#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
PRRC2C	23215	hgsc.bcm.edu;ucsc.edu	37	1	171553099	171553099	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr1:171553099C>G	ENST00000338920.4	+	29	7645	c.7408C>G	c.(7408-7410)Cag>Gag	p.Q2470E	PRRC2C_ENST00000426496.2_Missense_Mutation_p.Q2405E|PRRC2C_ENST00000392078.3_Missense_Mutation_p.Q2472E|PRRC2C_ENST00000367742.3_Missense_Mutation_p.Q2472E	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2470	Gln-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ATGTAGATCTCAGCCAGCTTT	0.378																																																	0													92.0	85.0	88.0					1																	171553099		2203	4300	6503	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.7408C>G	1.37:g.171553099C>G	ENSP00000343629:p.Gln2470Glu	Somatic		WXS	SOLID	Phase_I	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154490	0.57259	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.03496	3.91;3.94;3.93;3.93	5.98	5.98	0.97165	.	0.000000	0.44688	D	0.000435	T	0.12518	0.0304	L	0.61218	1.895	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.00704	-1.1602	10	0.87932	D	0	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	2470	Q9Y520-4	.	E	2472;2424;2405;2472;2470;2227	ENSP00000375928:Q2472E;ENSP00000410219:Q2405E;ENSP00000356716:Q2472E;ENSP00000343629:Q2470E	ENSP00000343629:Q2470E	Q	+	1	0	PRRC2C	169819723	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.194000	0.77789	2.835000	0.97688	0.650000	0.86243	CAG		0.378	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4		NM_015172	
BPI	671	hgsc.bcm.edu;ucsc.edu	37	20	36940337	36940337	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr20:36940337C>T	ENST00000262865.4	+	5	699	c.610C>T	c.(610-612)Cag>Tag	p.Q204*	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	204					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				GATGAACAGCCAGGTAGGAGG	0.507																																																	0													72.0	68.0	70.0					20																	36940337		2203	4300	6503	SO:0001587	stop_gained	671			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.610C>T	20.37:g.36940337C>T	ENSP00000262865:p.Gln204*	Somatic		WXS	SOLID	Phase_I	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Nonsense_Mutation	SNP	ENST00000262865.4	37	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960302	0.53400	.	.	ENSG00000101425	ENST00000262865	.	.	.	3.49	-1.56	0.08532	.	0.438759	0.23199	N	0.050818	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8999	4.0741	0.09895	0.4016:0.3781:0.2203:0.0	.	.	.	.	X	204	.	ENSP00000262865:Q204X	Q	+	1	0	BPI	36373751	0.163000	0.22920	0.038000	0.18304	0.008000	0.06430	0.298000	0.19120	-0.339000	0.08401	-1.325000	0.01285	CAG		0.507	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2		NM_001725	
OTOGL	283310	hgsc.bcm.edu;ucsc.edu	37	12	80750654	80750654	+	Silent	SNP	A	A	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr12:80750654A>G	ENST00000547103.1	+	48	5922	c.5916A>G	c.(5914-5916)caA>caG	p.Q1972Q	OTOGL_ENST00000546620.1_Silent_p.Q3Q|OTOGL_ENST00000458043.2_Silent_p.Q1984Q			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1972	Cys-rich.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCATGATTCAAGTTCGACAGG	0.348																																																	0													110.0	99.0	102.0					12																	80750654		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.5916A>G	12.37:g.80750654A>G		Somatic		WXS	SOLID	Phase_I	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	A	9.678	1.148470	0.21288	.	.	ENSG00000165899	ENST00000298820	.	.	.	5.47	1.56	0.23342	.	.	.	.	.	T	0.50701	0.1631	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33394	-0.9870	4	.	.	.	.	4.446	0.11597	0.64:0.0:0.2272:0.1328	.	.	.	.	R	427	.	.	K	+	2	0	OTOGL	79274785	0.998000	0.40836	0.998000	0.56505	0.995000	0.86356	0.677000	0.25262	0.016000	0.14998	0.455000	0.32223	AAG		0.348	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1		NM_173591	
