#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AASS	10157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	121719654	121719654	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr7:121719654T>G	ENST00000393376.1	-	20	2488	c.2393A>C	c.(2392-2394)gAa>gCa	p.E798A	AASS_ENST00000473553.1_5'UTR|AASS_ENST00000417368.2_Missense_Mutation_p.E798A|RNU7-154P_ENST00000516194.1_RNA			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	798	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.E798A(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TGCCTACCATTCAGCAGCCTC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											84.0	82.0	83.0					7																	121719654		2203	4300	6503	SO:0001583	missense	10157			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2393A>C	7.37:g.121719654T>G	ENSP00000377040:p.Glu798Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.270073	0.40194	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	5.74	4.57	0.56435	.	0.138969	0.64402	D	0.000004	T	0.49541	0.1563	L	0.48174	1.505	0.48901	D	0.999723	B	0.25105	0.118	B	0.26310	0.068	T	0.41251	-0.9519	9	0.35671	T	0.21	.	10.6991	0.45915	0.1424:0.0:0.0:0.8576	.	798	Q9UDR5	AASS_HUMAN	A	798	.	ENSP00000377040:E798A	E	-	2	0	AASS	121506890	0.989000	0.36119	0.541000	0.28102	0.646000	0.38490	2.290000	0.43531	0.972000	0.38314	0.533000	0.62120	GAA		0.398	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1		NM_005763	
ABCC10	89845	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43400901	43400901	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr6:43400901G>C	ENST00000372530.4	+	3	1398	c.1183G>C	c.(1183-1185)Gct>Cct	p.A395P	ABCC10_ENST00000443426.2_Intron|ABCC10_ENST00000244533.3_Missense_Mutation_p.A352P	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	395	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A352P(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GCTTAACTTTGCTGGGAGCTT	0.607																																																	1	Substitution - Missense(1)	kidney(1)											58.0	59.0	59.0					6																	43400901		2203	4300	6503	SO:0001583	missense	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1183G>C	6.37:g.43400901G>C	ENSP00000361608:p.Ala395Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832021	0.71258	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.89875	-2.58;-2.58	5.37	4.5	0.54988	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.272392	0.36134	N	0.002777	D	0.84320	0.5446	L	0.49571	1.57	0.32056	N	0.596294	P;P	0.47484	0.831;0.896	P;P	0.52881	0.712;0.602	D	0.83753	0.0210	10	0.66056	D	0.02	-33.3125	7.4201	0.27067	0.0837:0.0:0.6386:0.2777	.	352;395	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	P	395;352	ENSP00000361608:A395P;ENSP00000244533:A352P	ENSP00000244533:A352P	A	+	1	0	ABCC10	43508879	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	5.826000	0.69293	1.278000	0.44430	0.561000	0.74099	GCT		0.607	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2		NM_033450	
ACSM4	341392	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7469736	7469736	+	Silent	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr12:7469736C>T	ENST00000399422.4	+	4	672	c.624C>T	c.(622-624)ttC>ttT	p.F208F		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	208					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)	p.F208F(2)		endometrium(6)|kidney(1)|lung(14)	21						TTTGCAGATTCGCCTCTGAAG	0.483																																																	2	Substitution - coding silent(2)	kidney(2)											60.0	62.0	61.0					12																	7469736		2053	4202	6255	SO:0001819	synonymous_variant	341392				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.624C>T	12.37:g.7469736C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MTI6	Silent	SNP	ENST00000399422.4	37	CCDS44825.1																																																																																				0.483	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2		NM_001080454	
ACACB	32	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	109577276	109577276	+	Silent	SNP	C	C	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr12:109577276C>A	ENST00000338432.7	+	2	185	c.66C>A	c.(64-66)atC>atA	p.I22I	ACACB_ENST00000377848.3_Silent_p.I22I|ACACB_ENST00000377854.5_Silent_p.I22I			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	22					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.I22I(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GGTTAAAAATCTGGGGGAAAA	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											94.0	93.0	93.0					12																	109577276		2203	4300	6503	SO:0001819	synonymous_variant	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.66C>A	12.37:g.109577276C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	CCDS31898.1																																																																																				0.453	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1		NM_001093	
AGPS	8540	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	178326666	178326666	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr2:178326666G>C	ENST00000264167.4	+	9	1062	c.916G>C	c.(916-918)Gag>Cag	p.E306Q	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	306	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.E306Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			AGATTCCCTGGAGTTCAGTAC	0.378																																																	1	Substitution - Missense(1)	kidney(1)											99.0	95.0	96.0					2																	178326666		2203	4300	6503	SO:0001583	missense	8540			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.916G>C	2.37:g.178326666G>C	ENSP00000264167:p.Glu306Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A5D8U9|Q2TU35	Missense_Mutation	SNP	ENST00000264167.4	37	CCDS2275.1	.	.	.	.	.	.	.	.	.	.	G	33	5.206416	0.95033	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.96396	-4.0	5.76	5.76	0.90799	FAD-linked oxidase, FAD-binding, subdomain 2 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	0.049379	0.85682	D	0.000000	D	0.98346	0.9451	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98583	1.0651	10	0.59425	D	0.04	.	19.9584	0.97232	0.0:0.0:1.0:0.0	.	306	O00116	ADAS_HUMAN	Q	306;176	ENSP00000264167:E306Q	ENSP00000264167:E306Q	E	+	1	0	AGPS	178034912	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.229000	0.95273	2.717000	0.92951	0.655000	0.94253	GAG		0.378	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2			
ARFGEF2	10564	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	47569395	47569395	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr20:47569395A>T	ENST00000371917.4	+	5	577	c.577A>T	c.(577-579)Att>Ttt	p.I193F		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	193	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.I193F(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GCTGAACGTCATTTTCACCCG	0.463																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												1	Substitution - Missense(1)	kidney(1)											113.0	101.0	105.0					20																	47569395		2203	4300	6503	SO:0001583	missense	10564			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.577A>T	20.37:g.47569395A>T	ENSP00000360985:p.Ile193Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	A	34	5.354568	0.95854	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.28666	1.6	6.06	6.06	0.98353	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63686	0.2532	M	0.90650	3.135	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.71523	-0.4567	10	0.72032	D	0.01	.	16.6093	0.84858	1.0:0.0:0.0:0.0	.	193	Q9Y6D5	BIG2_HUMAN	F	193	ENSP00000360985:I193F	ENSP00000360985:I193F	I	+	1	0	ARFGEF2	47002802	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.328000	0.96403	2.324000	0.78689	0.533000	0.62120	ATT		0.463	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1		NM_006420	
ATP1A2	477	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	160100072	160100072	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:160100072C>T	ENST00000361216.3	+	12	1731	c.1642C>T	c.(1642-1644)Cgt>Tgt	p.R548C	ATP1A2_ENST00000392233.3_Missense_Mutation_p.R548C	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	548					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.R548C(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ACTTGGGGAGCGTGTGCTGGG	0.622																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CM082492	ATP1A2	M							52.0	53.0	53.0					1																	160100072		2203	4300	6503	SO:0001583	missense	477			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1642C>T	1.37:g.160100072C>T	ENSP00000354490:p.Arg548Cys	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470618	0.63625	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	D;D	0.92699	-3.09;-3.09	4.61	4.61	0.57282	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	H	0.99299	4.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97747	1.0212	10	0.87932	D	0	.	10.5807	0.45255	0.3107:0.6893:0.0:0.0	.	548;448;548	B1AKY9;F5GXJ7;P50993	.;.;AT1A2_HUMAN	C	548;548;251	ENSP00000354490:R548C;ENSP00000376066:R548C	ENSP00000354490:R548C	R	+	1	0	ATP1A2	158366696	1.000000	0.71417	0.998000	0.56505	0.921000	0.55340	1.234000	0.32660	2.283000	0.76528	0.511000	0.50034	CGT		0.622	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2		NM_000702	
BAZ2B	29994	broad.mit.edu;hgsc.bcm.edu	37	2	160289320	160289320	+	Missense_Mutation	SNP	T	T	G	rs576575200		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr2:160289320T>G	ENST00000392783.2	-	9	2343	c.1848A>C	c.(1846-1848)gaA>gaC	p.E616D	BAZ2B_ENST00000392782.1_Missense_Mutation_p.E614D|BAZ2B_ENST00000343439.5_Missense_Mutation_p.E614D|BAZ2B_ENST00000355831.2_Missense_Mutation_p.E616D	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	616	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E616D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						catcttcttcttcatcatctt	0.333																																																	1	Substitution - Missense(1)	kidney(1)											75.0	75.0	75.0					2																	160289320		1994	4197	6191	SO:0001583	missense	29994			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1848A>C	2.37:g.160289320T>G	ENSP00000376534:p.Glu616Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.195|9.195	1.027095|1.027095	0.19512|0.19512	.|.	.|.	ENSG00000123636|ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439|ENST00000546335	T;T;T;T|.	0.09163|.	3.01;3.01;3.01;3.01|.	5.47|5.47	3.4|3.4	0.38934|0.38934	.|.	0.212596|.	0.22957|.	U|.	0.053583|.	T|T	0.17492|0.17492	0.0420|0.0420	N|N	0.04880|0.04880	-0.145|-0.145	0.21355|0.21355	N|N	0.999712|0.999712	B;B;B;B;B|.	0.09022|.	0.002;0.002;0.001;0.001;0.0|.	B;B;B;B;B|.	0.10450|.	0.005;0.003;0.003;0.003;0.001|.	T|T	0.11155|0.11155	-1.0599|-1.0599	10|6	0.27785|0.41790	T|T	0.31|0.15	-2.3109|-2.3109	4.4662|4.4662	0.11691|0.11691	0.2881:0.4986:0.0:0.2133|0.2881:0.4986:0.0:0.2133	.|.	616;420;614;614;616|.	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8|.	.;.;.;.;BAZ2B_HUMAN|.	D|T	614;616;616;614|516	ENSP00000376533:E614D;ENSP00000376534:E616D;ENSP00000348087:E616D;ENSP00000339670:E614D|.	ENSP00000339670:E614D|ENSP00000437619:K516T	E|K	-|-	3|2	2|0	BAZ2B|BAZ2B	159997566|159997566	0.186000|0.186000	0.23225|0.23225	1.000000|1.000000	0.80357|0.80357	0.895000|0.895000	0.52256|0.52256	-0.203000|-0.203000	0.09438|0.09438	1.338000|1.338000	0.45544|0.45544	-0.213000|-0.213000	0.12676|0.12676	GAA|AAG		0.333	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			
