#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACAD10	80724	hgsc.bcm.edu	37	12	112186271	112186271	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr12:112186271A>T	ENST00000313698.4	+	17	2791	c.2636A>T	c.(2635-2637)gAt>gTt	p.D879V	ACAD10_ENST00000392636.2_Missense_Mutation_p.D481V|ACAD10_ENST00000455480.2_Missense_Mutation_p.D910V|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	879						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GGACTGGAAGATGCACCAGGT	0.597																																																	0													55.0	58.0	57.0					12																	112186271		2203	4300	6503	SO:0001583	missense	80724			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2636A>T	12.37:g.112186271A>T	ENSP00000325137:p.Asp879Val	Somatic		WXS	SOLID	Phase_I	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.670460	0.67814	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000455480;ENST00000313698	D;D;D	0.98862	-5.19;-5.17;-5.17	5.87	3.5	0.40072	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.272597	0.33980	N	0.004366	D	0.98845	0.9610	M	0.83692	2.655	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.988;0.998	D;D;D	0.68353	0.957;0.914;0.946	D	0.99327	1.0908	10	0.87932	D	0	.	9.847	0.41032	0.8553:0.0:0.1447:0.0	.	910;879;879	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	V	481;879;910;879	ENSP00000376411:D481V;ENSP00000389813:D910V;ENSP00000325137:D879V	ENSP00000325137:D879V	D	+	2	0	ACAD10	110670654	0.996000	0.38824	0.040000	0.18447	0.055000	0.15305	3.562000	0.53777	1.045000	0.40225	0.533000	0.62120	GAT		0.597	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1		NM_025247	
ADAM9	8754	hgsc.bcm.edu;ucsc.edu	37	8	38869228	38869228	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr8:38869228A>T	ENST00000487273.2	+	3	325	c.247A>T	c.(247-249)Agg>Tgg	p.R83W	ADAM9_ENST00000466936.1_Missense_Mutation_p.R83W|ADAM9_ENST00000481513.1_Missense_Mutation_p.R83W	NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	83				Missing (in Ref. 2; no nucleotide entry). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TCACTTGGAAAGGAACAAGTA	0.299																																																	0													156.0	155.0	155.0					8																	38869228		2203	4300	6503	SO:0001583	missense	8754			U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.247A>T	8.37:g.38869228A>T	ENSP00000419446:p.Arg83Trp	Somatic		WXS	SOLID	Phase_I	B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	ENST00000487273.2	37	CCDS6112.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.961415	0.74016	.	.	ENSG00000168615	ENST00000466936;ENST00000481513;ENST00000487273	T;T;T	0.07216	3.21;3.21;3.21	4.73	3.56	0.40772	Peptidase M12B, propeptide (1);	0.154590	0.64402	D	0.000010	T	0.30759	0.0775	M	0.89904	3.07	0.43283	D	0.995252	D;D;D	0.71674	0.971;0.998;0.997	P;D;D	0.73380	0.855;0.98;0.943	T	0.03852	-1.0998	10	0.72032	D	0.01	.	8.1293	0.31018	0.9053:0.0:0.0947:0.0	.	83;83;83	Q13443;C9J6H5;C9JPM3	ADAM9_HUMAN;.;.	W	83	ENSP00000420257:R83W;ENSP00000417066:R83W;ENSP00000419446:R83W	ENSP00000369249:R83W	R	+	1	2	ADAM9	38988385	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.631000	0.54280	0.753000	0.32945	0.455000	0.32223	AGG		0.299	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2			
BRD4	23476	hgsc.bcm.edu;ucsc.edu	37	19	15360094	15360095	+	Intron	DEL	GG	GG	-			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:15360094_15360095delGG	ENST00000263377.2	-	12	2380				BRD4_ENST00000371835.4_Frame_Shift_Del_p.A722fs	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4						cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CCAATGATTAGGCAGGACCTAC	0.46			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0																																										SO:0001627	intron_variant	23476			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.2159-4521CC>-	19.37:g.15360094_15360095delGG		Somatic		WXS	SOLID	Phase_I	O60433|Q4G0X8|Q86YS8|Q96PD3	Frame_Shift_Del	DEL	ENST00000263377.2	37	CCDS12328.1																																																																																				0.460	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3		NM_058243	
C2orf80	389073	hgsc.bcm.edu	37	2	209051692	209051692	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:209051692T>C	ENST00000341287.4	-	2	214	c.19A>G	c.(19-21)Aag>Gag	p.K7E	C2orf80_ENST00000453017.1_Missense_Mutation_p.K7E|C2orf80_ENST00000451346.1_Intron	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	7										endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						ATTTCCTTCTTTATGAGCCTT	0.418																																																	0													163.0	153.0	156.0					2																	209051692		1868	4124	5992	SO:0001583	missense	389073			AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.19A>G	2.37:g.209051692T>C	ENSP00000343171:p.Lys7Glu	Somatic		WXS	SOLID	Phase_I	A6NKZ3	Missense_Mutation	SNP	ENST00000341287.4	37	CCDS42809.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.968747	0.53614	.	.	ENSG00000188674	ENST00000341287;ENST00000453017;ENST00000449053	T;T	0.54071	1.53;0.59	5.34	5.34	0.76211	.	.	.	.	.	T	0.59266	0.2181	L	0.27053	0.805	0.36387	D	0.862303	D	0.89917	1.0	D	0.85130	0.997	T	0.68398	-0.5419	9	0.87932	D	0	-12.7833	11.8839	0.52592	0.0:0.0:0.0:1.0	.	7	Q0P641	CB080_HUMAN	E	7	ENSP00000343171:K7E;ENSP00000397144:K7E	ENSP00000343171:K7E	K	-	1	0	C2orf80	208759937	1.000000	0.71417	0.998000	0.56505	0.843000	0.47879	3.817000	0.55668	2.367000	0.80283	0.528000	0.53228	AAG		0.418	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336931.1		NM_001099334	
CCDC18	343099	hgsc.bcm.edu;ucsc.edu	37	1	93672797	93672798	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:93672797_93672798insA	ENST00000343253.7	+	9	1553_1554	c.1051_1052insA	c.(1051-1053)gacfs	p.D351fs	CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000401026.3_Frame_Shift_Ins_p.D351fs|CCDC18_ENST00000557479.1_Frame_Shift_Ins_p.D469fs|CCDC18_ENST00000338949.4_Frame_Shift_Ins_p.D150fs			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	351										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AGAGAACAAAGACGAAATACTT	0.347																																																	0																																										SO:0001589	frameshift_variant	343099					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1052dupA	1.37:g.93672798_93672798dupA	ENSP00000343377:p.Asp351fs	Somatic		WXS	SOLID	Phase_I	Q6ZU17	Frame_Shift_Ins	INS	ENST00000343253.7	37																																																																																					0.347	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1		NM_206886	
CHD6	84181	hgsc.bcm.edu;ucsc.edu	37	20	40081483	40081483	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr20:40081483C>G	ENST00000373233.3	-	21	3397	c.3220G>C	c.(3220-3222)Gac>Cac	p.D1074H	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1074					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TCGTCTGAGTCGCTGTCTAAC	0.537																																																	0													149.0	120.0	130.0					20																	40081483		2203	4300	6503	SO:0001583	missense	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.3220G>C	20.37:g.40081483C>G	ENSP00000362330:p.Asp1074His	Somatic		WXS	SOLID	Phase_I	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	31	5.062628	0.93898	.	.	ENSG00000124177	ENST00000373233	D	0.85861	-2.04	5.0	5.0	0.66597	.	0.000000	0.56097	D	0.000025	D	0.92391	0.7585	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.93281	0.6660	10	0.87932	D	0	-22.7332	18.6801	0.91544	0.0:1.0:0.0:0.0	.	1074	Q8TD26	CHD6_HUMAN	H	1074	ENSP00000362330:D1074H	ENSP00000362330:D1074H	D	-	1	0	CHD6	39514897	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.489000	0.83994	0.591000	0.81541	GAC		0.537	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			
CHSY1	22856	hgsc.bcm.edu;ucsc.edu	37	15	101717750	101717750	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr15:101717750C>G	ENST00000254190.3	-	3	2727	c.2252G>C	c.(2251-2253)tGt>tCt	p.C751S	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	751					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATTGGGATCACAAAAGACAGG	0.507																																																	0													116.0	92.0	100.0					15																	101717750		2203	4300	6503	SO:0001583	missense	22856			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.2252G>C	15.37:g.101717750C>G	ENSP00000254190:p.Cys751Ser	Somatic		WXS	SOLID	Phase_I	Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	ENST00000254190.3	37	CCDS10390.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157858	0.78114	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.18174	2.23	5.87	5.87	0.94306	.	0.103999	0.64402	D	0.000002	T	0.54046	0.1834	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61148	-0.7121	10	0.59425	D	0.04	-23.9437	20.1947	0.98239	0.0:1.0:0.0:0.0	.	751	Q86X52	CHSS1_HUMAN	S	751;479	ENSP00000254190:C751S	ENSP00000254190:C751S	C	-	2	0	CHSY1	99535273	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.627000	0.83176	2.780000	0.95670	0.561000	0.74099	TGT		0.507	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1		NM_014918	
COL4A5	1287	hgsc.bcm.edu;ucsc.edu	37	X	107930860	107930860	+	Silent	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chrX:107930860G>A	ENST00000361603.2	+	47	4690	c.4446G>A	c.(4444-4446)caG>caA	p.Q1482Q	COL4A5_ENST00000328300.6_Silent_p.Q1488Q	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1482	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GAACACTTCAGGTCTATGAAG	0.478									Alport syndrome with Diffuse Leiomyomatosis																																								0													128.0	121.0	123.0					X																	107930860		2203	4300	6503	SO:0001819	synonymous_variant	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4446G>A	X.37:g.107930860G>A		Somatic		WXS	SOLID	Phase_I	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	3.705	-0.060777	0.07317	.	.	ENSG00000188153	ENST00000515658	.	.	.	5.58	0.344	0.16006	.	.	.	.	.	T	0.21674	0.0522	.	.	.	0.20403	N	0.999907	.	.	.	.	.	.	T	0.23691	-1.0181	4	.	.	.	.	2.6332	0.04950	0.1268:0.1229:0.3906:0.3597	.	.	.	.	K	87	.	.	R	+	2	0	COL4A5	107817516	0.233000	0.23772	0.215000	0.23724	0.700000	0.40528	0.339000	0.19875	-0.125000	0.11703	0.600000	0.82982	AGG		0.478	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			
CRHR2	1395	hgsc.bcm.edu;ucsc.edu	37	7	30706864	30706864	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr7:30706864C>A	ENST00000471646.1	-	3	712	c.295G>T	c.(295-297)Gag>Tag	p.E99*	CRHR2_ENST00000348438.4_Nonsense_Mutation_p.E126*|CRHR2_ENST00000506074.2_Nonsense_Mutation_p.E99*|CRHR2_ENST00000341843.4_Nonsense_Mutation_p.E85*	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	99					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AAAATGGGCTCACACTGTGAG	0.522																																																	0													204.0	156.0	172.0					7																	30706864		2203	4300	6503	SO:0001587	stop_gained	1395				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.295G>T	7.37:g.30706864C>A	ENSP00000418722:p.Glu99*	Somatic		WXS	SOLID	Phase_I	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Nonsense_Mutation	SNP	ENST00000471646.1	37	CCDS5429.1	.	.	.	.	.	.	.	.	.	.	C	32	5.181794	0.94885	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	.	.	.	5.65	3.83	0.44106	.	0.207334	0.49305	D	0.000141	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	9.7814	0.40651	0.0:0.781:0.1414:0.0775	.	.	.	.	X	99;126;85;99	.	ENSP00000344304:E85X	E	-	1	0	CRHR2	30673389	0.962000	0.33011	0.968000	0.41197	0.996000	0.88848	0.350000	0.20079	0.847000	0.35167	0.561000	0.74099	GAG		0.522	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3			
CUL9	23113	hgsc.bcm.edu	37	6	43174214	43174214	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr6:43174214T>G	ENST00000252050.4	+	26	5262	c.5178T>G	c.(5176-5178)gaT>gaG	p.D1726E	CUL9_ENST00000354495.3_Missense_Mutation_p.D1616E|CUL9_ENST00000372647.2_Missense_Mutation_p.D1726E|CUL9_ENST00000502937.1_3'UTR	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1726					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AATTCTGTGATGCCCTTGACC	0.542																																																	0													108.0	104.0	106.0					6																	43174214		2203	4300	6503	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5178T>G	6.37:g.43174214T>G	ENSP00000252050:p.Asp1726Glu	Somatic		WXS	SOLID	Phase_I	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.525324	0.64747	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.73363	-0.74;-0.74;-0.74	5.36	1.49	0.22878	Cullin, N-terminal (1);Cullin homology (2);	0.417852	0.26753	N	0.022670	T	0.34308	0.0893	L	0.29908	0.895	0.27356	N	0.956093	P;B;B	0.34587	0.458;0.023;0.023	B;B;B	0.31869	0.137;0.012;0.012	T	0.26430	-1.0103	10	0.66056	D	0.02	-13.0105	0.9044	0.01281	0.1664:0.2359:0.3412:0.2566	.	1616;1726;1726	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	E	1726;1616;1726	ENSP00000252050:D1726E;ENSP00000346490:D1616E;ENSP00000361730:D1726E	ENSP00000252050:D1726E	D	+	3	2	CUL9	43282192	0.959000	0.32827	1.000000	0.80357	0.993000	0.82548	0.186000	0.16978	0.306000	0.22856	0.482000	0.46254	GAT		0.542	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2		NM_015089	
CYP4F11	57834	hgsc.bcm.edu	37	19	16035643	16035643	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:16035643A>C	ENST00000402119.4	-	5	1001	c.575T>G	c.(574-576)tTt>tGt	p.F192C	CYP4F11_ENST00000248041.8_Missense_Mutation_p.F192C|CYP4F11_ENST00000591841.1_Intron|CYP4F11_ENST00000326742.8_Missense_Mutation_p.F192C	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GATGTGTTCAAACATGTCCAG	0.532																																																	0													91.0	77.0	82.0					19																	16035643		2203	4300	6503	SO:0001583	missense	57834			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.575T>G	19.37:g.16035643A>C	ENSP00000384588:p.Phe192Cys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000402119.4	37	CCDS12337.1	.	.	.	.	.	.	.	.	.	.	a	11.85	1.762643	0.31228	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	T;T;T	0.69175	-0.38;-0.38;-0.38	2.84	1.79	0.24919	.	0.000000	0.64402	U	0.000001	T	0.76335	0.3973	M	0.87180	2.865	0.40676	D	0.982262	P;P	0.39624	0.681;0.566	P;P	0.52343	0.696;0.548	T	0.75172	-0.3411	10	0.87932	D	0	.	6.1617	0.20368	0.8638:0.0:0.1362:0.0	.	192;192	F8W978;Q9HBI6	.;CP4FB_HUMAN	C	192	ENSP00000384588:F192C;ENSP00000248041:F192C;ENSP00000319859:F192C	ENSP00000248041:F192C	F	-	2	0	CYP4F11	15896643	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	7.943000	0.87716	0.306000	0.22856	0.248000	0.18094	TTT		0.532	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460385.2		NM_021187	