CACNA2D1	781	hgsc.bcm.edu;ucsc.edu	37	7	81594953	81594953	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr7:81594953C>T	ENST00000356253.5	-	32	2822	c.2567G>A	c.(2566-2568)gGt>gAt	p.G856D	CACNA2D1_ENST00000535308.1_Missense_Mutation_p.G56D|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.G844D			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	856					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AAGAAACCCACCATCATCCAG	0.373																																																	0													155.0	138.0	144.0					7																	81594953		2203	4300	6503	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2567G>A	7.37:g.81594953C>T	ENSP00000348589:p.Gly856Asp	Somatic		WXS	SOLID	Phase_I	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	C	23.1	4.378696	0.82682	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	D;D;D	0.86230	-2.09;-2.09;-2.09	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.93687	0.7983	M	0.83012	2.62	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.988	D	0.92674	0.6152	10	0.33141	T	0.24	-21.2313	18.672	0.91514	0.0:1.0:0.0:0.0	.	56;844	B7Z658;P54289-2	.;.	D	844;863;856;56	ENSP00000349320:G844D;ENSP00000348589:G856D;ENSP00000443124:G56D	ENSP00000284088:G863D	G	-	2	0	CACNA2D1	81432889	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	7.295000	0.78780	2.407000	0.81776	0.591000	0.81541	GGT		0.373	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				
CCDC107	203260	hgsc.bcm.edu	37	9	35660625	35660625	+	Silent	SNP	C	C	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr9:35660625C>T	ENST00000426546.2	+	4	457	c.391C>T	c.(391-393)Ctg>Ttg	p.L131L	ARHGEF39_ENST00000378387.3_3'UTR|CCDC107_ENST00000378407.3_Silent_p.L131L|ARHGEF39_ENST00000343259.3_3'UTR|CCDC107_ENST00000421582.2_3'UTR|RMRP_ENST00000602361.1_lincRNA|ARHGEF39_ENST00000378395.2_3'UTR|CCDC107_ENST00000327351.2_Silent_p.L131L|ARHGEF39_ENST00000490970.1_5'Flank|CCDC107_ENST00000378406.1_Silent_p.L131L|CCDC107_ENST00000378409.3_Silent_p.L131L	NM_001195200.1|NM_001195201.1|NM_001195217.1|NM_174923.2	NP_001182129.1|NP_001182130.1|NP_001182146.1|NP_777583.2	Q8WV48	CC107_HUMAN	coiled-coil domain containing 107	131						integral component of membrane (GO:0016021)				endometrium(1)|lung(3)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GATGGCCCAGCTGGACCCCCT	0.547																																																	0													70.0	75.0	74.0					9																	35660625		2203	4300	6503	SO:0001819	synonymous_variant	203260			AK075523	CCDS6583.1, CCDS56573.1, CCDS56574.1, CCDS56575.1	9q13.3	2008-02-05			ENSG00000159884	ENSG00000159884			28465	protein-coding gene	gene with protein product						12477932	Standard	NM_174923		Approved	MGC31967	uc011lox.2	Q8WV48	OTTHUMG00000019868	ENST00000426546.2:c.391C>T	9.37:g.35660625C>T		Somatic		WXS	SOLID	Phase_I	A6XND6|Q5T4R5|Q5T4R8|Q5T4R9|Q86VB6|Q8N2E4	Silent	SNP	ENST00000426546.2	37	CCDS6583.1																																																																																				0.547	CCDC107-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052325.1		NM_174923	
CD97	976	hgsc.bcm.edu	37	19	14517988	14517988	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr19:14517988A>C	ENST00000242786.5	+	18	2403	c.2323A>C	c.(2323-2325)Aac>Cac	p.N775H	CD97_ENST00000358600.3_Missense_Mutation_p.N682H|CD97_ENST00000357355.3_Missense_Mutation_p.N726H|CTC-548K16.5_ENST00000590626.1_RNA|DDX39A_ENST00000592927.1_5'Flank	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	775					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TACCATCCTCAACTGCCTGCA	0.602																																																	0													152.0	128.0	136.0					19																	14517988		2203	4300	6503	SO:0001583	missense	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.2323A>C	19.37:g.14517988A>C	ENSP00000242786:p.Asn775His	Somatic		WXS	SOLID	Phase_I	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763777	0.69878	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.55760	0.5;0.5;0.5	5.16	5.16	0.70880	GPCR, family 2-like (1);	0.000000	0.36628	N	0.002497	T	0.77877	0.4196	M	0.93016	3.37	0.36144	D	0.846964	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86742	0.1955	10	0.87932	D	0	.	