C12orf10	60314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53693593	53693593	+	Silent	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr12:53693593C>T	ENST00000267103.5	+	1	124	c.72C>T	c.(70-72)cgC>cgT	p.R24R	C12orf10_ENST00000549488.1_5'Flank|C12orf10_ENST00000548632.1_5'UTR|RP11-680A11.5_ENST00000550263.1_RNA	NM_021640.3	NP_067653	Q9HB07	MYG1_HUMAN	chromosome 12 open reading frame 10	24					locomotory exploration behavior (GO:0035641)|pigmentation (GO:0043473)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.R24R(1)		cervix(1)|endometrium(3)|kidney(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	20						CCCGGCACCGCATGCTCGGTC	0.657											OREG0021864	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											38.0	39.0	38.0					12																	53693593		2203	4299	6502	SO:0001819	synonymous_variant	60314			AF289485	CCDS31810.1	12q13.13	2014-05-29			ENSG00000139637	ENSG00000139637			17590	protein-coding gene	gene with protein product	"""melanocyte related gene"", ""melanocyte proliferating gene 1"""	611366					Standard	NM_021640		Approved	MYG, MYG1, Gamm1	uc001scp.4	Q9HB07	OTTHUMG00000170030	ENST00000267103.5:c.72C>T	12.37:g.53693593C>T		Somatic	994	WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000267103.5	37	CCDS31810.1																																																																																				0.657	C12orf10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406906.1		NM_021640	
SWT1	54823	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	185143987	185143987	+	Silent	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:185143987C>T	ENST00000367500.4	+	5	873	c.708C>T	c.(706-708)atC>atT	p.I236I	SWT1_ENST00000367501.3_Silent_p.I236I	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	236								p.I236I(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						GTTTCAAAATCCCTATAAAAT	0.353																																																	1	Substitution - coding silent(1)	kidney(1)											80.0	90.0	87.0					1																	185143987		2202	4300	6502	SO:0001819	synonymous_variant	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.708C>T	1.37:g.185143987C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NEK9|Q9BZQ7|Q9NXQ0	Silent	SNP	ENST00000367500.4	37	CCDS1367.1																																																																																				0.353	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1		NM_017673	
CNOT11	55571	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	101885790	101885790	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr2:101885790G>C	ENST00000289382.3	+	7	1611	c.1448G>C	c.(1447-1449)aGg>aCg	p.R483T	RNF149_ENST00000485752.1_5'Flank	NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	483					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.R483T(1)									GAATTCAGTAGGATACGAGAA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											110.0	112.0	111.0					2																	101885790		2203	4300	6503	SO:0001583	missense	55571			AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.1448G>C	2.37:g.101885790G>C	ENSP00000289382:p.Arg483Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	37	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	G	33	5.232675	0.95207	.	.	ENSG00000158435	ENST00000289382	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.86029	0.5835	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86718	0.1940	9	0.54805	T	0.06	-29.3377	20.422	0.99049	0.0:0.0:1.0:0.0	.	483	Q9UKZ1	CB029_HUMAN	T	483	.	ENSP00000289382:R483T	R	+	2	0	C2orf29	101252222	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.731000	0.98807	2.832000	0.97577	0.655000	0.94253	AGG		0.393	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1		NM_017546	
CADM3	57863	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	159163732	159163732	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:159163732T>G	ENST00000368125.4	+	5	750	c.593T>G	c.(592-594)gTt>gGt	p.V198G	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.V232G	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	198	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.V232G(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					ACATTCCAGGTTACCCGGGAG	0.502																																																	1	Substitution - Missense(1)	kidney(1)											111.0	96.0	101.0					1																	159163732		2203	4300	6503	SO:0001583	missense	57863			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.593T>G	1.37:g.159163732T>G	ENSP00000357107:p.Val198Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.147008	0.57151	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	T;T	0.77358	-1.09;-1.09	5.0	5.0	0.66597	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81880	0.4916	M	0.72576	2.205	0.80722	D	1	P;D	0.89917	0.739;1.0	P;D	0.87578	0.614;0.998	T	0.80204	-0.1479	10	0.26408	T	0.33	.	12.7115	0.57092	0.0:0.0:0.0:1.0	.	198;232	Q8N126;Q8N126-2	CADM3_HUMAN;.	G	232;198	ENSP00000357106:V232G;ENSP00000357107:V198G	ENSP00000357106:V232G	V	+	2	0	CADM3	157430356	1.000000	0.71417	0.986000	0.45419	0.981000	0.71138	4.500000	0.60387	2.099000	0.63709	0.459000	0.35465	GTT		0.502	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1		NM_021189	
CATSPER1	117144	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	65793079	65793079	+	Missense_Mutation	SNP	G	G	T	rs375184637		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr11:65793079G>T	ENST00000312106.5	-	1	909	c.772C>A	c.(772-774)Cgt>Agt	p.R258S		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	258	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.R258S(1)		breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						GATATCCCACGCTGGTAGGAC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											123.0	106.0	111.0					11																	65793079		2201	4296	6497	SO:0001583	missense	117144			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.772C>A	11.37:g.65793079G>T	ENSP00000309052:p.Arg258Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	G	2.208	-0.381401	0.05000	.	.	ENSG00000175294	ENST00000312106	D	0.96745	-4.11	3.75	-2.16	0.07080	.	.	.	.	.	D	0.89171	0.6639	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.77895	-0.2417	9	0.16420	T	0.52	.	4.966	0.14091	0.0911:0.4626:0.3167:0.1296	.	258	Q8NEC5	CTSR1_HUMAN	S	258	ENSP00000309052:R258S	ENSP00000309052:R258S	R	-	1	0	CATSPER1	65549655	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.154000	0.16343	-0.299000	0.08909	-0.714000	0.03626	CGT		0.567	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1		NM_053054	
CDH22	64405	broad.mit.edu;hgsc.bcm.edu	37	20	44806600	44806600	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr20:44806600C>T	ENST00000372262.3	-	10	2300	c.1900G>A	c.(1900-1902)Gtt>Att	p.V634I	CDH22_ENST00000537909.1_Missense_Mutation_p.V634I	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	634					brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V634I(2)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				AGGATGAGAACGCAGACCAAG	0.652																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											59.0	53.0	55.0					20																	44806600		2203	4300	6503	SO:0001583	missense	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1900G>A	20.37:g.44806600C>T	ENSP00000361336:p.Val634Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	2.424	-0.332413	0.05314	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.36157	1.27;1.27	4.43	2.33	0.28932	.	0.213481	0.40640	N	0.001041	T	0.15089	0.0364	N	0.11064	0.09	0.34914	D	0.747784	B	0.18968	0.032	B	0.10450	0.005	T	0.27434	-1.0074	10	0.02654	T	1	.	9.8426	0.41008	0.0:0.7982:0.0:0.2018	.	634	Q9UJ99	CAD22_HUMAN	I	634	ENSP00000361336:V634I;ENSP00000437790:V634I	ENSP00000361336:V634I	V	-	1	0	CDH22	44240007	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	0.691000	0.25467	1.092000	0.41356	-0.140000	0.14226	GTT		0.652	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1		NM_021248	
CDH7	1005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	63477170	63477170	+	Silent	SNP	C	C	T	rs143932384		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr18:63477170C>T	ENST00000397968.2	+	3	867	c.441C>T	c.(439-441)aaC>aaT	p.N147N	CDH7_ENST00000323011.3_Silent_p.N147N|CDH7_ENST00000536984.2_Silent_p.N147N	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	147	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N147N(2)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				AGGATATCAACGACAATGAAC	0.507																																																	2	Substitution - coding silent(2)	kidney(2)						C	,	1,4405	2.1+/-5.4	0,1,2202	92.0	90.0	91.0		441,441	-7.7	0.8	18	dbSNP_134	91	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CDH7	NM_004361.2,NM_033646.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	147/786,147/786	63477170	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.441C>T	18.37:g.63477170C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H157	Silent	SNP	ENST00000397968.2	37	CCDS11993.1																																																																																				0.507	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2		NM_033646	