DEPDC1B	55789	hgsc.bcm.edu	37	5	59982922	59982922	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr5:59982922G>C	ENST00000265036.5	-	2	248	c.181C>G	c.(181-183)Caa>Gaa	p.Q61E	DEPDC1B_ENST00000545085.1_Missense_Mutation_p.Q34E|DEPDC1B_ENST00000453022.2_Missense_Mutation_p.Q61E	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	61	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.Q61K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				CCGAAGTTTTGACTGCACCTC	0.488																																																	1	Substitution - Missense(1)	ovary(1)											103.0	93.0	97.0					5																	59982922		2203	4300	6503	SO:0001583	missense	55789			AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.181C>G	5.37:g.59982922G>C	ENSP00000265036:p.Gln61Glu	Somatic		WXS	SOLID	Phase_I	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	37	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.910337	0.33721	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.20200	2.09;2.09;2.09	5.64	4.77	0.60923	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.422883	0.28448	N	0.015317	T	0.25680	0.0625	L	0.57536	1.79	0.39210	D	0.963309	B;B	0.23806	0.091;0.073	B;B	0.29663	0.105;0.105	T	0.06285	-1.0835	9	.	.	.	-21.1787	16.3686	0.83344	0.0:0.0:0.8671:0.1329	.	61;61	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	E	61;61;34	ENSP00000265036:Q61E;ENSP00000389101:Q61E;ENSP00000438320:Q34E	.	Q	-	1	0	DEPDC1B	60018679	1.000000	0.71417	0.964000	0.40570	0.928000	0.56348	2.351000	0.44071	1.507000	0.48752	0.561000	0.74099	CAA		0.488	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1		NM_018369	
DHX32	55760	hgsc.bcm.edu;ucsc.edu	37	10	127548370	127548370	+	Silent	SNP	G	G	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr10:127548370G>C	ENST00000284690.3	-	3	1141	c.651C>G	c.(649-651)tcC>tcG	p.S217S	DHX32_ENST00000284688.6_Silent_p.S217S	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	217	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GGTGAGGTGAGGAGTTAATTA	0.383																																																	0													176.0	170.0	172.0					10																	127548370		2203	4300	6503	SO:0001819	synonymous_variant	55760				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.651C>G	10.37:g.127548370G>C		Somatic		WXS	SOLID	Phase_I	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Silent	SNP	ENST00000284690.3	37	CCDS7652.1																																																																																				0.383	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2		NM_018180	
DHX35	60625	hgsc.bcm.edu	37	20	37597791	37597791	+	Silent	SNP	G	G	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr20:37597791G>T	ENST00000252011.3	+	2	141	c.108G>T	c.(106-108)acG>acT	p.T36T	DHX35_ENST00000373323.4_Silent_p.T36T|DHX35_ENST00000373325.2_Silent_p.T36T	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	36					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.T36T(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				CTGGGACAACGGTTGTTTACA	0.463																																																	1	Substitution - coding silent(1)	lung(1)											85.0	68.0	74.0					20																	37597791		2203	4300	6503	SO:0001819	synonymous_variant	60625			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.108G>T	20.37:g.37597791G>T		Somatic		WXS	SOLID	Phase_I	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	ENST00000252011.3	37	CCDS13310.1																																																																																				0.463	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2		NM_021931	
DNAH12	201625	hgsc.bcm.edu	37	3	57488136	57488136	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr3:57488136T>G	ENST00000351747.2	-	10	1337	c.1157A>C	c.(1156-1158)gAa>gCa	p.E386A	DNAH12_ENST00000311202.6_Missense_Mutation_p.E386A|DNAH12_ENST00000389536.4_Missense_Mutation_p.E386A	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	386	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TAACACGTGTTCAGGAAGTTC	0.388																																																	0													242.0	212.0	222.0					3																	57488136		2203	4300	6503	SO:0001583	missense	201625			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.1157A>C	3.37:g.57488136T>G	ENSP00000295937:p.Glu386Ala	Somatic		WXS	SOLID	Phase_I	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	T	14.94	2.685107	0.47991	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536;ENST00000311202	T;T;T;T	0.24538	2.0;1.85;3.26;2.85	5.21	5.21	0.72293	.	0.218631	0.37393	N	0.002108	T	0.26268	0.0641	M	0.62723	1.935	0.80722	D	1	B;B	0.25719	0.132;0.024	B;B	0.23574	0.047;0.005	T	0.04440	-1.0951	10	0.31617	T	0.26	.	10.9723	0.47446	0.0:0.0:0.1679:0.832	.	386;386	Q6ZR08-4;Q6ZR08	.;DYH12_HUMAN	A	386	ENSP00000295937:E386A;ENSP00000418137:E386A;ENSP00000374187:E386A;ENSP00000312554:E386A	ENSP00000312554:E386A	E	-	2	0	DNAH12	57463176	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.862000	0.39448	2.087000	0.62958	0.533000	0.62120	GAA		0.388	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_178504	
DNAH8	1769	hgsc.bcm.edu;ucsc.edu	37	6	38994431	38994431	+	Silent	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr6:38994431G>A	ENST00000359357.3	+	90	13427	c.13173G>A	c.(13171-13173)acG>acA	p.T4391T	DNAH8_ENST00000441566.1_Silent_p.T4355T			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4391					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGGAGATCACGTCACCCCCTG	0.532																																																	0													111.0	84.0	93.0					6																	38994431		2203	4300	6503	SO:0001819	synonymous_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.13173G>A	6.37:g.38994431G>A		Somatic		WXS	SOLID	Phase_I	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					0.532	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1		NM_001206927	
DUOX2	50506	hgsc.bcm.edu;ucsc.edu	37	15	45388135	45388135	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr15:45388135G>A	ENST00000603300.1	-	30	4173	c.3971C>T	c.(3970-3972)cCc>cTc	p.P1324L	DUOX2_ENST00000389039.6_Missense_Mutation_p.P1324L	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1324	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GTCCTCATGGGGCGCGGAGGT	0.632																																																	0													91.0	80.0	84.0					15																	45388135		2198	4298	6496	SO:0001583	missense	50506			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3971C>T	15.37:g.45388135G>A	ENSP00000475084:p.Pro1324Leu	Somatic		WXS	SOLID	Phase_I	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796824	0.90453	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.57	5.57	0.84162	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90909	0.7143	H	0.98276	4.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94180	0.7431	9	0.87932	D	0	-25.5716	18.5351	0.91008	0.0:0.0:1.0:0.0	.	1324	Q9NRD8	DUOX2_HUMAN	L	1324	.	ENSP00000373691:P1324L	P	-	2	0	DUOX2	43175427	1.000000	0.71417	0.998000	0.56505	0.572000	0.35998	9.841000	0.99482	2.619000	0.88677	0.561000	0.74099	CCC		0.632	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_014080	
AGO1	26523	hgsc.bcm.edu	37	1	36372708	36372708	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:36372708A>C	ENST00000373204.4	+	12	1783	c.1570A>C	c.(1570-1572)Acg>Ccg	p.T524P	AGO1_ENST00000373206.1_Missense_Mutation_p.T449P	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	524	Interaction with guide RNA.|Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										GCCAGGGAAGACGCCGGTGTA	0.532																																																	0													108.0	88.0	95.0					1																	36372708		2203	4300	6503	SO:0001583	missense	26523			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1570A>C	1.37:g.36372708A>C	ENSP00000362300:p.Thr524Pro	Somatic		WXS	SOLID	Phase_I	Q5TA57|Q6P4S0	Missense_Mutation	SNP	ENST00000373204.4	37	CCDS398.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.586438	0.86851	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.31247	1.5;1.5	5.58	5.58	0.84498	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.59662	0.2210	M	0.83953	2.67	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	T	0.65936	-0.6047	10	0.87932	D	0	-14.6934	15.7578	0.78051	1.0:0.0:0.0:0.0	.	524	Q9UL18	AGO1_HUMAN	P	449;524	ENSP00000362302:T449P;ENSP00000362300:T524P	ENSP00000362300:T524P	T	+	1	0	EIF2C1	36145295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.120000	0.65058	0.528000	0.53228	ACG		0.532	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019337.3			
EIF2S3	1968	hgsc.bcm.edu;ucsc.edu	37	X	24086218	24086218	+	Silent	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chrX:24086218T>C	ENST00000253039.4	+	9	1258	c.1005T>C	c.(1003-1005)ggT>ggC	p.G335G		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	335					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						CTCCAGGCGGTCTTATTGGTA	0.363																																																	0													82.0	73.0	76.0					X																	24086218		2203	4300	6503	SO:0001819	synonymous_variant	1968			L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.1005T>C	X.37:g.24086218T>C		Somatic		WXS	SOLID	Phase_I	B5BTZ4	Silent	SNP	ENST00000253039.4	37	CCDS14210.1																																																																																				0.363	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1		NM_001415	
EIF4ENIF1	56478	hgsc.bcm.edu;ucsc.edu	37	22	31851207	31851207	+	Silent	SNP	A	A	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr22:31851207A>T	ENST00000397525.1	-	9	1417	c.1194T>A	c.(1192-1194)atT>atA	p.I398I	EIF4ENIF1_ENST00000397523.1_Silent_p.I398I|RP11-247I13.11_ENST00000464523.1_RNA|EIF4ENIF1_ENST00000344710.5_Silent_p.I235I|EIF4ENIF1_ENST00000330125.5_Silent_p.I398I|EIF4ENIF1_ENST00000382180.2_Silent_p.I77I	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	398						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GCATTTCTAAAATATCCACTT	0.388																																																	0													83.0	81.0	81.0					22																	31851207		2203	4300	6503	SO:0001819	synonymous_variant	56478			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.1194T>A	22.37:g.31851207A>T		Somatic		WXS	SOLID	Phase_I	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Silent	SNP	ENST00000397525.1	37	CCDS13898.1																																																																																				0.388	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1		NM_019843	
ELP2	55250	hgsc.bcm.edu	37	18	33709981	33709981	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr18:33709981A>T	ENST00000358232.6	+	1	148	c.85A>T	c.(85-87)Aga>Tga	p.R29*	ELP2_ENST00000542824.1_Nonsense_Mutation_p.R29*|SLC39A6_ENST00000590986.1_5'Flank|ELP2_ENST00000350494.6_Nonsense_Mutation_p.R29*|ELP2_ENST00000423854.2_Nonsense_Mutation_p.R29*|SLC39A6_ENST00000269187.5_5'Flank|ELP2_ENST00000442325.2_Nonsense_Mutation_p.R29*|SLC39A6_ENST00000440549.2_5'Flank|ELP2_ENST00000351393.6_Nonsense_Mutation_p.R29*	NM_018255.2	NP_060725.1	Q6IA86	ELP2_HUMAN	elongator acetyltransferase complex subunit 2	29					chromatin organization (GO:0006325)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)				NS(1)|breast(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|urinary_tract(2)	30						CTCTGGGCCCAGAGGACTTCT	0.612																																																	0													73.0	68.0	70.0					18																	33709981		2203	4300	6503	SO:0001587	stop_gained	55250			AK001741	CCDS11918.1, CCDS56065.1, CCDS56066.1, CCDS56067.1, CCDS56068.1, CCDS56069.1	18q12.1	2013-01-10	2012-08-08	2007-04-20	ENSG00000134759	ENSG00000134759		"""Elongator acetyltransferase complex subunits"", ""WD repeat domain containing"""	18248	protein-coding gene	gene with protein product			"""signal transducer and activator of transcription 3 interacting protein 1"", ""elongation protein 2 homolog (S. cerevisiae)"""	STATIP1		11714725, 10954736	Standard	NM_001242875		Approved	FLJ10879, StIP	uc002kzk.2	Q6IA86	OTTHUMG00000132589	ENST00000358232.6:c.85A>T	18.37:g.33709981A>T	ENSP00000350967:p.Arg29*	Somatic		WXS	SOLID	Phase_I	A8KAI6|B4DTG0|B4DXP0|E7EP23|E9PCX0|Q53GZ0|Q687Y8|Q8N5C2|Q96GV4|Q96PI7|Q9H9N0|Q9NV81	Nonsense_Mutation	SNP	ENST00000358232.6	37	CCDS11918.1	.	.	.	.	.	.	.	.	.	.	A	37	6.372657	0.97515	.	.	ENSG00000134759	ENST00000358232;ENST00000351393;ENST00000442325;ENST00000423854;ENST00000350494;ENST00000542824	.	.	.	5.61	2.78	0.32641	.	0.345530	0.33875	N	0.004464	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-1.1365	5.4679	0.16654	0.1836:0.1639:0.6526:0.0	.	.	.	.	X	29	.	ENSP00000316051:R29X	R	+	1	2	ELP2	31963979	0.960000	0.32886	0.985000	0.45067	0.939000	0.58152	1.682000	0.37628	0.283000	0.22279	-0.472000	0.04984	AGA		0.612	ELP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255800.2		NM_018255	
EP300	2033	hgsc.bcm.edu;ucsc.edu	37	22	41536219	41536219	+	Silent	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr22:41536219T>C	ENST00000263253.7	+	9	3055	c.1836T>C	c.(1834-1836)gcT>gcC	p.A612A		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	612	KIX. {ECO:0000255|PROSITE- ProRule:PRU00311}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTGCATATGCTCGGAAAGTTG	0.413			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													162.0	162.0	162.0					22																	41536219		2203	4300	6503	SO:0001819	synonymous_variant	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.1836T>C	22.37:g.41536219T>C		Somatic		WXS	SOLID	Phase_I	B1AKC2	Silent	SNP	ENST00000263253.7	37	CCDS14010.1																																																																																				0.413	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1		NM_001429	