12.9243	0.58252	1.0:0.0:0.0:0.0	.	682;726;775	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	H	775;726;682;725	ENSP00000242786:N775H;ENSP00000349918:N726H;ENSP00000351413:N682H	ENSP00000242786:N775H	N	+	1	0	CD97	14378988	1.000000	0.71417	0.995000	0.50966	0.672000	0.39443	6.676000	0.74498	1.935000	0.56089	0.533000	0.62120	AAC		0.602	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2		NM_078481	
CDH23	64072	hgsc.bcm.edu;ucsc.edu	37	10	73199633	73199633	+	Missense_Mutation	SNP	G	G	C	rs397517331		TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr10:73199633G>C	ENST00000224721.6	+	1	50	c.45G>C	c.(43-45)ttG>ttC	p.L15F	CDH23_ENST00000299366.7_Missense_Mutation_p.L60F|CDH23_ENST00000398809.4_Missense_Mutation_p.L15F|CDH23_ENST00000398842.3_Missense_Mutation_p.L15F|CDH23_ENST00000461841.3_Missense_Mutation_p.L60F	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	15					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CCTGGCTTTTGGTGCTGATCT	0.622																																																	0													57.0	61.0	60.0					10																	73199633		2084	4187	6271	SO:0001583	missense	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.45G>C	10.37:g.73199633G>C	ENSP00000224721:p.Leu15Phe	Somatic		WXS	SOLID	Phase_I	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	G	9.686	1.150563	0.21371	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721	T;T	0.60424	0.19;0.22	4.59	-1.99	0.07457	.	1.047880	0.07645	N	0.931022	T	0.32585	0.0834	N	0.08118	0	0.18873	N	0.999981	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.20107	-1.0285	10	0.49607	T	0.09	.	5.5254	0.16955	0.0:0.4672:0.1938:0.339	.	15;15;15	A5D6V9;Q9H251;Q9H251-5	.;CAD23_HUMAN;.	F	15	ENSP00000381789:L15F;ENSP00000381822:L15F	ENSP00000224721:L15F	L	+	3	2	CDH23	72869639	0.018000	0.18449	0.101000	0.21167	0.887000	0.51463	-1.226000	0.02953	-0.240000	0.09696	0.313000	0.20887	TTG		0.622	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4		NM_052836	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123169477	123169477	+	Missense_Mutation	SNP	G	G	C	rs374793213		TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr9:123169477G>C	ENST00000349780.4	-	32	4955	c.4776C>G	c.(4774-4776)caC>caG	p.H1592Q	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.H1551Q|CDK5RAP2_ENST00000360190.4_Intron|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.H1560Q	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1592					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TCAGGAGGCTGTGCAGGTCCC	0.572																																																	0													79.0	72.0	75.0					9																	123169477		2203	4300	6503	SO:0001583	missense	55755			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4776C>G	9.37:g.123169477G>C	ENSP00000343818:p.His1592Gln	Somatic		WXS	SOLID	Phase_I	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	G	8.067	0.769314	0.15983	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T	0.21543	3.98;3.9;3.99;2.31;2.0	5.44	-6.71	0.01760	.	0.119134	0.37906	N	0.001891	T	0.13286	0.0322	L	0.41236	1.265	0.18873	N	0.999988	B;B;B;B	0.25048	0.082;0.091;0.117;0.082	B;B;B;B	0.25291	0.059;0.026;0.039;0.059	T	0.07328	-1.0778	10	0.46703	T	0.11	.	11.0202	0.47713	0.6292:0.0917:0.2791:0.0	.	602;1560;1592;986	Q5JTU8;Q96SN8-2;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	Q	1560;1551;1592;986;602;1364	ENSP00000354065:H1560Q;ENSP00000352258:H1551Q;ENSP00000343818:H1592Q;ENSP00000400395:H986Q;ENSP00000409941:H602Q	ENSP00000341695:H1364Q	H	-	3	2	CDK5RAP2	122209298	0.002000	0.14202	0.456000	0.27044	0.724000	0.41520	-1.175000	0.03102	-1.269000	0.02436	-0.136000	0.14681	CAC		0.572	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1		NM_018249	