DAPK1	1612	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	90311963	90311963	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr9:90311963G>T	ENST00000408954.3	+	22	2790	c.2455G>T	c.(2455-2457)Gtg>Ttg	p.V819L	DAPK1_ENST00000472284.1_Missense_Mutation_p.V819L|DAPK1_ENST00000469640.2_Missense_Mutation_p.V819L|DAPK1_ENST00000358077.5_Missense_Mutation_p.V819L|DAPK1_ENST00000491893.1_Intron	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	819					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V819L(1)|p.V820L(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TGGAAATCCTGTGTATTTCTG	0.398									Chronic Lymphocytic Leukemia, Familial Clustering of																																								2	Substitution - Missense(2)	kidney(2)											275.0	264.0	268.0					9																	90311963		1956	4169	6125	SO:0001583	missense	1612	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2455G>T	9.37:g.90311963G>T	ENSP00000386135:p.Val819Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747411	0.49257	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	5.5	4.59	0.56863	.	0.268702	0.25735	N	0.028660	T	0.15478	0.0373	L	0.47716	1.5	0.46521	D	0.999088	B	0.23591	0.088	B	0.21151	0.033	T	0.02358	-1.1171	10	0.35671	T	0.21	.	10.9009	0.47051	0.1449:0.0:0.8551:0.0	.	819	P53355	DAPK1_HUMAN	L	819	ENSP00000350785:V819L;ENSP00000417076:V819L;ENSP00000418885:V819L;ENSP00000386135:V819L	ENSP00000350785:V819L	V	+	1	0	DAPK1	89501783	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.560000	0.73950	2.854000	0.98071	0.655000	0.94253	GTG		0.398	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1		NM_004938	
DCLK2	166614	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	151169528	151169528	+	Silent	SNP	C	C	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr4:151169528C>A	ENST00000296550.7	+	14	2701	c.1947C>A	c.(1945-1947)ccC>ccA	p.P649P	DCLK2_ENST00000506325.1_Silent_p.P648P|DCLK2_ENST00000302176.8_Silent_p.P666P	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	649	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P649P(1)|p.P666P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TGAGTCACCCCTGGGTGTCAG	0.478																																					GBM(195;186 2215 13375 16801 37459)												2	Substitution - coding silent(2)	kidney(2)											100.0	96.0	97.0					4																	151169528		2203	4300	6503	SO:0001819	synonymous_variant	166614			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1947C>A	4.37:g.151169528C>A		Somatic		WXS	Illumina HiSeq	Phase_I	C9J5Q9|Q59GC8|Q8N399	Silent	SNP	ENST00000296550.7	37	CCDS34076.1																																																																																				0.478	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1		NM_001040260	
DENND1A	57706	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	126143757	126143757	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr9:126143757G>T	ENST00000373624.2	-	22	3185	c.2984C>A	c.(2983-2985)cCa>cAa	p.P995Q	DENND1A_ENST00000542603.1_Missense_Mutation_p.P780Q|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Missense_Mutation_p.P1006Q	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	995	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P995Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CACCGAGTCTGGGGCCGGGGC	0.652																																																	1	Substitution - Missense(1)	kidney(1)											39.0	48.0	45.0					9																	126143757		2203	4300	6503	SO:0001583	missense	57706			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.2984C>A	9.37:g.126143757G>T	ENSP00000362727:p.Pro995Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347411	0.24426	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219	T;T;T	0.21031	3.5;2.03;3.35	4.8	3.8	0.43715	.	0.099678	0.42964	D	0.000625	T	0.12518	0.0304	N	0.14661	0.345	0.80722	D	1	B;B;P;B	0.38250	0.013;0.013;0.624;0.025	B;B;B;B	0.34038	0.007;0.007;0.174;0.013	T	0.15723	-1.0427	10	0.33141	T	0.24	-0.4909	15.6467	0.77061	0.0:0.0:0.8532:0.1468	.	1006;996;995;858	Q8TEH3-6;Q8TEH3-7;Q8TEH3;Q9HCG4	.;.;DEN1A_HUMAN;.	Q	995;780;1006	ENSP00000362727:P995Q;ENSP00000437457:P780Q;ENSP00000377766:P1006Q	ENSP00000362727:P995Q	P	-	2	0	DENND1A	125183578	1.000000	0.71417	0.811000	0.32455	0.397000	0.30659	3.432000	0.52824	2.222000	0.72286	0.561000	0.74099	CCA		0.652	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1		NM_024820	
DNAH2	146754	broad.mit.edu;ucsc.edu	37	17	7721647	7721647	+	Missense_Mutation	SNP	C	C	T	rs529198153		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:7721647C>T	ENST00000572933.1	+	69	11865	c.10405C>T	c.(10405-10407)Cgc>Tgc	p.R3469C	DNAH2_ENST00000389173.2_Missense_Mutation_p.R3469C			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3469	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3469C(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCTGTTGATGCGCATTGGCGA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											206.0	183.0	191.0					17																	7721647		2203	4300	6503	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10405C>T	17.37:g.7721647C>T	ENSP00000458355:p.Arg3469Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	9.539	1.112980	0.20795	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.23950	1.88	5.0	4.02	0.46733	.	0.066251	0.64402	D	0.000014	T	0.49881	0.1583	M	0.87456	2.885	0.80722	D	1	B;D	0.76494	0.372;0.999	B;P	0.61722	0.032;0.893	T	0.57300	-0.7835	10	0.87932	D	0	.	10.2581	0.43410	0.152:0.701:0.147:0.0	.	3430;3469	Q9P225-2;Q9P225	.;DYH2_HUMAN	C	3430;3469	ENSP00000373825:R3469C	ENSP00000353818:R3430C	R	+	1	0	DNAH2	7662372	0.975000	0.34042	0.984000	0.44739	0.142000	0.21351	2.266000	0.43320	1.323000	0.45263	0.655000	0.94253	CGC		0.567	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1		NM_020877	
ESF1	51575	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	13695697	13695697	+	Missense_Mutation	SNP	C	C	T	rs555521056		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr20:13695697C>T	ENST00000202816.1	-	14	2487	c.2380G>A	c.(2380-2382)Gcc>Acc	p.A794T		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	794	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A794T(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						CTTTGCCGGGCCTTCTCCTCA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											176.0	169.0	172.0					20																	13695697		2203	4300	6503	SO:0001583	missense	51575				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.2380G>A	20.37:g.13695697C>T	ENSP00000202816:p.Ala794Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321144	0.81580	.	.	ENSG00000089048	ENST00000202816	T	0.68025	-0.3	6.05	6.05	0.98169	.	0.144836	0.44483	D	0.000450	T	0.64136	0.2571	L	0.60455	1.87	0.42344	D	0.992345	P	0.41366	0.747	B	0.37650	0.255	T	0.60954	-0.7160	10	0.14252	T	0.57	-3.0071	20.6013	0.99457	0.0:1.0:0.0:0.0	.	794	Q9H501	ESF1_HUMAN	T	794	ENSP00000202816:A794T	ENSP00000202816:A794T	A	-	1	0	ESF1	13643697	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.094000	0.57721	2.878000	0.98634	0.650000	0.86243	GCC		0.413	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1		NM_016649	
SUPT20H	55578	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	37593524	37593524	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr13:37593524delA	ENST00000350612.6	-	22	2047	c.1827delT	c.(1825-1827)tttfs	p.F609fs	SUPT20H_ENST00000356185.3_Frame_Shift_Del_p.F610fs|SUPT20H_ENST00000464744.1_Frame_Shift_Del_p.F610fs|SUPT20H_ENST00000475892.1_Frame_Shift_Del_p.F688fs|SUPT20H_ENST00000360252.4_Frame_Shift_Del_p.F610fs	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	609					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TTTTTAAACCAAATGGAACAC	0.254																																																	0													75.0	86.0	83.0					13																	37593524		2201	4294	6495	SO:0001589	frameshift_variant	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.1827delT	13.37:g.37593524delA	ENSP00000218894:p.Phe609fs	Somatic		WXS	Illumina HiSeq	Phase_I	E7ER46|Q71RF3|Q9Y6A6	Frame_Shift_Del	DEL	ENST00000350612.6	37	CCDS31959.1																																																																																				0.254	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1		NM_017569	
FGFR2	2263	broad.mit.edu;hgsc.bcm.edu	37	10	123353230	123353230	+	Silent	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr10:123353230C>T	ENST00000358487.5	-	2	374	c.102G>A	c.(100-102)gaG>gaA	p.E34E	FGFR2_ENST00000369056.1_Silent_p.E34E|FGFR2_ENST00000369061.4_Silent_p.E34E|FGFR2_ENST00000359354.2_Silent_p.E34E|FGFR2_ENST00000369059.1_Silent_p.E34E|FGFR2_ENST00000360144.3_Silent_p.E34E|FGFR2_ENST00000369060.4_Silent_p.E34E|FGFR2_ENST00000357555.5_Silent_p.E34E|FGFR2_ENST00000457416.2_Silent_p.E34E|FGFR2_ENST00000356226.4_Silent_p.E34E|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000351936.6_Silent_p.E34E|FGFR2_ENST00000346997.2_Silent_p.E34E	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	34	Ig-like C2-type 1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.E34E(4)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	TACCTTCTGGCTCTAATGTGG	0.483		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																															Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	4	Substitution - coding silent(4)	kidney(4)											95.0	85.0	88.0					10																	123353230		2203	4300	6503	SO:0001819	synonymous_variant	2263	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.102G>A	10.37:g.123353230C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	ENST00000358487.5	37	CCDS31298.1																																																																																				0.483	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1		NM_022976, NM_000141	
GJA1	2697	hgsc.bcm.edu	37	6	121768925	121768925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr6:121768925delC	ENST00000282561.3	+	2	1089	c.932delC	c.(931-933)gctfs	p.A311fs		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	311					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	CAAAACTGGGCTAATTACAGT	0.478																																																	0			GRCh37	CD073645	GJA1	D							72.0	73.0	73.0					6																	121768925		2203	4300	6503	SO:0001589	frameshift_variant	2697			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.932delC	6.37:g.121768925delC	ENSP00000282561:p.Ala311fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5U9|Q6FHU1|Q9Y5I8	Frame_Shift_Del	DEL	ENST00000282561.3	37	CCDS5123.1																																																																																				0.478	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1		NM_000165	
