570:K163N;ENSP00000387239:K163N	ENSP00000376570:K163N	K	+	3	2	GALNT13	154807467	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.533000	0.53561	0.877000	0.35895	0.585000	0.79938	AAG		0.333	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2		NM_052917	
GPR98	84059	hgsc.bcm.edu;ucsc.edu	37	5	89969937	89969938	+	Frame_Shift_Ins	INS	-	-	T	rs370077523		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:89969937_89969938insT	ENST00000405460.2	+	23	5092_5093	c.4996_4997insT	c.(4996-4998)gttfs	p.V1666fs	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1666					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGTGACATTGGTTTCTGCAATT	0.386																																																	0																																										SO:0001589	frameshift_variant	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4999dupT	5.37:g.89969940_89969940dupT	ENSP00000384582:p.Val1666fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75171|Q8TF58|Q9H0X5|Q9UL61	Frame_Shift_Ins	INS	ENST00000405460.2	37	CCDS47246.1																																																																																				0.386	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2		NM_032119	
HEXA	3073	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	72645420	72645420	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:72645420G>T	ENST00000268097.5	-	5	1062	c.559C>A	c.(559-561)Ctg>Atg	p.L187M	RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000567159.1_Missense_Mutation_p.L187M|HEXA_ENST00000429918.2_Intron|HEXA_ENST00000566304.1_Missense_Mutation_p.L198M|HEXA_ENST00000457859.2_De_novo_Start_InFrame|RP11-106M3.3_ENST00000570175.1_RNA	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	187					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.L187M(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						AGAGTGTCCAGGATGCTAGAG	0.478																																																	1	Substitution - Missense(1)	kidney(1)											80.0	69.0	73.0					15																	72645420		2199	4297	6496	SO:0001583	missense	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.559C>A	15.37:g.72645420G>T	ENSP00000268097:p.Leu187Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829272	0.50845	.	.	ENSG00000213614	ENST00000268097	D	0.97089	-4.24	5.59	2.68	0.31781	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.083276	0.49916	N	0.000124	D	0.95981	0.8691	M	0.75447	2.3	0.80722	D	1	B;B;P	0.39181	0.099;0.038;0.663	B;B;P	0.46026	0.378;0.322;0.501	D	0.92683	0.6160	10	0.33940	T	0.23	-7.0776	5.3613	0.16089	0.2152:0.0:0.6404:0.1444	.	198;67;187	B4DVA7;Q9BVJ8;P06865	.;.;HEXA_HUMAN	M	187	ENSP00000268097:L187M	ENSP00000268097:L187M	L	-	1	2	HEXA	70432474	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.037000	0.49775	0.700000	0.31782	0.650000	0.86243	CTG		0.478	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2		NM_000520	
HIP1	3092	broad.mit.edu;hgsc.bcm.edu	37	7	75168737	75168737	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr7:75168737C>A	ENST00000336926.6	-	30	2993	c.2967G>T	c.(2965-2967)gaG>gaT	p.E989D	HIP1_ENST00000434438.2_Missense_Mutation_p.E938D	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	989	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.E991D(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CATTTTCTAGCTCTAGCACCC	0.418			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	1	Substitution - Missense(1)	kidney(1)											198.0	198.0	198.0					7																	75168737		2203	4300	6503	SO:0001583	missense	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2967G>T	7.37:g.75168737C>A	ENSP00000336747:p.Glu989Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.105975	0.77096	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.46451	0.87;0.87	5.31	3.47	0.39725	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.63414	0.2509	M	0.85197	2.74	0.48975	D	0.999732	D;D	0.55172	0.97;0.966	P;D	0.69307	0.868;0.963	T	0.67546	-0.5643	10	0.87932	D	0	-31.404	9.0989	0.36656	0.0:0.7596:0.0:0.2404	.	938;989	E7ES17;O00291	.;HIP1_HUMAN	D	989;938	ENSP00000336747:E989D;ENSP00000410300:E938D	ENSP00000336747:E989D	E	-	3	2	HIP1	75006673	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.065000	0.49994	1.380000	0.46344	0.655000	0.94253	GAG		0.418	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2		NM_005338	
HMCN1	83872	hgsc.bcm.edu;ucsc.edu	37	1	186023105	186023105	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:186023105delT	ENST00000271588.4	+	44	7078	c.6849delT	c.(6847-6849)aatfs	p.N2283fs	HMCN1_ENST00000367492.2_Frame_Shift_Del_p.N2283fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2283	Ig-like C2-type 20.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAGAATACAATCTGCAAGTTT	0.363																																																	0													102.0	102.0	102.0					1																	186023105		2203	4300	6503	SO:0001589	frameshift_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6849delT	1.37:g.186023105delT	ENSP00000271588:p.Asn2283fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Del	DEL	ENST00000271588.4	37	CCDS30956.1																																																																																				0.363	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
HSPD1	3329	hgsc.bcm.edu	37	2	198363397	198363397	+	Splice_Site	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:198363397A>C	ENST00000388968.3	-	2	442		c.e2+1		HSPE1-MOB4_ENST00000604458.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank|HSPD1_ENST00000345042.2_Splice_Site|HSPE1_ENST00000409729.1_5'Flank|HSPD1_ENST00000544407.1_Splice_Site|HSPE1_ENST00000409468.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)						'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			AAATACTGGTACCTTTGGCCC	0.373																																																	0													46.0	49.0	48.0					2																	198363397		2203	4300	6503	SO:0001630	splice_region_variant	3329			M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.174+1T>G	2.37:g.198363397A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R5M6|B7Z712|Q38L19|Q9UCR6	Splice_Site	SNP	ENST00000388968.3	37	CCDS33357.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.782357	0.70222	.	.	ENSG00000144381	ENST00000388968;ENST00000345042;ENST00000430176;ENST00000452200;ENST00000544407;ENST00000426480;ENST00000428204;ENST00000439605	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7186	0.77688	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HSPD1	198071642	1.000000	0.71417	0.994000	0.49952	0.655000	0.38815	9.216000	0.95154	2.174000	0.68829	0.533000	0.62120	.		0.373	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2		NM_002156	Intron
HTR1E	3354	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	87725418	87725418	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:87725418G>T	ENST00000305344.5	+	2	1069	c.366G>T	c.(364-366)tgG>tgT	p.W122C		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	122					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.W122C(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	ACAGGTACTGGGCCATCACCA	0.557																																																	1	Substitution - Missense(1)	kidney(1)											107.0	86.0	93.0					6																	87725418		2203	4300	6503	SO:0001583	missense	3354				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.366G>T	6.37:g.87725418G>T	ENSP00000307766:p.Trp122Cys	Somatic		WXS	Illumina HiSeq	Phase_I	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.503046	0.64298	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.36699	1.24;1.24	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000016	T	0.48732	0.1516	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54892	-0.8225	10	0.87932	D	0	.	17.3338	0.87274	0.0:0.0:1.0:0.0	.	122	P28566	5HT1E_HUMAN	C	122	ENSP00000307766:W122C;ENSP00000358597:W122C	ENSP00000307766:W122C	W	+	3	0	HTR1E	87782137	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.219000	0.95173	2.085000	0.62840	0.404000	0.27445	TGG		0.557	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2		NM_000865	
IFNGR1	3459	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	137528120	137528120	+	Silent	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:137528120G>A	ENST00000367739.4	-	2	301	c.180C>T	c.(178-180)acC>acT	p.T60T	IFNGR1_ENST00000367735.2_Silent_p.T50T|IFNGR1_ENST00000543628.1_Silent_p.T32T|IFNGR1_ENST00000478333.1_5'UTR	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	60					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)	p.T60T(1)		central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTACCTCTACGGTAAAAACAG	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											122.0	119.0	120.0					6																	137528120		2203	4300	6503	SO:0001819	synonymous_variant	3459				CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.180C>T	6.37:g.137528120G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DFT7|E1P587|Q53Y96	Silent	SNP	ENST00000367739.4	37	CCDS5185.1																																																																																				0.373	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1			
IKZF3	22806	broad.mit.edu;hgsc.bcm.edu	37	17	37922736	37922737	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr17:37922736_37922737GC>TG	ENST00000346872.3	-	8	897_898	c.836_837GC>CA	c.(835-837)cGC>cCA	p.R279P	IKZF3_ENST00000351680.3_Missense_Mutation_p.R240P|IKZF3_ENST00000439016.2_Missense_Mutation_p.R184P|IKZF3_ENST00000583368.1_Missense_Mutation_p.R32P|IKZF3_ENST00000394189.2_Missense_Mutation_p.R97P|IKZF3_ENST00000377944.3_Missense_Mutation_p.R136P|IKZF3_ENST00000377945.3_Missense_Mutation_p.R145P|IKZF3_ENST00000535189.1_Missense_Mutation_p.R245P|IKZF3_ENST00000467757.1_Missense_Mutation_p.R223P|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000377952.2_Missense_Mutation_p.R58P|IKZF3_ENST00000377958.2_Missense_Mutation_p.R192P|IKZF3_ENST00000439167.2_Missense_Mutation_p.R206P|IKZF3_ENST00000346243.3_Missense_Mutation_p.R201P|IKZF3_ENST00000350532.3_Missense_Mutation_p.R240P	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	279					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R279P(2)|p.R279R(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CAAAGCAGTGGCGCTTCTCACC	0.436																																																	4	Substitution - Missense(2)|Substitution - coding silent(2)	kidney(3)|endometrium(1)																																								SO:0001583	missense	22806			AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.836_837delinsTG	17.37:g.37922736_37922737delinsTG	ENSP00000344544:p.Arg279Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Silent|Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1																																																																																				0.436	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2		NM_012481	
ISL1	3670	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	50685530	50685530	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:50685530C>T	ENST00000230658.7	+	4	1114	c.529C>T	c.(529-531)Cag>Tag	p.Q177*	ISL1_ENST00000511384.1_Nonsense_Mutation_p.Q177*|ISL1_ENST00000505475.2_3'UTR	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	177					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.Q177*(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				CGTCCACAAGCAGCCGGAGAA	0.701																																																	1	Substitution - Nonsense(1)	kidney(1)											33.0	40.0	37.0					5																	50685530		2203	4300	6503	SO:0001587	stop_gained	3670			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.529C>T	5.37:g.50685530C>T	ENSP00000230658:p.Gln177*	Somatic		WXS	Illumina HiSeq	Phase_I	P20663|P47894	Nonsense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.558096|5.558096	0.96514|0.96514	.|.	.|.	ENSG00000016082|ENSG00000016082	ENST00000505475|ENST00000230658;ENST00000503187;ENST00000511384	.|.	.|.	.|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.68348|.	0.2991|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.58014|.	-0.7711|.	4|.	0.87932|0.16420	D|T	0|0.52	.|.	20.547|20.547	0.99278|0.99278	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	123|177	.|.	ENSP00000421737:A123V|ENSP00000230658:Q177X	A|Q	+|+	2|1	0|0	ISL1|ISL1	50721287|50721287	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	7.395000|7.395000	0.79876|0.79876	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	GCA|CAG		0.701	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3		NM_002202	
JAKMIP3	282973	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	133930691	133930691	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr10:133930691G>C	ENST00000298622.4	+	2	384	c.246G>C	c.(244-246)gaG>gaC	p.E82D		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	82						Golgi apparatus (GO:0005794)		p.E82D(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCACGAGGAGAAGATGAAGG	0.592																																																	1	Substitution - Missense(1)	kidney(1)											50.0	59.0	56.0					10																	133930691		2196	4294	6490	SO:0001583	missense	282973			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.246G>C	10.37:g.133930691G>C	ENSP00000298622:p.Glu82Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484312	0.44147	.	.	ENSG00000188385	ENST00000298622	T	0.43688	0.94	4.53	0.117	0.14652	.	0.054756	0.64402	N	0.000001	T	0.32941	0.0846	L	0.55103	1.725	0.27060	N	0.963566	B	0.17038	0.02	B	0.16722	0.016	T	0.27971	-1.0058	10	0.59425	D	0.04	-29.7457	6.6243	0.22820	0.2899:0.2514:0.4586:0.0	.	82	Q5VZ66	JKIP3_HUMAN	D	82	ENSP00000298622:E82D	ENSP00000298622:E82D	E	+	3	2	JAKMIP3	133780681	0.397000	0.25270	1.000000	0.80357	0.972000	0.66771	-0.254000	0.08781	0.149000	0.19098	0.491000	0.48974	GAG		0.592	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3		NM_194303	
JTB	10899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	153949705	153949705	+	Silent	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:153949705A>T	ENST00000271843.4	-	1	459	c.24T>A	c.(22-24)ccT>ccA	p.P8P	JTB_ENST00000356648.1_5'UTR|RP11-422P24.11_ENST00000608236.1_lincRNA|JTB_ENST00000368589.1_5'UTR|JTB_ENST00000471173.1_5'UTR	NM_006694.3	NP_006685.1	O76095	JTB_HUMAN	jumping translocation breakpoint	8					apoptotic mitochondrial changes (GO:0008637)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|positive regulation of protein kinase activity (GO:0045860)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)	protein kinase binding (GO:0019901)	p.P8P(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)	10	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGGGGAGGCCAGGCCTCCCGG	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											45.0	50.0	49.0					1																	153949705		2203	4300	6503	SO:0001819	synonymous_variant	10899			AB016488	CCDS1057.1	1q21	2010-11-16			ENSG00000143543	ENSG00000143543			6201	protein-coding gene	gene with protein product	"""prostate androgen-regulated gene"""	604671				10321732	Standard	NM_006694		Approved	hJT	uc001fds.3	O76095	OTTHUMG00000036590	ENST00000271843.4:c.24T>A	1.37:g.153949705A>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95442|Q6IB19|Q9P0Q4	Silent	SNP	ENST00000271843.4	37	CCDS1057.1																																																																																				0.642	JTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088996.1		NM_006694	