FAT4	79633	hgsc.bcm.edu	37	4	126336940	126336940	+	Silent	SNP	A	A	C	rs192467233		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr4:126336940A>C	ENST00000394329.3	+	5	6835	c.6822A>C	c.(6820-6822)acA>acC	p.T2274T	FAT4_ENST00000335110.5_Silent_p.T572T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2274	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATTTAGGGACACTACCCAGAA	0.358																																																	0													44.0	44.0	44.0					4																	126336940		2203	4300	6503	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6822A>C	4.37:g.126336940A>C		Somatic		WXS	SOLID	Phase_I	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				0.358	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2		NM_024582	
FLII	2314	hgsc.bcm.edu;ucsc.edu	37	17	18156764	18156764	+	Silent	SNP	A	A	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr17:18156764A>T	ENST00000327031.4	-	9	1089	c.864T>A	c.(862-864)atT>atA	p.I288I	FLII_ENST00000579294.1_Silent_p.I277I|FLII_ENST00000584444.1_5'UTR|FLII_ENST00000545457.2_Silent_p.I234I|FLII_ENST00000379450.4_Silent_p.I203I|FLII_ENST00000578558.1_Silent_p.I288I	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	288	Interaction with LRRFIP1 and LRRFIP2.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					TCAGCTTGCAAATGGCTGACT	0.607																																																	0													66.0	67.0	67.0					17																	18156764		2203	4300	6503	SO:0001819	synonymous_variant	2314			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.864T>A	17.37:g.18156764A>T		Somatic		WXS	SOLID	Phase_I	B4DIL0|F5H407|J3QLG3	Silent	SNP	ENST00000327031.4	37	CCDS11192.1																																																																																				0.607	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2		NM_002018	
GIPC2	54810	hgsc.bcm.edu	37	1	78601425	78601425	+	Nonstop_Mutation	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:78601425T>C	ENST00000370759.3	+	6	1139	c.946T>C	c.(946-948)Tga>Cga	p.*316R		NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	0						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						AAGAGGATTATGATGTGTACA	0.398																																																	0													115.0	104.0	107.0					1																	78601425		2203	4300	6503	SO:0001578	stop_lost	54810			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.946T>C	1.37:g.78601425T>C	ENSP00000359795:p.*316Argext*19	Somatic		WXS	SOLID	Phase_I	Q8IYD3|Q9NXS7	Missense_Mutation	SNP	ENST00000370759.3	37	CCDS685.1	.	.	.	.	.	.	.	.	.	.	T	8.509	0.865964	0.17250	.	.	ENSG00000137960	ENST00000370759	.	.	.	5.53	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0819	0.25235	0.0:0.106:0.1577:0.7363	.	.	.	.	R	316	.	.	X	+	1	0	GIPC2	78374013	0.960000	0.32886	0.013000	0.15412	0.019000	0.09904	1.631000	0.37092	2.237000	0.73441	0.528000	0.53228	TGA		0.398	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098629.1		NM_017655	
GBP5	115362	hgsc.bcm.edu;ucsc.edu	37	1	89732723	89732723	+	Missense_Mutation	SNP	C	C	G	rs376262831		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:89732723C>G	ENST00000370459.3	-	5	669	c.542G>C	c.(541-543)aGa>aCa	p.R181T	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Missense_Mutation_p.R181T			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	181	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		GCAGAAATCTCTCAGAGTCCA	0.493																																																	0													127.0	130.0	129.0					1																	89732723		2203	4300	6503	SO:0001583	missense	115362			AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.542G>C	1.37:g.89732723C>G	ENSP00000359488:p.Arg181Thr	Somatic		WXS	SOLID	Phase_I	B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	CCDS722.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547316	0.86022	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	D;D;D	0.84730	-1.89;-1.89;-1.89	4.5	4.5	0.54988	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92782	0.7705	M	0.91818	3.245	0.34948	D	0.751	D	0.89917	1.0	D	0.97110	1.0	D	0.94200	0.7449	10	0.87932	D	0	-15.733	15.2322	0.73401	0.0:1.0:0.0:0.0	.	181	Q96PP8	GBP5_HUMAN	T	181	ENSP00000340396:R181T;ENSP00000359488:R181T;ENSP00000403010:R181T	ENSP00000340396:R181T	R	-	2	0	GBP5	89505311	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	5.399000	0.66314	2.542000	0.85734	0.449000	0.29647	AGA		0.493	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1		NM_052942	
GLP2R	9340	hgsc.bcm.edu;ucsc.edu	37	17	9745863	9745863	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr17:9745863C>T	ENST00000262441.5	+	4	947	c.434C>T	c.(433-435)aCg>aTg	p.T145M	GLP2R_ENST00000574745.1_5'UTR	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	145					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	ACTTGGCAGACGATAGAGAAC	0.522																																																	0													144.0	114.0	125.0					17																	9745863		2203	4300	6503	SO:0001583	missense	9340			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.434C>T	17.37:g.9745863C>T	ENSP00000262441:p.Thr145Met	Somatic		WXS	SOLID	Phase_I	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627123	0.28978	.	.	ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441	T	0.63913	-0.07	5.06	0.712	0.18167	GPCR, family 2, extracellular hormone receptor domain (2);	0.617651	0.13467	N	0.385709	T	0.43787	0.1263	L	0.38838	1.175	0.19575	N	0.999965	P	0.42039	0.769	B	0.36186	0.219	T	0.21280	-1.0250	10	0.33141	T	0.24	.	5.9187	0.19070	0.2691:0.5812:0.0:0.1497	.	145	O95838	GLP2R_HUMAN	M	145;120;145	ENSP00000262441:T145M	ENSP00000262441:T145M	T	+	2	0	GLP2R	9686588	0.036000	0.19791	0.133000	0.22050	0.884000	0.51177	0.277000	0.18734	0.028000	0.15324	0.655000	0.94253	ACG		0.522	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4			
GPR37	2861	hgsc.bcm.edu;ucsc.edu	37	7	124404891	124404891	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr7:124404891G>A	ENST00000303921.2	-	1	790	c.140C>T	c.(139-141)aCa>aTa	p.T47I		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	47					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CTGGATCACTGTAGGTGCACA	0.632																																																	0													26.0	29.0	28.0					7																	124404891		2203	4300	6503	SO:0001583	missense	2861				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.140C>T	7.37:g.124404891G>A	ENSP00000306449:p.Thr47Ile	Somatic		WXS	SOLID	Phase_I	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	2.444	-0.327991	0.05314	.	.	ENSG00000170775	ENST00000303921	T	0.07327	3.2	4.71	-1.41	0.08941	.	1.767710	0.02430	N	0.083490	T	0.04998	0.0134	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36040	-0.9764	10	0.17369	T	0.5	4.4278	4.901	0.13775	0.4518:0.1537:0.3945:0.0	.	47	O15354	GPR37_HUMAN	I	47	ENSP00000306449:T47I	ENSP00000306449:T47I	T	-	2	0	GPR37	124192127	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	0.136000	0.15974	-0.528000	0.06366	-0.748000	0.03510	ACA		0.632	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1		NM_005302	
GSTCD	79807	hgsc.bcm.edu	37	4	106766678	106766678	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr4:106766678A>C	ENST00000515279.1	+	12	2066	c.1846A>C	c.(1846-1848)Atg>Ctg	p.M616L	GSTCD_ENST00000394728.3_Missense_Mutation_p.M616L|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000360505.5_Missense_Mutation_p.M616L|GSTCD_ENST00000394730.3_Missense_Mutation_p.M529L			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	616						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		AGTGATATCCATGGAGCCAGA	0.433																																																	0													101.0	100.0	100.0					4																	106766678		1933	4136	6069	SO:0001583	missense	79807			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1846A>C	4.37:g.106766678A>C	ENSP00000422354:p.Met616Leu	Somatic		WXS	SOLID	Phase_I	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	37	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.043532	0.75732	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	L	0.28014	0.82	0.58432	D	0.999995	D;B	0.65815	0.995;0.017	D;B	0.73380	0.98;0.03	T	0.61510	-0.7048	9	0.29301	T	0.29	0.1316	15.333	0.74229	1.0:0.0:0.0:0.0	.	616;239	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	L	529;616;616;616	.	ENSP00000353695:M616L	M	+	1	0	GSTCD	106986127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.550000	0.90675	2.008000	0.58898	0.528000	0.53228	ATG		0.433	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1		NM_024751	
HADHB	3032	hgsc.bcm.edu;ucsc.edu	37	2	26505782	26505782	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:26505782G>A	ENST00000317799.5	+	11	1107	c.1003G>A	c.(1003-1005)Gca>Aca	p.A335T	HADHB_ENST00000537713.1_Missense_Mutation_p.A320T|HADHB_ENST00000494615.1_3'UTR|HADHB_ENST00000545822.1_Missense_Mutation_p.A313T|HADHB_ENST00000405867.3_Missense_Mutation_p.A212T	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	335					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAGCCGAAGGCATATTTGAG	0.358																																																	0													113.0	111.0	112.0					2																	26505782		2203	4300	6503	SO:0001583	missense	3032				CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.1003G>A	2.37:g.26505782G>A	ENSP00000325136:p.Ala335Thr	Somatic		WXS	SOLID	Phase_I	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	37	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849717	0.91277	.	.	ENSG00000138029	ENST00000317799;ENST00000405867;ENST00000537713;ENST00000545822	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.95	5.95	0.96441	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98811	0.9599	H	0.99619	4.66	0.80722	D	1	D;D;D;D	0.76494	0.998;0.996;0.999;0.999	D;D;D;D	0.85130	0.955;0.954;0.997;0.973	D	0.99187	1.0869	10	0.87932	D	0	-18.0672	18.9662	0.92697	0.0:0.0:1.0:0.0	.	320;313;212;335	F5GZQ3;B4E2W0;B5MD38;P55084	.;.;.;ECHB_HUMAN	T	335;212;320;313	ENSP00000325136:A335T;ENSP00000385411:A212T;ENSP00000444295:A320T;ENSP00000442665:A313T	ENSP00000325136:A335T	A	+	1	0	HADHB	26359286	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.478000	0.97927	2.827000	0.97445	0.650000	0.86243	GCA		0.358	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2		NM_000183	
HINFP	25988	hgsc.bcm.edu	37	11	119005189	119005189	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr11:119005189C>T	ENST00000350777.2	+	10	1598	c.1535C>T	c.(1534-1536)cCa>cTa	p.P512L		NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	512	Interaction with NPAT.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.P512L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCTGAGGAGCCAGAGATCCAG	0.587											OREG0021397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	pancreas(1)											21.0	24.0	23.0					11																	119005189		2200	4295	6495	SO:0001583	missense	25988			AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.1535C>T	11.37:g.119005189C>T	ENSP00000318085:p.Pro512Leu	Somatic	1492	WXS	SOLID	Phase_I	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	ENST00000350777.2	37	CCDS8414.1	.	.	.	.	.	.	.	.	.	.	C	7.205	0.594167	0.13875	.	.	ENSG00000172273	ENST00000350777	T	0.06218	3.33	5.13	3.21	0.36854	.	0.264553	0.31031	N	0.008384	T	0.03095	0.0091	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32903	-0.9889	10	0.02654	T	1	-4.1118	4.1923	0.10426	0.2031:0.6199:0.0:0.177	.	512	Q9BQA5	HINFP_HUMAN	L	512	ENSP00000318085:P512L	ENSP00000318085:P512L	P	+	2	0	HINFP	118510399	0.581000	0.26741	0.808000	0.32385	0.252000	0.25951	0.353000	0.20130	1.389000	0.46526	0.655000	0.94253	CCA		0.587	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388201.2		NM_015517	
HSPH1	10808	hgsc.bcm.edu	37	13	31711636	31711636	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr13:31711636A>C	ENST00000320027.5	-	18	2740	c.2396T>G	c.(2395-2397)gTt>gGt	p.V799G	HSPH1_ENST00000445273.2_Missense_Mutation_p.V801G|HSPH1_ENST00000380406.5_Missense_Mutation_p.V758G|HSPH1_ENST00000429785.2_Missense_Mutation_p.V618G|HSPH1_ENST00000380405.4_Missense_Mutation_p.V755G	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	799					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TTGTGTTACAACGGGTTCACA	0.348																																																	0													133.0	128.0	129.0					13																	31711636		2202	4300	6502	SO:0001583	missense	10808			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.2396T>G	13.37:g.31711636A>C	ENSP00000318687:p.Val799Gly	Somatic		WXS	SOLID	Phase_I	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	37	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.694185	0.48202	.	.	ENSG00000120694	ENST00000435381;ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000380363;ENST00000429785	T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37	5.85	5.85	0.93711	.	0.145914	0.42420	D	0.000704	T	0.34774	0.0909	L	0.50333	1.59	0.29425	N	0.860291	D;P;P;D;P	0.59357	0.985;0.841;0.92;0.959;0.865	P;P;P;P;P	0.61397	0.709;0.888;0.623;0.888;0.696	T	0.16070	-1.0415	10	0.87932	D	0	-10.8805	16.2271	0.82306	1.0:0.0:0.0:0.0	.	618;758;801;755;799	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	G	63;799;755;758;801;85;618	ENSP00000408991:V63G;ENSP00000318687:V799G;ENSP00000369768:V755G;ENSP00000369769:V758G;ENSP00000396090:V801G;ENSP00000388778:V618G	ENSP00000318687:V799G	V	-	2	0	HSPH1	30609636	0.971000	0.33674	0.013000	0.15412	0.454000	0.32378	7.521000	0.81832	2.234000	0.73211	0.460000	0.39030	GTT		0.348	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1			