GRM3	2913	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	86468364	86468364	+	Missense_Mutation	SNP	C	C	A	rs17856664		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr7:86468364C>A	ENST00000361669.2	+	4	2633	c.1534C>A	c.(1534-1536)Ccc>Acc	p.P512T	GRM3_ENST00000536043.1_Missense_Mutation_p.P384T|GRM3_ENST00000546348.1_Missense_Mutation_p.P104T|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000394720.2_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	512				P -> A (in Ref. 4; AAH22496). {ECO:0000305}.	adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.P512T(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					GTGCAGCGACCCCTGTGCCCC	0.512																																					GBM(52;969 1098 3139 52280)												1	Substitution - Missense(1)	kidney(1)											90.0	83.0	86.0					7																	86468364		2203	4300	6503	SO:0001583	missense	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1534C>A	7.37:g.86468364C>A	ENSP00000355316:p.Pro512Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258930	0.80246	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.90133	-2.62;-2.62;-2.62	6.17	6.17	0.99709	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.95056	0.8399	M	0.66560	2.04	0.80722	D	1	P;D;D	0.71674	0.733;0.998;0.986	P;D;D	0.76071	0.569;0.987;0.971	D	0.94653	0.7841	10	0.87932	D	0	.	19.8676	0.96824	0.0:1.0:0.0:0.0	.	104;384;512	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	T	512;104;384	ENSP00000355316:P512T;ENSP00000444064:P104T;ENSP00000441407:P384T	ENSP00000355316:P512T	P	+	1	0	GRM3	86306300	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CCC		0.512	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			
HEPACAM2	253012	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	92844896	92844896	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr7:92844896A>G	ENST00000394468.2	-	3	610	c.533T>C	c.(532-534)cTa>cCa	p.L178P	HEPACAM2_ENST00000440868.1_Missense_Mutation_p.L166P|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.L201P|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.L166P	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	178	Ig-like C2-type 1.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)		p.L178P(1)|p.L166P(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TTGGTAAGCTAGCCGAGTGCC	0.522																																																	2	Substitution - Missense(2)	kidney(2)											119.0	112.0	114.0					7																	92844896		2203	4300	6503	SO:0001583	missense	253012			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.533T>C	7.37:g.92844896A>G	ENSP00000377980:p.Leu178Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	A	8.817	0.936548	0.18206	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.59	4.42	0.53409	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.184916	0.46758	D	0.000277	T	0.28797	0.0714	N	0.00985	-1.075	0.58432	D	0.999997	B;B;B;B	0.19331	0.035;0.023;0.009;0.003	B;B;B;B	0.18561	0.018;0.022;0.013;0.004	T	0.09796	-1.0658	10	0.42905	T	0.14	-3.048	13.0375	0.58881	0.8654:0.1346:0.0:0.0	.	201;166;178;166	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	P	178;166;166;201	ENSP00000377980:L178P;ENSP00000340532:L166P;ENSP00000389592:L166P;ENSP00000390204:L201P	ENSP00000340532:L166P	L	-	2	0	HEPACAM2	92682832	0.602000	0.26916	0.043000	0.18650	0.416000	0.31233	3.978000	0.56881	1.038000	0.40049	0.482000	0.46254	CTA		0.522	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1		NM_198151	
IRX5	10265	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	54966436	54966436	+	Silent	SNP	C	C	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr16:54966436C>A	ENST00000394636.4	+	2	613	c.276C>A	c.(274-276)ggC>ggA	p.G92G	CTD-3032H12.2_ENST00000560487.1_lincRNA|IRX5_ENST00000558597.1_Silent_p.G26G|IRX5_ENST00000320990.5_Silent_p.G92G|IRX5_ENST00000560154.1_Intron			P78411	IRX5_HUMAN	iroquois homeobox 5	92					embryonic cranial skeleton morphogenesis (GO:0048701)|gonad development (GO:0008406)|neuron maturation (GO:0042551)|regulation of heart rate (GO:0002027)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|vitamin D binding (GO:0005499)	p.G92G(1)		kidney(3)|large_intestine(6)|lung(4)|prostate(1)	14						ACACACCCGGCATGGCGGGCT	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											43.0	49.0	47.0					16																	54966436		2197	4300	6497	SO:0001819	synonymous_variant	10265			U90309	CCDS10751.1, CCDS58462.1	16q12.2	2011-06-20	2007-07-13		ENSG00000176842	ENSG00000176842		"""Homeoboxes / TALE class"""	14361	protein-coding gene	gene with protein product		606195					Standard	NM_005853		Approved	IRX-2a	uc002ehv.3	P78411	OTTHUMG00000133201	ENST00000394636.4:c.276C>A	16.37:g.54966436C>A		Somatic		WXS	Illumina HiSeq	Phase_I	H0YMS7|P78416|Q7Z2E1	Silent	SNP	ENST00000394636.4	37	CCDS10751.1																																																																																				0.652	IRX5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256911.2			
KIAA1614	57710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	180910371	180910371	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:180910371C>T	ENST00000367588.4	+	7	3164	c.3109C>T	c.(3109-3111)Cct>Tct	p.P1037S	KIAA1614_ENST00000367587.1_Missense_Mutation_p.P658S|KIAA1614_ENST00000461346.1_3'UTR|RP11-46A10.5_ENST00000358073.2_RNA	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	1037	Ser-rich.							p.P1037S(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GCCCGCCCCGCCTGGCCTGAC	0.662																																																	1	Substitution - Missense(1)	kidney(1)											32.0	38.0	36.0					1																	180910371		1944	4126	6070	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.3109C>T	1.37:g.180910371C>T	ENSP00000356560:p.Pro1037Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704565	0.48412	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.26067	2.32;1.76	4.97	3.06	0.35304	.	0.442345	0.23955	N	0.042904	T	0.22551	0.0544	M	0.64997	1.995	0.26061	N	0.981352	B;P	0.46912	0.291;0.886	B;B	0.40256	0.104;0.324	T	0.29181	-1.0020	9	0.32370	T	0.25	-4.7725	6.6478	0.22945	0.1772:0.7277:0.0:0.0951	.	658;1037	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	S	1037;658	ENSP00000356560:P1037S;ENSP00000356559:P658S	ENSP00000356559:P658S	P	+	1	0	KIAA1614	179176994	0.001000	0.12720	0.013000	0.15412	0.002000	0.02628	0.214000	0.17541	0.471000	0.27319	-0.310000	0.09108	CCT		0.662	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1		XM_046531	
KRT37	8688	broad.mit.edu;hgsc.bcm.edu	37	17	39579096	39579096	+	Silent	SNP	G	G	A	rs559004919		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:39579096G>A	ENST00000225550.3	-	3	665	c.666C>T	c.(664-666)gcC>gcT	p.A222A	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	222	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.A222A(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CCTCCAGGTCGGCCTTGGCCA	0.662													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18443	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											69.0	60.0	64.0					17																	39579096		2203	4300	6503	SO:0001819	synonymous_variant	8688			Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.666C>T	17.37:g.39579096G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000225550.3	37	CCDS32653.1																																																																																				0.662	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2		NM_003770	
KIF19	124602	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	72350319	72350319	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:72350319C>A	ENST00000389916.4	+	18	2465	c.2327C>A	c.(2326-2328)aCt>aAt	p.T776N	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	776					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.T776N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GAGATCCTGACTGGCACCAAG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											58.0	70.0	66.0					17																	72350319		2046	4188	6234	SO:0001583	missense	124602			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2327C>A	17.37:g.72350319C>A	ENSP00000374566:p.Thr776Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861418	0.32884	.	.	ENSG00000196169	ENST00000389916	T	0.70986	-0.53	5.06	4.09	0.47781	.	.	.	.	.	T	0.62684	0.2448	L	0.51422	1.61	0.09310	N	1	B	0.31125	0.309	B	0.22386	0.039	T	0.47058	-0.9146	9	0.18276	T	0.48	.	15.3735	0.74587	0.0:0.8597:0.1403:0.0	.	776	Q2TAC6	KIF19_HUMAN	N	776	ENSP00000374566:T776N	ENSP00000374566:T776N	T	+	2	0	KIF19	69861914	0.193000	0.23313	0.146000	0.22360	0.812000	0.45895	2.258000	0.43249	1.150000	0.42419	-0.232000	0.12228	ACT		0.662	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2		NM_153209	
LRRCC1	85444	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	86048083	86048083	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr8:86048083A>G	ENST00000360375.3	+	14	2363	c.2214A>G	c.(2212-2214)atA>atG	p.I738M	LRRCC1_ENST00000414626.2_Missense_Mutation_p.I718M	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	738					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I718M(1)|p.I738M(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						GTATTCAAATAGAACTTCTCA	0.313																																																	2	Substitution - Missense(2)	kidney(2)											77.0	76.0	76.0					8																	86048083		1826	4079	5905	SO:0001583	missense	85444			BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.2214A>G	8.37:g.86048083A>G	ENSP00000353538:p.Ile738Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.523786	0.44866	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.32988	1.43;1.43	5.91	2.07	0.26955	.	0.000000	0.45867	D	0.000327	T	0.40862	0.1134	L	0.53249	1.67	0.37285	D	0.908003	D;D;D;P	0.67145	0.993;0.993;0.996;0.575	D;P;D;B	0.64321	0.924;0.875;0.924;0.195	T	0.31833	-0.9929	10	0.40728	T	0.16	-25.4295	6.2433	0.20803	0.3905:0.2259:0.0:0.3836	.	645;718;645;738	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	M	738;718	ENSP00000353538:I738M;ENSP00000394695:I718M	ENSP00000353538:I738M	I	+	3	3	LRRCC1	86235335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.847000	0.27696	0.106000	0.17784	0.528000	0.53228	ATA		0.313	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1		NM_033402	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11217322	11217322	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:11217322T>A	ENST00000361445.4	-	30	4432	c.4356A>T	c.(4354-4356)aaA>aaT	p.K1452N		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1452	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.K1452N(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ACTCGTGCAGTTTCTCATACC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											131.0	105.0	114.0					1																	11217322		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4356A>T	1.37:g.11217322T>A	ENSP00000354558:p.Lys1452Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711551	0.68730	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.68624	-0.34	5.69	-4.66	0.03329	PIK-related kinase (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80539	0.4642	M	0.85299	2.745	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.83355	-0.0001	10	0.87932	D	0	-23.025	18.8169	0.92079	0.0:0.7585:0.0:0.2415	.	1452	P42345	MTOR_HUMAN	N	1452	ENSP00000354558:K1452N	ENSP00000354558:K1452N	K	-	3	2	MTOR	11139909	0.759000	0.28416	0.851000	0.33527	0.995000	0.86356	-0.074000	0.11450	-0.901000	0.03891	0.533000	0.62120	AAA		0.517	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