KDM5D	8284	broad.mit.edu;ucsc.edu	37	Y	21903350	21903350	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chrY:21903350C>T	ENST00000317961.4	-	5	647	c.376G>A	c.(376-378)Gaa>Aaa	p.E126K	KDM5D_ENST00000541639.1_Missense_Mutation_p.E126K|KDM5D_ENST00000382806.2_Intron	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	126	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.E126K(1)		kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	CAGATGGCTTCATAGCCACCT	0.478																																																	1	Substitution - Missense(1)	kidney(1)											50.0	55.0	54.0					Y																	21903350		586	1914	2500	SO:0001583	missense	8284			U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.376G>A	Y.37:g.21903350C>T	ENSP00000322408:p.Glu126Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	ENST00000317961.4	37	CCDS14794.1																																																																																				0.478	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1		NM_004653	
GLTSCR1L	23506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	42796273	42796273	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:42796273C>T	ENST00000314073.5	+	6	378	c.202C>T	c.(202-204)Ctt>Ttt	p.L68F	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.L68F			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	68								p.L68F(1)									AAGCAACCAGCTTGGAGAAGG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											94.0	87.0	89.0					6																	42796273		2203	4300	6503	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.202C>T	6.37:g.42796273C>T	ENSP00000313933:p.Leu68Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642629	0.47153	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.53423	0.62;0.62	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000012	T	0.56804	0.2010	L	0.55481	1.735	0.43107	D	0.994806	D;P;P	0.71674	0.998;0.607;0.607	D;B;B	0.69142	0.962;0.187;0.12	T	0.56577	-0.7956	10	0.62326	D	0.03	-17.1116	15.8523	0.78943	0.0:0.8651:0.1349:0.0	.	68;68;68	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	F	68	ENSP00000313933:L68F;ENSP00000377723:L68F	ENSP00000313933:L68F	L	+	1	0	KIAA0240	42904251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.926000	0.56491	2.902000	0.99343	0.650000	0.86243	CTT		0.428	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3		NM_015349	
MAP10	54627	hgsc.bcm.edu;ucsc.edu	37	1	232943660	232943660	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:232943660delT	ENST00000418460.1	+	1	3018	c.2891delT	c.(2890-2892)attfs	p.I964fs		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	822					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										AATTCTGAAATTACAAAGAGA	0.363																																																	0													73.0	75.0	75.0					1																	232943660		1841	4092	5933	SO:0001589	frameshift_variant	54627			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.2891delT	1.37:g.232943660delT	ENSP00000403208:p.Ile964fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Frame_Shift_Del	DEL	ENST00000418460.1	37	CCDS44334.1																																																																																				0.363	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092317.3		NM_019090	
KLHL1	57626	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	70281831	70281831	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr13:70281831C>T	ENST00000377844.4	-	10	2872	c.2113G>A	c.(2113-2115)Gtt>Att	p.V705I	KLHL1_ENST00000545028.1_Missense_Mutation_p.V512I	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	705					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.V705I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TAGCCACCAACAGCATATAAT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											173.0	139.0	151.0					13																	70281831		2203	4299	6502	SO:0001583	missense	57626			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2113G>A	13.37:g.70281831C>T	ENSP00000367075:p.Val705Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290076	0.80914	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.72051	-0.62;-0.62	5.19	5.19	0.71726	Galactose oxidase, beta-propeller (1);	0.000000	0.53938	D	0.000054	T	0.77857	0.4193	L	0.45137	1.4	0.53688	D	0.999973	P;P	0.45212	0.853;0.853	P;P	0.57548	0.773;0.823	T	0.76578	-0.2908	10	0.44086	T	0.13	.	19.094	0.93242	0.0:1.0:0.0:0.0	.	705;705	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	I	705;512	ENSP00000367075:V705I;ENSP00000439602:V512I	ENSP00000367075:V705I	V	-	1	0	KLHL1	69179832	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.844000	0.69430	2.595000	0.87683	0.650000	0.86243	GTT		0.448	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3		NM_020866	
LMNB1	4001	broad.mit.edu;ucsc.edu	37	5	126158526	126158526	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:126158526C>T	ENST00000261366.5	+	8	1801	c.1440C>T	c.(1438-1440)gtC>gtT	p.V480V	LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	480	LTD.|Tail.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)	p.V480V(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		ACACATCAGTCAGTTATAAAT	0.388																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	85.0	87.0					5																	126158526		2203	4300	6503	SO:0001819	synonymous_variant	4001			L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.1440C>T	5.37:g.126158526C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B2R6J6|Q3SYN7|Q96EI6	Silent	SNP	ENST00000261366.5	37	CCDS4140.1																																																																																				0.388	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2		NM_005573	
LRP1	4035	hgsc.bcm.edu;ucsc.edu	37	12	57560827	57560833	+	Splice_Site	DEL	GTGGTAA	GTGGTAA	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	GTGGTAA	GTGGTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr12:57560827_57560833delGTGGTAA	ENST00000243077.3	+	18	3378_3380	c.2912_2914delGTGGTAA	c.(2911-2916)tgtggt>tgt	p.G972fs		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	972	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCTGCTTCGTGTGGTAAGAGGGATGGG	0.628																																																	0																																										SO:0001630	splice_region_variant	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2914+1GTGGTAA>-	12.37:g.57560827_57560833delGTGGTAA		Somatic		WXS	Illumina HiSeq	Phase_I	Q2PP12|Q86SW0|Q8IVG8	Frame_Shift_Del	DEL	ENST00000243077.3	37	CCDS8932.1																																																																																				0.628	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2		NM_002332	Frame_Shift_Del
LYPD3	27076	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	43967403	43967403	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:43967403C>T	ENST00000244333.3	-	4	507	c.419G>A	c.(418-420)tGc>tAc	p.C140Y		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	140	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.C140Y(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				ACAGCTGTAGCACTCCACGCC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											62.0	56.0	58.0					19																	43967403		2203	4300	6503	SO:0001583	missense	27076			AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.419G>A	19.37:g.43967403C>T	ENSP00000244333:p.Cys140Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UJ74	Missense_Mutation	SNP	ENST00000244333.3	37	CCDS12620.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632365	0.87660	.	.	ENSG00000124466	ENST00000244333	D	0.99677	-6.37	4.83	4.83	0.62350	CD59 antigen (1);	0.387355	0.25135	N	0.032873	D	0.99492	0.9819	L	0.54323	1.7	0.40954	D	0.984564	D	0.89917	1.0	D	0.87578	0.998	D	0.98107	1.0418	10	0.87932	D	0	.	13.8446	0.63459	0.0:1.0:0.0:0.0	.	140	O95274	LYPD3_HUMAN	Y	140	ENSP00000244333:C140Y	ENSP00000244333:C140Y	C	-	2	0	LYPD3	48659243	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	3.573000	0.53856	2.432000	0.82394	0.456000	0.33151	TGC		0.622	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1		NM_014400	
MAGI3	260425	hgsc.bcm.edu;ucsc.edu	37	1	114193718	114193718	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:114193718delA	ENST00000307546.9	+	14	2405	c.2330delA	c.(2329-2331)gatfs	p.D777fs	MAGI3_ENST00000369617.4_Frame_Shift_Del_p.D802fs|MAGI3_ENST00000369615.1_Frame_Shift_Del_p.D777fs|MAGI3_ENST00000369611.4_Frame_Shift_Del_p.D777fs	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	802	Interaction with BAI1.|PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTGCATTGATGGAATTCCT	0.443																																																	0													148.0	137.0	141.0					1																	114193718		2203	4300	6503	SO:0001589	frameshift_variant	260425			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2330delA	1.37:g.114193718delA	ENSP00000304604:p.Asp777fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Frame_Shift_Del	DEL	ENST00000307546.9	37	CCDS44196.1																																																																																				0.443	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1		NM_152900	
MCM5	4174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	35815920	35815920	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr22:35815920A>C	ENST00000216122.4	+	14	1901	c.1747A>C	c.(1747-1749)Aag>Cag	p.K583Q	MCM5_ENST00000382011.5_Missense_Mutation_p.K540Q	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	583					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.K583Q(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						AGAGAAACTGAAGAACCGCTA	0.642																																																	1	Substitution - Missense(1)	kidney(1)											61.0	64.0	63.0					22																	35815920		2203	4300	6503	SO:0001583	missense	4174				CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1747A>C	22.37:g.35815920A>C	ENSP00000216122:p.Lys583Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	ENST00000216122.4	37	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.868935	0.32977	.	.	ENSG00000100297	ENST00000216122;ENST00000382011	T;T	0.11169	2.8;2.8	4.93	3.88	0.44766	.	0.048715	0.85682	D	0.000000	T	0.08935	0.0221	N	0.20845	0.615	0.80722	D	1	B;B;B;B	0.27700	0.186;0.186;0.186;0.186	B;B;B;B	0.36186	0.219;0.219;0.219;0.219	T	0.31251	-0.9950	10	0.21014	T	0.42	-32.8051	11.9057	0.52711	0.8541:0.1459:0.0:0.0	.	583;583;540;583	B1AHB0;Q53FG5;B1AHB1;P33992	.;.;.;MCM5_HUMAN	Q	583;540	ENSP00000216122:K583Q;ENSP00000371441:K540Q	ENSP00000216122:K583Q	K	+	1	0	MCM5	34145920	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	8.036000	0.88901	0.885000	0.36088	-0.491000	0.04670	AAG		0.642	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3			
MED13	9969	hgsc.bcm.edu;ucsc.edu	37	17	60059957	60059957	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr17:60059957delT	ENST00000397786.2	-	16	3483	c.3407delA	c.(3406-3408)aacfs	p.N1137fs		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1137					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TCCTGAATTGTTTCCAAATTT	0.423																																																	0													150.0	137.0	141.0					17																	60059957		1896	4109	6005	SO:0001589	frameshift_variant	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3407delA	17.37:g.60059957delT	ENSP00000380888:p.Asn1137fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RU05|O60334	Frame_Shift_Del	DEL	ENST00000397786.2	37	CCDS42366.1																																																																																				0.423	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1		NM_005121	
MKI67	4288	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	129913433	129913433	+	Silent	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr10:129913433A>C	ENST00000368654.3	-	7	1614	c.1239T>G	c.(1237-1239)acT>acG	p.T413T	MKI67_ENST00000368653.3_Intron|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	413					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.T413T(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTTCTGGCTTAGTGGCAGAGT	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											92.0	95.0	94.0					10																	129913433		2203	4300	6503	SO:0001819	synonymous_variant	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1239T>G	10.37:g.129913433A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VWH2	Silent	SNP	ENST00000368654.3	37	CCDS7659.1																																																																																				0.428	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1		NM_002417	
MORC3	23515	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	37721695	37721695	+	Silent	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr21:37721695T>C	ENST00000400485.1	+	9	1168	c.1092T>C	c.(1090-1092)acT>acC	p.T364T	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	364					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.T364T(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						TCGACTATACTAATGAGTACA	0.333																																																	1	Substitution - coding silent(1)	kidney(1)											74.0	71.0	72.0					21																	37721695		1816	4068	5884	SO:0001819	synonymous_variant	23515			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1092T>C	21.37:g.37721695T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8KA92|Q9UEZ2	Silent	SNP	ENST00000400485.1	37	CCDS42924.1																																																																																				0.333	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1		NM_015358	
NAA10	8260	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	153196257	153196257	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chrX:153196257C>T	ENST00000464845.1	-	7	748	c.430G>A	c.(430-432)Gcc>Acc	p.A144T	NAA10_ENST00000370015.4_Missense_Mutation_p.A144T|NAA10_ENST00000393710.3_5'Flank|NAA10_ENST00000393712.3_Missense_Mutation_p.A144T|NAA10_ENST00000370009.1_Missense_Mutation_p.A129T	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit	144	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)	p.A144T(1)		breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						ATGGCATAGGCGTCCTCCCCA	0.612																																					Ovarian(94;1099 1433 38814 45882 51063)												1	Substitution - Missense(1)	kidney(1)											174.0	143.0	154.0					X																	153196257		2203	4300	6503	SO:0001583	missense	8260			BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.430G>A	X.37:g.153196257C>T	ENSP00000417763:p.Ala144Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NM98	Missense_Mutation	SNP	ENST00000464845.1	37	CCDS14737.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330898	0.60853	.	.	ENSG00000102030	ENST00000464845;ENST00000370015;ENST00000393712;ENST00000370009;ENST00000370011;ENST00000432089	T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46	4.41	3.55	0.40652	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.84156	0.5410	H	0.99900	4.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	D	0.87510	0.2439	10	0.87932	D	0	-40.4821	10.3479	0.43916	0.0:0.8989:0.0:0.1011	.	129;144	A6NM98;P41227	.;NAA10_HUMAN	T	144;144;144;129;123;138	ENSP00000417763:A144T;ENSP00000359032:A144T;ENSP00000377315:A144T;ENSP00000359026:A129T;ENSP00000359028:A123T;ENSP00000413668:A138T	ENSP00000359026:A129T	A	-	1	0	NAA10	152849451	0.995000	0.38212	0.280000	0.24747	0.148000	0.21650	7.173000	0.77612	0.862000	0.35528	0.509000	0.49947	GCC		0.612	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061108.2		NM_003491	