ITIH1	3697	hgsc.bcm.edu;ucsc.edu	37	3	52825566	52825566	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr3:52825566C>G	ENST00000273283.2	+	21	2552	c.2528C>G	c.(2527-2529)tCt>tGt	p.S843C	ITIH1_ENST00000405128.3_Missense_Mutation_p.S209C|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000537050.1_Missense_Mutation_p.S555C|ITIH1_ENST00000540715.1_Missense_Mutation_p.S701C	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	843	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TTTGAAGTGTCTGACATCCAC	0.597																																																	0													92.0	88.0	89.0					3																	52825566		2203	4300	6503	SO:0001583	missense	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2528C>G	3.37:g.52825566C>G	ENSP00000273283:p.Ser843Cys	Somatic		WXS	SOLID	Phase_I	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056233	0.36277	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68	5.61	-1.4	0.08968	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.683806	0.12760	N	0.441417	T	0.31358	0.0794	M	0.77820	2.39	0.09310	N	1	D;D;D;D	0.69078	0.964;0.996;0.997;0.994	P;D;P;D	0.67382	0.831;0.951;0.87;0.951	T	0.12167	-1.0558	10	0.39692	T	0.17	-3.2158	10.469	0.44624	0.0:0.3657:0.0:0.6343	.	701;209;444;843	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	C	843;701;555;396;209	ENSP00000273283:S843C;ENSP00000443973:S701C;ENSP00000443847:S555C;ENSP00000395836:S396C;ENSP00000384589:S209C	ENSP00000273283:S843C	S	+	2	0	ITIH1	52800606	0.000000	0.05858	0.021000	0.16686	0.627000	0.37826	0.160000	0.16462	-0.155000	0.11098	-0.218000	0.12543	TCT		0.597	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1		NM_002215	
UNC79	57578	hgsc.bcm.edu	37	14	93994955	93994955	+	Silent	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr14:93994955T>C	ENST00000393151.2	+	9	1015	c.1015T>C	c.(1015-1017)Ttg>Ctg	p.L339L	UNC79_ENST00000553484.1_Silent_p.L339L|UNC79_ENST00000256339.4_Silent_p.L162L|UNC79_ENST00000555664.1_Silent_p.L339L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	339					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACCACCCCCGTTGTATCTCTG	0.408																																																	0													115.0	111.0	113.0					14																	93994955		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1015T>C	14.37:g.93994955T>C		Somatic		WXS	SOLID	Phase_I	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37																																																																																					0.408	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1		XM_028395	
KIAA1549	57670	hgsc.bcm.edu;ucsc.edu	37	7	138595936	138595936	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr7:138595936T>G	ENST00000422774.1	-	4	3149	c.3101A>C	c.(3100-3102)aAa>aCa	p.K1034T	KIAA1549_ENST00000242365.4_Missense_Mutation_p.K984T|KIAA1549_ENST00000440172.1_Missense_Mutation_p.K1034T			Q9HCM3	K1549_HUMAN	KIAA1549	1034						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GAAAGAAGGTTTCACAGACAG	0.388			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													52.0	51.0	51.0					7																	138595936		1874	4112	5986	SO:0001583	missense	57670				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3101A>C	7.37:g.138595936T>G	ENSP00000416040:p.Lys1034Thr	Somatic		WXS	SOLID	Phase_I	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.851391	0.51270	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.23950	1.88;1.89;1.88	5.23	1.6	0.23607	.	0.563398	0.18063	N	0.152887	T	0.10551	0.0258	N	0.03608	-0.345	0.09310	N	0.99999	B;B	0.21225	0.031;0.053	B;B	0.24394	0.024;0.053	T	0.30031	-0.9992	10	0.31617	T	0.26	.	7.8253	0.29311	0.0:0.2561:0.0:0.7439	.	1034;1034	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	T	1034;984;1034	ENSP00000406661:K1034T;ENSP00000242365:K984T;ENSP00000416040:K1034T	ENSP00000242365:K984T	K	-	2	0	KIAA1549	138246476	0.333000	0.24731	0.782000	0.31804	0.997000	0.91878	0.909000	0.28558	0.123000	0.18342	0.533000	0.62120	AAA		0.388	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			
CFAP74	85452	hgsc.bcm.edu	37	1	1897857	1897857	+	IGR	SNP	C	C	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:1897857C>A								TMEM52 (47145 upstream) : C1orf222 (21705 downstream)																							ATCTCGGGCTCAGCTAACGTT	0.612																																																	0													49.0	56.0	54.0					1																	1897857		1940	4121	6061	SO:0001628	intergenic_variant	85452																															1.37:g.1897857C>A		Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	c	19.91	3.915037	0.72983	.	.	ENSG00000142609	ENST00000270720	.	.	.	3.87	-1.64	0.08318	.	0.501859	0.19066	N	0.123629	.	.	.	.	.	.	0.20074	N	0.999932	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-4.8261	0.9991	0.01473	0.1436:0.2924:0.2824:0.2816	.	.	.	.	X	452	.	ENSP00000270720:E452X	E	-	1	0	C1orf222	1887717	0.000000	0.05858	0.005000	0.12908	0.223000	0.24884	-0.565000	0.05929	-0.478000	0.06823	0.457000	0.33378	GAG	0	0.612									
LRMP	4033	hgsc.bcm.edu;ucsc.edu	37	12	25232386	25232386	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr12:25232386A>G	ENST00000354454.3	+	7	955	c.126A>G	c.(124-126)atA>atG	p.I42M	LRMP_ENST00000548766.1_Missense_Mutation_p.I42M|LRMP_ENST00000547044.1_Missense_Mutation_p.I42M	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	98					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					ACGGTACTATAACTTCAAGTG	0.393																																																	0													129.0	126.0	127.0					12																	25232386		2203	4300	6503	SO:0001583	missense	4033				CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.126A>G	12.37:g.25232386A>G	ENSP00000346442:p.Ile42Met	Somatic		WXS	SOLID	Phase_I	A0AVM2|B4E077|Q8N301	Missense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	.	.	.	.	.	.	.	.	.	.	A	8.164	0.790168	0.16258	.	.	ENSG00000118308	ENST00000550945;ENST00000557489;ENST00000354454;ENST00000548766;ENST00000554942;ENST00000547044	T;T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42;2.42	4.27	-2.25	0.06888	.	0.458028	0.18310	N	0.145146	T	0.09555	0.0235	N	0.08118	0	0.21105	N	0.999786	B	0.33777	0.425	B	0.40410	0.328	T	0.30794	-0.9966	10	0.62326	D	0.03	-7.1878	9.3051	0.37870	0.4371:0.0:0.5629:0.0	.	98	Q12912	LRMP_HUMAN	M	42	ENSP00000448534:I42M;ENSP00000452116:I42M;ENSP00000346442:I42M;ENSP00000446496:I42M;ENSP00000450634:I42M;ENSP00000450246:I42M	ENSP00000346442:I42M	I	+	3	3	LRMP	25123653	0.121000	0.22262	0.696000	0.30242	0.939000	0.58152	-0.370000	0.07523	-0.396000	0.07703	0.482000	0.46254	ATA		0.393	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1		NM_006152	
KLHL42	57542	hgsc.bcm.edu	37	12	27950786	27950786	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr12:27950786A>T	ENST00000381271.2	+	3	1516	c.1205A>T	c.(1204-1206)gAg>gTg	p.E402V	RP11-860B13.3_ENST00000543527.1_RNA	NM_020782.1	NP_065833.1	Q9P2K6	KLH42_HUMAN	kelch-like family member 42	402					mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of microtubule-based process (GO:0032886)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TGTCTCCACGAGCTGGGGCCC	0.587																																																	0													98.0	92.0	94.0					12																	27950786		2203	4300	6503	SO:0001583	missense	57542			AB037761	CCDS31763.1	12p11.22	2013-04-24	2013-02-22	2013-01-30	ENSG00000087448	ENSG00000087448		"""Kelch-like"""	29252	protein-coding gene	gene with protein product			"""kelch domain containing 5"""	KLHDC5		19261606	Standard	NM_020782		Approved	KIAA1340, Ctb9	uc001rij.3	Q9P2K6	OTTHUMG00000169217	ENST00000381271.2:c.1205A>T	12.37:g.27950786A>T	ENSP00000370671:p.Glu402Val	Somatic		WXS	SOLID	Phase_I	Q2VPK1|Q8N334	Missense_Mutation	SNP	ENST00000381271.2	37	CCDS31763.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.884695	0.51908	.	.	ENSG00000087448	ENST00000381271	T	0.74737	-0.87	4.9	4.9	0.64082	Kelch-type beta propeller (1);	0.115106	0.56097	D	0.000021	T	0.72645	0.3486	L	0.53249	1.67	0.47476	D	0.999437	P	0.48911	0.917	B	0.44315	0.446	T	0.77239	-0.2661	10	0.72032	D	0.01	.	13.8554	0.63524	1.0:0.0:0.0:0.0	.	402	Q9P2K6	KLDC5_HUMAN	V	402	ENSP00000370671:E402V	ENSP00000370671:E402V	E	+	2	0	KLHDC5	27842053	1.000000	0.71417	0.892000	0.35008	0.971000	0.66376	6.868000	0.75516	2.040000	0.60383	0.533000	0.62120	GAG		0.587	KLHL42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402904.1		NM_020782	
MAN2B2	23324	hgsc.bcm.edu	37	4	6588812	6588812	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr4:6588812A>G	ENST00000285599.3	+	4	517	c.481A>G	c.(481-483)Acc>Gcc	p.T161A	MAN2B2_ENST00000504248.1_Missense_Mutation_p.T161A	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	161					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CACGACGCCCACCCTATTTGC	0.617																																																	0													59.0	56.0	57.0					4																	6588812		2203	4300	6503	SO:0001583	missense	23324			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.481A>G	4.37:g.6588812A>G	ENSP00000285599:p.Thr161Ala	Somatic		WXS	SOLID	Phase_I	Q66MP2|Q86T67	Missense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.456540	0.63401	.	.	ENSG00000013288	ENST00000285599;ENST00000504248	T;T	0.22134	1.97;1.97	4.09	4.09	0.47781	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.367103	0.31167	N	0.008123	T	0.27524	0.0676	L	0.41961	1.31	0.39109	D	0.961437	P;P;B	0.45569	0.861;0.861;0.097	P;P;B	0.51918	0.684;0.684;0.099	T	0.04115	-1.0976	10	0.29301	T	0.29	-26.3922	12.5023	0.55962	1.0:0.0:0.0:0.0	.	161;161;161	E9PCD7;Q9Y2E5;Q9Y2E5-2	.;MA2B2_HUMAN;.	A	161	ENSP00000285599:T161A;ENSP00000423129:T161A	ENSP00000285599:T161A	T	+	1	0	MAN2B2	6639713	1.000000	0.71417	0.946000	0.38457	0.685000	0.39939	5.932000	0.70121	1.602000	0.50124	0.448000	0.29417	ACC		0.617	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2		NM_015274	
MECR	51102	hgsc.bcm.edu	37	1	29528533	29528533	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:29528533G>C	ENST00000263702.6	-	6	703	c.678C>G	c.(676-678)gaC>gaG	p.D226E	MECR_ENST00000373791.3_Missense_Mutation_p.D150E|MECR_ENST00000489248.1_5'Flank			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	226					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		TCTTCAGTCTGTCACTCAGCT	0.502																																																	0													192.0	195.0	194.0					1																	29528533		2203	4300	6503	SO:0001583	missense	51102				CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.678C>G	1.37:g.29528533G>C	ENSP00000263702:p.Asp226Glu	Somatic		WXS	SOLID	Phase_I	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634199	0.29068	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792;ENST00000453185	T;T	0.03496	3.91;3.91	5.75	2.78	0.32641	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.401640	0.31177	N	0.008108	T	0.02418	0.0074	N	0.20685	0.6	0.40099	D	0.976344	B	0.02656	0.0	B	0.04013	0.001	T	0.47873	-0.9083	10	0.10111	T	0.7	.	9.4496	0.38719	0.0752:0.2709:0.6539:0.0	.	226	Q9BV79	MECR_HUMAN	E	150;226;138;65	ENSP00000362896:D150E;ENSP00000263702:D226E	ENSP00000263702:D226E	D	-	3	2	MECR	29401120	0.986000	0.35501	0.897000	0.35233	0.690000	0.40134	0.189000	0.17037	0.314000	0.23086	0.561000	0.74099	GAC		0.502	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1		NM_016011	
MKKS	8195	hgsc.bcm.edu;ucsc.edu	37	20	10393758	10393758	+	Silent	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr20:10393758G>A	ENST00000347364.3	-	3	1167	c.405C>T	c.(403-405)acC>acT	p.T135T	MKKS_ENST00000399054.2_Silent_p.T135T	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	135					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						GACAACCACAGGTCTCAGACT	0.398																																					Melanoma(79;1979 2212 6640)												0													91.0	85.0	87.0					20																	10393758		2203	4300	6503	SO:0001819	synonymous_variant	8195			AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.405C>T	20.37:g.10393758G>A		Somatic		WXS	SOLID	Phase_I	A8K7B0|D3DW18	Silent	SNP	ENST00000347364.3	37	CCDS13111.1																																																																																				0.398	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3			
MUC16	94025	hgsc.bcm.edu	37	19	9048320	9048320	+	Missense_Mutation	SNP	C	C	T	rs56334501	byFrequency	TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:9048320C>T	ENST00000397910.4	-	5	33514	c.33311G>A	c.(33310-33312)aGt>aAt	p.S11104N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11106	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCCCTGGAACTAGTGACCAG	0.527													C|||	927	0.185104	0.062	0.2752	5008	,	,		22994	0.3363		0.167	False		,,,				2504	0.1503																0									ASN/SER	306,3534		15,276,1629	76.0	69.0	71.0		33311	0.3	0.0	19	dbSNP_129	71	1502,6772		137,1228,2772	yes	missense	MUC16	NM_024690.2	46	152,1504,4401	TT,TC,CC		18.1533,7.9687,14.9249	benign	11104/14508	9048320	1808,10306	1920	4137	6057	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33311G>A	19.37:g.9048320C>T	ENSP00000381008:p.Ser11104Asn	Somatic		WXS	SOLID	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	464	0.21245421245421245	34	0.06910569105691057	91	0.2513812154696133	213	0.3723776223776224	126	0.1662269129287599	c	12.98	2.099153	0.37048	0.079687	0.181533	ENSG00000181143	ENST00000397910	T	0.02656	4.21	2.94	0.273	0.15650	.	.	.	.	.	T	0.00012	0.0000	M	0.63843	1.955	.	.	.	B	0.34226	0.443	B	0.37888	0.26	T	0.45469	-0.9259	8	0.87932	D	0	.	7.801	0.29174	0.5775:0.4225:0.0:0.0	rs56334501;rs61745162	11104	B5ME49	.	N	11104	ENSP00000381008:S11104N	ENSP00000381008:S11104N	S	-	2	0	MUC16	8909320	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.768000	0.01794	0.105000	0.17753	-0.345000	0.07892	AGT		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MUC16	94025	hgsc.bcm.edu;ucsc.edu	37	19	9074828	9074828	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:9074828C>T	ENST00000397910.4	-	3	12821	c.12618G>A	c.(12616-12618)atG>atA	p.M4206I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4208	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTATCCTCGACATGTCTGTGG	0.493																																																	0													80.0	76.0	77.0					19																	9074828		1943	4152	6095	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12618G>A	19.37:g.9074828C>T	ENSP00000381008:p.Met4206Ile	Somatic		WXS	SOLID	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	3.636	-0.074506	0.07184	.	.	ENSG00000181143	ENST00000397910	T	0.18810	2.19	1.31	-2.61	0.06171	.	.	.	.	.	T	0.05823	0.0152	N	0.01352	-0.895	.	.	.	B	0.15141	0.012	B	0.09377	0.004	T	0.29458	-1.0011	8	0.87932	D	0	.	2.5085	0.04651	0.4896:0.3178:0.0:0.1926	.	4206	B5ME49	.	I	4206	ENSP00000381008:M4206I	ENSP00000381008:M4206I	M	-	3	0	MUC16	8935828	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-1.653000	0.01986	-0.961000	0.03609	0.313000	0.20887	ATG		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MUC16	94025	hgsc.bcm.edu;ucsc.edu	37	19	9091029	9091029	+	Silent	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:9091029T>C	ENST00000397910.4	-	1	989	c.786A>G	c.(784-786)ggA>ggG	p.G262G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	262	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAAGGGATATCCAGTGGTTG	0.448																																																	0													129.0	130.0	130.0					19																	9091029		1951	4153	6104	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.786A>G	19.37:g.9091029T>C		Somatic		WXS	SOLID	Phase_I	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