OSMR	9180	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	38921794	38921794	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr5:38921794A>G	ENST00000274276.3	+	12	2065	c.1663A>G	c.(1663-1665)Ata>Gta	p.I555V		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	555	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.I555V(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					TGGAGATGTTATAGGCTATGT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											234.0	212.0	219.0					5																	38921794		2203	4300	6503	SO:0001583	missense	9180			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1663A>G	5.37:g.38921794A>G	ENSP00000274276:p.Ile555Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	A	4.019	0.000927	0.07819	.	.	ENSG00000145623	ENST00000274276	T	0.55760	0.5	5.14	-5.77	0.02369	Long hematopoietin receptor, Gp130 family 2, conserved site (1);Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.135170	0.06098	N	0.664870	T	0.24470	0.0593	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18116	-1.0347	10	0.29301	T	0.29	.	7.9416	0.29961	0.2511:0.2748:0.4741:0.0	.	555	Q99650	OSMR_HUMAN	V	555	ENSP00000274276:I555V	ENSP00000274276:I555V	I	+	1	0	OSMR	38957551	0.000000	0.05858	0.000000	0.03702	0.342000	0.28953	-2.061000	0.01391	-0.982000	0.03515	-0.280000	0.10049	ATA		0.458	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2		NM_003999	
PDCD6IP	10015	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	33855050	33855050	+	Splice_Site	SNP	G	G	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr3:33855050G>A	ENST00000307296.3	+	3	641		c.e3-1		PDCD6IP_ENST00000457054.2_Splice_Site|PDCD6IP_ENST00000498147.1_Splice_Site			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein						apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)	p.?(1)		central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						ATTCTATCCAGATCTGCTTGA	0.323																																																	1	Unknown(1)	kidney(1)											148.0	150.0	149.0					3																	33855050		2203	4300	6503	SO:0001630	splice_region_variant	10015			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.265-1G>A	3.37:g.33855050G>A		Somatic		WXS	Illumina HiSeq	Phase_I	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Splice_Site	SNP	ENST00000307296.3	37	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281069	0.80692	.	.	ENSG00000170248	ENST00000307296;ENST00000457054	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.965	0.92692	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDCD6IP	33830054	1.000000	0.71417	0.995000	0.50966	0.972000	0.66771	9.291000	0.96070	2.487000	0.83934	0.563000	0.77884	.		0.323	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2			Intron
PLCE1	51196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	96058297	96058298	+	Frame_Shift_Ins	INS	-	-	C	rs3765524	byFrequency	TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr10:96058297_96058298insC	ENST00000371380.3	+	23	5564_5565	c.5329_5330insC	c.(5329-5331)accfs	p.T1777fs	PLCE1_ENST00000371375.1_Frame_Shift_Ins_p.T1469fs|PLCE1_ENST00000371385.3_Frame_Shift_Ins_p.T1469fs|PLCE1_ENST00000260766.3_Frame_Shift_Ins_p.T1777fs			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1777	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.		T -> I (in dbSNP:rs3765524). {ECO:0000269|PubMed:11022048, ECO:0000269|Ref.8}.		activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCAGAAACTGACCCAGCACACC	0.525																																																	0																																										SO:0001589	frameshift_variant	51196				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.5332dupC	10.37:g.96058300_96058300dupC	ENSP00000360431:p.Thr1777fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Frame_Shift_Ins	INS	ENST00000371380.3	37	CCDS41552.1																																																																																				0.525	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3		NM_016341	
PRKCA	5578	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	64731699	64731699	+	Silent	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:64731699C>T	ENST00000413366.3	+	10	1175	c.1149C>T	c.(1147-1149)tgC>tgT	p.C383C		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	383	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.C383C(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	ACGTGGAGTGCACCATGGTAG	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											247.0	200.0	216.0					17																	64731699		2203	4300	6503	SO:0001819	synonymous_variant	5578				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1149C>T	17.37:g.64731699C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	ENST00000413366.3	37	CCDS11664.1																																																																																				0.522	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			
PRRC2A	7916	broad.mit.edu;hgsc.bcm.edu	37	6	31593611	31593611	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr6:31593611C>T	ENST00000376033.2	+	8	1036	c.802C>T	c.(802-804)Cag>Tag	p.Q268*	PRRC2A_ENST00000376007.4_Nonsense_Mutation_p.Q268*|SNORA38_ENST00000363946.1_RNA|PRRC2A_ENST00000469577.1_3'UTR	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	268	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Q268*(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CTATGGACCCCAGGGGCCTTA	0.582																																																	1	Substitution - Nonsense(1)	kidney(1)											75.0	67.0	70.0					6																	31593611		1511	2709	4220	SO:0001587	stop_gained	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.802C>T	6.37:g.31593611C>T	ENSP00000365201:p.Gln268*	Somatic		WXS	Illumina HiSeq	Phase_I	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Nonsense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	40	8.146706	0.98675	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	.	.	.	4.98	4.98	0.66077	.	0.000000	0.47852	D	0.000217	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.2448	17.1913	0.86880	0.0:1.0:0.0:0.0	.	.	.	.	X	268	.	ENSP00000365175:Q268X	Q	+	1	0	PRRC2A	31701590	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.665000	0.61547	2.605000	0.88082	0.655000	0.94253	CAG		0.582	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1		NM_080686	
PZP	5858	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	9322148	9322148	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr12:9322148G>A	ENST00000261336.2	-	16	1907	c.1879C>T	c.(1879-1881)Cct>Tct	p.P627S	PZP_ENST00000381997.2_Missense_Mutation_p.P496S|PZP_ENST00000539983.1_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	627					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.P496S(1)|p.P627S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ACATTGTCAGGAAAATTGGTG	0.418																																					Melanoma(125;1402 1695 4685 34487 38571)												2	Substitution - Missense(2)	kidney(2)											91.0	83.0	86.0					12																	9322148		2203	4300	6503	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1879C>T	12.37:g.9322148G>A	ENSP00000261336:p.Pro627Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	G	8.763	0.923987	0.18056	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.35789	1.5;1.29	3.34	1.4	0.22301	.	0.792994	0.10706	U	0.643461	T	0.23330	0.0564	N	0.25380	0.74	0.09310	N	1	B;B	0.21452	0.056;0.049	B;B	0.30251	0.113;0.016	T	0.34875	-0.9811	10	0.22109	T	0.4	.	4.3382	0.11097	0.1296:0.0:0.6466:0.2238	.	496;627	P20742-2;P20742	.;PZP_HUMAN	S	627;496	ENSP00000261336:P627S;ENSP00000371427:P496S	ENSP00000261336:P627S	P	-	1	0	PZP	9213415	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.000000	0.12993	0.199000	0.20427	0.563000	0.77884	CCT		0.418	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1		NM_002864	
RAPGEFL1	51195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	38340547	38340547	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:38340547G>C	ENST00000456989.2	+	3	274	c.228G>C	c.(226-228)ttG>ttC	p.L76F	RAPGEFL1_ENST00000544503.1_Missense_Mutation_p.L70F|RAPGEFL1_ENST00000540388.1_3'UTR|RAPGEFL1_ENST00000436615.3_Missense_Mutation_p.L21F|RAPGEFL1_ENST00000264644.6_Missense_Mutation_p.L21F			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	227	Gly-rich.				G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.L21F(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						TCCATTTCTTGGACACCTACC	0.572																																					Esophageal Squamous(28;274 750 6870 14218 42203)												1	Substitution - Missense(1)	kidney(1)											90.0	103.0	99.0					17																	38340547		2203	4300	6503	SO:0001583	missense	51195			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.228G>C	17.37:g.38340547G>C	ENSP00000394530:p.Leu76Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000456989.2	37		.	.	.	.	.	.	.	.	.	.	G	29.8	5.036712	0.93630	.	.	ENSG00000108352	ENST00000456989;ENST00000543876;ENST00000544503;ENST00000537255;ENST00000264644;ENST00000436615;ENST00000541245;ENST00000538981	T;T;T;T;T;T;T	0.59772	1.35;0.99;1.35;0.24;1.35;1.35;0.99	5.47	5.47	0.80525	Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.51477	D	0.000098	T	0.66066	0.2752	L	0.27053	0.805	0.53688	D	0.999979	D	0.71674	0.998	D	0.83275	0.996	T	0.68938	-0.5277	10	0.62326	D	0.03	.	16.8079	0.85710	0.0:0.0:1.0:0.0	.	227	Q9UHV5	RPGFL_HUMAN	F	76;21;70;21;226;21;58;21	ENSP00000394530:L76F;ENSP00000440226:L21F;ENSP00000438631:L70F;ENSP00000264644:L226F;ENSP00000408322:L21F;ENSP00000444646:L58F;ENSP00000441059:L21F	ENSP00000264644:L226F	L	+	3	2	RAPGEFL1	35594073	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.581000	0.46077	2.549000	0.85964	0.655000	0.94253	TTG		0.572	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000397518.1		NM_016339	