NFE2L1	4779	broad.mit.edu;ucsc.edu	37	17	46135813	46135813	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr17:46135813C>G	ENST00000362042.3	+	6	1745	c.1129C>G	c.(1129-1131)Ctc>Gtc	p.L377V	RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000536222.1_Missense_Mutation_p.L221V|NFE2L1_ENST00000582155.1_Missense_Mutation_p.L189V|NFE2L1_ENST00000361665.3_Missense_Mutation_p.L366V|NFE2L1_ENST00000357480.5_Missense_Mutation_p.L347V|NFE2L1_ENST00000583378.1_Missense_Mutation_p.L178V|NFE2L1_ENST00000585291.1_Missense_Mutation_p.L347V	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	377					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.L377V(1)		cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGACTTCTTACTCTTCAGCCC	0.612																																																	1	Substitution - Missense(1)	kidney(1)											94.0	97.0	96.0					17																	46135813		2203	4300	6503	SO:0001583	missense	4779			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.1129C>G	17.37:g.46135813C>G	ENSP00000354855:p.Leu377Val	Somatic		WXS	Illumina GAIIx	Phase_I	D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	ENST00000362042.3	37	CCDS11524.1	.	.	.	.	.	.	.	.	.	.	C	8.577	0.881409	0.17467	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	T;D;D	0.95885	2.96;-3.84;-3.84	5.65	5.65	0.86999	.	0.419839	0.26149	N	0.026049	D	0.93360	0.7883	L	0.50333	1.59	0.49582	D	0.999809	B;B;B;B	0.30870	0.251;0.214;0.208;0.298	B;B;B;B	0.29267	0.1;0.031;0.038;0.065	D	0.91207	0.4996	10	0.26408	T	0.33	-39.9864	18.4922	0.90852	0.0:1.0:0.0:0.0	.	221;189;347;377	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	V	396;377;347;221	ENSP00000354855:L396V;ENSP00000350072:L347V;ENSP00000445811:L221V	ENSP00000350072:L347V	L	+	1	0	NFE2L1	43490812	0.969000	0.33509	0.963000	0.40424	0.984000	0.73092	2.131000	0.42074	2.661000	0.90470	0.655000	0.94253	CTC		0.612	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1		NM_003204	
NARF	26502	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	80443460	80443460	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr17:80443460G>T	ENST00000309794.11	+	10	1257	c.1059G>T	c.(1057-1059)caG>caT	p.Q353H	NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.Q399H|NARF_ENST00000345415.7_Missense_Mutation_p.Q305H|NARF_ENST00000390006.4_Missense_Mutation_p.Q294H	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	353						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)	p.Q399H(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GAAACATCCAGAACATGATCC	0.512																																																	1	Substitution - Missense(1)	kidney(1)											147.0	129.0	135.0					17																	80443460		2203	4300	6503	SO:0001583	missense	26502			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1059G>T	17.37:g.80443460G>T	ENSP00000309899:p.Gln353His	Somatic		WXS	Illumina HiSeq	Phase_I	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	.	13.45	2.241722	0.39598	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.48836	0.8;0.8;0.8	5.32	5.32	0.75619	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.051387	0.85682	D	0.000000	T	0.70325	0.3211	M	0.88105	2.93	0.80722	D	1	D;P;D;D	0.63046	0.983;0.838;0.986;0.992	D;P;D;D	0.67900	0.923;0.828;0.954;0.933	T	0.75277	-0.3374	10	0.62326	D	0.03	-17.0481	11.3919	0.49820	0.0923:0.0:0.9077:0.0	.	399;305;400;353	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	H	294;400;353;305	ENSP00000374656:Q294H;ENSP00000309899:Q353H;ENSP00000283996:Q305H	ENSP00000309899:Q353H	Q	+	3	2	NARF	78036749	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.998000	0.63927	2.480000	0.83734	0.561000	0.74099	CAG		0.512	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2		NM_031968	
NOTCH4	4855	hgsc.bcm.edu	37	6	32187443	32187443	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:32187443C>A	ENST00000375023.3	-	8	1574	c.1436G>T	c.(1435-1437)tGc>tTc	p.C479F		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	479	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.C479F(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTGGGAGAGGCACTCATTGTG	0.607																																																	1	Substitution - Missense(1)	kidney(1)											102.0	69.0	81.0					6																	32187443		1511	2709	4220	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1436G>T	6.37:g.32187443C>A	ENSP00000364163:p.Cys479Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448481	0.63178	.	.	ENSG00000204301	ENST00000375023	D	0.94793	-3.52	4.0	4.0	0.46444	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.45606	D	0.000346	D	0.98535	0.9511	H	0.99726	4.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98824	1.0748	10	0.87932	D	0	.	13.6604	0.62363	0.0:1.0:0.0:0.0	.	479;479	Q6P3V5;Q99466	.;NOTC4_HUMAN	F	479	ENSP00000364163:C479F	ENSP00000364163:C479F	C	-	2	0	NOTCH4	32295421	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	7.189000	0.77747	2.069000	0.61940	0.455000	0.32223	TGC		0.607	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			
NPTX1	4884	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	78445540	78445540	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr17:78445540G>T	ENST00000306773.4	-	4	1226	c.1069C>A	c.(1069-1071)Cag>Aag	p.Q357K	NPTX1_ENST00000575212.1_5'Flank	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	357	Pentaxin.				axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.Q357K(1)		kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			ACCTGCTCCTGGCCCAGCACC	0.657																																																	1	Substitution - Missense(1)	kidney(1)											45.0	38.0	41.0					17																	78445540		2203	4299	6502	SO:0001583	missense	4884			U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.1069C>A	17.37:g.78445540G>T	ENSP00000307549:p.Gln357Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	.	.	.	.	.	.	.	.	.	.	G	33	5.238452	0.95240	.	.	ENSG00000171246	ENST00000306773;ENST00000535681	T	0.12465	2.68	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.49592	0.1566	M	0.93420	3.415	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.63102	-0.6712	10	0.66056	D	0.02	-23.3103	18.1318	0.89604	0.0:0.0:1.0:0.0	.	357	Q15818	NPTX1_HUMAN	K	357;119	ENSP00000307549:Q357K	ENSP00000307549:Q357K	Q	-	1	0	NPTX1	76060135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.566000	0.98157	2.607000	0.88179	0.561000	0.74099	CAG		0.657	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1			
NSD1	64324	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	176720945	176720945	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:176720945C>T	ENST00000439151.2	+	23	6621	c.6576C>T	c.(6574-6576)ttC>ttT	p.F2192F	NSD1_ENST00000347982.4_Silent_p.F1923F|NSD1_ENST00000354179.4_Silent_p.F1923F|NSD1_ENST00000361032.4_Silent_p.F2089F	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2192					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.F2192F(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GGATGCTTTTCATTTCCAAAC	0.557			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	2	Substitution - coding silent(2)	kidney(2)											103.0	101.0	102.0					5																	176720945		2203	4300	6503	SO:0001819	synonymous_variant	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6576C>T	5.37:g.176720945C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																				0.557	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2		NM_172349	
NUP160	23279	broad.mit.edu;hgsc.bcm.edu	37	11	47828687	47828687	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr11:47828687G>A	ENST00000378460.2	-	19	2427	c.2381C>T	c.(2380-2382)tCt>tTt	p.S794F	NUP160_ENST00000528071.1_Missense_Mutation_p.S680F|NUP160_ENST00000530326.1_Missense_Mutation_p.S680F|RNA5SP340_ENST00000517132.1_RNA	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	794					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.S794F(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TTGGAGATTAGACTCCCTGTG	0.358																																																	1	Substitution - Missense(1)	kidney(1)											107.0	100.0	103.0					11																	47828687		2201	4298	6499	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2381C>T	11.37:g.47828687G>A	ENSP00000367721:p.Ser794Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029349	0.75504	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.48522	1.38;0.82;0.81	5.97	5.97	0.96955	.	0.181219	0.49916	D	0.000122	T	0.38665	0.1049	L	0.41236	1.265	0.80722	D	1	B	0.32693	0.38	B	0.21917	0.037	T	0.13124	-1.0521	10	0.30078	T	0.28	.	17.1653	0.86814	0.0:0.0:1.0:0.0	.	794	Q12769	NU160_HUMAN	F	794;680;680	ENSP00000367721:S794F;ENSP00000433590:S680F;ENSP00000432367:S680F	ENSP00000367721:S794F	S	-	2	0	NUP160	47785263	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	5.855000	0.69510	2.833000	0.97629	0.585000	0.79938	TCT		0.358	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2		NM_015231	
OR1C1	26188	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	247921449	247921449	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:247921449G>C	ENST00000408896.2	-	1	533	c.260C>G	c.(259-261)aCt>aGt	p.T87S		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	87					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T87S(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CTTGGTGCCAGTCAAGATATT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											65.0	62.0	63.0					1																	247921449		2009	4169	6178	SO:0001583	missense	26188			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.260C>G	1.37:g.247921449G>C	ENSP00000386138:p.Thr87Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.581447	0.00879	.	.	ENSG00000221888	ENST00000408896	T	0.01335	5.0	3.19	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01061	0.0035	N	0.10760	0.04	0.09310	N	1	B	0.14012	0.009	B	0.14578	0.011	T	0.48007	-0.9072	9	0.36615	T	0.2	.	9.5713	0.39429	0.1097:0.0:0.8903:0.0	.	87	Q15619	OR1C1_HUMAN	S	87	ENSP00000386138:T87S	ENSP00000386138:T87S	T	-	2	0	OR1C1	245988072	0.000000	0.05858	0.013000	0.15412	0.113000	0.19764	0.071000	0.14594	1.789000	0.52484	0.580000	0.79431	ACT		0.463	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			
ORC2	4999	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	201776015	201776015	+	3'UTR	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:201776015A>T	ENST00000234296.2	-	0	1992					NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TCAAGAATAAAGGAAAGCTTC	0.383																																																	0													98.0	92.0	94.0					2																	201776015		2203	4299	6502	SO:0001624	3_prime_UTR_variant	4999				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.*9T>A	2.37:g.201776015A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q13204|Q53TX5	RNA	SNP	ENST00000234296.2	37	CCDS2334.1																																																																																				0.383	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2		NM_006190	
PANK2	80025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	3897581	3897581	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr20:3897581A>C	ENST00000316562.4	+	5	1426	c.1420A>C	c.(1420-1422)Aac>Cac	p.N474H	MIR103A2_ENST00000362154.1_RNA|PANK2_ENST00000497424.1_Missense_Mutation_p.N183H|PANK2_ENST00000610179.1_Missense_Mutation_p.N351H|PANK2_ENST00000464452.1_3'UTR	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	474					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.N474H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CAGCTTTGGAAACATGATGAG	0.413																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CD060643	PANK2	D							84.0	72.0	76.0					20																	3897581		2203	4300	6503	SO:0001583	missense	80025			AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1420A>C	20.37:g.3897581A>C	ENSP00000313377:p.Asn474His	Somatic		WXS	Illumina HiSeq	Phase_I	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479619	0.44044	.	.	ENSG00000125779	ENST00000497424;ENST00000316562;ENST00000399552	D;D	0.99503	-6.03;-6.03	5.21	5.21	0.72293	.	0.045781	0.85682	D	0.000000	D	0.98289	0.9433	L	0.41824	1.3	0.41185	D	0.98626	B	0.18310	0.027	B	0.32624	0.149	D	0.97566	1.0101	10	0.59425	D	0.04	.	13.0859	0.59140	1.0:0.0:0.0:0.0	.	474	Q9BZ23	PANK2_HUMAN	H	183;474;290	ENSP00000417609:N183H;ENSP00000313377:N474H	ENSP00000313377:N474H	N	+	1	0	PANK2	3845581	0.996000	0.38824	1.000000	0.80357	0.984000	0.73092	3.109000	0.50345	2.191000	0.70037	0.533000	0.62120	AAC		0.413	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2		NM_024960	
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52696252	52696253	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:52696252_52696253insC	ENST00000296302.7	-	4	425_426	c.424_425insG	c.(424-426)gatfs	p.D142fs	PBRM1_ENST00000356770.4_Frame_Shift_Ins_p.D142fs|PBRM1_ENST00000337303.4_Frame_Shift_Ins_p.D142fs|PBRM1_ENST00000409114.3_Frame_Shift_Ins_p.D142fs|PBRM1_ENST00000409057.1_Frame_Shift_Ins_p.D142fs|PBRM1_ENST00000394830.3_Frame_Shift_Ins_p.D142fs|PBRM1_ENST00000409767.1_Frame_Shift_Ins_p.D142fs|PBRM1_ENST00000410007.1_Frame_Shift_Ins_p.D142fs			Q86U86	PB1_HUMAN	polybromo 1	142					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAGGTACAAATCCCAGAGTTTG	0.381			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0																																										SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.425dupG	3.37:g.52696255_52696255dupC	ENSP00000296302:p.Asp142fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Ins	INS	ENST00000296302.7	37																																																																																					0.381	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PDCL2	132954	broad.mit.edu;hgsc.bcm.edu	37	4	56435977	56435977	+	Silent	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr4:56435977T>C	ENST00000295645.4	-	4	372	c.270A>G	c.(268-270)ggA>ggG	p.G90G		NM_152401.2	NP_689614.2	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	90	Thioredoxin fold. {ECO:0000250}.							p.G90G(1)		endometrium(1)|kidney(1)|lung(4)|ovary(1)	7	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			CTCTTAATTCTCCAAATTTTT	0.289																																																	1	Substitution - coding silent(1)	kidney(1)											69.0	57.0	61.0					4																	56435977		1785	4028	5813	SO:0001819	synonymous_variant	132954			BC034431	CCDS47059.1	4q12	2008-02-05			ENSG00000163440	ENSG00000163440			29524	protein-coding gene	gene with protein product		611676				12424248	Standard	NM_152401		Approved	GCPHLP	uc003hbb.3	Q8N4E4	OTTHUMG00000160674	ENST00000295645.4:c.270A>G	4.37:g.56435977T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8MWA2|B9ZVQ9	Silent	SNP	ENST00000295645.4	37	CCDS47059.1																																																																																				0.289	PDCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361659.1		NM_152401	
