#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
B3GAT1	27087	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	134252621	134252621	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr11:134252621C>T	ENST00000524765.1	-	4	5445	c.901G>A	c.(901-903)Gca>Aca	p.A301T	B3GAT1_ENST00000392580.1_Missense_Mutation_p.A301T|B3GAT1_ENST00000537389.1_Missense_Mutation_p.A314T|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000312527.4_Missense_Mutation_p.A301T			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	301					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.A301T(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		CAGTTGGCTGCCTTGGGCTCC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											135.0	100.0	112.0					11																	134252621		2201	4297	6498	SO:0001583	missense	27087			AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.901G>A	11.37:g.134252621C>T	ENSP00000433847:p.Ala301Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96FS7	Missense_Mutation	SNP	ENST00000524765.1	37	CCDS8500.1	.	.	.	.	.	.	.	.	.	.	C	36	5.891914	0.97074	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.82495	0.5049	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.85130	0.931;0.997	D	0.84634	0.0691	10	0.66056	D	0.02	-19.4294	18.2408	0.89967	0.0:1.0:0.0:0.0	.	314;301	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	T	301;301;301;314	ENSP00000376359:A301T;ENSP00000307875:A301T;ENSP00000433847:A301T;ENSP00000445983:A314T	ENSP00000307875:A301T	A	-	1	0	B3GAT1	133757831	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.651000	0.83577	2.532000	0.85374	0.491000	0.48974	GCA		0.567	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393639.1		NM_018644	
CACNA2D1	781	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	81635088	81635088	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr7:81635088C>A	ENST00000356253.5	-	17	1763	c.1508G>T	c.(1507-1509)cGt>cTt	p.R503L	CACNA2D1_ENST00000464354.1_5'UTR|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.R503L			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	503	Cache.				calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R503L(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TACTGTAAAACGTGGTGTCAG	0.358																																																	1	Substitution - Missense(1)	kidney(1)											126.0	119.0	121.0					7																	81635088		2203	4299	6502	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1508G>T	7.37:g.81635088C>A	ENSP00000348589:p.Arg503Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.010026|4.010026	0.75046|0.75046	.|.	.|.	ENSG00000153956|ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253|ENST00000443883	T;T|.	0.07216|.	3.22;3.21|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76737|0.76737	0.4029|0.4029	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	B|.	0.16603|.	0.018|.	B|.	0.21546|.	0.035|.	T|T	0.76277|0.76277	-0.3018|-0.3018	10|5	0.62326|.	D|.	0.03|.	-11.1241|-11.1241	18.7374|18.7374	0.91761|0.91761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	503|.	P54289-2|.	.|.	L|F	503|7	ENSP00000349320:R503L;ENSP00000348589:R503L|.	ENSP00000284088:R503L|.	R|V	-|-	2|1	0|0	CACNA2D1|CACNA2D1	81473024|81473024	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	7.461000|7.461000	0.80834|0.80834	2.523000|2.523000	0.85059|0.85059	0.591000|0.591000	0.81541|0.81541	CGT|GTT		0.358	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				
CENPB	1059	hgsc.bcm.edu	37	20	3765529	3765529	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr20:3765529C>A	ENST00000379751.4	-	1	1808	c.1602G>T	c.(1600-1602)gaG>gaT	p.E534D	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	534	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						catcaccatcctcctcatcat	0.532																																																	0													228.0	168.0	188.0					20																	3765529		2203	4300	6503	SO:0001583	missense	1059			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1602G>T	20.37:g.3765529C>A	ENSP00000369075:p.Glu534Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	37	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	C	8.720	0.914144	0.17907	.	.	ENSG00000125817	ENST00000379751;ENST00000536335	T	0.20881	2.04	4.83	-5.16	0.02857	Centromere protein Cenp-B, dimerisation domain (1);	.	.	.	.	T	0.06234	0.0161	N	0.08118	0	0.24123	N	0.995794	B	0.02656	0.0	B	0.06405	0.002	T	0.39542	-0.9609	9	0.13108	T	0.6	.	0.1878	0.00130	0.3542:0.214:0.1737:0.2582	.	534	P07199	CENPB_HUMAN	D	534;73	ENSP00000369075:E534D	ENSP00000369075:E534D	E	-	3	2	CENPB	3713529	0.418000	0.25440	0.971000	0.41717	0.630000	0.37929	-0.627000	0.05521	-0.450000	0.07107	-0.182000	0.12963	GAG		0.532	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2		NM_001810	
CENPB	1059	hgsc.bcm.edu	37	20	3765532	3765532	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr20:3765532C>A	ENST00000379751.4	-	1	1805	c.1599G>T	c.(1597-1599)gaG>gaT	p.E533D	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	533	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						caccatcctcctcatcatcat	0.532																																																	0													228.0	168.0	189.0					20																	3765532		2203	4300	6503	SO:0001583	missense	1059			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1599G>T	20.37:g.3765532C>A	ENSP00000369075:p.Glu533Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	37	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	C	0.154	-1.088582	0.01873	.	.	ENSG00000125817	ENST00000379751;ENST00000536335	T	0.16597	2.33	4.83	-6.93	0.01638	Centromere protein Cenp-B, dimerisation domain (1);	.	.	.	.	T	0.05044	0.0135	N	0.03608	-0.345	0.20873	N	0.999839	B	0.02656	0.0	B	0.04013	0.001	T	0.46884	-0.9159	9	0.07813	T	0.8	.	8.9314	0.35672	0.3817:0.1524:0.4659:0.0	.	533	P07199	CENPB_HUMAN	D	533;72	ENSP00000369075:E533D	ENSP00000369075:E533D	E	-	3	2	CENPB	3713532	0.001000	0.12720	0.942000	0.38095	0.429000	0.31625	-2.904000	0.00702	-0.639000	0.05502	-0.176000	0.13171	GAG		0.532	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2		NM_001810	
CROCC	9696	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	17256695	17256695	+	Missense_Mutation	SNP	G	G	A	rs140045815	byFrequency	TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr1:17256695G>A	ENST00000375541.5	+	5	683	c.614G>A	c.(613-615)cGg>cAg	p.R205Q	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.R205Q(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAGCAGCAGCGGCTGAGGGTG	0.632													g|||	3	0.000599042	0.0	0.0	5008	,	,		25407	0.0		0.002	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)						G	GLN/ARG	2,4386		0,2,2192	13.0	12.0	12.0		614	0.5	1.0	1	dbSNP_134	12	16,8556		0,16,4270	no	missense	CROCC	NM_014675.3	43	0,18,6462	AA,AG,GG		0.1867,0.0456,0.1389	benign	205/2018	17256695	18,12942	2194	4286	6480	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.614G>A	1.37:g.17256695G>A	ENSP00000364691:p.Arg205Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119849	0.37436	4.56E-4	0.001867	ENSG00000058453	ENST00000375541	T	0.13657	2.57	5.0	0.491	0.16867	.	.	.	.	.	T	0.13543	0.0328	L	0.56769	1.78	0.24499	N	0.994264	B	0.21905	0.062	B	0.12837	0.008	T	0.27123	-1.0083	9	0.27082	T	0.32	.	10.0575	0.42255	0.3363:0.0:0.6637:0.0	.	205	Q5TZA2	CROCC_HUMAN	Q	205	ENSP00000364691:R205Q	ENSP00000364691:R205Q	R	+	2	0	CROCC	17129282	0.995000	0.38212	0.992000	0.48379	0.619000	0.37552	1.109000	0.31135	0.165000	0.19558	0.650000	0.86243	CGG		0.632	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2		NM_014675	
DIO2	1734	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	80669184	80669184	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr14:80669184C>A	ENST00000557010.1	-	4	1055	c.670G>T	c.(670-672)Ggg>Tgg	p.G224W	DIO2_ENST00000438257.4_Missense_Mutation_p.G224W|DIO2_ENST00000557125.1_3'UTR|DIO2_ENST00000422005.3_3'UTR|DIO2_ENST00000555750.1_Missense_Mutation_p.G260W	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	224					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)	p.G224W(1)|p.G260W(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		AAGGCTACCCCGTAAGCTATG	0.542																																																	2	Substitution - Missense(2)	kidney(2)											95.0	94.0	94.0					14																	80669184		2017	4180	6197	SO:0001583	missense	1734			AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.670G>T	14.37:g.80669184C>A	ENSP00000451419:p.Gly224Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	ENST00000557010.1	37	CCDS45146.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796995	0.90453	.	.	ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000555750	T;T;T	0.38887	1.11;1.11;1.11	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000002	T	0.73241	0.3562	M	0.90309	3.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78229	-0.2285	10	0.87932	D	0	.	19.9785	0.97317	0.0:1.0:0.0:0.0	.	260;224;260	Q92813-2;Q92813;G3V315	.;IOD2_HUMAN;.	W	224;224;260	ENSP00000405854:G224W;ENSP00000451419:G224W;ENSP00000450980:G260W	ENSP00000405854:G224W	G	-	1	0	DIO2	79738937	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	6.059000	0.71133	2.724000	0.93272	0.650000	0.86243	GGG		0.542	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000413428.2			