REXO1	57455	hgsc.bcm.edu	37	19	1825928	1825930	+	In_Frame_Del	DEL	CTC	CTC	-	rs149465929|rs75443592|rs199696044	byFrequency	TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr19:1825928_1825930delCTC	ENST00000170168.4	-	3	2018_2020	c.1924_1926delGAG	c.(1924-1926)gagdel	p.E642del	CTB-31O20.4_ENST00000593201.1_RNA|REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000590531.1_RNA|CTB-31O20.4_ENST00000587741.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	642						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCACTCTTCTCTTCCTTGGGG	0.606														1503	0.30012	0.2844	0.4135	5008	,	,		15520	0.3829		0.2087	False		,,,				2504	0.2495																0										1300,2964		203,894,1035						3.2	0.0		dbSNP_106	100	1727,6527		175,1377,2575	no	coding	REXO1	NM_020695.3		378,2271,3610	A1A1,A1R,RR		20.9232,30.4878,24.1812				3027,9491				SO:0001651	inframe_deletion	57455			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1924_1926delGAG	19.37:g.1825928_1825930delCTC	ENSP00000170168:p.Glu642del	Somatic		WXS	Illumina HiSeq	Phase_I	Q9ULT2	In_Frame_Del	DEL	ENST00000170168.4	37	CCDS32866.1																																																																																				0.606	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1		NM_020695	
RPS18	6222	broad.mit.edu;hgsc.bcm.edu	37	6	33240437	33240437	+	Silent	SNP	T	T	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr6:33240437T>C	ENST00000439602.2	+	2	146	c.36T>C	c.(34-36)atT>atC	p.I12I	VPS52_ENST00000445902.2_5'Flank|VPS52_ENST00000482399.1_5'Flank|RPS18_ENST00000474973.1_5'UTR|VPS52_ENST00000478934.1_5'Flank|VPS52_ENST00000436044.2_5'Flank|RPS18_ENST00000476222.1_3'UTR			P62269	RS18_HUMAN	ribosomal protein S18	12					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribosome (GO:0005840)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.I12I(1)		kidney(2)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	9						TCCAGCATATTTTGCGAGTAC	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											126.0	135.0	132.0					6																	33240437		2203	4300	6503	SO:0001819	synonymous_variant	6222			X69150	CCDS4771.1	6p21.3	2011-04-05			ENSG00000231500	ENSG00000231500		"""S ribosomal proteins"""	10401	protein-coding gene	gene with protein product		180473		D6S218E		8441687, 9582194	Standard	NM_022551		Approved	KE3, KE-3, HKE3, S18	uc003odp.1	P62269	OTTHUMG00000031053	ENST00000439602.2:c.36T>C	6.37:g.33240437T>C		Somatic		WXS	Illumina HiSeq	Phase_I	P25232|Q5SUJ3|Q6IPF8	Silent	SNP	ENST00000439602.2	37	CCDS4771.1																																																																																				0.433	RPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076059.2			
RYR3	6263	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	34129174	34129174	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr15:34129174T>C	ENST00000389232.4	+	88	11706	c.11636T>C	c.(11635-11637)cTg>cCg	p.L3879P	RYR3_ENST00000415757.3_Missense_Mutation_p.L3874P	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3879					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.L3878P(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTGATGCTTCTGTCCCTCCTG	0.473																																																	1	Substitution - Missense(1)	kidney(1)											140.0	136.0	137.0					15																	34129174		2076	4231	6307	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11636T>C	15.37:g.34129174T>C	ENSP00000373884:p.Leu3879Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204182	0.58234	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	T	0.78003	-1.14	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000012	D	0.87176	0.6112	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.88639	0.3174	10	0.87932	D	0	.	15.4836	0.75548	0.0:0.0:0.0:1.0	.	3874;3879	Q15413-2;Q15413	.;RYR3_HUMAN	P	3879;3875	ENSP00000373884:L3879P	ENSP00000354735:L3875P	L	+	2	0	RYR3	31916466	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.769000	0.85360	2.243000	0.73865	0.519000	0.50382	CTG		0.473	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			
RYR3	6263	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	34130917	34130917	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr15:34130917G>A	ENST00000389232.4	+	89	12806	c.12736G>A	c.(12736-12738)Gac>Aac	p.D4246N	RYR3_ENST00000415757.3_Missense_Mutation_p.D4241N	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4246					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.D4245N(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TATCCATGATGACACTATGGA	0.507																																																	1	Substitution - Missense(1)	kidney(1)											55.0	57.0	56.0					15																	34130917		2024	4186	6210	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.12736G>A	15.37:g.34130917G>A	ENSP00000373884:p.Asp4246Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934705	0.73442	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.94576	-3.46	5.44	5.44	0.79542	Ryanodine Receptor TM 4-6 (1);	0.000000	0.85682	D	0.000000	D	0.96667	0.8912	M	0.64404	1.975	0.80722	D	1	D;D	0.71674	0.998;0.987	D;P	0.81914	0.995;0.9	D	0.95886	0.8903	10	0.39692	T	0.17	.	19.2631	0.93975	0.0:0.0:1.0:0.0	.	4241;4246	Q15413-2;Q15413	.;RYR3_HUMAN	N	4246;4242	ENSP00000373884:D4246N	ENSP00000354735:D4242N	D	+	1	0	RYR3	31918209	1.000000	0.71417	0.990000	0.47175	0.807000	0.45602	9.807000	0.99171	2.549000	0.85964	0.655000	0.94253	GAC		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			
SH2D1B	117157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	162368719	162368719	+	Silent	SNP	T	T	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:162368719T>G	ENST00000367929.2	-	3	466	c.357A>C	c.(355-357)acA>acC	p.T119T	SH2D1B_ENST00000359567.3_Intron	NM_053282.4	NP_444512.2	O14796	SH21B_HUMAN	SH2 domain containing 1B	119					leukocyte activation involved in immune response (GO:0002366)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of innate immune response (GO:0045089)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of natural killer cell activation (GO:0032814)	intracellular (GO:0005622)	protein binding, bridging (GO:0030674)	p.T119T(1)		kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TTACCACAAATGTTTCCAACT	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											83.0	80.0	81.0					1																	162368719		2203	4300	6503	SO:0001819	synonymous_variant	117157			AF484964	CCDS30928.1	1q23.3	2013-02-14			ENSG00000198574	ENSG00000198574		"""SH2 domain containing"""	30416	protein-coding gene	gene with protein product		608510				9000139, 11689425	Standard	NM_053282		Approved	EAT2	uc001gbz.1	O14796	OTTHUMG00000031377	ENST00000367929.2:c.357A>C	1.37:g.162368719T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RBN6|Q5T0L1|Q8NI18|Q969K9	Silent	SNP	ENST00000367929.2	37	CCDS30928.1																																																																																				0.398	SH2D1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076794.1		NM_053282	
SLA2	84174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	35261962	35261962	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr20:35261962delC	ENST00000262866.4	-	4	684	c.262delG	c.(262-264)gccfs	p.A88fs	SLA2_ENST00000360672.2_Frame_Shift_Del_p.A88fs	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	88	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GAGACTTTGGCCACGTGGACG	0.597																																					Ovarian(59;720 1165 26994 46188 51693)												0													127.0	110.0	115.0					20																	35261962		2203	4300	6503	SO:0001589	frameshift_variant	84174			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.262delG	20.37:g.35261962delC	ENSP00000262866:p.Ala88fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Frame_Shift_Del	DEL	ENST00000262866.4	37	CCDS13282.1																																																																																				0.597	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079037.2		NM_175077	
SSH2	85464	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	27959837	27959837	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:27959837T>C	ENST00000269033.3	-	15	2445	c.2294A>G	c.(2293-2295)cAg>cGg	p.Q765R	SSH2_ENST00000540801.1_Missense_Mutation_p.Q792R|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	765					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Q765R(1)	SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGTTGAATCTGCCCAACTCC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											88.0	77.0	81.0					17																	27959837		2203	4300	6503	SO:0001583	missense	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.2294A>G	17.37:g.27959837T>C	ENSP00000269033:p.Gln765Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.102247	0.76983	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.35048	1.33;1.33	5.78	5.78	0.91487	.	0.234226	0.38492	N	0.001667	T	0.51075	0.1653	M	0.64997	1.995	0.80722	D	1	D;D	0.63046	0.992;0.986	P;P	0.57009	0.811;0.651	T	0.53493	-0.8431	10	0.66056	D	0.02	-12.0362	13.0748	0.59081	0.0:0.0:0.1424:0.8576	.	792;765	F5H527;Q76I76	.;SSH2_HUMAN	R	765;792	ENSP00000269033:Q765R;ENSP00000444743:Q792R	ENSP00000269033:Q765R	Q	-	2	0	SSH2	24983963	0.997000	0.39634	1.000000	0.80357	0.980000	0.70556	1.734000	0.38166	2.333000	0.79357	0.533000	0.62120	CAG		0.473	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1		NM_033389	
SUCLG2	8801	broad.mit.edu;hgsc.bcm.edu	37	3	67578587	67578587	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr3:67578587T>C	ENST00000307227.5	-	4	413	c.386A>G	c.(385-387)cAa>cGa	p.Q129R	SUCLG2_ENST00000493112.1_Missense_Mutation_p.Q129R|SUCLG2_ENST00000492795.1_Missense_Mutation_p.Q129R	NM_003848.3	NP_003839.2	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	129	ATP-grasp.				cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)	p.Q129R(1)|p.Q81R(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	TTTTGGAGTTTGTTTTGTCGC	0.348																																																	2	Substitution - Missense(2)	kidney(2)											119.0	105.0	109.0					3																	67578587		1836	4082	5918	SO:0001583	missense	8801			AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000307227.5:c.386A>G	3.37:g.67578587T>C	ENSP00000307432:p.Gln129Arg	Somatic		WXS	Illumina HiSeq	Phase_I	C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	ENST00000307227.5	37	CCDS43104.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772120	0.90108	.	.	ENSG00000172340	ENST00000493112;ENST00000307227;ENST00000541608;ENST00000492795	T;T;T	0.73152	-0.72;-0.72;-0.72	5.95	5.95	0.96441	ATP-grasp fold, subdomain 1 (1);ATP-grasp fold, succinyl-CoA synthetase-type (1);	0.000000	0.85682	D	0.000000	D	0.89068	0.6610	H	0.95816	3.725	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	D	0.92170	0.5743	10	0.87932	D	0	.	16.4219	0.83766	0.0:0.0:0.0:1.0	.	81;129	F5H4S7;Q96I99	.;SUCB2_HUMAN	R	129;129;81;129	ENSP00000419325:Q129R;ENSP00000307432:Q129R;ENSP00000417589:Q129R	ENSP00000307432:Q129R	Q	-	2	0	SUCLG2	67661277	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.841000	0.86834	2.277000	0.76020	0.528000	0.53228	CAA		0.348	SUCLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351993.1		NM_003848	