CES1	1066	hgsc.bcm.edu	37	16	55862682	55862682	+	Missense_Mutation	SNP	G	G	A	rs144498758	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr16:55862682G>A	ENST00000361503.4	-	2	384	c.254C>T	c.(253-255)cCt>cTt	p.P85L	CES1_ENST00000360526.3_Missense_Mutation_p.P86L|CES1_ENST00000566555.1_5'Flank|CES1_ENST00000422046.2_Missense_Mutation_p.P85L			P23141	EST1_HUMAN	carboxylesterase 1	85					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	AGCTTACATAGGAGGGTACGA	0.552													.|||	5	0.000998403	0.0	0.0029	5008	,	,		31724	0.0		0.003	False		,,,				2504	0.0				NSCLC(162;1801 2756 42904 52896)												0													97.0	97.0	97.0					16																	55862682		2198	4300	6498	SO:0001583	missense	1066			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.254C>T	16.37:g.55862682G>A	ENSP00000355193:p.Pro85Leu	Somatic		WXS	SOLID	Phase_I	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	13.92	2.381373	0.42207	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046	T;T;T	0.71222	-0.55;-0.55;-0.55	4.48	4.48	0.54585	Carboxylesterase, type B (1);	0.000000	0.48286	D	0.000200	D	0.86760	0.6010	M	0.91249	3.19	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90023	0.4129	10	0.87932	D	0	.	14.6933	0.69101	0.0:0.0:1.0:0.0	.	85;85;86	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	L	86;85;85	ENSP00000353720:P86L;ENSP00000355193:P85L;ENSP00000390492:P85L	ENSP00000353720:P86L	P	-	2	0	CES1	54420183	0.998000	0.40836	0.982000	0.44146	0.104000	0.19210	4.002000	0.57053	2.051000	0.60960	0.393000	0.25936	CCT		0.552	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1		NM_001266	
CLEC5A	23601	hgsc.bcm.edu;ucsc.edu	37	7	141635627	141635627	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr7:141635627G>A	ENST00000546910.1	-	5	528	c.332C>T	c.(331-333)aCg>aTg	p.T111M	CLEC5A_ENST00000438351.1_Missense_Mutation_p.T88M|CLEC5A_ENST00000470595.1_Intron|CLEC5A_ENST00000439991.1_Intron|CLEC5A_ENST00000551012.2_Missense_Mutation_p.T88M	NM_013252.2	NP_037384.1	Q9NY25	CLC5A_HUMAN	C-type lectin domain family 5, member A	111	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myeloid cell apoptotic process (GO:0033033)|osteoblast development (GO:0002076)|positive regulation of cytokine secretion (GO:0050715)|response to virus (GO:0009615)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|virus receptor activity (GO:0001618)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	10	Melanoma(164;0.0171)					TTTCTCTGGCGTGTTGACAAT	0.463																																					GBM(154;1592 2613 3360 42983)												0													168.0	141.0	150.0					7																	141635627		2203	4300	6503	SO:0001583	missense	23601				CCDS5870.1, CCDS75670.1	7q34	2012-10-03	2005-02-09	2005-02-09	ENSG00000258227	ENSG00000258227		"""C-type lectin domain containing"""	2054	protein-coding gene	gene with protein product		604987	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5"""	CLECSF5		10449773	Standard	NM_013252		Approved	MDL-1	uc003vwv.1	Q9NY25	OTTHUMG00000157173	ENST00000546910.1:c.332C>T	7.37:g.141635627G>A	ENSP00000449999:p.Thr111Met	Somatic		WXS	SOLID	Phase_I	Q52M11|Q9UKQ0	Missense_Mutation	SNP	ENST00000546910.1	37	CCDS5870.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297552	0.40694	.	.	ENSG00000258227	ENST00000546910;ENST00000551012;ENST00000438351	T;T;T	0.19532	2.14;2.14;2.14	4.75	2.74	0.32292	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.265559	0.27591	N	0.018681	T	0.43765	0.1262	M	0.84326	2.69	0.31889	N	0.617457	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.993;0.966;0.958;0.975	T	0.53662	-0.8407	10	0.87932	D	0	-11.5498	7.2545	0.26168	0.0:0.1884:0.617:0.1947	.	88;88;111;111	C9JPR7;Q14DL9;Q9NY25-2;Q9NY25	.;.;.;CLC5A_HUMAN	M	111;88;88	ENSP00000449999:T111M;ENSP00000446890:T88M;ENSP00000414897:T88M	ENSP00000265306:T111M	T	-	2	0	CLEC5A	141282096	0.846000	0.29590	0.860000	0.33809	0.584000	0.36387	0.984000	0.29565	1.302000	0.44855	0.549000	0.68633	ACG		0.463	CLEC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347756.1		NM_013252	