POLK	51426	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	74865216	74865216	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:74865216A>G	ENST00000241436.4	+	4	479	c.307A>G	c.(307-309)Ata>Gta	p.I103V	POLK_ENST00000504026.1_Missense_Mutation_p.I103V|POLK_ENST00000515295.1_Missense_Mutation_p.I103V|POLK_ENST00000508526.1_Missense_Mutation_p.I103V|POLK_ENST00000380481.3_Missense_Mutation_p.I13V|POLK_ENST00000352007.5_Missense_Mutation_p.I103V|POLK_ENST00000506928.1_3'UTR	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	103	UmuC.				DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.I103V(2)		endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		GAGCAATACCATAGTGCACAT	0.338								DNA polymerases (catalytic subunits)																																									2	Substitution - Missense(2)	kidney(2)											97.0	91.0	93.0					5																	74865216		2203	4300	6503	SO:0001583	missense	51426			AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.307A>G	5.37:g.74865216A>G	ENSP00000241436:p.Ile103Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	37	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.333753	0.81801	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000514296;ENST00000515295;ENST00000504026;ENST00000508526;ENST00000380481	T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.61	5.61	0.85477	DNA-repair protein, UmuC-like, N-terminal (1);	0.042224	0.85682	D	0.000000	D	0.85957	0.5818	L	0.58510	1.815	0.58432	D	0.999999	D;P;D;D	0.71674	0.981;0.609;0.996;0.998	D;B;D;D	0.87578	0.99;0.254;0.998;0.995	D	0.86237	0.1641	10	0.51188	T	0.08	-13.957	16.0973	0.81135	1.0:0.0:0.0:0.0	.	103;103;103;103	Q9UBT6-3;Q5Q9G5;Q9UBT6-2;Q9UBT6	.;.;.;POLK_HUMAN	V	103;103;103;103;103;103;13	ENSP00000241436:I103V;ENSP00000342256:I103V;ENSP00000425208:I103V;ENSP00000424174:I103V;ENSP00000425075:I103V;ENSP00000426853:I103V;ENSP00000369848:I13V	ENSP00000241436:I103V	I	+	1	0	POLK	74900972	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.287000	0.95975	2.263000	0.75096	0.377000	0.23210	ATA		0.338	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3		NM_016218	
PPIP5K2	23262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	102513641	102513641	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:102513641A>C	ENST00000358359.3	+	23	3223	c.2714A>C	c.(2713-2715)aAt>aCt	p.N905T	PPIP5K2_ENST00000414217.1_Missense_Mutation_p.N905T|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.N905T	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	905					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.N905T(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAAGACAAAAATTTGCCATCT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											76.0	75.0	75.0					5																	102513641		2202	4298	6500	SO:0001583	missense	23262			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2714A>C	5.37:g.102513641A>C	ENSP00000351126:p.Asn905Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	A	16.13	3.034520	0.54896	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.23950	2.48;2.47;2.48;1.88	6.07	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	M	0.73217	2.22	0.58432	D	0.999996	B;B;B	0.24823	0.052;0.032;0.112	B;B;B	0.26770	0.056;0.073;0.049	T	0.08659	-1.0711	10	0.72032	D	0.01	.	11.9491	0.52944	0.9329:0.0:0.0671:0.0	.	920;905;905	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	T	905;905;920;905;179	ENSP00000313070:N905T;ENSP00000351126:N905T;ENSP00000416016:N905T;ENSP00000424948:N179T	ENSP00000313070:N905T	N	+	2	0	PPIP5K2	102541540	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.301000	0.72782	1.128000	0.42052	0.533000	0.62120	AAT		0.393	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1		NM_015216	
PPP2R2A	5520	broad.mit.edu;ucsc.edu	37	8	26217736	26217736	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr8:26217736G>T	ENST00000380737.3	+	5	727	c.398G>T	c.(397-399)gGg>gTg	p.G133V	PPP2R2A_ENST00000315985.7_Missense_Mutation_p.G143V	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	133					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.G133V(1)		kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		AGACCAGAAGGGTATAACTTG	0.328																																																	1	Substitution - Missense(1)	kidney(1)											97.0	99.0	98.0					8																	26217736		2203	4300	6503	SO:0001583	missense	5520			M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.398G>T	8.37:g.26217736G>T	ENSP00000370113:p.Gly133Val	Somatic		WXS	Illumina GAIIx	Phase_I	B2RBU8|B4E1T7|P50409|Q00007	Missense_Mutation	SNP	ENST00000380737.3	37	CCDS34867.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655790	0.88056	.	.	ENSG00000221914	ENST00000380737;ENST00000315985	T;T	0.31247	1.51;1.5	5.18	5.18	0.71444	WD40 repeat-like-containing domain (1);	0.000000	0.85682	U	0.000000	T	0.32585	0.0834	M	0.65320	2	0.80722	D	1	B;P	0.42296	0.053;0.775	B;B	0.34242	0.085;0.178	T	0.26883	-1.0090	10	0.48119	T	0.1	-13.4216	19.0947	0.93246	0.0:0.0:1.0:0.0	.	143;133	B4E1T7;P63151	.;2ABA_HUMAN	V	133;143	ENSP00000370113:G133V;ENSP00000325074:G143V	ENSP00000325074:G143V	G	+	2	0	PPP2R2A	26273653	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.623000	0.98386	2.593000	0.87608	0.585000	0.79938	GGG		0.328	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375954.2		NM_002717	
PRRC2A	7916	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	31594808	31594808	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:31594808G>A	ENST00000376033.2	+	11	1357	c.1123G>A	c.(1123-1125)Ggc>Agc	p.G375S	PRRC2A_ENST00000376007.4_Missense_Mutation_p.G375S	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	375	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G375S(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TGAAGCAGATGGCAAAAAGGG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											69.0	72.0	71.0					6																	31594808		2203	4300	6503	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1123G>A	6.37:g.31594808G>A	ENSP00000365201:p.Gly375Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.850443	0.32699	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.01527	4.8;4.8	4.6	2.8	0.32819	.	0.388456	0.22338	N	0.061365	T	0.00580	0.0019	N	0.22421	0.69	0.28716	N	0.903271	B	0.10296	0.003	B	0.08055	0.003	T	0.48210	-0.9055	10	0.87932	D	0	-7.0743	8.4775	0.33023	0.1943:0.0:0.8057:0.0	.	375	P48634	PRC2A_HUMAN	S	375	ENSP00000365175:G375S;ENSP00000365201:G375S	ENSP00000365175:G375S	G	+	1	0	PRRC2A	31702787	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.702000	0.37836	1.284000	0.44531	0.655000	0.94253	GGC		0.562	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1		NM_080686	
PSMB8	5696	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	32808790	32808790	+	Silent	SNP	T	T	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:32808790T>A	ENST00000374882.3	-	6	827	c.777A>T	c.(775-777)gtA>gtT	p.V259V	PSMB8_ENST00000374881.2_Silent_p.V255V|PSMB8_ENST00000395339.3_Silent_p.V235V|TAP2_ENST00000374897.2_5'Flank|TAP2_ENST00000452392.2_5'Flank|TAP2_ENST00000374899.4_5'Flank	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	259					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.V255V(1)|p.V259V(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	CTGTACTTTCTACTTTCACCC	0.502																																					NSCLC(48;53 1172 10859 13624 22883)												2	Substitution - coding silent(2)	kidney(2)											185.0	155.0	165.0					6																	32808790		2203	4300	6503	SO:0001819	synonymous_variant	5696				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.777A>T	6.37:g.32808790T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Silent	SNP	ENST00000374882.3	37	CCDS4757.1																																																																																				0.502	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076617.3		NM_148919	
RAB3GAP2	25782	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	220445640	220445640	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:220445640G>T	ENST00000358951.2	-	1	156	c.40C>A	c.(40-42)Ctc>Atc	p.L14I	RAB3GAP2_ENST00000462353.1_5'UTR	NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	14					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.L14I(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		GCGGCCTGGAGGTCCTGGAAG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											37.0	40.0	39.0					1																	220445640		2203	4299	6502	SO:0001583	missense	25782			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.40C>A	1.37:g.220445640G>T	ENSP00000351832:p.Leu14Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212491	0.58452	.	.	ENSG00000118873	ENST00000358951	T	0.34472	1.36	4.34	4.34	0.51931	.	0.067426	0.64402	D	0.000017	T	0.19927	0.0479	N	0.11427	0.14	0.43857	D	0.996451	B;B	0.19583	0.004;0.037	B;B	0.19148	0.019;0.024	T	0.06285	-1.0835	10	0.26408	T	0.33	.	12.2102	0.54375	0.0:0.0:1.0:0.0	.	14;14	Q9H2M9-2;Q9H2M9	.;RBGPR_HUMAN	I	14	ENSP00000351832:L14I	ENSP00000351832:L14I	L	-	1	0	RAB3GAP2	218512263	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.916000	0.63362	2.224000	0.72417	0.563000	0.77884	CTC		0.657	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2		NM_012414	
RBM39	9584	hgsc.bcm.edu;ucsc.edu	37	20	34309720	34309720	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr20:34309720delG	ENST00000253363.6	-	9	790	c.767delC	c.(766-768)tcafs	p.S256fs	RBM39_ENST00000361162.6_Frame_Shift_Del_p.S256fs|RBM39_ENST00000407261.4_Frame_Shift_Del_p.S99fs|RBM39_ENST00000528062.3_Frame_Shift_Del_p.S234fs			Q14498	RBM39_HUMAN	RNA binding motif protein 39	256	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					GAAGTGTAATGAGCCCACATA	0.408																																																	0													177.0	154.0	162.0					20																	34309720		2203	4300	6503	SO:0001589	frameshift_variant	9584			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.767delC	20.37:g.34309720delG	ENSP00000253363:p.Ser256fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Frame_Shift_Del	DEL	ENST00000253363.6	37	CCDS13266.1																																																																																				0.408	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2		NM_184237	
RIMKLB	57494	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	8904578	8904578	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr12:8904578G>A	ENST00000538135.1	+	4	1257	c.432G>A	c.(430-432)atG>atA	p.M144I	RIMKLB_ENST00000357529.3_Missense_Mutation_p.M144I|RIMKLB_ENST00000299673.5_3'UTR|RIMKLB_ENST00000535829.1_Missense_Mutation_p.M144I			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	144	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)	p.M144I(1)		central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TTGCTAAAATGATTGATGAGG	0.373																																																	1	Substitution - Missense(1)	kidney(1)											159.0	145.0	150.0					12																	8904578		1841	4082	5923	SO:0001583	missense	57494			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.432G>A	12.37:g.8904578G>A	ENSP00000440943:p.Met144Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	ENST00000538135.1	37	CCDS41748.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525301	0.64747	.	.	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	4.96	4.96	0.65561	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 1 (1);	0.000000	0.85682	U	0.000000	T	0.45115	0.1326	N	0.13043	0.29	0.80722	D	1	B;B	0.20887	0.019;0.049	B;B	0.26416	0.041;0.069	T	0.44314	-0.9336	9	0.62326	D	0.03	.	16.9516	0.86247	0.0:0.0:1.0:0.0	.	144;144	Q9ULI2-2;Q9ULI2	.;RIMKB_HUMAN	I	144	.	ENSP00000350136:M144I	M	+	3	0	RIMKLB	8795845	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.029000	0.93718	2.576000	0.86940	0.591000	0.81541	ATG		0.373	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398874.1		NM_020734	
RPGRIP1	57096	hgsc.bcm.edu;ucsc.edu	37	14	21796727	21796727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr14:21796727C>T	ENST00000400017.2	+	18	3040	c.3040C>T	c.(3040-3042)Caa>Taa	p.Q1014*	RPGRIP1_ENST00000556336.1_Nonsense_Mutation_p.Q671*|RPGRIP1_ENST00000206660.6_Nonsense_Mutation_p.Q1014*|RPGRIP1_ENST00000557771.1_Nonsense_Mutation_p.Q976*|RPGRIP1_ENST00000382933.4_Nonsense_Mutation_p.Q340*|RPGRIP1_ENST00000307974.4_Nonsense_Mutation_p.Q373*	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	1014					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.Q630*(1)|p.Q1014*(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AATAGGTGTTCAAGGAAAGAA	0.398																																																	2	Substitution - Nonsense(2)	kidney(2)											99.0	94.0	96.0					14																	21796727		1880	4107	5987	SO:0001587	stop_gained	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.3040C>T	14.37:g.21796727C>T	ENSP00000382895:p.Gln1014*	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Nonsense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	C	40	8.197055	0.98701	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	.	.	.	4.44	4.44	0.53790	.	0.569594	0.17982	N	0.155515	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-14.6963	12.7601	0.57359	0.0:1.0:0.0:0.0	.	.	.	.	X	671;976;1014;1014;340;489;373	.	ENSP00000206660:Q1014X	Q	+	1	0	RPGRIP1	20866567	0.979000	0.34478	0.971000	0.41717	0.623000	0.37688	3.018000	0.49625	2.478000	0.83669	0.650000	0.86243	CAA		0.398	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1		NM_020366	
RREB1	6239	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	7248780	7248780	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:7248780C>G	ENST00000349384.6	+	12	4957	c.4643C>G	c.(4642-4644)aCc>aGc	p.T1548S	RREB1_ENST00000334984.6_Missense_Mutation_p.T1337S|RREB1_ENST00000379933.3_Missense_Mutation_p.T1548S|RREB1_ENST00000379938.2_Missense_Mutation_p.T1603S	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1548					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T1548S(1)|p.T1603S(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				TGCGAGCGAACCTTCACCTTG	0.547																																																	2	Substitution - Missense(2)	kidney(2)											93.0	84.0	87.0					6																	7248780		2203	4300	6503	SO:0001583	missense	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.4643C>G	6.37:g.7248780C>G	ENSP00000305560:p.Thr1548Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755505	0.89843	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.46063	3.22;3.22;3.22;0.88	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000007	T	0.29588	0.0738	N	0.03177	-0.4	0.34078	D	0.659216	D;D;D	0.76494	0.995;0.996;0.999	D;D;D	0.74348	0.935;0.961;0.983	T	0.32025	-0.9922	10	0.18710	T	0.47	-60.7628	19.8411	0.96685	0.0:1.0:0.0:0.0	.	1337;1548;1603	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	S	1548;1603;1548;1337	ENSP00000369265:T1548S;ENSP00000369270:T1603S;ENSP00000305560:T1548S;ENSP00000335574:T1337S	ENSP00000335574:T1337S	T	+	2	0	RREB1	7193779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.133000	0.77259	2.683000	0.91414	0.655000	0.94253	ACC		0.547	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			