DST	667	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	56357868	56357868	+	Missense_Mutation	SNP	A	A	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr6:56357868A>T	ENST00000361203.3	-	79	19461	c.19454T>A	c.(19453-19455)cTc>cAc	p.L6485H	DST_ENST00000340834.4_5'Flank|DST_ENST00000244364.6_Missense_Mutation_p.L4182H|DST_ENST00000370754.5_Missense_Mutation_p.L6774H|DST_ENST00000370788.2_Missense_Mutation_p.L4399H|DST_ENST00000421834.2_Missense_Mutation_p.L4508H|DST_ENST00000446842.2_Missense_Mutation_p.L6270H|DST_ENST00000370769.4_Missense_Mutation_p.L6596H|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	6485					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.L6596H(1)|p.L4182H(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGCCAAGTTGAGAGCCTCTTC	0.423																																																	2	Substitution - Missense(2)	kidney(2)											104.0	99.0	100.0					6																	56357868		1881	4132	6013	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19454T>A	6.37:g.56357868A>T	ENSP00000354508:p.Leu6485His	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	A	19.01	3.744015	0.69418	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.53	5.53	0.82687	.	0.000000	0.44483	D	0.000451	T	0.60261	0.2255	M	0.81341	2.54	0.33936	D	0.642654	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.972;0.993	T	0.66060	-0.6017	9	0.56958	D	0.05	.	15.9613	0.79933	1.0:0.0:0.0:0.0	.	4508;6596;6774;6594;4182	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	H	4182;6774;6596;4508;6270;4399;6485	ENSP00000244364:L4182H;ENSP00000359790:L6774H;ENSP00000359805:L6596H;ENSP00000400883:L4508H;ENSP00000393645:L6270H;ENSP00000359824:L4399H;ENSP00000354508:L6485H	ENSP00000244364:L4182H	L	-	2	0	DST	56465827	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.195000	0.94971	2.240000	0.73641	0.477000	0.44152	CTC		0.423	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3		NM_001723	
FLRT2	23768	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	86088605	86088605	+	Silent	SNP	C	C	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr14:86088605C>T	ENST00000330753.4	+	2	1514	c.747C>T	c.(745-747)ctC>ctT	p.L249L	FLRT2_ENST00000554746.1_Silent_p.L249L	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	249					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.L249L(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CTCCCGATCTCCCAGGTACGC	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											87.0	86.0	86.0					14																	86088605		2203	4300	6503	SO:0001819	synonymous_variant	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.747C>T	14.37:g.86088605C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1																																																																																				0.502	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1			
FRMD7	90167	hgsc.bcm.edu	37	X	131261862	131261862	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chrX:131261862delA	ENST00000298542.4	-	1	186	c.11delT	c.(10-12)ttafs	p.L4fs	FRMD7_ENST00000464296.1_Frame_Shift_Del_p.L4fs	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	4	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					CTGCACTTTTAAATGTAGCAT	0.428																																																	0													93.0	86.0	88.0					X																	131261862		2203	4300	6503	SO:0001589	frameshift_variant	90167			AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.11delT	X.37:g.131261862delA	ENSP00000298542:p.Leu4fs	Somatic		WXS	Illumina HiSeq	Phase_I	C0LLJ3|Q5JX99	Frame_Shift_Del	DEL	ENST00000298542.4	37	CCDS35397.1																																																																																				0.428	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1		NM_194277	
GPN3	51184	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	110897606	110897606	+	Silent	SNP	G	G	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr12:110897606G>T	ENST00000228827.3	-	3	281	c.219C>A	c.(217-219)ccC>ccA	p.P73P	GPN3_ENST00000543199.1_Silent_p.P112P|GPN3_ENST00000552180.1_5'Flank|GPN3_ENST00000537466.2_Silent_p.P83P	NM_016301.3	NP_057385.3			GPN-loop GTPase 3									p.P112P(1)|p.P73P(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						ATCCTCCGTTGGGACCGAATC	0.453																																																	2	Substitution - coding silent(2)	kidney(2)											163.0	148.0	153.0					12																	110897606		2203	4300	6503	SO:0001819	synonymous_variant	51184			BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.219C>A	12.37:g.110897606G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000228827.3	37	CCDS9147.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452313	0.26074	.	.	ENSG00000111231	ENST00000550228	T	0.27256	1.68	5.98	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.18272	-1.0342	7	0.87932	D	0	-26.3324	8.0265	0.30440	0.1336:0.0:0.7387:0.1277	.	.	.	.	Q	21	ENSP00000448335:P21Q	ENSP00000448335:P21Q	P	-	2	0	GPN3	109381989	0.998000	0.40836	1.000000	0.80357	0.959000	0.62525	0.552000	0.23376	1.556000	0.49512	0.591000	0.81541	CCA		0.453	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1		NM_016301	
GPR97	222487	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	57713136	57713136	+	Silent	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr16:57713136C>A	ENST00000333493.4	+	5	701	c.540C>A	c.(538-540)cgC>cgA	p.R180R	GPR97_ENST00000450388.3_Silent_p.R60R|RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000327655.6_De_novo_Start_InFrame	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	180					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R180R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGAACAATCGCCTGGTGGGTT	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											130.0	119.0	122.0					16																	57713136		2198	4300	6498	SO:0001819	synonymous_variant	222487			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.540C>A	16.37:g.57713136C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	ENST00000333493.4	37	CCDS10786.1																																																																																				0.642	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2		NM_170776	
HSPA4	3308	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	132424155	132424155	+	Missense_Mutation	SNP	G	G	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr5:132424155G>T	ENST00000304858.2	+	9	1334	c.1045G>T	c.(1045-1047)Gcg>Tcg	p.A349S	HSPA4_ENST00000504328.1_3'UTR	NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	349					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.A349S(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACGAATCCCTGCGGTAAAAGA	0.348																																					Colon(114;1299 1588 6063 12302 48757)												1	Substitution - Missense(1)	kidney(1)											110.0	99.0	103.0					5																	132424155		2203	4300	6503	SO:0001583	missense	3308			AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.1045G>T	5.37:g.132424155G>T	ENSP00000302961:p.Ala349Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	ENST00000304858.2	37	CCDS4166.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.350996	0.61183	.	.	ENSG00000170606	ENST00000304858;ENST00000537974	T	0.01068	5.38	6.02	5.15	0.70609	Heat shock protein 70, conserved site (1);	0.045848	0.85682	D	0.000000	T	0.02012	0.0063	L	0.55990	1.75	0.80722	D	1	B	0.22746	0.074	B	0.20955	0.032	T	0.56080	-0.8038	10	0.39692	T	0.17	-16.5811	15.1588	0.72764	0.0672:0.0:0.9328:0.0	.	349	P34932	HSP74_HUMAN	S	349	ENSP00000302961:A349S	ENSP00000302961:A349S	A	+	1	0	HSPA4	132452054	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.585000	0.82584	1.554000	0.49487	0.650000	0.86243	GCG		0.348	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1		NM_002154, NM_198431	
IMPA2	3613	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	11999101	11999101	+	Missense_Mutation	SNP	T	T	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr18:11999101T>G	ENST00000269159.3	+	2	387	c.145T>G	c.(145-147)Tca>Gca	p.S49A	IMPA2_ENST00000588927.1_De_novo_Start_OutOfFrame|IMPA2_ENST00000588752.1_3'UTR|IMPA2_ENST00000589238.1_De_novo_Start_OutOfFrame	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	49					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.S49A(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	AACAAAAACATCAGCTGCAGA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											140.0	139.0	139.0					18																	11999101		2203	4300	6503	SO:0001583	missense	3613			AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.145T>G	18.37:g.11999101T>G	ENSP00000269159:p.Ser49Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ29|Q9UJT3	Missense_Mutation	SNP	ENST00000269159.3	37	CCDS11855.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.339912	0.41398	.	.	ENSG00000141401	ENST00000269159;ENST00000383376	T;T	0.45668	0.89;0.89	5.38	5.38	0.77491	.	0.088789	0.47852	D	0.000209	T	0.36468	0.0968	L	0.43598	1.365	0.80722	D	1	B	0.02656	0.0	B	0.13407	0.009	T	0.12426	-1.0548	10	0.22706	T	0.39	-11.9321	15.072	0.72046	0.0:0.0:0.0:1.0	.	49	O14732	IMPA2_HUMAN	A	49	ENSP00000269159:S49A;ENSP00000372867:S49A	ENSP00000269159:S49A	S	+	1	0	IMPA2	11989101	1.000000	0.71417	0.998000	0.56505	0.529000	0.34654	3.599000	0.54045	2.046000	0.60703	0.533000	0.62120	TCA		0.418	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254601.1			
KIAA0020	9933	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	2823805	2823805	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr9:2823805C>G	ENST00000397885.2	-	12	1370	c.1164G>C	c.(1162-1164)aaG>aaC	p.K388N		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	388	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.K388N(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CAACATAAGTCTTCATTGTTT	0.259																																																	1	Substitution - Missense(1)	kidney(1)											42.0	38.0	39.0					9																	2823805		2178	4247	6425	SO:0001583	missense	9933			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1164G>C	9.37:g.2823805C>G	ENSP00000380982:p.Lys388Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	37	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309206	0.60414	.	.	ENSG00000080608	ENST00000397885	T	0.20738	2.05	5.68	3.38	0.38709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51584	0.1683	M	0.92169	3.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.55860	-0.8074	10	0.87932	D	0	-23.0798	8.7756	0.34760	0.0:0.7034:0.0:0.2966	.	248;388	B2RDG4;Q15397	.;K0020_HUMAN	N	388	ENSP00000380982:K388N	ENSP00000380982:K388N	K	-	3	2	KIAA0020	2813805	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	2.290000	0.43531	0.589000	0.29677	0.650000	0.86243	AAG		0.259	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3		NM_014878	