THOC5	8563	hgsc.bcm.edu;ucsc.edu	37	22	29914993	29914997	+	Splice_Site	DEL	ACCTA	ACCTA	-			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	ACCTA	ACCTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr22:29914993_29914997delACCTA	ENST00000490103.1	-	15	1609_1612	c.1487_1490delTAGGT	c.(1486-1491)ctaggt>ct	p.LG496fs	THOC5_ENST00000397873.2_Splice_Site_p.LG496fs|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397872.1_Splice_Site_p.LG496fs|THOC5_ENST00000397871.1_Splice_Site_p.LG496fs	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	496					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCATCAGCTTACCTAGGGATGCAAA	0.507																																																	0																																										SO:0001630	splice_region_variant	8563			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1489+1TAGGT>-	22.37:g.29914993_29914997delACCTA		Somatic		WXS	Illumina HiSeq	Phase_I	O60839|Q9UPZ5	Frame_Shift_Del	DEL	ENST00000490103.1	37	CCDS13859.1																																																																																				0.507	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1		NM_003678	Frame_Shift_Del
TRAPPC6A	79090	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	45666460	45666460	+	Missense_Mutation	SNP	G	G	A	rs146982912		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr19:45666460G>A	ENST00000585934.1	-	6	488	c.470C>T	c.(469-471)cCg>cTg	p.P157L	TRAPPC6A_ENST00000592647.1_3'UTR|TRAPPC6A_ENST00000588062.1_3'UTR|TRAPPC6A_ENST00000006275.4_Missense_Mutation_p.P171L	NM_001270891.1	NP_001257820.1	O75865	TPC6A_HUMAN	trafficking protein particle complex 6A	157					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)		p.P171L(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	8		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00872)|GBM - Glioblastoma multiforme(486;0.233)		TTAGGATTTCGGAATCACCAC	0.637																																																	1	Substitution - Missense(1)	kidney(1)							LEU/PRO	2,4404	4.2+/-10.8	0,2,2201	105.0	82.0	90.0		512	0.5	0.5	19	dbSNP_134	90	0,8600		0,0,4300	no	missense	TRAPPC6A	NM_024108.1	98	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	171/174	45666460	2,13004	2203	4300	6503	SO:0001583	missense	79090			AF161407	CCDS12655.1, CCDS59395.1, CCDS59396.1, CCDS59397.1	19q13.32	2012-10-02				ENSG00000007255		"""Trafficking protein particle complex"""	23069	protein-coding gene	gene with protein product		610396					Standard	NM_024108		Approved	TRS33, MGC2650, HSPC289	uc002pav.4	O75865		ENST00000585934.1:c.470C>T	19.37:g.45666460G>A	ENSP00000468612:p.Pro157Leu	Somatic		WXS	Illumina HiSeq	Phase_I	K7ERB1|K7ERQ4|Q9BQ45|Q9P092	Missense_Mutation	SNP	ENST00000585934.1	37	CCDS59397.1	.	.	.	.	.	.	.	.	.	.	g	7.357	0.624024	0.14193	4.54E-4	0.0	ENSG00000007255	ENST00000006275	T	0.39056	1.1	5.2	0.531	0.17108	NO signalling/Golgi transport  ligand-binding domain (1);	0.379950	0.26646	N	0.023232	T	0.20088	0.0483	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07252	-1.0782	10	0.35671	T	0.21	-4.2755	1.0595	0.01597	0.149:0.1752:0.1605:0.5153	.	157;171	O75865;O75865-2	TPC6A_HUMAN;.	L	171	ENSP00000006275:P171L	ENSP00000006275:P171L	P	-	2	0	TRAPPC6A	50358300	1.000000	0.71417	0.536000	0.28039	0.035000	0.12851	0.434000	0.21494	-0.264000	0.09365	-1.520000	0.00934	CCG		0.637	TRAPPC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457556.1		NM_024108	
TUBAL3	79861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	5435755	5435755	+	Missense_Mutation	SNP	T	T	C	rs181652174		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr10:5435755T>C	ENST00000380419.3	-	4	1103	c.1066A>G	c.(1066-1068)Act>Gct	p.T356A	TUBAL3_ENST00000479328.1_Missense_Mutation_p.T316A	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	356					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T356A(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						TTGAAACCAGTTGGACACCAA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											85.0	78.0	80.0					10																	5435755		2203	4300	6503	SO:0001583	missense	79861			AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.1066A>G	10.37:g.5435755T>C	ENSP00000369784:p.Thr356Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	SNP	ENST00000380419.3	37	CCDS7066.2	.	.	.	.	.	.	.	.	.	.	T	14.56	2.570685	0.45798	.	.	ENSG00000178462	ENST00000380419;ENST00000479328	D;D	0.84370	-1.84;-1.84	4.41	3.26	0.37387	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.114770	0.40144	N	0.001170	D	0.94195	0.8137	H	0.97659	4.05	0.42341	D	0.992332	D;B	0.76494	0.999;0.229	D;B	0.79784	0.993;0.07	D	0.93875	0.7166	10	0.87932	D	0	.	9.3858	0.38342	0.0:0.0881:0.0:0.9119	.	316;356	A6NHL2-2;A6NHL2	.;TBAL3_HUMAN	A	356;316	ENSP00000369784:T356A;ENSP00000418799:T316A	ENSP00000369784:T356A	T	-	1	0	TUBAL3	5425755	1.000000	0.71417	0.990000	0.47175	0.058000	0.15608	6.178000	0.71968	0.805000	0.34159	0.528000	0.53228	ACT		0.567	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046548.2		NM_024803	
UBE2D1	7321	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	60128479	60128479	+	Splice_Site	SNP	G	G	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr10:60128479G>T	ENST00000373910.4	+	7	625		c.e7-1			NM_001204880.1|NM_003338.4	NP_001191809.1|NP_003329.1	P51668	UB2D1_HUMAN	ubiquitin-conjugating enzyme E2D 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|BMP signaling pathway (GO:0030509)|cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|prostate(1)|skin(2)	10						TGTATCTACAGATACAACAGA	0.264																																																	1	Unknown(1)	kidney(1)											67.0	68.0	68.0					10																	60128479		2202	4295	6497	SO:0001630	splice_region_variant	7321			BC015997	CCDS7252.1, CCDS73139.1	10q21.1	2011-05-19	2011-05-19		ENSG00000072401	ENSG00000072401		"""Ubiquitin-conjugating enzymes E2"""	12474	protein-coding gene	gene with protein product		602961	"""stimulator of Fe transport"", ""ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)"""	SFT		10072594, 8530467	Standard	NM_003338		Approved	UbcH5A, UBCH5, UBC4/5, E2(17)KB1	uc001jke.2	P51668	OTTHUMG00000018269	ENST00000373910.4:c.399-1G>T	10.37:g.60128479G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NLF6|A8K786	Splice_Site	SNP	ENST00000373910.4	37	CCDS7252.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031721	0.54790	.	.	ENSG00000072401	ENST00000373910	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3704	0.87376	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE2D1	59798485	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.790000	0.99075	2.695000	0.91970	0.650000	0.86243	.		0.264	UBE2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048143.2		NM_003338	Intron
USP48	84196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	22079531	22079531	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:22079531G>T	ENST00000308271.9	-	4	1142	c.494C>A	c.(493-495)cCa>cAa	p.P165Q	USP48_ENST00000400301.1_Missense_Mutation_p.P165Q|USP48_ENST00000421625.2_Missense_Mutation_p.P165Q|USP48_ENST00000529637.1_Missense_Mutation_p.P165Q	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	165	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.P165Q(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		AAATCCTGATGGATCAATGTA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											84.0	85.0	84.0					1																	22079531		2203	4300	6503	SO:0001583	missense	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.494C>A	1.37:g.22079531G>T	ENSP00000309262:p.Pro165Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927690	0.92389	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625;ENST00000527823;ENST00000532737	T;T;T;T;T;T	0.80033	2.95;2.95;2.95;2.95;-0.88;-1.33	5.91	5.91	0.95273	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.92482	0.7613	M	0.92738	3.34	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.997;0.996;1.0;1.0;1.0	D	0.93518	0.6859	10	0.87932	D	0	.	18.8601	0.92268	0.0:0.0:1.0:0.0	.	165;165;165;165;165;165	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	Q	165;165;165;165;38;38	ENSP00000383157:P165Q;ENSP00000309262:P165Q;ENSP00000431949:P165Q;ENSP00000406256:P165Q;ENSP00000434073:P38Q;ENSP00000435612:P38Q	ENSP00000309262:P165Q	P	-	2	0	USP48	21952118	1.000000	0.71417	0.997000	0.53966	0.874000	0.50279	9.382000	0.97209	2.813000	0.96785	0.655000	0.94253	CCA		0.353	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1		NM_032236	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191570	10191570	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr3:10191570T>C	ENST00000256474.2	+	3	1403	c.563T>C	c.(562-564)cTg>cCg	p.L188P	VHL_ENST00000345392.2_Missense_Mutation_p.L147P|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	188			L -> P (in VHLD; type I-II). {ECO:0000269|PubMed:9829912}.|L -> Q (in VHLD; type I). {ECO:0000269|PubMed:8956040}.|L -> V (in ECYT2, pheochromocytoma and VHLD; type IIA; dbSNP:rs5030824). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:12844285}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L188P(4)|p.L188fs*14(2)|p.L188Q(2)|p.D187_L188del(2)|p.L188R(2)|p.D187_N193del(1)|p.E189fs*27(1)|p.Y185fs*11(1)|p.D187fs*14(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TACGAAGATCTGGAAGACCAC	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	16	Substitution - Missense(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Insertion - Frameshift(1)	kidney(16)	GRCh37	CD962181|CM951299|CM982013	VHL	D|M							76.0	69.0	72.0					3																	10191570		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.563T>C	3.37:g.10191570T>C	ENSP00000256474:p.Leu188Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.312357	0.81358	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99878	-7.42;-7.42	4.97	4.97	0.65823	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.64402	D	0.000002	D	0.99799	0.9914	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96566	0.9419	10	0.87932	D	0	-7.586	12.9354	0.58311	0.0:0.0:0.0:1.0	.	