NCAPH	23397	hgsc.bcm.edu;ucsc.edu	37	2	97020027	97020027	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:97020027G>A	ENST00000240423.4	+	9	1152	c.1109G>A	c.(1108-1110)gGg>gAg	p.G370E	NCAPH_ENST00000427946.1_Missense_Mutation_p.G234E|NCAPH_ENST00000455200.1_Missense_Mutation_p.G359E	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	370					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				GGGTCCCTGGGGGATGACTTT	0.532																																																	0													161.0	157.0	158.0					2																	97020027		2203	4300	6503	SO:0001583	missense	23397			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1109G>A	2.37:g.97020027G>A	ENSP00000240423:p.Gly370Glu	Somatic		WXS	SOLID	Phase_I	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	CCDS2021.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.426320	0.01117	.	.	ENSG00000121152	ENST00000240423;ENST00000427946;ENST00000435975;ENST00000455200	T;T;T;T	0.44482	0.92;0.93;0.94;0.93	5.27	2.63	0.31362	.	0.366682	0.27720	N	0.018126	T	0.10035	0.0246	N	0.00465	-1.465	0.31159	N	0.704615	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.002;0.002;0.003;0.001	T	0.07927	-1.0747	10	0.29301	T	0.29	-11.4446	1.933	0.03331	0.5806:0.1612:0.0912:0.167	.	346;359;359;370	B4DRG7;E9PHA2;C9J470;Q15003	.;.;.;CND2_HUMAN	E	370;234;359;359	ENSP00000240423:G370E;ENSP00000400774:G234E;ENSP00000405237:G359E;ENSP00000407308:G359E	ENSP00000240423:G370E	G	+	2	0	NCAPH	96383754	1.000000	0.71417	0.518000	0.27811	0.369000	0.29798	1.332000	0.33805	0.283000	0.22279	-0.459000	0.05422	GGG		0.532	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2		NM_015341	
NRG1	3084	hgsc.bcm.edu;ucsc.edu	37	8	32600253	32600253	+	Intron	SNP	T	T	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr8:32600253T>A	ENST00000405005.3	+	7	700				NRG1_ENST00000520407.1_Missense_Mutation_p.S412R|NRG1_ENST00000523079.1_Splice_Site|NRG1_ENST00000356819.4_Splice_Site|NRG1_ENST00000519301.1_Splice_Site|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000520502.2_Missense_Mutation_p.S286R|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000341377.5_Splice_Site|NRG1_ENST00000287842.3_Splice_Site|NRG1_ENST00000539990.1_Splice_Site|NRG1_ENST00000287845.5_Splice_Site			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCTTCTACAGTACGTCCACTC	0.463																																																	0													283.0	237.0	253.0					8																	32600253		2203	4300	6503	SO:0001627	intron_variant	3084			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.700+660T>A	8.37:g.32600253T>A		Somatic		WXS	SOLID	Phase_I	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.77|19.77	3.888557|3.888557	0.72524|0.72524	.|.	.|.	ENSG00000157168|ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000523079;ENST00000356819;ENST00000287845;ENST00000287842;ENST00000518084;ENST00000519240;ENST00000539990|ENST00000520407;ENST00000520502	.|D;D	.|0.91740	.|-2.9;-2.9	6.03|6.03	4.88|4.88	0.63580|0.63580	.|.	.|.	.|.	.|.	.|.	.|D	.|0.92231	.|0.7536	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B;B;D;P	.|0.53462	.|0.127;0.126;0.96;0.865	.|B;B;P;P	.|0.50537	.|0.042;0.082;0.643;0.618	.|D	.|0.90851	.|0.4731	.|7	.|.	.|.	.|.	.|.	11.8765|11.8765	0.52550|0.52550	0.0:0.0674:0.0:0.9326|0.0:0.0674:0.0:0.9326	.|.	.|196;286;231;412	.|B0FWZ3;Q02297-10;Q02297-8;Q02297-9	.|.;.;.;.	.|R	-1|412;286	.|ENSP00000434640:S412R;ENSP00000433289:S286R	.|.	.|S	+|+	.|3	.|2	NRG1|NRG1	32719795|32719795	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.015000|8.015000	0.88690|0.88690	1.113000|1.113000	0.41760|0.41760	0.533000|0.533000	0.62120|0.62120	.|AGT		0.463	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			
PADI2	11240	hgsc.bcm.edu;ucsc.edu	37	1	17396596	17396596	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:17396596A>C	ENST00000375486.4	-	15	1814	c.1751T>G	c.(1750-1752)tTc>tGc	p.F584C	PADI2_ENST00000466151.1_5'UTR|PADI2_ENST00000444885.2_Missense_Mutation_p.F468C	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	584					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	GTTTGGGAAGAAGGCTCTGGC	0.587																																																	0													113.0	91.0	99.0					1																	17396596		2203	4300	6503	SO:0001583	missense	11240			AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1751T>G	1.37:g.17396596A>C	ENSP00000364635:p.Phe584Cys	Somatic		WXS	SOLID	Phase_I	Q96DA7|Q9UPN2	Missense_Mutation	SNP	ENST00000375486.4	37	CCDS177.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672295	0.67928	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	T;T	0.31769	1.48;1.48	4.74	-3.02	0.05446	Protein-arginine deiminase, C-terminal (1);	0.644721	0.17000	N	0.190930	T	0.51346	0.1669	M	0.79926	2.475	0.28733	N	0.902398	D;D	0.89917	1.0;0.967	D;P	0.79784	0.993;0.828	T	0.53194	-0.8473	10	0.87932	D	0	-11.9227	12.1099	0.53834	0.3355:0.0:0.0:0.6645	.	468;584	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	C	584;468	ENSP00000364635:F584C;ENSP00000405894:F468C	ENSP00000364635:F584C	F	-	2	0	PADI2	17269183	0.943000	0.32029	0.992000	0.48379	0.978000	0.69477	0.007000	0.13174	-0.265000	0.09352	0.460000	0.39030	TTC		0.587	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1			
OR2T27	403239	hgsc.bcm.edu	37	1	248814052	248814052	+	Missense_Mutation	SNP	T	T	A	rs28533004		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:248814052T>A	ENST00000344889.3	-	1	133	c.134A>T	c.(133-135)aAg>aTg	p.K45M		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	45			K -> M (in dbSNP:rs28533004).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGAATGATCTTGACCACGTT	0.517																																																	0													51.0	44.0	46.0					1																	248814052		2202	4282	6484	SO:0001583	missense	403239				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.134A>T	1.37:g.248814052T>A	ENSP00000342008:p.Lys45Met	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000344889.3	37	CCDS31124.1	1246	0.5705128205128205	263	0.5345528455284553	219	0.6049723756906077	318	0.5559440559440559	446	0.5883905013192612	.	0.006	-2.110494	0.00353	.	.	ENSG00000187701	ENST00000344889	T	0.00355	7.91	3.3	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	N	0.000198	T	0.00012	0.0000	N	0.00004	-3.355	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.26608	-1.0098	9	0.02654	T	1	.	8.1814	0.31313	0.8202:0.0:0.0:0.1798	rs28533004	45	Q8NH04	O2T27_HUMAN	M	45	ENSP00000342008:K45M	ENSP00000342008:K45M	K	-	2	0	OR2T27	246880675	0.022000	0.18835	0.828000	0.32881	0.018000	0.09664	2.940000	0.49003	0.470000	0.27294	-1.235000	0.01560	AAG		0.517	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1		NM_001001824	
PCDHB7	56129	hgsc.bcm.edu	37	5	140553822	140553822	+	Missense_Mutation	SNP	C	C	A	rs202165393	byFrequency	TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr5:140553822C>A	ENST00000231137.3	+	1	1580	c.1406C>A	c.(1405-1407)cCc>cAc	p.P469H		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	469	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCGCCCTGCCCATCGGCAGT	0.632													C|||	15	0.00299521	0.0008	0.0187	5008	,	,		17961	0.001		0.0	False		,,,				2504	0.0																0								C	HIS/PRO	2,4404		0,2,2201	112.0	111.0	112.0		1406	1.9	1.0	5		112	7,8593		0,7,4293	no	missense	PCDHB7	NM_018940.2	77	0,9,6494	AA,AC,CC		0.0814,0.0454,0.0692	benign	469/794	140553822	9,12997	2203	4300	6503	SO:0001583	missense	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1406C>A	5.37:g.140553822C>A	ENSP00000231137:p.Pro469His	Somatic		WXS	SOLID	Phase_I	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	63	0.028846153846153848	20	0.04065040650406504	16	0.04419889502762431	4	0.006993006993006993	23	0.030343007915567283	N	0.020	-1.437021	0.01098	4.54E-4	8.14E-4	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.01745	4.66	4.44	1.9	0.25705	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.00241	0.0007	N	0.05230	-0.09	0.21020	N	0.999809	B	0.02656	0.0	B	0.04013	0.001	T	0.47262	-0.9131	9	0.02654	T	1	.	5.1719	0.15114	0.3915:0.2663:0.0:0.3421	.	469	Q9Y5E2	PCDB7_HUMAN	H	469;252	ENSP00000231137:P469H	ENSP00000231137:P469H	P	+	2	0	PCDHB7	140534006	0.000000	0.05858	1.000000	0.80357	0.987000	0.75469	0.213000	0.17521	0.162000	0.19483	-0.395000	0.06472	CCC		0.632	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2		NM_018940	
PDCD11	22984	hgsc.bcm.edu;ucsc.edu	37	10	105164925	105164925	+	Silent	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr10:105164925C>T	ENST00000369797.3	+	5	643	c.549C>T	c.(547-549)gcC>gcT	p.A183A		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	183					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GTGCTGAGGCCCTGAAGCCTG	0.552																																																	0													159.0	138.0	145.0					10																	105164925		2203	4300	6503	SO:0001819	synonymous_variant	22984			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.549C>T	10.37:g.105164925C>T		Somatic		WXS	SOLID	Phase_I	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	CCDS31276.1																																																																																				0.552	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			
PDE4C	5143	hgsc.bcm.edu	37	19	18329004	18329004	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:18329004C>T	ENST00000355502.3	-	15	2156	c.1285G>A	c.(1285-1287)Gac>Aac	p.D429N	PDE4C_ENST00000447275.3_Missense_Mutation_p.D323N|PDE4C_ENST00000594465.3_Missense_Mutation_p.D429N|PDE4C_ENST00000594617.3_Missense_Mutation_p.D429N|PDE4C_ENST00000597297.1_Missense_Mutation_p.D199N|PDE4C_ENST00000262805.12_Missense_Mutation_p.D397N|PDE4C_ENST00000539010.1_Missense_Mutation_p.D198N|PDE4C_ENST00000598111.2_Missense_Mutation_p.D144N|AC068499.10_ENST00000594805.3_RNA			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	429					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TGGTCCACGTCGTGGATGGCG	0.597																																																	0													104.0	99.0	101.0					19																	18329004		2203	4300	6503	SO:0001583	missense	5143				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1285G>A	19.37:g.18329004C>T	ENSP00000347689:p.Asp429Asn	Somatic		WXS	SOLID	Phase_I	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	37	CCDS12373.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499830	0.64298	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87	4.61	4.61	0.57282	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	D	0.95227	0.8452	H	0.98068	4.14	0.47214	D	0.999353	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.994;1.0	D	0.96993	0.9723	10	0.87932	D	0	.	14.9276	0.70890	0.0:1.0:0.0:0.0	.	429;397;235;144	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	N	508;429;417;397;323;235;143;198;538	ENSP00000347689:D429N;ENSP00000262805:D397N;ENSP00000402091:D323N;ENSP00000439470:D198N	ENSP00000262805:D397N	D	-	1	0	PDE4C	18190004	1.000000	0.71417	0.744000	0.31058	0.049000	0.14656	5.749000	0.68704	2.110000	0.64415	0.313000	0.20887	GAC		0.597	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1			
PDE4DIP	9659	hgsc.bcm.edu	37	1	144906486	144906486	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:144906486G>A	ENST00000369354.3	-	18	2560	c.2371C>T	c.(2371-2373)Cag>Tag	p.Q791*	PDE4DIP_ENST00000369356.4_Nonsense_Mutation_p.Q791*|PDE4DIP_ENST00000369351.3_Nonsense_Mutation_p.Q791*|PDE4DIP_ENST00000313382.9_Nonsense_Mutation_p.Q857*|PDE4DIP_ENST00000479408.2_Nonsense_Mutation_p.Q578*|PDE4DIP_ENST00000369359.4_Nonsense_Mutation_p.Q928*|PDE4DIP_ENST00000530740.1_Nonsense_Mutation_p.Q928*|PDE4DIP_ENST00000529945.1_Nonsense_Mutation_p.Q954*|PDE4DIP_ENST00000313431.9_Nonsense_Mutation_p.Q954*|PDE4DIP_ENST00000369349.3_Nonsense_Mutation_p.Q791*|PDE4DIP_ENST00000524974.1_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	791					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCCTGCACCTGCAGCTCTTCT	0.413			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													102.0	102.0	102.0					1																	144906486		2203	4296	6499	SO:0001587	stop_gained	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2371C>T	1.37:g.144906486G>A	ENSP00000358360:p.Gln791*	Somatic		WXS	SOLID	Phase_I	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Nonsense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	41	8.534783	0.98852	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	18.3129	0.90207	0.0:0.0:1.0:0.0	.	.	.	.	X	857;791;791;954;928;928;791;791;954;954;578	.	ENSP00000327209:Q857X	Q	-	1	0	PDE4DIP	143617843	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.776000	0.75023	2.928000	0.99379	0.638000	0.83543	CAG		0.413	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2		NM_022359	