RUSC2	9853	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	35547730	35547730	+	Silent	SNP	A	A	T	rs367983066		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr9:35547730A>T	ENST00000455600.1	+	2	1781	c.1212A>T	c.(1210-1212)ctA>ctT	p.L404L		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	404						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)	p.L404L(1)		NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CCTGTGACCTATCTTCCCAAT	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											92.0	101.0	98.0					9																	35547730		2203	4300	6503	SO:0001819	synonymous_variant	9853			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1212A>T	9.37:g.35547730A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	37	CCDS35008.1																																																																																				0.562	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1		XM_048462	
RXRB	6257	broad.mit.edu;hgsc.bcm.edu	37	6	33163416	33163416	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:33163416A>G	ENST00000374680.3	-	7	1398	c.1187T>C	c.(1186-1188)cTc>cCc	p.L396P	RXRB_ENST00000544186.1_Missense_Mutation_p.L206P|RXRB_ENST00000374685.4_Missense_Mutation_p.L396P	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	396	Ligand-binding. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.L396P(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TGTGGCAAGGAGGATGCCATC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											78.0	72.0	74.0					6																	33163416		1511	2708	4219	SO:0001583	missense	6257			M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.1187T>C	6.37:g.33163416A>G	ENSP00000363812:p.Leu396Pro	Somatic		WXS	Illumina HiSeq	Phase_I	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752572	0.69533	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186	D;D;D	0.96992	-4.2;-4.2;-4.2	5.35	5.35	0.76521	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	D	0.000001	D	0.98532	0.9510	H	0.95260	3.645	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;1.0	D	0.99679	1.0998	10	0.87932	D	0	.	13.3302	0.60483	1.0:0.0:0.0:0.0	.	206;396;436;396	E9PK95;Q5STP9;Q59G65;P28702	.;.;.;RXRB_HUMAN	P	396;396;206	ENSP00000363817:L396P;ENSP00000363812:L396P;ENSP00000439222:L206P	ENSP00000363812:L396P	L	-	2	0	RXRB	33271394	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.088000	0.94132	2.246000	0.74042	0.448000	0.29417	CTC		0.567	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2		NM_021976	
SEC14L3	266629	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	30856107	30856107	+	Silent	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr22:30856107G>T	ENST00000215812.4	-	12	1194	c.1104C>A	c.(1102-1104)acC>acA	p.T368T	SEC14L3_ENST00000401751.1_Silent_p.T309T|SEC14L3_ENST00000415957.2_Intron|SEC14L3_ENST00000403066.1_Intron|SEC14L3_ENST00000539629.1_Silent_p.T309T|SEC14L3_ENST00000540910.1_Silent_p.T291T|SEC14L3_ENST00000402286.1_Silent_p.T291T	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	368	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.T368T(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	CAAAGCTATAGGTGTTGTCGA	0.542																																					Esophageal Squamous(108;290 1516 3584 23771 37333)												1	Substitution - coding silent(1)	kidney(1)											129.0	110.0	117.0					22																	30856107		2203	4300	6503	SO:0001819	synonymous_variant	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.1104C>A	22.37:g.30856107G>T		Somatic		WXS	Illumina HiSeq	Phase_I	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000215812.4	37	CCDS13877.1																																																																																				0.542	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4		NM_174975	
SEC16B	89866	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	177906454	177906454	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:177906454A>G	ENST00000308284.6	-	19	2487	c.2398T>C	c.(2398-2400)Tca>Cca	p.S800P	SEC16B_ENST00000495165.1_5'Flank|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	800					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.S801P(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						TCAGGAACTGAGTAAAAAGGC	0.637																																																	1	Substitution - Missense(1)	kidney(1)											48.0	55.0	53.0					1																	177906454		2001	4162	6163	SO:0001583	missense	89866			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2398T>C	1.37:g.177906454A>G	ENSP00000308339:p.Ser800Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	CCDS44281.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.411484	0.42817	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.13657	2.57	4.59	-0.502	0.12004	.	0.646567	0.14331	N	0.326378	T	0.22244	0.0536	M	0.69823	2.125	0.09310	N	0.999999	D;D;D;D	0.71674	0.998;0.996;0.996;0.988	P;P;P;P	0.59115	0.852;0.676;0.755;0.676	T	0.13818	-1.0495	10	0.25106	T	0.35	-0.4631	4.0083	0.09611	0.4266:0.371:0.2024:0.0	.	355;801;800;497	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	P	800;484;515	ENSP00000308339:S800P	ENSP00000239472:S515P	S	-	1	0	AL359075.1	176173077	0.000000	0.05858	0.005000	0.12908	0.325000	0.28411	0.009000	0.13219	0.029000	0.15352	0.528000	0.53228	TCA		0.637	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16		NM_033127	
SECISBP2L	9728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	49301485	49301485	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:49301485G>C	ENST00000559471.1	-	14	2218	c.1955C>G	c.(1954-1956)cCt>cGt	p.P652R	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.P607R	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	652							poly(A) RNA binding (GO:0044822)	p.P607R(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						AGAACTAGCAGGAGAGCCTTG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											186.0	164.0	172.0					15																	49301485		2197	4295	6492	SO:0001583	missense	9728			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1955C>G	15.37:g.49301485G>C	ENSP00000453854:p.Pro652Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301906	0.81136	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.74209	-0.82	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.85898	0.5804	M	0.76328	2.33	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	D	0.84410	0.0565	10	0.37606	T	0.19	.	18.7888	0.91965	0.0:0.0:1.0:0.0	.	652;607	Q93073;Q93073-2	SBP2L_HUMAN;.	R	607;652	ENSP00000261847:P607R	ENSP00000261847:P607R	P	-	2	0	SECISBP2L	47088777	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	7.241000	0.78201	2.757000	0.94681	0.655000	0.94253	CCT		0.423	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1		NM_014701	
SHROOM3	57619	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	77661527	77661527	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr4:77661527C>G	ENST00000296043.6	+	5	3154	c.2201C>G	c.(2200-2202)tCt>tGt	p.S734C		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	734					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.S733C(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			GCCTCGGCTTCTTTCAACAGC	0.701																																																	1	Substitution - Missense(1)	kidney(1)											24.0	29.0	27.0					4																	77661527		2180	4263	6443	SO:0001583	missense	57619			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2201C>G	4.37:g.77661527C>G	ENSP00000296043:p.Ser734Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	c	16.94	3.261381	0.59431	.	.	ENSG00000138771	ENST00000296043	T	0.36520	1.25	5.65	3.88	0.44766	.	0.666605	0.14254	N	0.331223	T	0.34106	0.0886	M	0.65975	2.015	0.09310	N	1	P;B;P	0.35033	0.481;0.159;0.481	B;B;B	0.28232	0.087;0.039;0.087	T	0.24333	-1.0163	10	0.72032	D	0.01	-20.1968	9.2699	0.37664	0.0:0.6503:0.2744:0.0754	.	558;734;512	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	C	734	ENSP00000296043:S734C	ENSP00000296043:S734C	S	+	2	0	SHROOM3	77880551	0.003000	0.15002	0.007000	0.13788	0.004000	0.04260	1.371000	0.34250	0.688000	0.31529	0.558000	0.71614	TCT		0.701	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2		NM_020859	
SKP2	6502	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	36177323	36177323	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr5:36177323A>T	ENST00000274255.6	+	9	1186	c.990A>T	c.(988-990)gaA>gaT	p.E330D	SKP2_ENST00000274254.5_Missense_Mutation_p.E330D|SKP2_ENST00000508514.1_Missense_Mutation_p.E123D|SKP2_ENST00000546211.1_Missense_Mutation_p.E116D	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	330					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)	p.E330D(2)		breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCTTTCAGGAATTTTTCCAGC	0.343																																																	2	Substitution - Missense(2)	kidney(2)											138.0	128.0	132.0					5																	36177323		2203	4300	6503	SO:0001583	missense	6502			U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.990A>T	5.37:g.36177323A>T	ENSP00000274255:p.Glu330Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	ENST00000274255.6	37	CCDS3916.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.252944	0.22965	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000508514;ENST00000546211	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	4.38	4.38	0.52667	.	0.208179	0.39909	N	0.001229	T	0.37128	0.0992	M	0.73217	2.22	0.30194	N	0.799265	B;P;B	0.34815	0.043;0.47;0.043	B;B;B	0.27887	0.005;0.084;0.012	T	0.32981	-0.9886	10	0.18710	T	0.47	-7.5621	5.0772	0.14638	0.5702:0.147:0.0:0.2829	.	116;330;330	B4DJT4;Q13309-2;Q13309	.;.;SKP2_HUMAN	D	330;330;296;123;116	ENSP00000274254:E330D;ENSP00000274255:E330D;ENSP00000421941:E123D;ENSP00000443492:E116D	ENSP00000274254:E330D	E	+	3	2	SKP2	36213080	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	1.243000	0.32767	1.956000	0.56807	0.455000	0.32223	GAA		0.343	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2		NM_005983	
SLITRK6	84189	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	86370298	86370298	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr13:86370298G>T	ENST00000400286.2	-	2	944	c.346C>A	c.(346-348)Caa>Aaa	p.Q116K		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	116					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.Q116K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		ATATGAAGTTGTTTCAGGAGG	0.358																																																	1	Substitution - Missense(1)	kidney(1)											123.0	114.0	117.0					13																	86370298		1838	4086	5924	SO:0001583	missense	84189			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.346C>A	13.37:g.86370298G>T	ENSP00000383143:p.Gln116Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	G	5.305	0.241696	0.10077	.	.	ENSG00000184564	ENST00000400286	T	0.50813	0.73	6.17	3.38	0.38709	.	0.172871	0.51477	N	0.000095	T	0.28532	0.0706	N	0.12182	0.205	0.35311	D	0.783898	B	0.02656	0.0	B	0.01281	0.0	T	0.22906	-1.0203	10	0.46703	T	0.11	-7.8464	10.4372	0.44443	0.0:0.1238:0.4923:0.3839	.	116	Q9H5Y7	SLIK6_HUMAN	K	116	ENSP00000383143:Q116K	ENSP00000383143:Q116K	Q	-	1	0	SLITRK6	85268299	1.000000	0.71417	0.946000	0.38457	0.838000	0.47535	2.671000	0.46842	0.900000	0.36469	0.655000	0.94253	CAA		0.358	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2		NM_032229	
SMARCB1	6598	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	24143192	24143192	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr22:24143192T>A	ENST00000263121.7	+	4	620	c.424T>A	c.(424-426)Tta>Ata	p.L142I	SMARCB1_ENST00000407082.3_Intron|SMARCB1_ENST00000344921.6_Missense_Mutation_p.L133I|SMARCB1_ENST00000407422.3_Missense_Mutation_p.L133I	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	142	DNA-binding. {ECO:0000255}.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(5)|p.L142I(1)|p.L133I(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CTCCCACCACTTAGATGCCGT	0.557			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	7	Deletion - Frameshift(3)|Substitution - Missense(2)|Unknown(2)	soft_tissue(5)|kidney(2)											201.0	144.0	164.0					22																	24143192		2203	4300	6503	SO:0001583	missense	6598			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.424T>A	22.37:g.24143192T>A	ENSP00000263121:p.Leu142Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	37	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.539337	0.85917	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.02	4.01	0.46588	.	0.000000	0.85682	D	0.000000	D	0.96725	0.8931	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D;D	0.76494	0.998;0.999;0.994;0.999;0.998;0.982	D;D;D;D;D;D	0.87578	0.996;0.998;0.96;0.931;0.931;0.952	D	0.96498	0.9369	10	0.51188	T	0.08	-16.1584	13.233	0.59955	0.0:0.9225:0.0:0.0775	.	133;142;133;133;142;142	B4E117;B4DRT1;G5E975;Q17S11;Q12824;C9JTA6	.;.;.;.;SNF5_HUMAN;.	I	142;133;142;133	ENSP00000388489:L142I;ENSP00000340883:L133I;ENSP00000263121:L142I;ENSP00000383984:L133I	ENSP00000263121:L142I	L	+	1	2	SMARCB1	22473192	0.999000	0.42202	0.986000	0.45419	0.927000	0.56198	4.066000	0.57520	1.283000	0.44513	-0.154000	0.13518	TTA		0.557	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1		NM_003073	
SPTA1	6708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	158582749	158582749	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:158582749T>C	ENST00000368147.4	-	51	7172	c.6992A>G	c.(6991-6993)aAg>aGg	p.K2331R	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2331	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.K2331R(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GACATAGCCCTTCCTGTGGGA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											60.0	57.0	58.0					1																	158582749		1907	4123	6030	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6992A>G	1.37:g.158582749T>C	ENSP00000357129:p.Lys2331Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.761959	0.89932	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.22336	1.96;1.96	5.39	5.39	0.77823	EF-hand-like domain (1);	0.000000	0.33572	N	0.004769	T	0.20536	0.0494	L	0.51422	1.61	0.41325	D	0.987202	P	0.46656	0.882	P	0.49752	0.621	T	0.01071	-1.1461	10	0.87932	D	0	.	14.3835	0.66926	0.0:0.0:0.0:1.0	.	2331	P02549	SPTA1_HUMAN	R	2331;2328	ENSP00000357130:K2331R;ENSP00000357129:K2328R	ENSP00000357129:K2328R	K	-	2	0	SPTA1	156849373	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.156000	0.77453	2.255000	0.74692	0.533000	0.62120	AAG		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	
SRCAP	10847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	30749422	30749422	+	Silent	SNP	A	A	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr16:30749422A>T	ENST00000262518.4	+	34	8446	c.8061A>T	c.(8059-8061)ccA>ccT	p.P2687P	RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Silent_p.P2625P|SRCAP_ENST00000344771.4_Silent_p.P2529P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2687	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.P2687P(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCTCCAGCCCAGAGAAGCCAC	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											85.0	71.0	76.0					16																	30749422		2197	4300	6497	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.8061A>T	16.37:g.30749422A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1		NM_006662	