147;188	P40337-2;P40337	.;VHL_HUMAN	P	188;147;106	ENSP00000256474:L188P;ENSP00000344757:L147P	ENSP00000256474:L188P	L	+	2	0	VHL	10166570	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.790000	0.69038	2.209000	0.71365	0.533000	0.62120	CTG		0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS8	23355	broad.mit.edu;ucsc.edu	37	3	184633149	184633149	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr3:184633149G>A	ENST00000437079.3	+	28	2440	c.2269G>A	c.(2269-2271)Gaa>Aaa	p.E757K	VPS8_ENST00000446204.2_Missense_Mutation_p.E665K|VPS8_ENST00000436792.2_Missense_Mutation_p.E755K|VPS8_ENST00000287546.4_Missense_Mutation_p.E757K	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	757							zinc ion binding (GO:0008270)	p.E757K(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GCAGGTTTTTGAATTTCTAAT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											52.0	48.0	49.0					3																	184633149		1794	4078	5872	SO:0001583	missense	23355			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2269G>A	3.37:g.184633149G>A	ENSP00000397879:p.Glu757Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881830	0.72294	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.18338	2.22;2.22;2.22;2.25	6.0	6.0	0.97389	Quinonprotein alcohol dehydrogenase-like (1);	0.141180	0.64402	D	0.000006	T	0.18551	0.0445	L	0.38531	1.155	0.80722	D	1	P;P;P	0.45176	0.852;0.694;0.822	B;B;B	0.42462	0.388;0.19;0.269	T	0.01762	-1.1279	10	0.18710	T	0.47	-20.1271	20.105	0.97888	0.0:0.0:1.0:0.0	.	757;665;755	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	K	757;757;755;665	ENSP00000287546:E757K;ENSP00000397879:E757K;ENSP00000404704:E755K;ENSP00000405483:E665K	ENSP00000287546:E757K	E	+	1	0	VPS8	186115843	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.179000	0.94861	2.846000	0.97976	0.650000	0.86243	GAA		0.368	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_015303	
ZNF233	353355	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44777290	44777290	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr19:44777290A>G	ENST00000391958.2	+	5	604	c.477A>G	c.(475-477)atA>atG	p.I159M	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Intron|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I159M(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				ACTATGTAATAAAGCTACAAG	0.433																																																	1	Substitution - Missense(1)	kidney(1)											55.0	58.0	57.0					19																	44777290		2202	4299	6501	SO:0001583	missense	353355			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.477A>G	19.37:g.44777290A>G	ENSP00000375820:p.Ile159Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	ENST00000391958.2	37	CCDS33047.1	.	.	.	.	.	.	.	.	.	.	A	2.861	-0.236074	0.05944	.	.	ENSG00000159915	ENST00000391958;ENST00000544563;ENST00000280305	T	0.04654	3.58	2.73	-4.84	0.03151	.	.	.	.	.	T	0.01156	0.0038	N	0.00707	-1.245	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44267	-0.9339	9	0.27082	T	0.32	1.3706	1.8339	0.03135	0.4717:0.1311:0.2675:0.1297	.	159	A6NK53	ZN233_HUMAN	M	159;80;80	ENSP00000375820:I159M	ENSP00000280305:I80M	I	+	3	3	ZNF233	49469130	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.011000	0.03652	-1.474000	0.01879	-0.476000	0.04901	ATA		0.433	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1		NM_181756	
CA14	23632	broad.mit.edu	37	1	150234002	150234002	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr1:150234002C>A	ENST00000369111.4	+	3	1191	c.221C>A	c.(220-222)aCc>aAc	p.T74N	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	74					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)	p.T74N(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	CAGCCTGGCACCGAGCCTTTG	0.527																																																	1	Substitution - Missense(1)	kidney(1)											100.0	77.0	85.0					1																	150234002		2203	4300	6503	SO:0001583	missense	23632			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.221C>A	1.37:g.150234002C>A	ENSP00000358107:p.Thr74Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q5TB24|Q8NCF4	Missense_Mutation	SNP	ENST00000369111.4	37	CCDS947.1	.	.	.	.	.	.	.	.	.	.	C	6.475	0.455741	0.12283	.	.	ENSG00000118298	ENST00000369111	T	0.67171	-0.25	5.71	4.8	0.61643	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.288956	0.38005	N	0.001860	T	0.24812	0.0602	N	0.22421	0.69	0.25298	N	0.989309	B	0.10296	0.003	B	0.15052	0.012	T	0.11941	-1.0567	10	0.10902	T	0.67	.	7.6447	0.28312	0.1621:0.7551:0.0:0.0828	.	74	Q9ULX7	CAH14_HUMAN	N	74	ENSP00000358107:T74N	ENSP00000358107:T74N	T	+	2	0	CA14	148500626	0.003000	0.15002	0.796000	0.32109	0.946000	0.59487	1.049000	0.30392	1.428000	0.47296	0.563000	0.77884	ACC		0.527	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035064.2		NM_012113	
CPNE7	27132	broad.mit.edu	37	16	89657660	89657660	+	Frame_Shift_Del	DEL	A	A	-	rs35731090	byFrequency	TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr16:89657660delA	ENST00000268720.5	+	15	1649	c.1519delA	c.(1519-1521)aaafs	p.K507fs	CPNE7_ENST00000319518.8_Frame_Shift_Del_p.K432fs	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	507	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.		K -> E (in dbSNP:rs35731090).		lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		GAGCACCGGGAAAGCCTCTGT	0.687																																																	0													14.0	17.0	16.0					16																	89657660		2178	4288	6466	SO:0001589	frameshift_variant	27132			AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.1519delA	16.37:g.89657660delA	ENSP00000268720:p.Lys507fs	Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000268720.5	37	CCDS10980.1																																																																																				0.687	CPNE7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269929.2			
KRTAP4-8	728224	broad.mit.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																																	4	Substitution - Missense(4)	endometrium(3)|kidney(1)											7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224			AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1		NM_031960	
NUTM2B-AS1	101060691	broad.mit.edu	37	10	81444997	81444997	+	RNA	SNP	T	T	C	rs370178959		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr10:81444997T>C	ENST00000600376.1	-	0	54				RP11-119F19.2_ENST00000596088.1_RNA																							ACAACAATTTTCGGGCTTGCA	0.612																																																	0																																												0																															10.37:g.81444997T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000600376.1	37																																																																																					0.612	RP11-119F19.2-004	KNOWN	basic	antisense	antisense	OTTHUMT00000461766.1			
PRDM14	63978	broad.mit.edu	37	8	70982083	70982083	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr8:70982083G>A	ENST00000276594.2	-	2	214	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	5					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R5W(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			TCACTTGGCCGGGGTAGAGCC	0.701																																					NSCLC(129;99 1813 5906 40656 46114)												1	Substitution - Missense(1)	kidney(1)											11.0	12.0	12.0					8																	70982083		2121	4256	6377	SO:0001583	missense	63978			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.13C>T	8.37:g.70982083G>A	ENSP00000276594:p.Arg5Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424933	0.43020	.	.	ENSG00000147596	ENST00000276594;ENST00000426346	T	0.11712	2.75	5.34	0.828	0.18841	.	1.002020	0.08052	N	0.996846	T	0.06735	0.0172	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39165	-0.9627	10	0.66056	D	0.02	1.328	5.9723	0.19359	0.1873:0.2974:0.5153:0.0	.	5	Q9GZV8	PRD14_HUMAN	W	5	ENSP00000276594:R5W	ENSP00000276594:R5W	R	-	1	2	PRDM14	71144637	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.458000	0.21892	0.213000	0.20722	-0.886000	0.02939	CGG		0.701	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			
TEX11	56159	broad.mit.edu	37	X	69871299	69871299	+	Splice_Site	SNP	C	C	A			TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chrX:69871299C>A	ENST00000395889.2	-	18	1684		c.e18+1		TEX11_ENST00000374320.2_Splice_Site|TEX11_ENST00000374333.2_Splice_Site|TEX11_ENST00000344304.3_Splice_Site	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11						chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.?(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AAAATTTATACCTCTTTCAGA	0.333																																																	1	Unknown(1)	kidney(1)											33.0	31.0	32.0					X																	69871299		2203	4299	6502	SO:0001630	splice_region_variant	56159			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1528+1G>T	X.37:g.69871299C>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Splice_Site	SNP	ENST00000395889.2	37	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	C	8.088	0.773878	0.16051	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	.	.	.	2.98	2.11	0.27256	.	.	.	.	.	.	.	.	.	.	.	0.32259	N	0.570379	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.4115	0.16351	0.0:0.83:0.0:0.17	.	.	.	.	.	-1	.	.	.	-	.	.	TEX11	69788024	1.000000	0.71417	0.206000	0.23566	0.071000	0.16799	2.278000	0.43426	0.438000	0.26450	0.513000	0.50165	.		0.333	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			Intron
Unknown	0	broad.mit.edu	37	12	92133	92133	+	IGR	SNP	G	G	T	rs374355671		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr12:92133G>T								AC215219.1 (18811 upstream) : AC026369.1 (54918 downstream)																							GCAGCTGCCTGTCAGGAAGAG	0.592																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.92133G>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.592									
ZNF814	730051	broad.mit.edu	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-CZ-5987-01A-11D-1669-08	TCGA-CZ-5987-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84a1a8d2-54c6-4771-9092-27c5f7fc4e5c	a36b2e09-a18e-4b92-ba23-cb501698161c	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																																	2	Substitution - coding silent(2)	kidney(2)											25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic		WXS	Illumina GAIIx	Phase_I	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																				0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1		XM_001725708	