POGK	57645	hgsc.bcm.edu	37	1	166818812	166818812	+	Silent	SNP	G	G	T	rs369140999		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:166818812G>T	ENST00000367875.1	+	5	1356	c.996G>T	c.(994-996)ccG>ccT	p.P332P	POGK_ENST00000367876.4_Silent_p.P332P|POGK_ENST00000536514.1_Silent_p.P247P|POGK_ENST00000537173.1_Silent_p.P214P			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	332					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						AGCACCTGCCGGAAGACCTGA	0.547																																					GBM(76;192 1530 30153 48742)												0													77.0	80.0	79.0					1																	166818812		2203	4300	6503	SO:0001819	synonymous_variant	57645			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.996G>T	1.37:g.166818812G>T		Somatic		WXS	SOLID	Phase_I	Q5TIJ1|Q8TE07	Silent	SNP	ENST00000367875.1	37	CCDS1254.1																																																																																				0.547	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1		NM_017542	
POP7	10248	hgsc.bcm.edu	37	7	100304816	100304816	+	Silent	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr7:100304816G>A	ENST00000303151.4	+	2	625	c.363G>A	c.(361-363)ctG>ctA	p.L121L		NM_005837.2	NP_005828.2	O75817	POP7_HUMAN	processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)	121					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			endometrium(2)|kidney(1)|ovary(1)	4	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGGAGCCACTGACTCGGATCC	0.572																																																	0													66.0	67.0	66.0					7																	100304816		2203	4300	6503	SO:0001819	synonymous_variant	10248			U94316	CCDS5704.1	7q22	2012-05-21	2007-06-26		ENSG00000172336	ENSG00000172336			19949	protein-coding gene	gene with protein product	"""ribonuclease P protein subunit p20"""	606113	"""processing of precursor 7, ribonuclease P subunit (S. cerevisiae)"""			9630247	Standard	NM_005837		Approved	RPP20, RPP2	uc003uwh.4	O75817	OTTHUMG00000044311	ENST00000303151.4:c.363G>A	7.37:g.100304816G>A		Somatic		WXS	SOLID	Phase_I	A4D2E0|Q9BV74	Silent	SNP	ENST00000303151.4	37	CCDS5704.1																																																																																				0.572	POP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103070.1		NM_005837	
RHAG	6005	hgsc.bcm.edu	37	6	49587014	49587014	+	Silent	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr6:49587014C>T	ENST00000371175.4	-	2	245	c.219G>A	c.(217-219)aaG>aaA	p.K73K	RHAG_ENST00000229810.7_Silent_p.K73K	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	73					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					AGCCATATTTCTTCAGGAAGG	0.448																																					Ovarian(176;476 2003 7720 43408 44749)												0													90.0	76.0	81.0					6																	49587014		2203	4300	6503	SO:0001819	synonymous_variant	6005				CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.219G>A	6.37:g.49587014C>T		Somatic		WXS	SOLID	Phase_I	B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Silent	SNP	ENST00000371175.4	37	CCDS4927.1																																																																																				0.448	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1			
SARS	6301	hgsc.bcm.edu;ucsc.edu	37	1	109773533	109773533	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:109773533G>T	ENST00000234677.2	+	5	556	c.481G>T	c.(481-483)Gat>Tat	p.D161Y	SARS_ENST00000369923.4_Missense_Mutation_p.D161Y	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	161					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	GATTTGGGGTGATTGTACAGT	0.423																																																	0													164.0	160.0	161.0					1																	109773533		2203	4300	6503	SO:0001583	missense	6301			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.481G>T	1.37:g.109773533G>T	ENSP00000234677:p.Asp161Tyr	Somatic		WXS	SOLID	Phase_I	B2R6Y9|Q5T5C8|Q9NSE3	Missense_Mutation	SNP	ENST00000234677.2	37	CCDS795.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852916	0.71719	.	.	ENSG00000031698	ENST00000234677;ENST00000369923	T;T	0.76186	-1.0;-1.0	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.86243	0.5886	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.998	D;D;D	0.67231	0.95;0.95;0.95	D	0.88412	0.3022	10	0.87932	D	0	-18.1902	18.7283	0.91724	0.0:0.0:1.0:0.0	.	161;161;161	Q0VGA5;Q5T5C7;P49591	.;.;SYSC_HUMAN	Y	161	ENSP00000234677:D161Y;ENSP00000358939:D161Y	ENSP00000234677:D161Y	D	+	1	0	SARS	109575056	1.000000	0.71417	0.572000	0.28498	0.487000	0.33371	7.415000	0.80131	2.526000	0.85167	0.650000	0.86243	GAT		0.423	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032394.2		NM_006513	
SERPINB1	1992	hgsc.bcm.edu	37	6	2834179	2834179	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr6:2834179T>C	ENST00000380739.5	-	7	1005	c.803A>G	c.(802-804)gAa>gGa	p.E268G	SERPINB1_ENST00000476896.1_5'Flank|SERPINB1_ENST00000537185.1_Missense_Mutation_p.E117G	NM_030666.3	NP_109591.1	P30740	ILEU_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 1	268					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|ovary(2)	13	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		GACATTAACTTCAATGAAATC	0.443																																																	0													45.0	40.0	42.0					6																	2834179		2203	4300	6503	SO:0001583	missense	1992			M93056	CCDS4477.1	6p25.2	2014-02-18	2005-08-18		ENSG00000021355	ENSG00000021355		"""Serine (or cysteine) peptidase inhibitors"""	3311	protein-coding gene	gene with protein product		130135	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1"""	ELANH2		1376927, 24172014	Standard	NM_030666		Approved	EI, PI2, anti-elastase	uc003mub.4	P30740	OTTHUMG00000014124	ENST00000380739.5:c.803A>G	6.37:g.2834179T>C	ENSP00000370115:p.Glu268Gly	Somatic		WXS	SOLID	Phase_I	A8K5L2|B4DNT0|Q53FB9|Q5W0E1|Q9UDF8	Missense_Mutation	SNP	ENST00000380739.5	37	CCDS4477.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.460712	0.63513	.	.	ENSG00000021355	ENST00000380739;ENST00000542771;ENST00000537185	D;D	0.85258	-1.96;-1.96	5.57	4.4	0.53042	Serpin domain (3);	0.475569	0.23123	N	0.051670	T	0.76962	0.4061	M	0.69523	2.12	0.43296	D	0.995283	P	0.38195	0.622	B	0.36766	0.232	T	0.79492	-0.1781	10	0.87932	D	0	.	11.0875	0.48095	0.0:0.0728:0.0:0.9272	.	268	P30740	ILEU_HUMAN	G	268;230;117	ENSP00000370115:E268G;ENSP00000444543:E117G	ENSP00000370115:E268G	E	-	2	0	SERPINB1	2779178	1.000000	0.71417	0.026000	0.17262	0.053000	0.15095	7.746000	0.85057	1.052000	0.40392	-0.297000	0.09499	GAA		0.443	SERPINB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039637.1			
SEZ6L2	26470	hgsc.bcm.edu;ucsc.edu	37	16	29884668	29884668	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr16:29884668G>T	ENST00000308713.5	-	14	2908	c.2381C>A	c.(2380-2382)tCt>tAt	p.S794Y	SEZ6L2_ENST00000346932.5_Missense_Mutation_p.S680Y|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.S750Y|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.S724Y	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	794	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAAGCGCAGAGACTCGCCCGC	0.637																																																	0													113.0	112.0	112.0					16																	29884668		2197	4300	6497	SO:0001583	missense	26470			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.2381C>A	16.37:g.29884668G>T	ENSP00000312550:p.Ser794Tyr	Somatic		WXS	SOLID	Phase_I	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187160	0.78789	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	4.39	4.39	0.52855	Complement control module (2);Sushi/SCR/CCP (3);	0.305247	0.23896	N	0.043486	T	0.76126	0.3944	M	0.62209	1.925	0.49051	D	0.999743	D;P;D;P;P;P	0.61080	0.98;0.938;0.989;0.924;0.938;0.924	P;P;P;P;P;P	0.58077	0.782;0.77;0.832;0.66;0.77;0.66	T	0.79505	-0.1776	10	0.66056	D	0.02	.	15.8793	0.79193	0.0:0.0:1.0:0.0	.	750;794;680;724;794;724	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	Y	724;794;680;750	ENSP00000310206:S724Y;ENSP00000312550:S794Y;ENSP00000319215:S680Y;ENSP00000439412:S750Y	ENSP00000312550:S794Y	S	-	2	0	SEZ6L2	29792169	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.263000	0.95617	2.257000	0.74773	0.655000	0.94253	TCT		0.637	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2		NM_012410	
SH3GL1	6455	hgsc.bcm.edu	37	19	4363421	4363421	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:4363421T>C	ENST00000269886.3	-	7	852	c.674A>G	c.(673-675)tAc>tGc	p.Y225C	AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000417295.2_Missense_Mutation_p.Y177C|SH3GL1_ENST00000598564.1_Missense_Mutation_p.Y161C	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	225	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Interaction with ARC. {ECO:0000250}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CTGCCGGTGGTAGTCCAGCTG	0.657			T	MLL	AL																																NSCLC(94;1152 2133 30346 33362)			Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	0													32.0	26.0	28.0					19																	4363421		2202	4299	6501	SO:0001583	missense	6455				CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.674A>G	19.37:g.4363421T>C	ENSP00000269886:p.Tyr225Cys	Somatic		WXS	SOLID	Phase_I	B4DRA1|E7EVZ4|M0QZV5|Q99668	Missense_Mutation	SNP	ENST00000269886.3	37	CCDS32874.1	.	.	.	.	.	.	.	.	.	.	.	19.45	3.830410	0.71258	.	.	ENSG00000141985	ENST00000269886;ENST00000417295	T;T	0.57436	0.4;0.4	4.67	4.67	0.58626	BAR (3);	0.000000	0.85682	U	0.000000	T	0.77831	0.4189	M	0.92833	3.35	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.83622	0.0140	10	0.87932	D	0	-29.1884	13.2607	0.60102	0.0:0.0:0.0:1.0	.	177;225;225	E7EVZ4;Q6FGM0;Q99961	.;.;SH3G1_HUMAN	C	225;177	ENSP00000269886:Y225C;ENSP00000404568:Y177C	ENSP00000269886:Y225C	Y	-	2	0	SH3GL1	4314421	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	6.141000	0.71744	1.737000	0.51674	0.454000	0.30748	TAC		0.657	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1		NM_003025	
SMC6	79677	hgsc.bcm.edu	37	2	17922877	17922877	+	Splice_Site	SNP	A	A	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:17922877A>G	ENST00000448223.2	-	4	508		c.e4+1		SMC6_ENST00000402989.1_Splice_Site|SMC6_ENST00000351948.4_Splice_Site|SMC6_ENST00000381272.4_Splice_Site	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6						cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AAAAACACTTACTTCCATTGT	0.323																																																	0													126.0	126.0	126.0					2																	17922877		2203	4300	6503	SO:0001630	splice_region_variant	79677			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.238+1T>C	2.37:g.17922877A>G		Somatic		WXS	SOLID	Phase_I	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Splice_Site	SNP	ENST00000448223.2	37	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.584755	0.86748	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2952	0.73898	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMC6	17786358	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.842000	0.92136	2.246000	0.74042	0.533000	0.62120	.		0.323	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1		NM_024624	Intron
SOX6	55553	hgsc.bcm.edu	37	11	16010675	16010675	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr11:16010675G>A	ENST00000352083.6	-	14	1911	c.1834C>T	c.(1834-1836)Cgc>Tgc	p.R612C	SOX6_ENST00000396356.3_Missense_Mutation_p.R592C|SOX6_ENST00000528429.1_Missense_Mutation_p.R612C|SOX6_ENST00000528252.1_Missense_Mutation_p.R585C|SOX6_ENST00000527619.1_Missense_Mutation_p.R588C|SOX6_ENST00000316399.6_Missense_Mutation_p.R592C			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	612					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R592C(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						GCACGGCCGCGGGCGTCCCTG	0.522											OREG0020800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	ovary(1)											141.0	136.0	138.0					11																	16010675		2200	4294	6494	SO:0001583	missense	55553			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1834C>T	11.37:g.16010675G>A	ENSP00000339876:p.Arg612Cys	Somatic	707	WXS	SOLID	Phase_I	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37		.	.	.	.	.	.	.	.	.	.	G	20.7	4.034538	0.75617	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98264	-4.82;-4.8;-4.82;-4.83;-4.83;-4.8	5.72	5.72	0.89469	High mobility group, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98454	0.9485	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.995	D	0.99904	1.1171	10	0.87932	D	0	.	19.879	0.96888	0.0:0.0:1.0:0.0	.	592;612;588	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	C	592;612;592;585;588;612	ENSP00000324948:R592C;ENSP00000339876:R612C;ENSP00000379644:R592C;ENSP00000432134:R585C;ENSP00000434455:R588C;ENSP00000433233:R612C	ENSP00000324948:R592C	R	-	1	0	SOX6	15967251	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.531000	0.60602	2.695000	0.91970	0.655000	0.94253	CGC		0.522	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1		NM_033326	
STK11IP	114790	hgsc.bcm.edu	37	2	220466798	220466798	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:220466798C>A	ENST00000456909.1	+	5	521	c.431C>A	c.(430-432)gCa>gAa	p.A144E	STK11IP_ENST00000295641.10_Missense_Mutation_p.A155E|STK11IP_ENST00000459692.1_3'UTR			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	155					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.A144V(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCTCCAGGCATTAGAGGTA	0.572																																																	1	Substitution - Missense(1)	ovary(1)											26.0	25.0	26.0					2																	220466798		1986	4156	6142	SO:0001583	missense	114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.431C>A	2.37:g.220466798C>A	ENSP00000389383:p.Ala144Glu	Somatic		WXS	SOLID	Phase_I	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37		.	.	.	.	.	.	.	.	.	.	C	22.7	4.325209	0.81580	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.05025	3.51;3.51	4.93	4.93	0.64822	.	0.629307	0.16429	N	0.214808	T	0.16041	0.0386	L	0.47716	1.5	0.28828	N	0.897306	B;D;D;D	0.61697	0.184;0.965;0.96;0.99	B;P;P;P	0.61003	0.131;0.55;0.55;0.882	T	0.01326	-1.1384	10	0.44086	T	0.13	-1.1989	13.6658	0.62393	0.0:0.8449:0.155:0.0	.	155;155;155;155	B4DUE4;B4DII2;Q8N1F8-2;Q8N1F8	.;.;.;S11IP_HUMAN	E	144;155;155	ENSP00000389383:A144E;ENSP00000295641:A155E	ENSP00000295641:A155E	A	+	2	0	STK11IP	220175042	0.997000	0.39634	0.994000	0.49952	0.847000	0.48162	3.846000	0.55888	2.549000	0.85964	0.655000	0.94253	GCA		0.572	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1		NM_052902	