AREL1	9870	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	75136696	75136696	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr14:75136696G>A	ENST00000356357.4	-	14	2257	c.1742C>T	c.(1741-1743)aCc>aTc	p.T581I	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	581	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.T581I(1)									GAAAGAGCGGGTGAAGCGAGC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											84.0	83.0	83.0					14																	75136696		1935	4127	6062	SO:0001583	missense	9870			AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1742C>T	14.37:g.75136696G>A	ENSP00000348714:p.Thr581Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	G	33	5.244633	0.95272	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.58506	0.33;0.33	5.84	5.84	0.93424	HECT (4);	0.000000	0.85682	D	0.000000	T	0.70029	0.3177	L	0.47190	1.495	0.80722	D	1	D	0.69078	0.997	D	0.71870	0.975	T	0.61501	-0.7050	10	0.19590	T	0.45	.	20.139	0.98050	0.0:0.0:1.0:0.0	.	581	O15033	K0317_HUMAN	I	581;420;420	ENSP00000348714:T581I;ENSP00000452101:T420I	ENSP00000348714:T581I	T	-	2	0	KIAA0317	74206449	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.764000	0.94973	0.655000	0.94253	ACC		0.522	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2		NM_014821	
KRT3	3850	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53188042	53188042	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr12:53188042G>A	ENST00000417996.2	-	2	793	c.719C>T	c.(718-720)tCc>tTc	p.S240F	KRT3_ENST00000309505.3_Missense_Mutation_p.S240F	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	240	Linker 1.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.S240F(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GCCTGAGATGGAACTTGTGCC	0.542																																																	1	Substitution - Missense(1)	kidney(1)											138.0	156.0	150.0					12																	53188042		2192	4299	6491	SO:0001583	missense	3850				CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.719C>T	12.37:g.53188042G>A	ENSP00000413479:p.Ser240Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	37	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933827	0.34096	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.79940	-1.32;-1.32	4.66	3.77	0.43336	Filament (1);	0.000000	0.46442	D	0.000299	T	0.76190	0.3953	N	0.14661	0.345	0.09310	N	1	D	0.59767	0.986	P	0.61874	0.895	T	0.66077	-0.6013	10	0.87932	D	0	.	6.7958	0.23725	0.0955:0.1779:0.7266:0.0	.	240	P12035	K2C3_HUMAN	F	240	ENSP00000413479:S240F;ENSP00000312206:S240F	ENSP00000312206:S240F	S	-	2	0	KRT3	51474309	0.998000	0.40836	0.081000	0.20488	0.269000	0.26545	3.574000	0.53863	1.333000	0.45449	0.655000	0.94253	TCC		0.542	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1		NM_057088	
LRRC14B	389257	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	194972	194972	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr5:194972C>G	ENST00000328278.3	+	2	1077	c.1049C>G	c.(1048-1050)aCc>aGc	p.T350S	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	350								p.T362S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						TACCCCTCGACCTTCTTCAGG	0.617																																																	1	Substitution - Missense(1)	kidney(1)											29.0	33.0	31.0					5																	194972		2115	4231	6346	SO:0001583	missense	389257				CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1049C>G	5.37:g.194972C>G	ENSP00000327675:p.Thr350Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000328278.3	37	CCDS47184.1	.	.	.	.	.	.	.	.	.	.	C	0.553	-0.848646	0.02651	.	.	ENSG00000185028	ENST00000328278	T	0.10382	2.88	5.65	3.81	0.43845	.	0.392242	0.29924	N	0.010858	T	0.09069	0.0224	L	0.35288	1.05	0.31018	N	0.718515	B	0.23806	0.091	B	0.17433	0.018	T	0.09015	-1.0694	10	0.19590	T	0.45	.	14.1283	0.65235	0.0:0.7133:0.2867:0.0	.	350	A6NHZ5	LR14B_HUMAN	S	350	ENSP00000327675:T350S	ENSP00000327675:T350S	T	+	2	0	LRRC14B	247972	0.476000	0.25901	0.714000	0.30535	0.088000	0.18126	1.879000	0.39618	0.696000	0.31696	0.561000	0.74099	ACC		0.617	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2		NM_001080478	
LTBR	4055	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6493822	6493822	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr12:6493822C>G	ENST00000228918.4	+	2	491	c.165C>G	c.(163-165)caC>caG	p.H55Q	LTBR_ENST00000541102.1_5'Flank|LTBR_ENST00000543190.1_5'UTR|LTBR_ENST00000546296.1_3'UTR|LTBR_ENST00000539925.1_Missense_Mutation_p.H36Q	NM_002342.2	NP_002333.1	P36941	TNR3_HUMAN	lymphotoxin beta receptor (TNFR superfamily, member 3)	55					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)	p.H55Q(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15						AGCCCCAGCACCGCATCTGCT	0.627																																																	1	Substitution - Missense(1)	kidney(1)											57.0	61.0	60.0					12																	6493822		2203	4300	6503	SO:0001583	missense	4055			L04270	CCDS8544.1, CCDS59233.1	12p13	2013-05-22				ENSG00000111321		"""Tumor necrosis factor receptor superfamily"""	6718	protein-coding gene	gene with protein product		600979		D12S370		8171323, 8486360	Standard	NM_002342		Approved	TNFCR, TNFR-RP, TNFR2-RP, TNF-R-III, TNFRSF3	uc001qny.2	P36941		ENST00000228918.4:c.165C>G	12.37:g.6493822C>G	ENSP00000228918:p.His55Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1D2|D3DUR2|F5GXE7	Missense_Mutation	SNP	ENST00000228918.4	37	CCDS8544.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418813	0.83559	.	.	ENSG00000111321	ENST00000539925;ENST00000228918;ENST00000536876	D;D;T	0.92099	-2.97;-2.97;-0.4	5.06	-3.86	0.04230	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.263091	0.31092	N	0.008261	D	0.88753	0.6522	L	0.53249	1.67	0.09310	N	0.999995	P;P;P	0.48998	0.899;0.918;0.918	P;P;P	0.52386	0.571;0.697;0.697	T	0.82452	-0.0450	10	0.14252	T	0.57	-5.9335	6.9191	0.24378	0.0:0.5735:0.1579:0.2686	.	36;36;55	F5GXE7;B7Z1D2;P36941	.;.;TNR3_HUMAN	Q	36;55;55	ENSP00000440875:H36Q;ENSP00000228918:H55Q;ENSP00000437647:H55Q	ENSP00000228918:H55Q	H	+	3	2	LTBR	6364083	0.000000	0.05858	0.000000	0.03702	0.872000	0.50106	-0.897000	0.04110	-0.568000	0.06038	0.491000	0.48974	CAC		0.627	LTBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399422.1			
MLLT1	4298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6218035	6218035	+	Silent	SNP	C	C	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr19:6218035C>T	ENST00000252674.7	-	7	1291	c.1128G>A	c.(1126-1128)ccG>ccA	p.P376P	MLLT1_ENST00000585588.1_5'Flank	NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	376	Poly-Ser.				negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)	p.P376P(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						TGGAGTTGGACGGGCTTGACT	0.612			T	MLL	AL						OREG0025196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	1	Substitution - coding silent(1)	kidney(1)											161.0	127.0	138.0					19																	6218035		2197	4295	6492	SO:0001819	synonymous_variant	4298				CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.1128G>A	19.37:g.6218035C>T		Somatic	632	WXS	Illumina HiSeq	Phase_I	Q14768	Silent	SNP	ENST00000252674.7	37	CCDS12160.1																																																																																				0.612	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1		NM_005934	
MMRN1	22915	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	90874205	90874205	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr4:90874205C>T	ENST00000394980.1	+	9	3642	c.3323C>T	c.(3322-3324)aCg>aTg	p.T1108M	MMRN1_ENST00000394981.1_Missense_Mutation_p.T411M|MMRN1_ENST00000508372.1_Missense_Mutation_p.T850M|MMRN1_ENST00000264790.2_Missense_Mutation_p.T1108M			Q13201	MMRN1_HUMAN	multimerin 1	1108	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.T1108M(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GCATCTCATACGTATGGAATG	0.348																																																	1	Substitution - Missense(1)	kidney(1)											110.0	114.0	112.0					4																	90874205		2203	4300	6503	SO:0001583	missense	22915			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.3323C>T	4.37:g.90874205C>T	ENSP00000378431:p.Thr1108Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.991200	0.54041	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981;ENST00000508372	D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22	4.73	3.86	0.44501	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.104770	0.42548	D	0.000684	D	0.92176	0.7519	M	0.72118	2.19	0.27368	N	0.955765	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	D	0.86547	0.1832	10	0.87932	D	0	.	13.1994	0.59758	0.1598:0.8402:0.0:0.0	.	411;1108	Q13201-2;Q13201	.;MMRN1_HUMAN	M	1108;1108;411;850	ENSP00000378431:T1108M;ENSP00000264790:T1108M;ENSP00000378432:T411M;ENSP00000426461:T850M	ENSP00000264790:T1108M	T	+	2	0	MMRN1	91093228	0.970000	0.33590	0.127000	0.21898	0.916000	0.54674	2.504000	0.45416	1.266000	0.44231	0.484000	0.47621	ACG		0.348	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2		NM_007351	