SRGAP1	57522	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	64377845	64377845	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr12:64377845A>C	ENST00000355086.3	+	2	710	c.186A>C	c.(184-186)gaA>gaC	p.E62D	SRGAP1_ENST00000543397.1_Missense_Mutation_p.E22D|SRGAP1_ENST00000357825.3_Missense_Mutation_p.E62D	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	62	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.E62D(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TTGAGACGGAATATTCCCGGA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											116.0	118.0	117.0					12																	64377845		2203	4300	6503	SO:0001583	missense	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.186A>C	12.37:g.64377845A>C	ENSP00000347198:p.Glu62Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.058809	0.55325	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.23147	1.92;1.92;2.19	5.13	0.894	0.19242	Fps/Fes/Fer/CIP4 homology (3);	0.209168	0.22341	N	0.061340	T	0.11750	0.0286	N	0.20685	0.6	0.58432	D	0.999996	B;B;B	0.26258	0.017;0.145;0.058	B;B;B	0.29785	0.107;0.101;0.065	T	0.15150	-1.0447	9	.	.	.	.	0.6149	0.00767	0.4457:0.1882:0.1818:0.1843	.	62;22;62	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	D	62;62;22	ENSP00000347198:E62D;ENSP00000350480:E62D;ENSP00000437948:E22D	.	E	+	3	2	SRGAP1	62664112	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	1.569000	0.36428	0.324000	0.23333	0.477000	0.44152	GAA		0.393	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1			
STK11IP	114790	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	220465991	220465991	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:220465991C>T	ENST00000456909.1	+	3	186	c.96C>T	c.(94-96)agC>agT	p.S32S	STK11IP_ENST00000295641.10_Silent_p.S43S|STK11IP_ENST00000459692.1_3'UTR			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	43					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.S40S(1)|p.S32S(1)|p.S43S(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCACCCTGAGCCTGCTGACTC	0.552																																																	3	Substitution - coding silent(3)	kidney(3)											62.0	65.0	64.0					2																	220465991		2183	4281	6464	SO:0001819	synonymous_variant	114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.96C>T	2.37:g.220465991C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	37																																																																																					0.552	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1		NM_052902	
SULT1E1	6783	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	70707775	70707775	+	Silent	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr4:70707775T>C	ENST00000226444.3	-	8	934	c.822A>G	c.(820-822)aaA>aaG	p.K274K		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	274					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)	p.K274K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	GTTTATCAAATTTTTCATTCA	0.308																																																	1	Substitution - coding silent(1)	kidney(1)											112.0	114.0	113.0					4																	70707775		2203	4294	6497	SO:0001819	synonymous_variant	6783			BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.822A>G	4.37:g.70707775T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N6X5	Silent	SNP	ENST00000226444.3	37	CCDS3531.1																																																																																				0.308	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251559.1		NM_005420	
SYNM	23336	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	99672128	99672128	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:99672128T>C	ENST00000336292.6	+	5	3680	c.3560T>C	c.(3559-3561)aTc>aCc	p.I1187T	RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000560674.1_Intron|SYNM_ENST00000328642.7_Intron	NM_145728.2	NP_663780.2	O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1188	Interaction with TLN1 and VCL.|Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)	p.I1187T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						AGAGAAGTCATCTTCCTAGGC	0.632																																					Pancreas(125;1071 1762 21750 40003 40381)												1	Substitution - Missense(1)	kidney(1)											25.0	27.0	27.0					15																	99672128		1998	4167	6165	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000336292.6:c.3560T>C	15.37:g.99672128T>C	ENSP00000336775:p.Ile1187Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000336292.6	37		.	.	.	.	.	.	.	.	.	.	T	10.26	1.302190	0.23736	.	.	ENSG00000182253	ENST00000336292	D	0.86694	-2.16	5.27	4.16	0.48862	.	.	.	.	.	T	0.81588	0.4854	.	.	.	0.25855	N	0.9839	B	0.20052	0.041	B	0.17433	0.018	T	0.72991	-0.4123	8	0.87932	D	0	.	8.6703	0.34145	0.0:0.0857:0.0:0.9143	.	1188	O15061	SYNEM_HUMAN	T	1187	ENSP00000336775:I1187T	ENSP00000336775:I1187T	I	+	2	0	SYNM	97489651	0.010000	0.17322	0.130000	0.21974	0.034000	0.12701	1.156000	0.31712	0.856000	0.35383	0.533000	0.62120	ATC		0.632	SYNM-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_145728	
TACC2	10579	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	123846868	123846868	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr10:123846868T>C	ENST00000369005.1	+	4	5193	c.4853T>C	c.(4852-4854)tTt>tCt	p.F1618S	TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Missense_Mutation_p.F1618S|TACC2_ENST00000453444.2_Missense_Mutation_p.F1618S|TACC2_ENST00000515603.1_Missense_Mutation_p.F1618S|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000334433.3_Missense_Mutation_p.F1618S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1618					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.F1618S(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCCGGGGACTTTGCTCACACA	0.582																																																	1	Substitution - Missense(1)	kidney(1)											82.0	81.0	81.0					10																	123846868		2203	4300	6503	SO:0001583	missense	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.4853T>C	10.37:g.123846868T>C	ENSP00000358001:p.Phe1618Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	T	10.50	1.366615	0.24771	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.03212	4.1;4.01;4.04;4.1;4.01	5.55	-5.05	0.02955	.	1.902330	0.02936	N	0.139803	T	0.03011	0.0089	N	0.17082	0.46	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.002	B;B;B	0.08055	0.003;0.002;0.002	T	0.43114	-0.9411	10	0.30854	T	0.27	2.0649	11.4283	0.50025	0.0:0.6357:0.1156:0.2487	.	1618;1618;1618	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	S	1618;1618;1618;1618;1618;1608	ENSP00000358001:F1618S;ENSP00000424467:F1618S;ENSP00000427618:F1618S;ENSP00000334280:F1618S;ENSP00000395048:F1618S	ENSP00000334280:F1618S	F	+	2	0	TACC2	123836858	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	-1.084000	0.03393	-0.832000	0.04251	-0.269000	0.10298	TTT		0.582	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			
TECRL	253017	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	65274994	65274995	+	Missense_Mutation	DNP	GT	GT	CA			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr4:65274994_65274995GT>CA	ENST00000381210.3	-	1	185_186	c.75_76AC>TG	c.(73-78)atACtg>atTGtg	p.L26V	TECRL_ENST00000507440.1_Missense_Mutation_p.L26V	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	26					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.L26V(2)|p.I25I(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TCATCCTTCAGTATGAACCGTG	0.441																																																	3	Substitution - Missense(2)|Substitution - coding silent(1)	kidney(3)																																								SO:0001583	missense	253017			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.75_76delinsCA	4.37:g.65274994_65274995delinsCA	ENSP00000370607:p.Leu26Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation|Silent	SNP	ENST00000381210.3	37	CCDS33990.1																																																																																				0.441	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4		NM_001010874	
TINAG	27283	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	54214608	54214608	+	Missense_Mutation	SNP	C	C	T	rs35758529		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:54214608C>T	ENST00000259782.4	+	7	1090	c.994C>T	c.(994-996)Cgg>Tgg	p.R332W		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	332					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R332W(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GCGAGGAAAACGGCATGCCAC	0.458																																																	1	Substitution - Missense(1)	kidney(1)											155.0	141.0	146.0					6																	54214608		2203	4300	6503	SO:0001583	missense	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.994C>T	6.37:g.54214608C>T	ENSP00000259782:p.Arg332Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844446	0.71488	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	D	0.84223	-1.82	5.87	2.73	0.32206	Peptidase C1A, papain C-terminal (2);	0.166795	0.41712	D	0.000836	D	0.89276	0.6669	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90114	0.4194	10	0.66056	D	0.02	.	12.9501	0.58394	0.4644:0.5356:0.0:0.0	.	332	Q9UJW2	TINAG_HUMAN	W	191;332;11	ENSP00000259782:R332W	ENSP00000259782:R332W	R	+	1	2	TINAG	54322567	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	0.888000	0.28268	0.758000	0.33059	0.591000	0.81541	CGG		0.458	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1		NM_014464	
TIPRL	261726	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	168153162	168153162	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:168153162C>T	ENST00000367833.2	+	2	272	c.127C>T	c.(127-129)Cca>Tca	p.P43S	TIPRL_ENST00000367830.3_Missense_Mutation_p.P43S	NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	43					DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.P43S(1)		breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					ATTACATATGCCATCTCTCCC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											144.0	135.0	138.0					1																	168153162		2203	4300	6503	SO:0001583	missense	261726			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.127C>T	1.37:g.168153162C>T	ENSP00000356807:p.Pro43Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8V3|Q5HYB2|Q8IZ86	Missense_Mutation	SNP	ENST00000367833.2	37	CCDS1270.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692730	0.88735	.	.	ENSG00000143155	ENST00000367833;ENST00000367830	.	.	.	5.7	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	M	0.72894	2.215	0.40501	D	0.980642	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.71307	-0.4632	8	0.32370	T	0.25	-21.2126	16.2076	0.82138	0.0:0.8665:0.1335:0.0	.	43;43	O75663;O75663-2	TIPRL_HUMAN;.	S	43	.	ENSP00000356804:P43S	P	+	1	0	TIPRL	166419786	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.380000	0.79704	1.363000	0.46019	0.655000	0.94253	CCA		0.388	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083822.1		NM_152902	
TM4SF19	116211	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	196051159	196051159	+	Silent	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:196051159G>A	ENST00000273695.3	-	4	557	c.432C>T	c.(430-432)ttC>ttT	p.F144F	TM4SF19-AS1_ENST00000452051.1_RNA|TM4SF19_ENST00000446879.1_Silent_p.F144F|TM4SF19_ENST00000454715.1_Silent_p.F118F|TM4SF19_ENST00000442633.1_Silent_p.F144F|TM4SF19-AS1_ENST00000420226.1_RNA|TM4SF19-AS1_ENST00000444939.1_RNA	NM_001204897.1|NM_138461.3	NP_001191826.1|NP_612470.2	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	144						integral component of membrane (GO:0016021)		p.F144F(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(5)	12	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		GCAGGTCTTTGAATGGGTAAC	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											95.0	88.0	90.0					3																	196051159		2203	4300	6503	SO:0001819	synonymous_variant	116211			BC013113	CCDS3316.1, CCDS56299.1	3q29	2005-08-09			ENSG00000145107	ENSG00000145107			25167	protein-coding gene	gene with protein product						12477932	Standard	NM_138461		Approved		uc021xjs.1	Q96DZ7	OTTHUMG00000155675	ENST00000273695.3:c.432C>T	3.37:g.196051159G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RV20|E9PH22|Q336K7	Silent	SNP	ENST00000273695.3	37	CCDS3316.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.496263	0.44352	.	.	ENSG00000145107	ENST00000440822	.	.	.	5.01	1.67	0.24075	.	.	.	.	.	T	0.54431	0.1858	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45512	-0.9256	4	.	.	.	-25.1849	6.9396	0.24486	0.3633:0.0:0.6367:0.0	.	.	.	.	L	12	.	.	S	-	2	0	TM4SF19	197535556	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.518000	0.35877	0.490000	0.27771	0.563000	0.77884	TCA		0.433	TM4SF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341174.1		NM_138461	
TRAF5	7188	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	211542827	211542827	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:211542827G>A	ENST00000261464.5	+	9	877	c.823G>A	c.(823-825)Gaa>Aaa	p.E275K	TRAF5_ENST00000367004.3_Missense_Mutation_p.E275K|TRAF5_ENST00000336184.2_Missense_Mutation_p.E275K|TRAF5_ENST00000427925.2_Missense_Mutation_p.E169K	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	275					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E275K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		AGAACAGAAAGAAAGTAAAAT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											108.0	111.0	110.0					1																	211542827		2203	4300	6503	SO:0001583	missense	7188			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.823G>A	1.37:g.211542827G>A	ENSP00000261464:p.Glu275Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	ENST00000261464.5	37	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608160	0.46527	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;D;T;T	0.84589	2.09;-1.87;2.09;2.09	4.11	4.11	0.48088	TRAF-like (1);	0.730381	0.13350	N	0.394486	T	0.82079	0.4959	L	0.56769	1.78	0.36152	D	0.847548	P;B;B	0.45531	0.86;0.064;0.108	B;B;B	0.41271	0.352;0.025;0.042	T	0.81315	-0.0988	10	0.08179	T	0.78	-17.8075	16.3463	0.83134	0.0:0.0:1.0:0.0	.	169;286;275	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	K	275;169;275;275	ENSP00000336825:E275K;ENSP00000389891:E169K;ENSP00000261464:E275K;ENSP00000355971:E275K	ENSP00000261464:E275K	E	+	1	0	TRAF5	209609450	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	5.949000	0.70257	1.843000	0.53566	0.467000	0.42956	GAA		0.353	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1		NM_004619	
TRIP12	9320	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	230642131	230642131	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:230642131G>T	ENST00000283943.5	-	36	5382	c.5204C>A	c.(5203-5205)tCa>tAa	p.S1735*	TRIP12_ENST00000389045.3_Nonsense_Mutation_p.S1465*|TRIP12_ENST00000389044.4_Nonsense_Mutation_p.S1783*	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1735					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.S1735*(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CAAATCGTGTGATGTCAGTGA	0.403																																																	1	Substitution - Nonsense(1)	kidney(1)											220.0	206.0	211.0					2																	230642131		2203	4300	6503	SO:0001587	stop_gained	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5204C>A	2.37:g.230642131G>T	ENSP00000283943:p.Ser1735*	Somatic		WXS	Illumina HiSeq	Phase_I	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Nonsense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	G	47	13.549606	0.99749	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044;ENST00000418123	.	.	.	5.92	5.92	0.95590	.	0.060697	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	20.3151	0.98650	0.0:0.0:1.0:0.0	.	.	.	.	X	1735;1465;1783;33	.	ENSP00000283943:S1735X	S	-	2	0	TRIP12	230350375	1.000000	0.71417	0.473000	0.27253	0.990000	0.78478	9.167000	0.94773	2.809000	0.96659	0.467000	0.42956	TCA		0.403	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3		NM_004238	