COL5A3	50509	hgsc.bcm.edu	37	19	10071434	10071434	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr19:10071434T>C	ENST00000264828.3	-	66	5069	c.4984A>G	c.(4984-4986)Acg>Gcg	p.T1662A		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1662	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TAGTCACCCGTGGCTTCGTCC	0.592																																																	0													73.0	65.0	67.0					19																	10071434		2203	4300	6503	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4984A>G	19.37:g.10071434T>C	ENSP00000264828:p.Thr1662Ala	Somatic		WXS	SOLID	Phase_I	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	0.208	-1.038792	0.02013	.	.	ENSG00000080573	ENST00000264828	T	0.73258	-0.73	4.03	0.487	0.16842	Fibrillar collagen, C-terminal (4);	0.795441	0.11200	N	0.588890	T	0.38374	0.1038	N	0.05574	-0.02	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29397	-1.0013	10	0.02654	T	1	.	2.019	0.03505	0.3484:0.3748:0.1706:0.1062	.	1662	P25940	CO5A3_HUMAN	A	1662	ENSP00000264828:T1662A	ENSP00000264828:T1662A	T	-	1	0	COL5A3	9932434	0.000000	0.05858	0.004000	0.12327	0.055000	0.15305	-0.737000	0.04877	0.009000	0.14813	-0.464000	0.05259	ACG		0.592	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1		NM_015719	
DNAJC14	85406	hgsc.bcm.edu	37	12	56221611	56221611	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr12:56221611G>A	ENST00000357606.3	-	3	1121	c.832C>T	c.(832-834)Caa>Taa	p.Q278*	TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317287.5_Nonsense_Mutation_p.Q278*|RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317269.3_Nonsense_Mutation_p.Q278*			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	278					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CTTTTCAGTTGCCTGCAGGCA	0.507																																																	0													94.0	80.0	85.0					12																	56221611		2203	4300	6503	SO:0001587	stop_gained	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.832C>T	12.37:g.56221611G>A	ENSP00000350223:p.Gln278*	Somatic		WXS	SOLID	Phase_I	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Nonsense_Mutation	SNP	ENST00000357606.3	37	CCDS8894.1	.	.	.	.	.	.	.	.	.	.	G	39	7.373284	0.98245	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000317287	.	.	.	5.18	3.3	0.37823	.	0.596334	0.17554	N	0.170070	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.9963	4.8829	0.13688	0.178:0.0:0.645:0.177	.	.	.	.	X	278	.	.	Q	-	1	0	DNAJC14	54507878	0.999000	0.42202	0.997000	0.53966	0.995000	0.86356	1.798000	0.38814	0.637000	0.30526	0.655000	0.94253	CAA		0.507	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1		NM_032364	
DHX37	57647	hgsc.bcm.edu	37	12	125455876	125455876	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr12:125455876A>G	ENST00000308736.2	-	8	1261	c.1163T>C	c.(1162-1164)cTg>cCg	p.L388P	DHX37_ENST00000544745.1_Missense_Mutation_p.L175P	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	388	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		AATGCGGGACAGGAGGCCGAT	0.662																																																	0													78.0	59.0	66.0					12																	125455876		2203	4300	6503	SO:0001583	missense	57647			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1163T>C	12.37:g.125455876A>G	ENSP00000311135:p.Leu388Pro	Somatic		WXS	SOLID	Phase_I	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527255	0.85706	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.63744	-0.06;-0.06	5.22	5.22	0.72569	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.88937	0.6573	H	0.99838	4.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93857	0.7150	10	0.87932	D	0	-9.8489	14.8025	0.69926	1.0:0.0:0.0:0.0	.	388	Q8IY37	DHX37_HUMAN	P	388;175	ENSP00000311135:L388P;ENSP00000439009:L175P	ENSP00000311135:L388P	L	-	2	0	DHX37	124021829	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.165000	0.94761	1.980000	0.57719	0.454000	0.30748	CTG		0.662	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_032656	