NFATC3	4775	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	68156583	68156583	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr16:68156583G>C	ENST00000346183.3	+	2	821	c.797G>C	c.(796-798)aGg>aCg	p.R266T	NFATC3_ENST00000329524.4_Missense_Mutation_p.R266T|NFATC3_ENST00000349223.5_Missense_Mutation_p.R266T|RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Missense_Mutation_p.R266T	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	266	3 X SP repeats.				cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R266T(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CCCTCATCAAGGCCCACATCC	0.557																																																	2	Substitution - Missense(2)	kidney(2)											88.0	85.0	86.0					16																	68156583		2198	4300	6498	SO:0001583	missense	4775			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.797G>C	16.37:g.68156583G>C	ENSP00000300659:p.Arg266Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	37	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980933	0.74474	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524	T;T;T	0.15718	2.4;2.4;2.41	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.47967	0.1474	M	0.83118	2.625	0.80722	D	1	D;D;D;D	0.89917	0.994;1.0;0.994;0.994	D;D;D;D	0.87578	0.983;0.998;0.983;0.983	T	0.48843	-0.8999	9	.	.	.	-7.2955	19.2666	0.93988	0.0:0.0:1.0:0.0	.	266;266;266;266	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	T	266	ENSP00000264008:R266T;ENSP00000300659:R266T;ENSP00000331324:R266T	.	R	+	2	0	NFATC3	66714084	1.000000	0.71417	0.994000	0.49952	0.899000	0.52679	9.416000	0.97383	2.612000	0.88384	0.563000	0.77884	AGG		0.557	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2		NM_004555	
NKTR	4820	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	42679500	42679500	+	Silent	SNP	T	T	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr3:42679500T>G	ENST00000232978.8	+	13	2492	c.2304T>G	c.(2302-2304)gtT>gtG	p.V768V	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	768	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.V768V(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AAAATAGCGTTTCACATAAAA	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											88.0	89.0	89.0					3																	42679500		2203	4300	6503	SO:0001819	synonymous_variant	4820				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2304T>G	3.37:g.42679500T>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000232978.8	37	CCDS2702.1																																																																																				0.393	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2		NM_005385	
NLRP1	22861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	5463037	5463038	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr17:5463037_5463038insC	ENST00000572272.1	-	4	977_978	c.978_979insG	c.(976-981)gaacctfs	p.P327fs	NLRP1_ENST00000345221.3_Frame_Shift_Ins_p.P327fs|NLRP1_ENST00000354411.3_Frame_Shift_Ins_p.P327fs|NLRP1_ENST00000262467.5_Frame_Shift_Ins_p.P327fs|NLRP1_ENST00000269280.4_Frame_Shift_Ins_p.P327fs|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Frame_Shift_Ins_p.P327fs			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	327					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				ACTATGCGAGGTTCTTGGGTAT	0.545																																																	0																																										SO:0001589	frameshift_variant	22861			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.978_979insG	17.37:g.5463037_5463038insC	ENSP00000460475:p.Pro327fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Frame_Shift_Ins	INS	ENST00000572272.1	37	CCDS42246.1																																																																																				0.545	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1		NM_033004	
NLRP1	22861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	5463038	5463039	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr17:5463038_5463039insC	ENST00000572272.1	-	4	976_977	c.977_978insG	c.(976-978)gaafs	p.E326fs	NLRP1_ENST00000345221.3_Frame_Shift_Ins_p.E326fs|NLRP1_ENST00000354411.3_Frame_Shift_Ins_p.E326fs|NLRP1_ENST00000262467.5_Frame_Shift_Ins_p.E326fs|NLRP1_ENST00000269280.4_Frame_Shift_Ins_p.E326fs|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Frame_Shift_Ins_p.E326fs			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	326					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CTATGCGAGGTTCTTGGGTATC	0.545																																																	0																																										SO:0001589	frameshift_variant	22861			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.977_978insG	17.37:g.5463038_5463039insC	ENSP00000460475:p.Glu326fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Frame_Shift_Ins	INS	ENST00000572272.1	37	CCDS42246.1																																																																																				0.545	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1		NM_033004	
NOS1	4842	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	117723925	117723925	+	Missense_Mutation	SNP	T	T	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr12:117723925T>A	ENST00000338101.4	-	5	1278	c.1274A>T	c.(1273-1275)cAg>cTg	p.Q425L	NOS1_ENST00000317775.6_Missense_Mutation_p.Q425L|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.Q425L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CTTGGACCACTGGATCCTGCC	0.542																																					Esophageal Squamous(162;1748 2599 51982 52956)												1	Substitution - Missense(1)	kidney(1)											125.0	124.0	124.0					12																	117723925		2169	4296	6465	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1274A>T	12.37:g.117723925T>A	ENSP00000337459:p.Gln425Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.965643	0.74131	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.30182	1.54;1.54	4.93	4.93	0.64822	Nitric oxide synthase, oxygenase domain (4);	0.000000	0.85682	D	0.000000	T	0.58104	0.2099	M	0.92833	3.35	0.80722	D	1	D	0.57571	0.98	P	0.55112	0.769	T	0.70880	-0.4752	10	0.72032	D	0.01	-17.0569	14.7436	0.69474	0.0:0.0:0.0:1.0	.	425	P29475	NOS1_HUMAN	L	425	ENSP00000320758:Q425L;ENSP00000337459:Q425L	ENSP00000320758:Q425L	Q	-	2	0	NOS1	116208308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.070000	0.61991	0.482000	0.46254	CAG		0.542	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			
PRSS48	345062	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	152212274	152212274	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr4:152212274A>G	ENST00000455694.2	+	5	658	c.656A>G	c.(655-657)gAt>gGt	p.D219G	SH3D19_ENST00000604030.1_Intron|PRSS48_ENST00000441586.2_Missense_Mutation_p.D76G	NM_183375.2	NP_899231.2	Q7RTY5	PRS48_HUMAN	protease, serine, 48	219	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.D228G(1)|p.D219G(1)		kidney(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8						CCTTAGGGTGATTCTGGAGGG	0.433																																																	2	Substitution - Missense(2)	kidney(2)											101.0	91.0	94.0					4																	152212274		1880	4115	5995	SO:0001583	missense	345062			BN000134	CCDS47145.1	4q31.3	2010-05-07			ENSG00000189099	ENSG00000189099		"""Serine peptidases / Serine peptidases"""	24635	protein-coding gene	gene with protein product						12838346	Standard	NM_183375		Approved	ESSPL	uc011cif.2	Q7RTY5	OTTHUMG00000161673	ENST00000455694.2:c.656A>G	4.37:g.152212274A>G	ENSP00000401328:p.Asp219Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q08E82|Q0VAD4	Missense_Mutation	SNP	ENST00000455694.2	37	CCDS47145.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.98|16.98	3.272045|3.272045	0.59649|0.59649	.|.	.|.	ENSG00000189099|ENSG00000189099	ENST00000455694;ENST00000441586|ENST00000530477	D;D|.	0.95482|.	-3.72;-3.72|.	4.09|4.09	4.09|4.09	0.47781|0.47781	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.000000|.	0.37219|.	N|.	0.002199|.	D|D	0.86822|0.86822	0.6025|0.6025	H|H	0.97829|0.97829	4.085|4.085	0.44454|0.44454	D|D	0.99738|0.99738	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.994|.	D|D	0.89504|0.89504	0.3766|0.3766	10|5	0.87932|.	D|.	0|.	.|.	9.7561|9.7561	0.40504|0.40504	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	76;219|.	Q7RTY5-3;Q7RTY5|.	.;PRS48_HUMAN|.	G|V	219;76|198	ENSP00000401328:D219G;ENSP00000401420:D76G|.	ENSP00000401420:D76G|.	D|I	+|+	2|1	0|0	PRSS48|PRSS48	152431724|152431724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.830000|0.830000	0.47004|0.47004	3.618000|3.618000	0.54188|0.54188	2.088000|2.088000	0.63022|0.63022	0.260000|0.260000	0.18958|0.18958	GAT|ATT		0.433	PRSS48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365685.3		NM_183375	
RAP2B	5912	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	152880567	152880567	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr3:152880567A>G	ENST00000323534.2	+	1	539	c.85A>G	c.(85-87)Atc>Gtc	p.I29V	RP11-529G21.2_ENST00000487827.1_RNA	NM_002886.2	NP_002877.2	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family	29					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)	p.I29V(1)		NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			GGGCTCCTTCATCGAGAAGTA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											75.0	74.0	74.0					3																	152880567		2203	4300	6503	SO:0001583	missense	5912				CCDS3170.1	3q25.2	2014-05-09			ENSG00000181467	ENSG00000181467			9862	protein-coding gene	gene with protein product	"""Ras-related protein RAP-2B"", ""small GTP binding protein"", ""Ras family small GTP binding protein RAP2B"""	179541				2118648	Standard	NM_002886		Approved		uc003ezr.3	P61225	OTTHUMG00000159655	ENST00000323534.2:c.85A>G	3.37:g.152880567A>G	ENSP00000319096:p.Ile29Val	Somatic		WXS	Illumina HiSeq	Phase_I	P17964|Q96EG5|Q9CXG0	Missense_Mutation	SNP	ENST00000323534.2	37	CCDS3170.1	.	.	.	.	.	.	.	.	.	.	A	6.962	0.547352	0.13312	.	.	ENSG00000181467	ENST00000323534	T	0.75821	-0.97	4.61	4.61	0.57282	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	T	0.48714	0.1515	N	0.04805	-0.155	0.80722	D	1	B	0.02656	0.0	B	0.10450	0.005	T	0.48681	-0.9014	10	0.02654	T	1	.	12.0014	0.53232	1.0:0.0:0.0:0.0	.	29	P61225	RAP2B_HUMAN	V	29	ENSP00000319096:I29V	ENSP00000319096:I29V	I	+	1	0	RAP2B	154363257	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.048000	0.76606	1.917000	0.55516	0.460000	0.39030	ATC		0.622	RAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356707.1		NM_002886	