SVEP1	79987	hgsc.bcm.edu	37	9	113169538	113169538	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr9:113169538A>G	ENST00000401783.2	-	38	8678	c.8342T>C	c.(8341-8343)gTc>gCc	p.V2781A	SVEP1_ENST00000374469.1_Missense_Mutation_p.V2758A|SVEP1_ENST00000297826.5_Missense_Mutation_p.V707A	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2781	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCCATTCATGACTGGATTTGG	0.468																																																	0													119.0	118.0	118.0					9																	113169538		2041	4193	6234	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8342T>C	9.37:g.113169538A>G	ENSP00000384917:p.Val2781Ala	Somatic		WXS	SOLID	Phase_I	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	8.316	0.823288	0.16678	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	T;T;T	0.66460	-0.21;-0.21;-0.21	5.47	5.47	0.80525	Complement control module (2);Sushi/SCR/CCP (3);	0.613800	0.16396	N	0.216256	T	0.61527	0.2354	L	0.61218	1.895	0.80722	D	1	B	0.31655	0.334	B	0.28385	0.089	T	0.59252	-0.7489	10	0.31617	T	0.26	.	10.9783	0.47480	0.9269:0.0:0.0731:0.0	.	2781	Q4LDE5	SVEP1_HUMAN	A	2781;2758;707;453	ENSP00000384917:V2781A;ENSP00000363593:V2758A;ENSP00000297826:V707A	ENSP00000297826:V707A	V	-	2	0	SVEP1	112209359	0.735000	0.28153	0.005000	0.12908	0.360000	0.29518	6.067000	0.71193	2.203000	0.70933	0.482000	0.46254	GTC		0.468	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
TDRKH	11022	hgsc.bcm.edu;ucsc.edu	37	1	151751697	151751697	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:151751697C>T	ENST00000368822.1	-	5	1076	c.443G>A	c.(442-444)cGt>cAt	p.R148H	TDRKH_ENST00000368827.6_Missense_Mutation_p.R148H|TDRKH_ENST00000458431.2_Missense_Mutation_p.R148H|TDRKH_ENST00000368824.3_Missense_Mutation_p.R148H|TDRKH_ENST00000440583.2_5'UTR|TDRKH_ENST00000368823.1_Missense_Mutation_p.R144H|TDRKH_ENST00000484421.1_5'UTR|TDRKH_ENST00000368825.3_Intron			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	148	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACAGATAGAACGAATTGTCTC	0.403																																																	0													114.0	105.0	108.0					1																	151751697		1859	4094	5953	SO:0001583	missense	11022			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.443G>A	1.37:g.151751697C>T	ENSP00000357812:p.Arg148His	Somatic		WXS	SOLID	Phase_I	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	ENST00000368822.1	37	CCDS41394.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691897	0.88735	.	.	ENSG00000182134	ENST00000368827;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431	T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37	5.87	5.87	0.94306	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.053244	0.64402	D	0.000001	T	0.63117	0.2484	M	0.88181	2.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.989	T	0.68758	-0.5324	10	0.72032	D	0.01	-10.3827	18.7883	0.91964	0.0:1.0:0.0:0.0	.	144;148	Q5SZR4;Q9Y2W6	.;TDRKH_HUMAN	H	148;148;144;148;148	ENSP00000357819:R148H;ENSP00000357815:R148H;ENSP00000357813:R144H;ENSP00000357812:R148H;ENSP00000395718:R148H	ENSP00000357812:R148H	R	-	2	0	TDRKH	150018321	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.468000	0.60162	2.770000	0.95276	0.650000	0.86243	CGT		0.403	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2		NM_006862	
TAF1A	9015	hgsc.bcm.edu;ucsc.edu	37	1	222736578	222736578	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:222736578C>T	ENST00000352967.4	-	9	1210	c.1022G>A	c.(1021-1023)gGa>gAa	p.G341E	TAF1A_ENST00000391882.1_Missense_Mutation_p.G227E|TAF1A_ENST00000366890.1_Missense_Mutation_p.G227E|TAF1A_ENST00000350027.4_Missense_Mutation_p.G341E	NM_005681.3	NP_005672.1	Q15573	TAF1A_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	341					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA binding (GO:0003677)			kidney(3)|large_intestine(3)|lung(11)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(131;0.0186)		CTTAGTGCATCCGGCAAAATC	0.333																																																	0													77.0	79.0	78.0					1																	222736578		2202	4297	6499	SO:0001583	missense	9015			L39060	CCDS1531.1, CCDS1532.1	1q42	2008-02-05	2002-08-29		ENSG00000143498	ENSG00000143498			11532	protein-coding gene	gene with protein product		604903	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kD"""			7801123	Standard	NM_005681		Approved	TAFI48, SL1	uc009xdz.2	Q15573	OTTHUMG00000037544	ENST00000352967.4:c.1022G>A	1.37:g.222736578C>T	ENSP00000327072:p.Gly341Glu	Somatic		WXS	SOLID	Phase_I	B2RDZ8|D3DTB7|Q9NWA1	Missense_Mutation	SNP	ENST00000352967.4	37	CCDS1531.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736386	0.89482	.	.	ENSG00000143498	ENST00000366890;ENST00000350027;ENST00000352967;ENST00000391882	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	6.04	6.04	0.98038	.	0.086995	0.85682	D	0.000000	T	0.63236	0.2494	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63422	-0.6641	10	0.59425	D	0.04	-8.2029	17.5116	0.87761	0.0:1.0:0.0:0.0	.	341	Q15573	TAF1A_HUMAN	E	227;341;341;227	ENSP00000355856:G227E;ENSP00000339976:G341E;ENSP00000327072:G341E;ENSP00000375754:G227E	ENSP00000339976:G341E	G	-	2	0	TAF1A	220803201	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.060000	0.64312	2.873000	0.98535	0.563000	0.77884	GGA		0.333	TAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091493.2		NM_005681	
TGS1	96764	hgsc.bcm.edu	37	8	56711602	56711602	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr8:56711602A>C	ENST00000260129.5	+	8	2149	c.1672A>C	c.(1672-1674)Aaa>Caa	p.K558Q		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	558					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			GTCTGTTAAAAAAGGTGATGA	0.413																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0													139.0	121.0	127.0					8																	56711602		2203	4300	6503	SO:0001583	missense	96764			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.1672A>C	8.37:g.56711602A>C	ENSP00000260129:p.Lys558Gln	Somatic		WXS	SOLID	Phase_I	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	ENST00000260129.5	37	CCDS34894.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.202204	0.58234	.	.	ENSG00000137574	ENST00000260129	T	0.10960	2.82	5.73	2.01	0.26516	.	0.466924	0.24965	N	0.034188	T	0.10337	0.0253	M	0.68317	2.08	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.15052	0.012;0.011	T	0.32824	-0.9892	10	0.52906	T	0.07	-4.906	1.6996	0.02870	0.5251:0.1397:0.2151:0.1201	.	558;558	B2RBJ7;Q96RS0	.;TGS1_HUMAN	Q	558	ENSP00000260129:K558Q	ENSP00000260129:K558Q	K	+	1	0	TGS1	56874156	0.000000	0.05858	0.000000	0.03702	0.891000	0.51852	-0.062000	0.11674	0.099000	0.17552	0.528000	0.53228	AAA		0.413	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1		NM_024831	
TNIP1	10318	hgsc.bcm.edu;ucsc.edu	37	5	150422134	150422134	+	Silent	SNP	G	G	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr5:150422134G>C	ENST00000389378.2	-	11	1689	c.1101C>G	c.(1099-1101)ctC>ctG	p.L367L	TNIP1_ENST00000523338.1_Silent_p.L367L|TNIP1_ENST00000315050.7_Silent_p.L367L|TNIP1_ENST00000518977.1_Silent_p.L367L|TNIP1_ENST00000524280.1_Silent_p.L367L|TNIP1_ENST00000522226.1_Silent_p.L367L|TNIP1_ENST00000520931.1_Silent_p.L314L|TNIP1_ENST00000521423.1_Intron|TNIP1_ENST00000523200.1_Silent_p.L367L|TNIP1_ENST00000521591.1_Silent_p.L367L	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	367	Interaction with Shigella flexneri ipah9.8.|Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGCCAGGAGGAGCTTGCGGT	0.567																																																	0													66.0	62.0	63.0					5																	150422134		2203	4300	6503	SO:0001819	synonymous_variant	10318			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1101C>G	5.37:g.150422134G>C		Somatic		WXS	SOLID	Phase_I	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	ENST00000389378.2	37	CCDS34280.1																																																																																				0.567	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1		NM_006058	
TRIM16	10626	hgsc.bcm.edu	37	17	15539426	15539426	+	Missense_Mutation	SNP	C	C	T	rs200176122		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr17:15539426C>T	ENST00000578237.1	-	8	1628	c.773G>A	c.(772-774)aGg>aAg	p.R258K	TRIM16_ENST00000336708.7_Missense_Mutation_p.R258K|TRIM16_ENST00000581224.1_5'Flank|TRIM16_ENST00000579219.1_Missense_Mutation_p.R42K|TRIM16_ENST00000416464.2_Missense_Mutation_p.R128K|RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.R258K|TRIM16_ENST00000577886.1_Missense_Mutation_p.R42K			O95361	TRI16_HUMAN	tripartite motif containing 16	258					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CTCGGCACTCCTGTACTCCAG	0.597																																																	0													127.0	103.0	111.0					17																	15539426		2188	4298	6486	SO:0001583	missense	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.773G>A	17.37:g.15539426C>T	ENSP00000463188:p.Arg258Lys	Somatic		WXS	SOLID	Phase_I	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	28|28	0.01282051282051282|0.01282051282051282	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	2|2	0.0034965034965034965|0.0034965034965034965	24|24	0.0316622691292876|0.0316622691292876	c|c	11.63|11.63	1.694498|1.694498	0.30052|0.30052	.|.	.|.	ENSG00000251537|ENSG00000221926	ENST00000455584|ENST00000336708;ENST00000416464	.|T;T	.|0.65916	.|0.11;-0.18	3.97|3.97	3.0|3.0	0.34707|0.34707	.|.	.|0.204791	.|0.37053	.|U	.|0.002275	T|T	0.17195|0.17195	0.0413|0.0413	L|L	0.27053|0.27053	0.805|0.805	0.25712|0.25712	N|N	0.985473|0.985473	.|B;B;B	.|0.29805	.|0.257;0.072;0.023	.|B;B;B	.|0.23574	.|0.043;0.047;0.028	T|T	0.02646|0.02646	-1.1129|-1.1129	5|10	.|0.20519	.|T	.|0.43	.|.	5.3947|5.3947	0.16263|0.16263	0.0:0.7753:0.0:0.2247|0.0:0.7753:0.0:0.2247	.|.	.|128;258;272	.|B3KP96;O95361;Q59EB2	.|.;TRI16_HUMAN;.	R|K	273|258;128	.|ENSP00000338989:R258K;ENSP00000399918:R128K	.|ENSP00000338989:R258K	G|R	-|-	1|2	0|0	RP11-385D13.1|TRIM16	15480151|15480151	0.991000|0.991000	0.36638|0.36638	0.941000|0.941000	0.38009|0.38009	0.717000|0.717000	0.41224|0.41224	1.626000|1.626000	0.37039|0.37039	2.230000|2.230000	0.72887|0.72887	0.555000|0.555000	0.69702|0.69702	GGA|AGG		0.597	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2		NM_006470	
TRMT2B	79979	hgsc.bcm.edu;ucsc.edu	37	X	100265618	100265618	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chrX:100265618C>A	ENST00000372936.3	-	14	2239	c.1467G>T	c.(1465-1467)ttG>ttT	p.L489F	TRMT2B_ENST00000545398.1_Missense_Mutation_p.L489F|TRMT2B_ENST00000372935.1_Missense_Mutation_p.L489F|TRMT2B_ENST00000372939.1_Missense_Mutation_p.L444F|TRMT2B_ENST00000338687.7_Missense_Mutation_p.L444F	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	489						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)			breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						TGTGAGGGAACAAATCCACAG	0.498																																																	0													114.0	95.0	102.0					X																	100265618		2203	4300	6503	SO:0001583	missense	79979			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.1467G>T	X.37:g.100265618C>A	ENSP00000362027:p.Leu489Phe	Somatic		WXS	SOLID	Phase_I	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Missense_Mutation	SNP	ENST00000372936.3	37	CCDS14477.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684254	0.47991	.	.	ENSG00000188917	ENST00000338687;ENST00000545398;ENST00000372939;ENST00000372935;ENST00000372936	T;T;T;T;T	0.50001	0.78;0.76;0.78;0.76;0.76	4.39	2.46	0.29980	.	0.253384	0.34507	N	0.003920	T	0.57504	0.2058	M	0.66297	2.02	0.80722	D	1	D;P	0.64830	0.994;0.942	P;P	0.62298	0.9;0.643	T	0.57849	-0.7740	10	0.87932	D	0	-14.065	5.9778	0.19391	0.1879:0.7033:0.0:0.1088	.	444;489	Q96GJ1-3;Q96GJ1	.;TRM2_HUMAN	F	444;489;444;489;489	ENSP00000340970:L444F;ENSP00000438134:L489F;ENSP00000362030:L444F;ENSP00000362026:L489F;ENSP00000362027:L489F	ENSP00000340970:L444F	L	-	3	2	TRMT2B	100152274	1.000000	0.71417	0.988000	0.46212	0.529000	0.34654	1.682000	0.37628	0.804000	0.34136	0.600000	0.82982	TTG		0.498	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1		NM_024917	
TTN	7273	hgsc.bcm.edu	37	2	179429258	179429258	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:179429258T>G	ENST00000591111.1	-	276	76902	c.76678A>C	c.(76678-76680)Aaa>Caa	p.K25560Q	TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K18136Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K18261Q|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K27201Q|TTN_ENST00000342175.6_Missense_Mutation_p.K18328Q|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K24633Q|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25560	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGTTATTTTGCTACCACCA	0.423																																																	0													75.0	70.0	71.0					2																	179429258		1884	4129	6013	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76678A>C	2.37:g.179429258T>G	ENSP00000465570:p.Lys25560Gln	Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	10.73	1.432270	0.25813	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57330	0.2046	M	0.68593	2.085	0.44424	D	0.997349	P;P;P;P	0.35226	0.491;0.491;0.491;0.491	B;B;B;B	0.37650	0.255;0.255;0.255;0.255	T	0.61043	-0.7142	9	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	18136;18261;18328;25560	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	24633;18136;18328;18261;18134	ENSP00000343764:K24633Q;ENSP00000434586:K18136Q;ENSP00000340554:K18328Q;ENSP00000352154:K18261Q	ENSP00000340554:K18328Q	K	-	1	0	TTN	179137504	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.539000	0.45718	2.367000	0.80283	0.528000	0.53228	AAA		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