TSPAN11	441631	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	31136075	31136075	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr12:31136075C>A	ENST00000261177.9	+	7	751	c.692C>A	c.(691-693)gCc>gAc	p.A231D	TSPAN11_ENST00000546076.1_Missense_Mutation_p.A231D|TSPAN11_ENST00000535215.1_Missense_Mutation_p.A160D|TSPAN11_ENST00000544427.1_Missense_Mutation_p.A221D	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	231						integral component of membrane (GO:0016021)		p.A231D(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					ATCGGGGTGGCCTGCCTGCAG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											29.0	29.0	29.0					12																	31136075		2203	4300	6503	SO:0001583	missense	441631				CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.692C>A	12.37:g.31136075C>A	ENSP00000261177:p.Ala231Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A1L158|B2RUX6	Missense_Mutation	SNP	ENST00000261177.9	37	CCDS31765.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119048	0.77323	.	.	ENSG00000110900	ENST00000546076;ENST00000535215;ENST00000544427;ENST00000261177	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	3.17	3.17	0.36434	.	0.000000	0.64402	U	0.000002	D	0.93103	0.7804	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.991;0.996	D	0.94459	0.7674	10	0.87932	D	0	.	12.1342	0.53961	0.0:1.0:0.0:0.0	.	221;231	F5H0F0;A1L157	.;TSN11_HUMAN	D	231;160;221;231	ENSP00000437403:A231D;ENSP00000445503:A160D;ENSP00000439895:A221D;ENSP00000261177:A231D	ENSP00000261177:A231D	A	+	2	0	TSPAN11	31027342	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.104000	0.77024	1.744000	0.51775	0.467000	0.42956	GCC		0.622	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399888.1		XM_497334	
TUBB	203068	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	30688293	30688293	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:30688293A>C	ENST00000327892.8	+	1	316	c.10A>C	c.(10-12)Atc>Ctc	p.I4L	TUBB_ENST00000396389.1_5'Flank|MDC1_ENST00000376406.3_5'Flank|TUBB_ENST00000396384.1_5'Flank|MDC1_ENST00000376405.2_5'Flank|TUBB_ENST00000435534.1_Missense_Mutation_p.I4L|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000330914.3_5'Flank	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	4					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.I4L(1)		breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	CATGAGGGAAATCGTGCACAT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											103.0	90.0	94.0					6																	30688293		2203	4300	6503	SO:0001583	missense	203068			AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.10A>C	6.37:g.30688293A>C	ENSP00000339001:p.Ile4Leu	Somatic		WXS	Illumina HiSeq	Phase_I	P05218|Q8WUC1|Q9CY33	Missense_Mutation	SNP	ENST00000327892.8	37	CCDS4687.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.751500	0.89753	.	.	ENSG00000196230	ENST00000327892;ENST00000422827;ENST00000435534	T;T	0.75704	-0.96;-0.96	4.53	4.53	0.55603	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.85682	D	0.000000	D	0.83681	0.5307	M	0.84948	2.725	0.58432	D	0.999996	P;D	0.57257	0.898;0.979	D;D	0.87578	0.998;0.997	D	0.86646	0.1895	10	0.87932	D	0	.	12.0935	0.53742	1.0:0.0:0.0:0.0	.	4;4	P07437;F8VW92	TBB5_HUMAN;.	L	4	ENSP00000339001:I4L;ENSP00000391672:I4L	ENSP00000339001:I4L	I	+	1	0	TUBB	30796272	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.229000	0.95273	1.818000	0.53035	0.260000	0.18958	ATC		0.413	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076074.2		NM_178014	
TUBGCP3	10426	hgsc.bcm.edu;ucsc.edu	37	13	113176789	113176789	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr13:113176789delA	ENST00000261965.3	-	14	1776	c.1590delT	c.(1588-1590)tttfs	p.F530fs	TUBGCP3_ENST00000462580.1_5'UTR|TUBGCP3_ENST00000375669.3_Frame_Shift_Del_p.F530fs	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	530					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TCTTCCCCTGAAATGCATTTT	0.418																																																	0													107.0	94.0	98.0					13																	113176789		2203	4300	6503	SO:0001589	frameshift_variant	10426			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.1590delT	13.37:g.113176789delA	ENSP00000261965:p.Phe530fs	Somatic		WXS	Illumina HiSeq	Phase_I	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Frame_Shift_Del	DEL	ENST00000261965.3	37	CCDS9525.1																																																																																				0.418	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2		NM_006322	
UGGT1	56886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	128867214	128867214	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:128867214G>A	ENST00000259253.6	+	5	462	c.415G>A	c.(415-417)Gct>Act	p.A139T	UGGT1_ENST00000375990.3_Missense_Mutation_p.A115T	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	139					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)	p.A139T(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ACAGATAGCAGCTGATGAACC	0.363																																																	1	Substitution - Missense(1)	kidney(1)											166.0	154.0	158.0					2																	128867214		2203	4300	6503	SO:0001583	missense	56886			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.415G>A	2.37:g.128867214G>A	ENSP00000259253:p.Ala139Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631626	0.46944	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.08634	3.07;3.07	5.5	5.5	0.81552	.	0.109676	0.64402	D	0.000006	T	0.10465	0.0256	L	0.48877	1.53	0.32518	N	0.536684	B;B	0.12630	0.004;0.006	B;B	0.13407	0.009;0.003	T	0.10823	-1.0613	10	0.15066	T	0.55	.	19.3486	0.94374	0.0:0.0:1.0:0.0	.	115;139	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	T	115;139	ENSP00000365158:A115T;ENSP00000259253:A139T	ENSP00000259253:A139T	A	+	1	0	UGGT1	128583684	1.000000	0.71417	0.991000	0.47740	0.912000	0.54170	2.913000	0.48790	2.736000	0.93811	0.591000	0.81541	GCT		0.363	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2		NM_020120	
UGGT1	56886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	128867224	128867224	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr2:128867224C>A	ENST00000259253.6	+	5	472	c.425C>A	c.(424-426)cCt>cAt	p.P142H	UGGT1_ENST00000375990.3_Missense_Mutation_p.P118H	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	142					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)	p.P142H(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GCTGATGAACCTCCACCAGAA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											174.0	161.0	165.0					2																	128867224		2203	4300	6503	SO:0001583	missense	56886			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.425C>A	2.37:g.128867224C>A	ENSP00000259253:p.Pro142His	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250492	0.59212	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.08720	3.06;3.06	5.5	2.55	0.30701	.	0.164390	0.56097	D	0.000039	T	0.16896	0.0406	M	0.78049	2.395	0.58432	D	0.99999	P;P	0.41265	0.742;0.744	P;B	0.49276	0.605;0.336	T	0.00628	-1.1637	10	0.45353	T	0.12	.	7.3869	0.26888	0.0:0.7023:0.1374:0.1604	.	118;142	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	H	118;142	ENSP00000365158:P118H;ENSP00000259253:P142H	ENSP00000259253:P142H	P	+	2	0	UGGT1	128583694	1.000000	0.71417	0.998000	0.56505	0.809000	0.45718	2.858000	0.48356	0.298000	0.22638	0.591000	0.81541	CCT		0.373	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2		NM_020120	
VGLL2	245806	hgsc.bcm.edu;ucsc.edu	37	6	117589513	117589514	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr6:117589513_117589514insG	ENST00000326274.5	+	2	440_441	c.250_251insG	c.(250-252)cgcfs	p.R84fs	VGLL2_ENST00000352536.3_Frame_Shift_Ins_p.R84fs	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	84					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.R84S(1)		central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		CATCAACTCCCGCTGCGTCCTC	0.559																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001589	frameshift_variant	245806			AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.251dupG	6.37:g.117589514_117589514dupG	ENSP00000320957:p.Arg84fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WWX1	Frame_Shift_Ins	INS	ENST00000326274.5	37	CCDS5115.1																																																																																				0.559	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041975.2		NM_153453	
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10188215	10188215	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:10188215A>G	ENST00000256474.2	+	2	1198	c.358A>G	c.(358-360)Aga>Gga	p.R120G	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	120	Involved in binding to CCT complex.				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.R120G(1)|p.R120fs*38(1)|p.?(1)|p.R120*(1)|p.L118_G123>P(1)|p.W117fs*1(1)|p.F119fs*11(1)|p.D121fs*10(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TTGGCTCTTCAGAGATGCAGG	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	8	Deletion - Frameshift(4)|Substitution - Nonsense(1)|Unknown(1)|Complex - deletion inframe(1)|Substitution - Missense(1)	kidney(8)	GRCh37	CI951985|CM014753	VHL	I|M							181.0	168.0	172.0					3																	10188215		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.358A>G	3.37:g.10188215A>G	ENSP00000256474:p.Arg120Gly	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.761649	0.49468	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	D	0.99830	-7.01	5.07	3.95	0.45737	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97999	1.0359	10	0.54805	T	0.06	-7.4406	9.9526	0.41647	0.5806:0.4194:0.0:0.0	.	120	P40337	VHL_HUMAN	G	120;38	ENSP00000256474:R120G	ENSP00000256474:R120G	R	+	1	2	VHL	10163215	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	1.082000	0.30803	0.927000	0.37143	0.460000	0.39030	AGA		0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS39	23339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42480038	42480038	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:42480038T>A	ENST00000348544.4	-	7	391	c.392A>T	c.(391-393)gAg>gTg	p.E131V	VPS39_ENST00000318006.5_Missense_Mutation_p.E120V			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	131	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)	p.E120V(1)		breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		TAACACCTCCTCACCGGTCTC	0.433																																																	1	Substitution - Missense(1)	kidney(1)											160.0	159.0	159.0					15																	42480038		2203	4299	6502	SO:0001583	missense	23339			AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.392A>T	15.37:g.42480038T>A	ENSP00000335193:p.Glu131Val	Somatic		WXS	Illumina HiSeq	Phase_I	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	37	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.516410	0.85495	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.05447	3.44;3.44	4.95	4.95	0.65309	Citron-like (2);	0.052356	0.85682	D	0.000000	T	0.09468	0.0233	L	0.60845	1.875	0.80722	D	1	B;B	0.25521	0.071;0.128	B;B	0.24006	0.05;0.03	T	0.07462	-1.0771	10	0.37606	T	0.19	-10.8466	14.9395	0.70983	0.0:0.0:0.0:1.0	.	131;120	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	V	120;131	ENSP00000326534:E120V;ENSP00000335193:E131V	ENSP00000326534:E120V	E	-	2	0	VPS39	40267330	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	1.984000	0.57885	0.533000	0.62120	GAG		0.433	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1		NM_015289	
XCR1	2829	broad.mit.edu;hgsc.bcm.edu	37	3	46063001	46063001	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr3:46063001C>T	ENST00000309285.3	-	2	795	c.439G>A	c.(439-441)Gtg>Atg	p.V147M	XCR1_ENST00000542109.1_Missense_Mutation_p.V147M	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	147					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)	p.V147M(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GTCACCAGCACCCGGCAGCGG	0.592																																																	1	Substitution - Missense(1)	kidney(1)											43.0	43.0	43.0					3																	46063001		2203	4300	6503	SO:0001583	missense	2829				CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.439G>A	3.37:g.46063001C>T	ENSP00000310405:p.Val147Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000309285.3	37	CCDS2736.1	.	.	.	.	.	.	.	.	.	.	C	7.359	0.624538	0.14193	.	.	ENSG00000173578	ENST00000309285;ENST00000542109	T;T	0.38887	1.11;1.11	5.57	0.394	0.16299	GPCR, rhodopsin-like superfamily (1);	1.029920	0.07648	N	0.931498	T	0.33673	0.0871	L	0.46885	1.475	0.09310	N	1	P	0.41673	0.759	B	0.39971	0.315	T	0.29181	-1.0020	10	0.72032	D	0.01	.	2.8522	0.05561	0.1089:0.4649:0.1064:0.3198	.	147	P46094	XCR1_HUMAN	M	147	ENSP00000310405:V147M;ENSP00000438119:V147M	ENSP00000310405:V147M	V	-	1	0	XCR1	46038005	0.000000	0.05858	0.117000	0.21633	0.135000	0.20990	-0.502000	0.06390	0.043000	0.15746	0.650000	0.86243	GTG		0.592	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257322.2			
XPOT	11260	broad.mit.edu;hgsc.bcm.edu	37	12	64828368	64828368	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr12:64828368G>T	ENST00000332707.5	+	20	3063	c.2534G>T	c.(2533-2535)tGt>tTt	p.C845F		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	845	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.C845F(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		CAGAAAACATGTTTTATCATC	0.353																																																	1	Substitution - Missense(1)	kidney(1)											109.0	109.0	109.0					12																	64828368		2203	4300	6503	SO:0001583	missense	11260			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.2534G>T	12.37:g.64828368G>T	ENSP00000327821:p.Cys845Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566712	0.86439	.	.	ENSG00000184575	ENST00000332707	T	0.66099	-0.19	5.2	5.2	0.72013	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76256	0.3962	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.74562	-0.3624	9	.	.	.	.	19.1186	0.93353	0.0:0.0:1.0:0.0	.	845	O43592	XPOT_HUMAN	F	845	ENSP00000327821:C845F	.	C	+	2	0	XPOT	63114635	1.000000	0.71417	0.902000	0.35471	0.976000	0.68499	9.542000	0.98086	2.624000	0.88883	0.555000	0.69702	TGT		0.353	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1		NM_007235	