RNF4	6047	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	2498774	2498774	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr4:2498774A>C	ENST00000511600.1	+	3	1565	c.50A>C	c.(49-51)cAg>cCg	p.Q17P	RNF4_ENST00000506706.1_Missense_Mutation_p.Q17P|RNF4_ENST00000314289.8_Missense_Mutation_p.Q17P|RNF4_ENST00000509258.1_Missense_Mutation_p.Q17P|RNF4_ENST00000511859.1_Missense_Mutation_p.Q17P|RNF4_ENST00000541204.1_Missense_Mutation_p.Q17P|RNF4_ENST00000511843.1_3'UTR			P78317	RNF4_HUMAN	ring finger protein 4	17	Mediates interaction with TRPS1. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SUMO polymer binding (GO:0032184)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q51P(1)		endometrium(2)|kidney(2)|lung(1)	5		all_epithelial(65;0.241)				AGACAAGCTCAGAAGCGAACT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											52.0	52.0	52.0					4																	2498774		1890	4116	6006	SO:0001583	missense	6047			U95140	CCDS47001.1, CCDS54713.1	4p16.3	2013-01-09				ENSG00000063978		"""RING-type (C3HC4) zinc fingers"""	10067	protein-coding gene	gene with protein product		602850				9479498	Standard	NM_001185009		Approved	RES4-26, SNURF, SLX5	uc003gfb.3	P78317		ENST00000511600.1:c.50A>C	4.37:g.2498774A>C	ENSP00000426503:p.Gln17Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6D6|D6RF58|Q49AR8	Missense_Mutation	SNP	ENST00000511600.1	37	CCDS47001.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994815	0.74703	.	.	ENSG00000063978	ENST00000504224;ENST00000314289;ENST00000536449;ENST00000541204;ENST00000502316;ENST00000507247;ENST00000509258;ENST00000511859;ENST00000506706;ENST00000511600;ENST00000513450	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	5.7	5.7	0.88788	.	0.204969	0.43579	D	0.000541	T	0.60818	0.2298	M	0.65975	2.015	0.38750	D	0.954081	D;D;P	0.63880	0.993;0.986;0.883	P;P;P	0.58520	0.84;0.738;0.462	T	0.65038	-0.6265	9	.	.	.	-35.1613	12.3567	0.55180	1.0:0.0:0.0:0.0	.	17;17;17	D6RF58;D6RBZ1;P78317	.;.;RNF4_HUMAN	P	17	ENSP00000315212:Q17P;ENSP00000446369:Q17P;ENSP00000423100:Q17P;ENSP00000424076:Q17P;ENSP00000426503:Q17P	.	Q	+	2	0	RNF4	2468572	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	2.224000	0.42945	2.178000	0.69098	0.459000	0.35465	CAG		0.498	RNF4-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360920.1		NM_002938	
SENP8	123228	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	72432091	72432091	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr15:72432091C>T	ENST00000542035.2	+	2	460	c.127C>T	c.(127-129)Cag>Tag	p.Q43*	RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000544171.1_Nonsense_Mutation_p.Q43*|SENP8_ENST00000544411.1_Nonsense_Mutation_p.Q43*|SENP8_ENST00000340912.4_Nonsense_Mutation_p.Q43*	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	43	Protease.						cysteine-type peptidase activity (GO:0008234)	p.Q43*(1)		breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						TGCCAACAGTCAGTTTCATGA	0.478																																																	1	Substitution - Nonsense(1)	kidney(1)											163.0	145.0	151.0					15																	72432091		2199	4297	6496	SO:0001587	stop_gained	123228			BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.127C>T	15.37:g.72432091C>T	ENSP00000446057:p.Gln43*	Somatic		WXS	Illumina HiSeq	Phase_I	Q96QA4	Nonsense_Mutation	SNP	ENST00000542035.2	37	CCDS10240.1	.	.	.	.	.	.	.	.	.	.	C	36	5.756765	0.96898	.	.	ENSG00000166192	ENST00000542035;ENST00000544411;ENST00000340912;ENST00000544171	.	.	.	5.62	4.7	0.59300	.	0.267510	0.37715	N	0.001964	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-6.941	16.8658	0.86029	0.0:0.8715:0.1285:0.0	.	.	.	.	X	43	.	ENSP00000340505:Q43X	Q	+	1	0	SENP8	70219145	1.000000	0.71417	0.992000	0.48379	0.938000	0.57974	3.632000	0.54287	1.491000	0.48482	0.655000	0.94253	CAG		0.478	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420036.1		NM_145204	
SETD2	29072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	47143043	47143043	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr3:47143043C>A	ENST00000409792.3	-	8	4962	c.4920G>T	c.(4918-4920)tgG>tgT	p.W1640C		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1640	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.W1137C(1)|p.W1640C(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CGTTCACAGTCCACTGAGATG	0.408			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	kidney(2)											116.0	114.0	115.0					3																	47143043		2203	4300	6503	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4920G>T	3.37:g.47143043C>A	ENSP00000386759:p.Trp1640Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631464	0.87660	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	T	0.80824	-1.42	5.85	5.85	0.93711	SET domain (3);	0.000000	0.50627	D	0.000110	D	0.92427	0.7596	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93227	0.6614	10	0.87932	D	0	.	20.1576	0.98120	0.0:1.0:0.0:0.0	.	1640;1640	F2Z317;Q9BYW2	.;SETD2_HUMAN	C	1640	ENSP00000386759:W1640C	ENSP00000386759:W1640C	W	-	3	0	SETD2	47118047	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.735000	0.84939	2.773000	0.95371	0.650000	0.86243	TGG		0.408	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
SON	6651	hgsc.bcm.edu	37	21	34925612	34925635	+	In_Frame_Del	DEL	GTCCTGGAGTCTTCGGCTGTGACC	GTCCTGGAGTCTTCGGCTGTGACC	-	rs140276173|rs550454473|rs113673546	byFrequency	TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	GTCCTGGAGTCTTCGGCTGTGACC	GTCCTGGAGTCTTCGGCTGTGACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr21:34925612_34925635delGTCCTGGAGTCTTCGGCTGTGACC	ENST00000356577.4	+	3	4550_4573	c.4075_4098delGTCCTGGAGTCTTCGGCTGTGACC	c.(4075-4098)gtcctggagtcttcggctgtgaccdel	p.VLESSAVT1359del	SON_ENST00000290239.6_In_Frame_Del_p.VLESSAVT1359del|SON_ENST00000300278.4_In_Frame_Del_p.VLESSAVT1359del|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_In_Frame_Del_p.VLESSAVT1359del	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1359	4 X 8 AA tandem repeats of V-L-E-SS- [AVT]-VT.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AGCTATGGCTGTCCTGGAGTCTTCGGCTGTGACCGTCCTGGAGT	0.571																																																	0									,	21,4243		0,21,2111					,	-0.6	0.0			44	100,8154		0,100,4027	no	coding,coding	SON	NM_138927.1,NM_032195.1	,	0,121,6138	A1A1,A1R,RR		1.2115,0.4925,0.9666	,	,		121,12397				SO:0001651	inframe_deletion	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4075_4098delGTCCTGGAGTCTTCGGCTGTGACC	21.37:g.34925612_34925635delGTCCTGGAGTCTTCGGCTGTGACC	ENSP00000348984:p.Val1359_Thr1366del	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	In_Frame_Del	DEL	ENST00000356577.4	37	CCDS13629.1																																																																																				0.571	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2		NM_138927	
STARD9	57519	hgsc.bcm.edu;ucsc.edu	37	15	42976364	42976364	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr15:42976364C>G	ENST00000290607.7	+	23	2645	c.2588C>G	c.(2587-2589)cCt>cGt	p.P863R		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	863					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						AGGCCTGACCCTACACACCAA	0.502																																																	0													153.0	122.0	131.0					15																	42976364		692	1590	2282	SO:0001583	missense	57519			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.2588C>G	15.37:g.42976364C>G	ENSP00000290607:p.Pro863Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	ENST00000290607.7	37	CCDS53935.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671241	0.67814	.	.	ENSG00000159433	ENST00000290607	T	0.63255	-0.03	4.1	3.17	0.36434	.	.	.	.	.	T	0.52008	0.1708	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.49273	-0.8957	7	0.72032	D	0.01	.	9.0326	0.36269	0.0:0.8903:0.0:0.1097	.	.	.	.	R	863	ENSP00000290607:P863R	ENSP00000290607:P863R	P	+	2	0	STARD9	40763656	0.003000	0.15002	0.351000	0.25721	0.695000	0.40330	0.557000	0.23454	1.289000	0.44618	0.650000	0.86243	CCT		0.502	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431094.1			
TARBP1	6894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	234541769	234541769	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr1:234541769G>A	ENST00000040877.1	-	24	3868	c.3869C>T	c.(3868-3870)gCt>gTt	p.A1290V	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1290					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.A1290V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGCAACTAAAGCATACAGTCG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											137.0	129.0	131.0					1																	234541769		2203	4300	6503	SO:0001583	missense	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3869C>T	1.37:g.234541769G>A	ENSP00000040877:p.Ala1290Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549636	0.86127	.	.	ENSG00000059588	ENST00000040877	T	0.33654	1.4	4.67	4.67	0.58626	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.69150	-0.5221	10	0.87932	D	0	-12.5207	17.5352	0.87829	0.0:0.0:1.0:0.0	.	1290	Q13395	TARB1_HUMAN	V	1290	ENSP00000040877:A1290V	ENSP00000040877:A1290V	A	-	2	0	TARBP1	232608392	1.000000	0.71417	0.804000	0.32291	0.889000	0.51656	8.186000	0.89706	2.137000	0.66172	0.462000	0.41574	GCT		0.393	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1		NM_005646	