TUBGCP6	85378	hgsc.bcm.edu;ucsc.edu	37	22	50665215	50665215	+	Silent	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr22:50665215C>T	ENST00000248846.5	-	7	1652	c.1548G>A	c.(1546-1548)gaG>gaA	p.E516E	TUBGCP6_ENST00000491449.1_5'Flank|TUBGCP6_ENST00000439308.2_Silent_p.E516E			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	516					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CAGGGTAGTGCTCGTTGCTGC	0.682																																																	0													40.0	36.0	37.0					22																	50665215		2203	4294	6497	SO:0001819	synonymous_variant	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1548G>A	22.37:g.50665215C>T		Somatic		WXS	SOLID	Phase_I	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Silent	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	C	9.399	1.077414	0.20227	.	.	ENSG00000128159	ENST00000434349	.	.	.	5.59	-1.77	0.07982	.	.	.	.	.	T	0.57799	0.2078	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56013	-0.8049	4	.	.	.	.	11.5768	0.50866	0.0:0.472:0.0:0.528	.	.	.	.	N	260	.	.	S	-	2	0	TUBGCP6	49007342	0.029000	0.19370	0.994000	0.49952	0.850000	0.48378	-0.695000	0.05109	-0.166000	0.10890	-0.254000	0.11334	AGC		0.682	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3		NM_020461	
UNG	7374	hgsc.bcm.edu;ucsc.edu	37	12	109541417	109541417	+	Splice_Site	SNP	G	G	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr12:109541417G>A	ENST00000242576.2	+	6	907		c.e6+1		UNG_ENST00000336865.2_Splice_Site	NM_080911.2	NP_550433.1			uracil-DNA glycosylase											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						CATTGATAGGGTATGttttgt	0.393								Base excision repair (BER), DNA glycosylases	Immune Deficiency with Hyper-IgM																																								0													48.0	39.0	42.0					12																	109541417		2203	4300	6503	SO:0001630	splice_region_variant	7374	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	A64377	CCDS9124.1, CCDS9125.1	12q23-q24.1	2014-09-17			ENSG00000076248	ENSG00000076248	3.2.2.27		12572	protein-coding gene	gene with protein product	"""uracil-DNA glycosylase 1, uracil-DNA glycosylase 2"""	191525		DGU		1923798, 17101234	Standard	NM_080911		Approved	UDG, UNG1, UNG2, HIGM4	uc001tnz.2	P13051	OTTHUMG00000169247	ENST00000242576.2:c.801+1G>A	12.37:g.109541417G>A		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000242576.2	37	CCDS9124.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029167	0.75504	.	.	ENSG00000076248	ENST00000242576;ENST00000336865;ENST00000537518;ENST00000542183	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7324	0.88382	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNG	108025800	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.316000	0.96319	2.500000	0.84329	0.650000	0.86243	.		0.393	UNG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403067.1		NM_080911	Intron
UXS1	80146	hgsc.bcm.edu;ucsc.edu	37	2	106729163	106729163	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:106729163A>G	ENST00000409501.3	-	10	860	c.803T>C	c.(802-804)aTg>aCg	p.M268T	UXS1_ENST00000540130.1_Missense_Mutation_p.M211T|UXS1_ENST00000409032.1_Missense_Mutation_p.M100T|UXS1_ENST00000428048.2_Missense_Mutation_p.M112T|UXS1_ENST00000283148.7_Missense_Mutation_p.M273T			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	268					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						CCCATCGTTCATGTGCATGCG	0.602																																																	0													75.0	77.0	76.0					2																	106729163		2102	4228	6330	SO:0001583	missense	80146			AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.803T>C	2.37:g.106729163A>G	ENSP00000387019:p.Met268Thr	Somatic		WXS	SOLID	Phase_I	Q8NBX3|Q9H5C2	Missense_Mutation	SNP	ENST00000409501.3	37	CCDS46378.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.227689	0.39399	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000409032;ENST00000428048;ENST00000441952;ENST00000416298;ENST00000444193	D;D;D;D;D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08;-3.08;-3.08;-3.08;-3.08	5.25	5.25	0.73442	NAD-dependent epimerase/dehydratase (1);	0.083046	0.85682	D	0.000000	D	0.87985	0.6316	N	0.11313	0.125	0.80722	D	1	B;P;P	0.36144	0.22;0.483;0.539	B;B;P	0.48166	0.289;0.433;0.569	D	0.85491	0.1185	10	0.16896	T	0.51	.	14.8147	0.70024	1.0:0.0:0.0:0.0	.	112;273;268	B4E3U7;Q8NBZ7-2;Q8NBZ7	.;.;UXS1_HUMAN	T	273;211;268;100;112;112;100;100	ENSP00000283148:M273T;ENSP00000438265:M211T;ENSP00000387019:M268T;ENSP00000387096:M100T;ENSP00000394334:M112T;ENSP00000416656:M112T;ENSP00000403612:M100T;ENSP00000404468:M100T	ENSP00000283148:M273T	M	-	2	0	UXS1	106095595	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.035000	0.88872	1.985000	0.57927	0.459000	0.35465	ATG		0.602	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1		NM_025076.3	
WDR87	83889	hgsc.bcm.edu;ucsc.edu	37	19	38382417	38382417	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr19:38382417T>A	ENST00000303868.5	-	5	3276	c.3052A>T	c.(3052-3054)Atg>Ttg	p.M1018L	WDR87_ENST00000447313.2_Missense_Mutation_p.M1057L	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1018										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GTGGCCCGCATCCCCAGTAGA	0.483																																																	0													76.0	68.0	71.0					19																	38382417		692	1591	2283	SO:0001583	missense	83889			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3052A>T	19.37:g.38382417T>A	ENSP00000368025:p.Met1018Leu	Somatic		WXS	SOLID	Phase_I	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	T	5.500	0.277264	0.10403	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.07800	3.16;3.18	4.74	-0.601	0.11638	.	0.652024	0.14216	N	0.333723	T	0.05410	0.0143	N	0.21448	0.665	0.20821	N	0.999846	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.43163	-0.9408	10	0.16420	T	0.52	-5.1584	11.7451	0.51815	0.0:0.0:0.6609:0.3391	.	1018;1057	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	L	1057;1018	ENSP00000405012:M1057L;ENSP00000368025:M1018L	ENSP00000368025:M1018L	M	-	1	0	WDR87	43074257	0.168000	0.22989	0.988000	0.46212	0.142000	0.21351	0.448000	0.21726	-0.145000	0.11294	0.368000	0.22195	ATG		0.483	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2		XM_940478	
WWOX	51741	hgsc.bcm.edu;ucsc.edu	37	16	78466519	78466519	+	Missense_Mutation	SNP	G	G	T	rs370792938		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr16:78466519G>T	ENST00000566780.1	+	8	1292	c.926G>T	c.(925-927)cGt>cTt	p.R309L	WWOX_ENST00000406884.2_Intron|WWOX_ENST00000408984.3_Missense_Mutation_p.R309L|WWOX_ENST00000539474.2_Intron|WWOX_ENST00000402655.2_Intron	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	309	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		GAGCTGCACCGTCGCCTCTCC	0.532																																																	0													120.0	124.0	122.0					16																	78466519		2073	4202	6275	SO:0001583	missense	51741			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.926G>T	16.37:g.78466519G>T	ENSP00000457230:p.Arg309Leu	Somatic		WXS	SOLID	Phase_I	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	ENST00000566780.1	37	CCDS42196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.631623|4.631623	0.87660|0.87660	.|.	.|.	ENSG00000186153|ENSG00000186153	ENST00000408984|ENST00000299644	D|.	0.85861|.	-2.04|.	5.93|5.93	5.93|5.93	0.95920|0.95920	NAD(P)-binding domain (1);|.	0.117017|.	0.64402|.	D|.	0.000016|.	D|D	0.90386|0.90386	0.6991|0.6991	H|H	0.96691|0.96691	3.865|3.865	0.80722|0.80722	D|D	1|1	D|.	0.54207|.	0.965|.	P|.	0.50405|.	0.64|.	D|D	0.92586|0.92586	0.6079|0.6079	10|6	0.72032|0.72032	D|D	0.01|0.01	.|.	20.3261|20.3261	0.98701|0.98701	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	309|.	Q9NZC7|.	WWOX_HUMAN|.	L|F	309|152	ENSP00000386161:R309L|.	ENSP00000386161:R309L|ENSP00000299644:V152F	R|V	+|+	2|1	0|0	WWOX|WWOX	77024020|77024020	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.462000|0.462000	0.32619|0.32619	9.476000|9.476000	0.97823|0.97823	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	CGT|GTC		0.532	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434328.1			
ZFPM2	23414	hgsc.bcm.edu;ucsc.edu	37	8	106815608	106815608	+	Missense_Mutation	SNP	C	C	G	rs199678497		TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr8:106815608C>G	ENST00000407775.2	+	8	3548	c.3298C>G	c.(3298-3300)Cag>Gag	p.Q1100E	RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.Q968E|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.Q968E|ZFPM2_ENST00000378472.4_Missense_Mutation_p.Q831E	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	1100					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGCAGAGGAACAGTTGTCTAG	0.478																																																	0								C	GLU/GLN	0,3800		0,0,1900	53.0	52.0	52.0		3298	5.8	1.0	8		52	2,8244		0,2,4121	no	missense	ZFPM2	NM_012082.3	29	0,2,6021	GG,GC,CC		0.0243,0.0,0.0166	benign	1100/1152	106815608	2,12044	1900	4123	6023	SO:0001583	missense	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.3298C>G	8.37:g.106815608C>G	ENSP00000384179:p.Gln1100Glu	Somatic		WXS	SOLID	Phase_I	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.456531	0.01071	0.0	2.43E-4	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.17854	2.25;2.73;2.73;3.94	5.81	5.81	0.92471	.	0.214248	0.50627	D	0.000120	T	0.10551	0.0258	N	0.12182	0.205	0.43417	D	0.995561	B	0.11235	0.004	B	0.09377	0.004	T	0.11591	-1.0581	10	0.02654	T	1	.	20.0805	0.97772	0.0:1.0:0.0:0.0	.	1100	Q8WW38	FOG2_HUMAN	E	1100;968;968;831	ENSP00000384179:Q1100E;ENSP00000430757:Q968E;ENSP00000428720:Q968E;ENSP00000367733:Q831E	ENSP00000367733:Q831E	Q	+	1	0	ZFPM2	106884784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.958000	0.56737	2.755000	0.94549	0.650000	0.86243	CAG		0.478	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			
ZHX1	11244	hgsc.bcm.edu	37	8	124267674	124267674	+	Silent	SNP	A	A	G			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr8:124267674A>G	ENST00000522655.1	-	3	1053	c.513T>C	c.(511-513)gtT>gtC	p.V171V	ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Silent_p.V171V|ZHX1_ENST00000395571.3_Silent_p.V171V			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	171					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CCGAAGAAGAAACTTCTGTAG	0.333																																																	0													105.0	106.0	105.0					8																	124267674		2203	4300	6503	SO:0001819	synonymous_variant	11244			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.513T>C	8.37:g.124267674A>G		Somatic		WXS	SOLID	Phase_I	Q8IWD8	Silent	SNP	ENST00000522655.1	37	CCDS6342.1																																																																																				0.333	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1			
ZMYM1	79830	hgsc.bcm.edu	37	1	35570190	35570190	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr1:35570190A>C	ENST00000373330.1	+	7	801	c.627A>C	c.(625-627)aaA>aaC	p.K209N	ZMYM1_ENST00000359858.4_Missense_Mutation_p.K209N|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	209						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AAAATGTGAAACATAATCTTT	0.343																																																	0													64.0	59.0	61.0					1																	35570190		1996	4191	6187	SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.627A>C	1.37:g.35570190A>C	ENSP00000362427:p.Lys209Asn	Somatic		WXS	SOLID	Phase_I	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	A	5.896	0.349423	0.11182	.	.	ENSG00000197056	ENST00000417119;ENST00000359858;ENST00000373329;ENST00000373330	T;T;T;T	0.17691	2.26;2.54;2.28;2.54	4.45	-4.48	0.03515	TRASH (1);	0.000000	0.49305	D	0.000142	T	0.08358	0.0208	L	0.44542	1.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.25363	-1.0134	10	0.20519	T	0.43	-9.4092	0.8834	0.01239	0.2533:0.2952:0.2528:0.1986	.	209;209	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	N	209;209;134;209	ENSP00000394233:K209N;ENSP00000352920:K209N;ENSP00000362426:K134N;ENSP00000362427:K209N	ENSP00000352920:K209N	K	+	3	2	ZMYM1	35342777	0.016000	0.18221	0.002000	0.10522	0.544000	0.35116	-0.787000	0.04618	-0.574000	0.05990	-0.301000	0.09380	AAA		0.343	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1		NM_024772	
ZNF385B	151126	hgsc.bcm.edu;ucsc.edu	37	2	180310276	180310276	+	Splice_Site	SNP	C	C	T			TCGA-AK-3428-01A-02D-1361-10	TCGA-AK-3428-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6fc3e193-399a-4434-9aef-8eab73ad7b4d	621bf83f-cd42-415e-92df-6f77ac4ccbbc	g.chr2:180310276C>T	ENST00000410066.1	-	8	1699		c.e8+1		ZNF385B_ENST00000409343.1_Splice_Site|ZNF385B_ENST00000336917.5_Splice_Site|ZNF385B_ENST00000409692.1_Splice_Site|ZNF385B_ENST00000466398.1_Splice_Site	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B						intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GGATACGTTACCTGTTTGAGT	0.353																																					Colon(155;204 2491 32774 51842)												0													123.0	106.0	112.0					2																	180310276		2203	4300	6503	SO:0001630	splice_region_variant	151126			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1095+1G>A	2.37:g.180310276C>T		Somatic		WXS	SOLID	Phase_I	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Splice_Site	SNP	ENST00000410066.1	37	CCDS33339.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766494	0.90020	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8807	0.96899	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF385B	180018521	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.818000	0.86416	2.700000	0.92200	0.563000	0.77884	.		0.353	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1		NM_152520	Intron