YIF1B	90522	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	38798068	38798068	+	Splice_Site	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:38798068C>A	ENST00000339413.6	-	7	834	c.789G>T	c.(787-789)atG>atT	p.M263I	YIF1B_ENST00000329420.8_Splice_Site_p.M248I|YIF1B_ENST00000587361.1_5'Flank|YIF1B_ENST00000591755.1_Splice_Site_p.M260I|YIF1B_ENST00000592246.1_Splice_Site_p.M197I|YIF1B_ENST00000392124.3_Splice_Site_p.M232I|YIF1B_ENST00000592694.1_Splice_Site_p.M232I|YIF1B_ENST00000337679.8_Splice_Site_p.M260I|YIF1B_ENST00000591784.1_Splice_Site_p.M232I	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	263						integral component of membrane (GO:0016021)		p.M263I(1)|p.M260I(1)|p.M232I(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCCAGCTCACCATGAACACAA	0.622																																																	3	Substitution - Missense(3)	kidney(3)											76.0	66.0	70.0					19																	38798068		2203	4299	6502	SO:0001630	splice_region_variant	90522			AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.789+1G>T	19.37:g.38798068C>A		Somatic		WXS	Illumina HiSeq	Phase_I	H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Missense_Mutation	SNP	ENST00000339413.6	37	CCDS33010.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913926	0.33815	.	.	ENSG00000167645	ENST00000339413;ENST00000329420;ENST00000392124;ENST00000337679	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	5.66	5.66	0.87406	.	0.085246	0.85682	D	0.000000	T	0.70395	0.3219	N	0.17564	0.495	0.58432	D	0.999998	B;B;B;P;B	0.39576	0.372;0.041;0.063;0.679;0.003	B;B;B;B;B	0.40066	0.121;0.032;0.022;0.318;0.01	T	0.69202	-0.5207	9	.	.	.	-18.4322	17.2371	0.87002	0.0:1.0:0.0:0.0	.	232;260;260;263;260	Q5BJH7-2;Q5BJH7-5;Q5BJH7-4;Q5BJH7;Q5BJH7-3	.;.;.;YIF1B_HUMAN;.	I	263;248;232;260	ENSP00000343435:M263I;ENSP00000329559:M248I;ENSP00000375971:M232I;ENSP00000337411:M260I	.	M	-	3	0	YIF1B	43489908	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	3.351000	0.52232	2.662000	0.90505	0.555000	0.69702	ATG		0.622	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460511.1		NM_033557	Missense_Mutation
ZNF404	342908	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44376785	44376785	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:44376785delT	ENST00000587539.1	-	3	1580	c.1581delA	c.(1579-1581)gaafs	p.E527fs	ZNF404_ENST00000324394.6_Frame_Shift_Del_p.E525fs	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				CCTTACCACATTCTTTGCATT	0.388																																																	0													59.0	62.0	61.0					19																	44376785		2127	4264	6391	SO:0001589	frameshift_variant	342908			XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.1581delA	19.37:g.44376785delT	ENSP00000466051:p.Glu527fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4FU30|K7ELF2	Frame_Shift_Del	DEL	ENST00000587539.1	37	CCDS59394.1																																																																																				0.388	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460019.1		NM_001033719	
ZNF764	92595	broad.mit.edu;ucsc.edu	37	16	30569111	30569111	+	Missense_Mutation	SNP	A	A	C	rs369068123		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr16:30569111A>C	ENST00000252797.2	-	2	333	c.253T>G	c.(253-255)Tgg>Ggg	p.W85G	ZNF764_ENST00000395091.2_Missense_Mutation_p.W85G|AC002310.13_ENST00000568114.1_Intron	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	85	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W85G(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						GCCGGACCCCACAGTTCGGCC	0.617																																																	1	Substitution - Missense(1)	kidney(1)						A	GLY/TRP,GLY/TRP	1,4393		0,1,2196	45.0	39.0	41.0		253,253	3.2	0.6	16		41	0,8600		0,0,4300	no	missense,missense	ZNF764	NM_001172679.1,NM_033410.3	184,184	0,1,6496	CC,CA,AA		0.0,0.0228,0.0077	possibly-damaging,possibly-damaging	85/408,85/409	30569111	1,12993	2197	4300	6497	SO:0001583	missense	92595			BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.253T>G	16.37:g.30569111A>C	ENSP00000252797:p.Trp85Gly	Somatic		WXS	Illumina GAIIx	Phase_I	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Missense_Mutation	SNP	ENST00000252797.2	37	CCDS10683.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961268	0.53400	2.28E-4	0.0	ENSG00000169951	ENST00000252797;ENST00000395091	T;T	0.09630	2.98;2.96	4.32	3.17	0.36434	Krueppel-associated box (2);	0.224808	0.23167	N	0.051172	T	0.14141	0.0342	M	0.70842	2.15	0.23879	N	0.996588	P;P	0.41673	0.596;0.759	B;B	0.40410	0.107;0.328	T	0.08289	-1.0729	10	0.51188	T	0.08	-13.1587	9.0654	0.36460	0.8139:0.1861:0.0:0.0	.	85;85	B3KSN2;Q96H86	.;ZN764_HUMAN	G	85	ENSP00000252797:W85G;ENSP00000378526:W85G	ENSP00000252797:W85G	W	-	1	0	ZNF764	30476612	0.000000	0.05858	0.604000	0.28916	0.004000	0.04260	-0.140000	0.10342	0.746000	0.32786	0.459000	0.35465	TGG		0.617	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255541.1		NM_033410	
ZYG11B	79699	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	53237222	53237222	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:53237222G>C	ENST00000294353.6	+	3	872	c.727G>C	c.(727-729)Gat>Cat	p.D243H	ZYG11B_ENST00000545132.1_Missense_Mutation_p.D243H|ZYG11B_ENST00000443756.2_Missense_Mutation_p.D243H	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	243								p.D243H(1)		breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						GAATCATCTTGATATCTCAGA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											89.0	82.0	84.0					1																	53237222		2203	4300	6503	SO:0001583	missense	79699			AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.727G>C	1.37:g.53237222G>C	ENSP00000294353:p.Asp243His	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	37	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318151	0.81469	.	.	ENSG00000162378	ENST00000443756;ENST00000545132;ENST00000294353	T;T;T	0.23147	1.92;1.92;1.92	5.26	5.26	0.73747	.	0.100977	0.64402	D	0.000001	T	0.56171	0.1967	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.60398	-0.7271	10	0.87932	D	0	.	19.1243	0.93376	0.0:0.0:1.0:0.0	.	243;243	B4DK95;Q9C0D3	.;ZY11B_HUMAN	H	243	ENSP00000400522:D243H;ENSP00000441315:D243H;ENSP00000294353:D243H	ENSP00000294353:D243H	D	+	1	0	ZYG11B	53009810	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.501000	0.97979	2.741000	0.93983	0.650000	0.86243	GAT		0.393	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1		NM_024646	
ABCA7	10347	broad.mit.edu	37	19	1056479	1056479	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:1056479C>A	ENST00000263094.6	+	33	4798	c.4567C>A	c.(4567-4569)Cag>Aag	p.Q1523K	ABCA7_ENST00000435683.2_Missense_Mutation_p.Q1385K|ABCA7_ENST00000433129.1_Missense_Mutation_p.Q1523K	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1523					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)	p.Q1523K(1)		NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCAAGGAGCAGCTGTCTGA	0.632																																																	1	Substitution - Missense(1)	kidney(1)											141.0	113.0	122.0					19																	1056479		2203	4300	6503	SO:0001583	missense	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.4567C>A	19.37:g.1056479C>A	ENSP00000263094:p.Gln1523Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.472685	0.63737	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.87029	-2.2;-2.2	3.66	3.66	0.41972	.	.	.	.	.	D	0.92473	0.7610	M	0.87827	2.91	0.43152	D	0.994927	P	0.50819	0.939	P	0.56960	0.81	D	0.94028	0.7298	9	0.72032	D	0.01	.	14.055	0.64761	0.0:1.0:0.0:0.0	.	1523	Q8IZY2	ABCA7_HUMAN	K	1523	ENSP00000263094:Q1523K;ENSP00000414062:Q1523K	ENSP00000263094:Q1523K	Q	+	1	0	ABCA7	1007479	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	5.753000	0.68736	1.889000	0.54706	0.555000	0.69702	CAG		0.632	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1		NM_019112	
ACO1	48	broad.mit.edu	37	9	32427337	32427337	+	Missense_Mutation	SNP	G	G	A	rs189305274	byFrequency	TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr9:32427337G>A	ENST00000309951.6	+	12	1525	c.1387G>A	c.(1387-1389)Gtg>Atg	p.V463M	ACO1_ENST00000541043.1_Missense_Mutation_p.V364M|ACO1_ENST00000379923.1_Missense_Mutation_p.V463M	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	463					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.V463M(2)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TGGCCTGAACGTGATGCCTTA	0.517													G|||	8	0.00159744	0.0	0.0	5008	,	,		20198	0.0079		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)						G	MET/VAL	3,4403	6.2+/-15.9	0,3,2200	174.0	140.0	151.0		1387	6.1	1.0	9		151	0,8600		0,0,4300	yes	missense	ACO1	NM_002197.2	21	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	463/890	32427337	3,13003	2203	4300	6503	SO:0001583	missense	48			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1387G>A	9.37:g.32427337G>A	ENSP00000309477:p.Val463Met	Somatic		WXS	Illumina GAIIx	Phase_I	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	37	CCDS6525.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	23.6	4.435295	0.83885	6.81E-4	0.0	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000541043	T;T;T	0.21191	2.02;2.02;2.02	6.07	6.07	0.98685	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.000000	0.85682	D	0.000000	T	0.42765	0.1217	M	0.92555	3.32	0.80722	D	1	D;P	0.60160	0.987;0.883	P;P	0.53102	0.718;0.679	T	0.58059	-0.7703	10	0.56958	D	0.05	-9.5504	19.4308	0.94765	0.0:0.0:1.0:0.0	.	499;463	Q59FI0;P21399	.;ACOC_HUMAN	M	499;463;463;364	ENSP00000309477:V463M;ENSP00000369255:V463M;ENSP00000438733:V364M	ENSP00000309477:V463M	V	+	1	0	ACO1	32417337	1.000000	0.71417	0.972000	0.41901	0.981000	0.71138	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GTG		0.517	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3		NM_002197	
C1orf159	54991	broad.mit.edu	37	1	1019876	1019876	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr1:1019876delC	ENST00000379339.1	-	10	774	c.564delG	c.(562-564)ctgfs	p.L188fs	C1orf159_ENST00000294576.5_Frame_Shift_Del_p.L152fs|C1orf159_ENST00000448924.1_Frame_Shift_Del_p.L188fs|C1orf159_ENST00000379319.1_Frame_Shift_Del_p.L152fs|C1orf159_ENST00000437760.1_Frame_Shift_Del_p.L172fs|C1orf159_ENST00000421241.2_Frame_Shift_Del_p.L152fs|C1orf159_ENST00000379320.1_Frame_Shift_Del_p.L152fs|C1orf159_ENST00000482816.1_5'UTR			Q96HA4	CA159_HUMAN	chromosome 1 open reading frame 159	188						integral component of membrane (GO:0016021)						all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CGCCAGGCTGCAGGGCCGGAG	0.662																																																	0													29.0	29.0	29.0					1																	1019876		2148	4225	6373	SO:0001589	frameshift_variant	54991			AK128434	CCDS7.2	1p36.33	2008-02-05			ENSG00000131591	ENSG00000131591			26062	protein-coding gene	gene with protein product						12975309	Standard	NM_017891		Approved	FLJ20584	uc001acu.2	Q96HA4	OTTHUMG00000000745	ENST00000379339.1:c.564delG	1.37:g.1019876delC	ENSP00000368644:p.Leu188fs	Somatic		WXS	Illumina GAIIx	Phase_I	B3KQ46|Q5T2W6|Q6UX67|Q6ZR77|Q9NWV0	Frame_Shift_Del	DEL	ENST00000379339.1	37																																																																																					0.662	C1orf159-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000001851.2		NM_017891	
CYP2F1	1572	broad.mit.edu	37	19	41627951	41627951	+	Silent	SNP	C	C	T	rs139489388		TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr19:41627951C>T	ENST00000331105.2	+	6	807	c.735C>T	c.(733-735)atC>atT	p.I245I		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	245					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.I245I(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						GAGACCTCATCGCCCACAGCG	0.602																																																	1	Substitution - coding silent(1)	kidney(1)						C		1,4403		0,1,2201	48.0	47.0	47.0		735	-0.5	0.2	19	dbSNP_134	47	0,8590		0,0,4295	no	coding-synonymous	CYP2F1	NM_000774.3		0,1,6496	TT,TC,CC		0.0,0.0227,0.0077		245/492	41627951	1,12993	2202	4295	6497	SO:0001819	synonymous_variant	1572			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.735C>T	19.37:g.41627951C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Silent	SNP	ENST00000331105.2	37	CCDS12572.1																																																																																				0.602	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2			
TSSC2	650368	broad.mit.edu	37	11	3427759	3427759	+	RNA	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr11:3427759C>T	ENST00000529482.1	+	0	876									tumor suppressing subtransferable candidate 2 pseudogene																		TGTCTGCACACGTCCTGCAGT	0.612																																																	0																																												650368					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3427759C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000529482.1	37																																																																																					0.612	TSSC2-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000392020.1			
MNX1	3110	broad.mit.edu	37	7	156798268	156798268	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr7:156798268delG	ENST00000252971.6	-	3	1452	c.1152delC	c.(1150-1152)tccfs	p.S385fs	MNX1-AS2_ENST00000429228.1_RNA|MNX1_ENST00000469500.1_Intron|MNX1_ENST00000543409.1_Frame_Shift_Del_p.S173fs	NM_005515.3	NP_005506.3	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1	385					anatomical structure morphogenesis (GO:0009653)|diaphragm development (GO:0060539)|dorsal/ventral neural tube patterning (GO:0021904)|endocrine pancreas development (GO:0031018)|humoral immune response (GO:0006959)|motor neuron axon guidance (GO:0008045)|nerve development (GO:0021675)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGTCCTCCGAGGAGCAGTCGG	0.751																																																	0													34.0	12.0	19.0					7																	156798268		1950	3922	5872	SO:0001589	frameshift_variant	3110			AF107457	CCDS34788.1, CCDS55187.1	7q36	2012-03-09	2007-08-09	2007-08-09	ENSG00000130675	ENSG00000130675		"""Homeoboxes / ANTP class : HOXL subclass"""	4979	protein-coding gene	gene with protein product		142994	"""homeo box HB9"", ""homeobox HB9"""	HLXB9		9843207	Standard	NM_001165255		Approved	HB9, HOXHB9, SCRA1	uc003wmz.4	P50219	OTTHUMG00000157181	ENST00000252971.6:c.1152delC	7.37:g.156798268delG	ENSP00000252971:p.Ser385fs	Somatic		WXS	Illumina GAIIx	Phase_I	F5H401|Q9Y648	Frame_Shift_Del	DEL	ENST00000252971.6	37	CCDS34788.1																																																																																				0.751	MNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347796.3			
SPTBN5	51332	broad.mit.edu	37	15	42175214	42175214	+	Silent	SNP	C	C	T			TCGA-CJ-6030-01A-11D-1669-08	TCGA-CJ-6030-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c904299c-09a8-4a4c-9378-2fee0ac4cd33	ac520dbf-14be-4783-a879-412bed97580c	g.chr15:42175214C>T	ENST00000320955.6	-	9	2099	c.1872G>A	c.(1870-1872)ctG>ctA	p.L624L		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	624					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)	p.L624L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CAAGAGCCACCAGGCTCTGTT	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											10.0	11.0	11.0					15																	42175214		1885	4096	5981	SO:0001819	synonymous_variant	51332			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.1872G>A	15.37:g.42175214C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000320955.6	37																																																																																					0.572	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1		NM_016642	