TBC1D24	57465	broad.mit.edu;hgsc.bcm.edu	37	16	2546380	2546380	+	Silent	SNP	C	C	A	rs375578380		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr16:2546380C>A	ENST00000293970.5	+	2	364	c.231C>A	c.(229-231)atC>atA	p.I77I	TBC1D24_ENST00000434757.2_Silent_p.I77I|RP11-20I23.1_ENST00000564543.1_Silent_p.I77I|TBC1D24_ENST00000567020.1_Silent_p.I77I	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	77	Rab-GAP TBC.				neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)	p.I77I(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						ACAGCGACATCGTGGGCAAGA	0.667																																																	1	Substitution - coding silent(1)	kidney(1)											48.0	57.0	54.0					16																	2546380		2164	4268	6432	SO:0001819	synonymous_variant	57465			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.231C>A	16.37:g.2546380C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0JNW3|B9A6M6|Q2KJ08	Silent	SNP	ENST00000293970.5	37	CCDS55980.1																																																																																				0.667	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000435637.1		NM_020705	
TCF7L2	6934	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	114901063	114901063	+	Missense_Mutation	SNP	G	G	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr10:114901063G>T	ENST00000355995.4	+	6	1180	c.673G>T	c.(673-675)Gac>Tac	p.D225Y	TCF7L2_ENST00000538897.1_Missense_Mutation_p.D225Y|TCF7L2_ENST00000355717.4_Missense_Mutation_p.D249Y|TCF7L2_ENST00000536810.1_Missense_Mutation_p.D225Y|TCF7L2_ENST00000543371.1_Missense_Mutation_p.D225Y|TCF7L2_ENST00000369389.1_5'Flank|TCF7L2_ENST00000352065.5_Missense_Mutation_p.D202Y|TCF7L2_ENST00000369395.1_Missense_Mutation_p.D250Y|TCF7L2_ENST00000534894.1_Missense_Mutation_p.D225Y|TCF7L2_ENST00000349937.2_Missense_Mutation_p.D225Y|TCF7L2_ENST00000369397.4_Missense_Mutation_p.D202Y|TCF7L2_ENST00000545257.1_Missense_Mutation_p.D225Y|TCF7L2_ENST00000542695.1_5'UTR			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	225	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D202Y(1)|p.D249Y(1)|p.D225Y(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		AGCCGACGTAGACCCCAAAAC	0.602			T	VTI1A	colorectal																																			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	3	Substitution - Missense(3)	kidney(3)											111.0	94.0	100.0					10																	114901063		2203	4300	6503	SO:0001583	missense	6934			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.673G>T	10.37:g.114901063G>T	ENSP00000348274:p.Asp225Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	g	32	5.127441	0.94473	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000349937;ENST00000352065;ENST00000369395;ENST00000346198	D;D;D;D;D;D;D;D;D	0.99445	-5.33;-5.33;-5.36;-5.37;-5.91;-5.86;-5.84;-5.32;-5.86	5.45	5.45	0.79879	CTNNB1 binding, N-teminal (1);	0.104686	0.64402	D	0.000007	D	0.99462	0.9809	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D	0.89917	0.999;1.0;0.973;0.997;0.999;0.997;0.999;0.999;0.999;1.0;0.999;1.0;0.946;1.0;0.966;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D	0.85130	0.992;0.992;0.951;0.99;0.986;0.981;0.99;0.987;0.979;0.992;0.992;0.996;0.864;0.997;0.923;0.994;0.993;0.987;0.996	D	0.99075	1.0835	10	0.87932	D	0	-3.143	19.2979	0.94131	0.0:0.0:1.0:0.0	.	82;42;119;225;96;144;202;202;202;168;225;202;202;202;249;202;225;202;202	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Y	225;225;225;225;249;225;225;202;225;202;250;219	ENSP00000348274:D225Y;ENSP00000440547:D225Y;ENSP00000444972:D225Y;ENSP00000446238:D225Y;ENSP00000347949:D249Y;ENSP00000446172:D225Y;ENSP00000443626:D225Y;ENSP00000358404:D202Y;ENSP00000344823:D202Y	ENSP00000345640:D219Y	D	+	1	0	TCF7L2	114891053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.559000	0.86315	0.650000	0.86243	GAC		0.602	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding			NM_030756	
UPB1	51733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	24921682	24921682	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr22:24921682A>G	ENST00000326010.5	+	10	1419	c.1075A>G	c.(1075-1077)Acg>Gcg	p.T359A	UPB1_ENST00000498140.1_3'UTR|UPB1_ENST00000413389.2_Missense_Mutation_p.T291A	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	359	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)	p.T359A(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					CTTTCAGATGACGGGCAGGTA	0.527											OREG0026412	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											170.0	162.0	165.0					22																	24921682		2203	4300	6503	SO:0001583	missense	51733			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.1075A>G	22.37:g.24921682A>G	ENSP00000324343:p.Thr359Ala	Somatic	775	WXS	Illumina HiSeq	Phase_I	A3KMF8|Q9UIR3	Missense_Mutation	SNP	ENST00000326010.5	37	CCDS13827.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716699	0.89205	.	.	ENSG00000100024	ENST00000413389;ENST00000326010	D;D	0.85484	-1.99;-1.99	5.72	5.72	0.89469	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.000000	0.85682	D	0.000000	D	0.93582	0.7951	H	0.94582	3.555	0.80722	D	1	D;D	0.63046	0.992;0.96	P;P	0.60541	0.876;0.746	D	0.94561	0.7762	10	0.51188	T	0.08	-13.4847	15.1216	0.72447	1.0:0.0:0.0:0.0	.	359;291	Q9UBR1;E7EUZ5	BUP1_HUMAN;.	A	291;359	ENSP00000406057:T291A;ENSP00000324343:T359A	ENSP00000324343:T359A	T	+	1	0	UPB1	23251682	1.000000	0.71417	0.998000	0.56505	0.835000	0.47333	8.570000	0.90748	2.311000	0.77944	0.533000	0.62120	ACG		0.527	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319869.1			
USP24	23358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55638068	55638068	+	Silent	SNP	G	G	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr1:55638068G>A	ENST00000294383.6	-	4	683	c.684C>T	c.(682-684)ctC>ctT	p.L228L	USP24_ENST00000407756.1_Silent_p.L116L	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	228					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.L228L(1)|p.L197L(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GCACACCCAGGAGACCAGTGG	0.338																																																	2	Substitution - coding silent(2)	kidney(2)											97.0	89.0	91.0					1																	55638068		1833	4090	5923	SO:0001819	synonymous_variant	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.684C>T	1.37:g.55638068G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	37	CCDS44154.2																																																																																				0.338	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			
USP24	23358	broad.mit.edu;hgsc.bcm.edu	37	1	55642117	55642117	+	Splice_Site	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr1:55642117C>A	ENST00000294383.6	-	3	490		c.e3-1		USP24_ENST00000407756.1_Splice_Site	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.?(2)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TCGGAAAGACCTTAGTAAAAT	0.323																																																	2	Unknown(2)	kidney(2)											63.0	58.0	59.0					1																	55642117		1818	4082	5900	SO:0001630	splice_region_variant	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.491-1G>T	1.37:g.55642117C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZSY2|Q8N2Y4|Q9NXD1	Splice_Site	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480769	0.84747	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4464	0.94849	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP24	55414705	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.950000	0.75977	2.827000	0.97445	0.655000	0.94253	.		0.323	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			Intron
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191590	10191590	+	Nonsense_Mutation	SNP	C	C	T	rs5030825		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr3:10191590C>T	ENST00000256474.2	+	3	1423	c.583C>T	c.(583-585)Cag>Tag	p.Q195*	VHL_ENST00000345392.2_Nonsense_Mutation_p.Q154*|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	195					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.Q195*(5)|p.P192fs*3(1)|p.N193fs*>16(1)|p.Q195fs*20(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCAAATGTGCAGAAAGACCT	0.498		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	8	Substitution - Nonsense(5)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	kidney(8)	GRCh37	CI951988|CM941391	VHL	I|M	rs5030825						73.0	66.0	68.0					3																	10191590		2203	4300	6503	SO:0001587	stop_gained	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.583C>T	3.37:g.10191590C>T	ENSP00000256474:p.Gln195*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287576	0.59976	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.97	0.468	0.16732	.	1.095100	0.06783	N	0.785583	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-3.7004	5.1954	0.15233	0.1872:0.608:0.104:0.1007	rs5030825	.	.	.	X	195;154;113	.	ENSP00000256474:Q195X	Q	+	1	0	VHL	10166590	0.000000	0.05858	0.261000	0.24466	0.989000	0.77384	-0.569000	0.05902	0.264000	0.21851	0.655000	0.94253	CAG		0.498	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZNF169	169841	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	97055309	97055309	+	Missense_Mutation	SNP	C	C	G	rs532233833		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr9:97055309C>G	ENST00000395395.2	+	4	304	c.214C>G	c.(214-216)Cct>Gct	p.P72A	ZNF169_ENST00000375354.4_Missense_Mutation_p.P72A|ZNF169_ENST00000481550.2_Missense_Mutation_p.P72A|ZNF169_ENST00000480716.1_Missense_Mutation_p.P72A|ZNF169_ENST00000340911.4_Missense_Mutation_p.P72A	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.		P -> L (in dbSNP:rs1536690).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P72A(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				AGGCGACGAACCTTGGAGAGA	0.502																																																	1	Substitution - Missense(1)	kidney(1)											95.0	70.0	79.0					9																	97055309		2203	4300	6503	SO:0001583	missense	169841			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.214C>G	9.37:g.97055309C>G	ENSP00000378792:p.Pro72Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	ENST00000395395.2	37	CCDS6709.2	.	.	.	.	.	.	.	.	.	.	c	9.817	1.184800	0.21870	.	.	ENSG00000175787	ENST00000395395;ENST00000375354	T;T	0.10192	2.9;5.44	3.09	3.09	0.35607	Krueppel-associated box (2);	.	.	.	.	T	0.26810	0.0656	M	0.75085	2.285	0.32625	N	0.522749	D;P;D	0.61080	0.989;0.908;0.97	P;P;P	0.61070	0.883;0.54;0.527	T	0.33777	-0.9855	9	0.72032	D	0.01	.	9.8219	0.40887	0.0:1.0:0.0:0.0	.	72;72;72	Q6PIG1;Q7Z761;Q14929	.;.;ZN169_HUMAN	A	72	ENSP00000378792:P72A;ENSP00000364503:P72A	ENSP00000364503:P72A	P	+	1	0	ZNF169	96095130	0.002000	0.14202	0.945000	0.38365	0.118000	0.20060	0.461000	0.21940	1.754000	0.51921	0.543000	0.68304	CCT		0.502	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1		NM_194320	
ZNF445	353274	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	44489465	44489465	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr3:44489465C>A	ENST00000396077.2	-	8	2045	c.1698G>T	c.(1696-1698)aaG>aaT	p.K566N	ZNF445_ENST00000425708.2_Missense_Mutation_p.K566N	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	566					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K566N(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CAAGAAATTTCTTCTTAGCAT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											99.0	102.0	101.0					3																	44489465		2203	4300	6503	SO:0001583	missense	353274			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1698G>T	3.37:g.44489465C>A	ENSP00000379387:p.Lys566Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189146	0.38707	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.60672	0.17;0.17	3.61	3.61	0.41365	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.693106	0.12905	N	0.429401	T	0.49115	0.1538	L	0.46614	1.455	0.28696	N	0.904335	B;B	0.33694	0.281;0.421	B;B	0.24848	0.056;0.056	T	0.54807	-0.8238	10	0.87932	D	0	.	13.5594	0.61779	0.0:1.0:0.0:0.0	.	554;566	B7ZKX2;P59923	.;ZN445_HUMAN	N	566	ENSP00000413073:K566N;ENSP00000379387:K566N	ENSP00000379387:K566N	K	-	3	2	ZNF445	44464469	0.502000	0.26107	0.242000	0.24170	0.860000	0.49131	3.273000	0.51623	2.325000	0.78763	0.591000	0.81541	AAG		0.448	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2		NM_181489	
ZNF98	148198	broad.mit.edu;hgsc.bcm.edu	37	19	22574443	22574443	+	Missense_Mutation	SNP	T	T	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr19:22574443T>C	ENST00000357774.5	-	4	1715	c.1594A>G	c.(1594-1596)Att>Gtt	p.I532V		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	532					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I532V(2)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CTGTTAAGAATAGAGGAGTTG	0.363																																																	2	Substitution - Missense(2)	kidney(2)											48.0	41.0	43.0					19																	22574443		2107	4245	6352	SO:0001583	missense	148198				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1594A>G	19.37:g.22574443T>C	ENSP00000350418:p.Ile532Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.033064	0.00406	.	.	ENSG00000197360	ENST00000357774	T	0.07216	3.21	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03348	0.0097	N	0.11818	0.18	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.42999	-0.9418	9	0.15952	T	0.53	.	0.991	0.01457	0.164:0.1475:0.3258:0.3627	.	532	A6NK75	ZNF98_HUMAN	V	532	ENSP00000350418:I532V	ENSP00000350418:I532V	I	-	1	0	ZNF98	22366283	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-3.261000	0.00536	-2.294000	0.00663	-1.118000	0.02043	ATT		0.363	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1		NM_001098626	
ZSWIM2	151112	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	187693068	187693068	+	Silent	SNP	A	A	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr2:187693068A>C	ENST00000295131.2	-	9	1584	c.1545T>G	c.(1543-1545)ccT>ccG	p.P515P		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	515					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P515P(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			GAACAATAGGAGGAAGCAGTG	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											67.0	65.0	65.0					2																	187693068		2203	4300	6503	SO:0001819	synonymous_variant	151112			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1545T>G	2.37:g.187693068A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B3KXV6|Q53SI3|Q57ZY3	Silent	SNP	ENST00000295131.2	37	CCDS33348.1																																																																																				0.383	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1		NM_182521	
ABCC10	89845	broad.mit.edu	37	6	43417778	43417778	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr6:43417778G>C	ENST00000372530.4	+	22	4643	c.4428G>C	c.(4426-4428)caG>caC	p.Q1476H	ABCC10_ENST00000244533.3_Missense_Mutation_p.Q1448H	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	1476	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.Q1448H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TGTTCCAGCAGCTGCTGCAGA	0.652																																																	1	Substitution - Missense(1)	kidney(1)											53.0	60.0	57.0					6																	43417778		2203	4300	6503	SO:0001583	missense	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.4428G>C	6.37:g.43417778G>C	ENSP00000361608:p.Gln1476His	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726274	0.48833	.	.	ENSG00000124574	ENST00000372530;ENST00000244533;ENST00000443394;ENST00000505344	D;D;D	0.90620	-2.7;-2.7;-2.7	5.5	5.5	0.81552	ABC transporter-like (1);	0.260017	0.31347	N	0.007820	T	0.68155	0.2970	N	0.10707	0.03	0.39623	D	0.970053	B;B	0.11235	0.004;0.003	B;B	0.12156	0.007;0.003	T	0.65685	-0.6108	10	0.27785	T	0.31	-37.751	8.4381	0.32799	0.0825:0.2058:0.7117:0.0	.	1448;1476	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	H	1476;1448;232;113	ENSP00000361608:Q1476H;ENSP00000244533:Q1448H;ENSP00000422699:Q113H	ENSP00000244533:Q1448H	Q	+	3	2	ABCC10	43525756	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.051000	0.41307	2.590000	0.87494	0.555000	0.69702	CAG		0.652	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2		NM_033450	
FAM86B3P	286042	broad.mit.edu	37	8	8092007	8092007	+	IGR	SNP	C	C	T	rs200134232	byFrequency	TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr8:8092007C>T								FAM85B (7871 upstream) : ALG1L13P (3188 downstream)																							GCCCCCAGCACGAGGCTGTCC	0.547																																																	0																																										SO:0001628	intergenic_variant	0																															8.37:g.8092007C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.547									
RP3-470B24.5	0	broad.mit.edu	37	6	168377019	168377019	+	lincRNA	SNP	A	A	G	rs200389857		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr6:168377019A>G	ENST00000538528.1	-	0	600																											TGGGGAGGAGAAGACAGTGGG	0.632																																																	0													11.0	10.0	10.0					6																	168377019		689	1576	2265			100128124																															6.37:g.168377019A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.632	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
RP3-470B24.5	0	broad.mit.edu	37	6	168377022	168377022	+	lincRNA	SNP	A	A	G	rs112006230		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr6:168377022A>G	ENST00000538528.1	-	0	597																											GGAGGAGAAGACAGTGGGGGT	0.632																																																	0													10.0	9.0	9.0					6																	168377022		686	1572	2258			100128124																															6.37:g.168377022A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.632	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
RP3-470B24.5	0	broad.mit.edu	37	6	168377071	168377071	+	lincRNA	SNP	G	G	A	rs201618689		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr6:168377071G>A	ENST00000538528.1	-	0	548																											AAGACAGTGGGGGTCATTCCC	0.642																																																	0													3.0	4.0	4.0					6																	168377071		539	1376	1915			100128124																															6.37:g.168377071G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.642	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
KRTAP5-7	440050	broad.mit.edu	37	11	71238705	71238705	+	Missense_Mutation	SNP	G	G	A	rs536797652		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr11:71238705G>A	ENST00000398536.4	+	1	393	c.359G>A	c.(358-360)tGc>tAc	p.C120Y		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	120	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.C120Y(2)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						tgtaagccctgctgctgccag	0.607													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20154	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)											129.0	139.0	136.0					11																	71238705		2200	4294	6494	SO:0001583	missense	440050			AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.359G>A	11.37:g.71238705G>A	ENSP00000417330:p.Cys120Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	B2RNM3|Q701N5	Missense_Mutation	SNP	ENST00000398536.4	37	CCDS41682.1	.	.	.	.	.	.	.	.	.	.	N	4.462	0.085611	0.08583	.	.	ENSG00000244411	ENST00000398536	T	0.01304	5.03	1.87	1.87	0.25490	.	.	.	.	.	T	0.01421	0.0046	L	0.60455	1.87	0.26143	N	0.980242	B	0.12630	0.006	B	0.08055	0.003	T	0.51733	-0.8668	9	0.02654	T	1	.	4.3831	0.11304	0.201:0.0:0.799:0.0	.	120	Q6L8G8	KRA57_HUMAN	Y	120	ENSP00000417330:C120Y	ENSP00000417330:C120Y	C	+	2	0	KRTAP5-7	70916353	0.718000	0.27976	0.999000	0.59377	0.075000	0.17131	2.143000	0.42187	1.367000	0.46095	0.289000	0.19496	TGC		0.607	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1			
Unknown	0	broad.mit.edu	37	1	149281361	149281362	+	IGR	INS	-	-	T	rs147139304|rs141634253		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr1:149281361_149281362insT								RP11-403I13.4 (15851 upstream) : RP11-403I13.7 (3282 downstream)																							GGGCAATTGCCTTTTTTTTTCT	0.51																																																	0																																										SO:0001628	intergenic_variant	388692																															1.37:g.149281370_149281370dupT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS		37																																																																																				0	0.510									
LOC441666	441666	broad.mit.edu	37	10	42833142	42833142	+	RNA	SNP	A	A	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr10:42833142A>T	ENST00000609841.1	-	0	761					NR_024380.1																						CATTCTTCACATTTGTAGGTT	0.358																																																	0																																												441666																															10.37:g.42833142A>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000609841.1	37																																																																																					0.358	RP11-313J2.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472483.1			
LOC441666	441666	broad.mit.edu	37	10	42833154	42833154	+	RNA	SNP	T	T	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr10:42833154T>C	ENST00000609841.1	-	0	749					NR_024380.1																						TTGTAGGTTGTATCTCCAGTA	0.338																																																	0																																												441666																															10.37:g.42833154T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000609841.1	37																																																																																					0.338	RP11-313J2.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472483.1			
LOC283299	283299	broad.mit.edu	37	11	7870650	7870650	+	RNA	DEL	T	T	-			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr11:7870650delT	ENST00000527847.1	-	0	5006				RP11-35J10.5_ENST00000527565.1_lincRNA	NR_036678.1																						TACACAGCTATTATGACGCAG	0.507																																																	0																																												26343																															11.37:g.7870650delT		Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000527847.1	37																																																																																					0.507	RP11-494M8.4-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000385693.1			
PWRN2	791115	broad.mit.edu	37	15	24412660	24412661	+	lincRNA	INS	-	-	G	rs58087386|rs72446903	byFrequency	TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr15:24412660_24412661insG	ENST00000567246.1	-	0	1557_1558					NR_026647.1				Prader-Willi region non-protein coding RNA 2																		taaagtgttaaaactgaatagt	0.371													|||unknown(NO_COVERAGE)	1041	0.207867	0.2352	0.2565	5008	,	,		28548	0.0317		0.2535	False		,,,				2504	0.271																0																																												791115			AC087474		15q11.2	2014-07-18	2008-08-13			ENSG00000260551		"""-"""	33236	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 199"""	611217				17337158	Standard	NR_026647		Approved	NCRNA00199	uc010uad.1				15.37:g.24412660_24412661insG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS	ENST00000567246.1	37																																																																																					0.371	PWRN2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000422053.1		NR_026647	
RAPGEF2	9693	broad.mit.edu	37	4	160275198	160275198	+	Splice_Site	DEL	G	G	-			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr4:160275198delG	ENST00000264431.4	+	22	4587	c.4168delG	c.(4168-4170)gca>ca	p.A1390fs		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1390					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GGGGCTCATTGGTAAGTTTTA	0.413																																																	0													33.0	33.0	33.0					4																	160275198		1759	3904	5663	SO:0001630	splice_region_variant	9693			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.4168+1G>-	4.37:g.160275198delG		Somatic		WXS	Illumina GAIIx	Phase_I	D3DP27	Frame_Shift_Del	DEL	ENST00000264431.4	37	CCDS43277.1																																																																																				0.413	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2		NM_014247	Frame_Shift_Del
TNNI1	7135	broad.mit.edu	37	1	201398087	201398087	+	De_novo_Start_OutOfFrame	SNP	A	A	T			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr1:201398087A>T	ENST00000336092.4	-	0	483							P19237	TNNI1_HUMAN	troponin I type 1 (skeletal, slow)						muscle filament sliding (GO:0030049)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|troponin complex (GO:0005861)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	8						TGAGACTTCAACAGCAAGTTT	0.517																																																	0																																												7135			BC012600	CCDS1411.1	1q31.3	2008-02-05	2005-09-12		ENSG00000159173	ENSG00000159173			11945	protein-coding gene	gene with protein product		191042	"""troponin I, skeletal, slow"""			2365354, 8144655	Standard	NM_003281		Approved		uc021phd.1	P19237	OTTHUMG00000035736	ENST00000336092.4:c.-314T>A	1.37:g.201398087A>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NEH3|A8MSJ0|Q659A5|Q6FGS7|Q6FGW1|Q6ICU2|Q86T57|Q96DT9	RNA	SNP	ENST00000336092.4	37	CCDS1411.1																																																																																				0.517	TNNI1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086945.3		NM_003281	
Unknown	0	broad.mit.edu	37	2	97950268	97950269	+	IGR	DEL	AG	AG	-			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr2:97950268_97950269delAG								ANKRD36 (20010 upstream) : AC159540.3 (119278 downstream)																							ACTGAGTGACAGATAATCAGGA	0.465																																																	0																																										SO:0001628	intergenic_variant	0																															2.37:g.97950268_97950269delAG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.465									
UNC5C	8633	broad.mit.edu	37	4	96088447	96088447	+	3'UTR	DEL	C	C	-			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr4:96088447delC	ENST00000453304.1	-	0	5082					NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ATTCTTTAATCCCCACCTGCT	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.*1938G>-	4.37:g.96088447delC		Somatic		WXS	Illumina GAIIx	Phase_I	Q8IUT0	RNA	DEL	ENST00000453304.1	37	CCDS3643.1																																																																																				0.383	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1		NM_003728	
C8orf34-AS1	286189	broad.mit.edu	37	8	69214611	69214611	+	5'Flank	DEL	T	T	-			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr8:69214611delT	ENST00000584858.1	-	0	325																											tagttgacaatttttaacaac	0.269																																																	0																																										SO:0001631	upstream_gene_variant	0																															8.37:g.69214611delT	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000584858.1	37																																																																																					0.269	RP11-664D7.4-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000447261.1			
LINC01410	103352539	broad.mit.edu	37	9	66468755	66468755	+	lincRNA	SNP	T	T	C			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr9:66468755T>C	ENST00000424345.1	+	0	2322																											gtgatgcctatctgacctctc	0.493																																																	0																																												0																															9.37:g.66468755T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000424345.1	37																																																																																					0.493	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000128851.1			
LINC01410	103352539	broad.mit.edu	37	9	66468909	66468909	+	lincRNA	SNP	G	G	A	rs78672302		TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr9:66468909G>A	ENST00000424345.1	+	0	2476																											attgtgaccagcacagattca	0.453																																																	0																																												0																															9.37:g.66468909G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000424345.1	37																																																																																					0.453	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000128851.1			
ZNF765	91661	broad.mit.edu	37	19	53911474	53911474	+	Silent	SNP	A	A	G			TCGA-CW-5591-01A-01D-1534-10	TCGA-CW-5591-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02ac80cd-caa3-4dbc-9b57-4a324cec0ad4	62481cc6-a290-4771-a728-4a69a49f1cfc	g.chr19:53911474A>G	ENST00000396408.3	+	4	783	c.666A>G	c.(664-666)aaA>aaG	p.K222K	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K222K(1)		endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		ACAGTGGCAAAGCCTATAATT	0.343																																																	1	Substitution - coding silent(1)	kidney(1)											73.0	74.0	73.0					19																	53911474		2193	4295	6488	SO:0001819	synonymous_variant	91661			BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.666A>G	19.37:g.53911474A>G		Somatic		WXS	Illumina GAIIx	Phase_I	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Silent	SNP	ENST00000396408.3	37	CCDS46171.1																																																																																				0.343	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1		NM_138372	