DUSP8	1850	hgsc.bcm.edu;ucsc.edu	37	11	1580186	1580186	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr11:1580186G>T	ENST00000397374.3	-	4	597	c.470C>A	c.(469-471)cCc>cAc	p.P157H	DUSP8_ENST00000331588.4_Missense_Mutation_p.P157H|DUSP8_ENST00000528778.1_5'UTR	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	157					inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		GCCCACGCTGGGCACAGGCAG	0.662																																																	0													74.0	62.0	66.0					11																	1580186		2202	4299	6501	SO:0001583	missense	1850				CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.470C>A	11.37:g.1580186G>T	ENSP00000380530:p.Pro157His	Somatic		WXS	SOLID	Phase_I	Q86SS8	Missense_Mutation	SNP	ENST00000397374.3	37	CCDS7724.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367850	0.61513	.	.	ENSG00000184545	ENST00000397374;ENST00000331588	T;T	0.61158	0.13;0.13	4.34	4.34	0.51931	.	0.421699	0.23563	N	0.046835	T	0.48429	0.1499	L	0.36672	1.1	0.33003	D	0.52644	B	0.30584	0.286	B	0.23716	0.048	T	0.63545	-0.6613	10	0.59425	D	0.04	.	17.0423	0.86493	0.0:0.0:1.0:0.0	.	157	Q13202	DUS8_HUMAN	H	157	ENSP00000380530:P157H;ENSP00000329539:P157H	ENSP00000329539:P157H	P	-	2	0	DUSP8	1536762	1.000000	0.71417	1.000000	0.80357	0.215000	0.24574	7.498000	0.81546	2.247000	0.74100	0.549000	0.68633	CCC		0.662	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257178.3		NM_004420	
EPRS	2058	hgsc.bcm.edu;ucsc.edu	37	1	220153534	220153534	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr1:220153534C>T	ENST00000366923.3	-	26	3873	c.3604G>A	c.(3604-3606)Gca>Aca	p.A1202T		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1202	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	ACAGGAATTGCCAGGAGTTCT	0.343																																																	0													132.0	124.0	127.0					1																	220153534		2203	4300	6503	SO:0001583	missense	2058			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3604G>A	1.37:g.220153534C>T	ENSP00000355890:p.Ala1202Thr	Somatic		WXS	SOLID	Phase_I	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	36	5.844362	0.97016	.	.	ENSG00000136628	ENST00000366923	T	0.67865	-0.29	5.96	5.96	0.96718	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.046152	0.85682	D	0.000000	D	0.90283	0.6961	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93418	0.6774	10	0.87932	D	0	-24.6693	20.422	0.99049	0.0:1.0:0.0:0.0	.	1202	P07814	SYEP_HUMAN	T	1202	ENSP00000355890:A1202T	ENSP00000355890:A1202T	A	-	1	0	EPRS	218220157	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.807000	0.86032	2.832000	0.97577	0.655000	0.94253	GCA		0.343	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2		NM_004446	
F9	2158	hgsc.bcm.edu;ucsc.edu	37	X	138633386	138633386	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chrX:138633386G>T	ENST00000218099.2	+	6	693	c.686G>T	c.(685-687)gGt>gTt	p.G229V	F9_ENST00000394090.2_Missense_Mutation_p.G191V	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	229	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	CGGGTTGTTGGTGGAGAAGAT	0.448																																																	0													133.0	109.0	118.0					X																	138633386		2203	4300	6503	SO:0001583	missense	2158			M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.686G>T	X.37:g.138633386G>T	ENSP00000218099:p.Gly229Val	Somatic		WXS	SOLID	Phase_I	A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Missense_Mutation	SNP	ENST00000218099.2	37	CCDS14666.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.992920	0.74703	.	.	ENSG00000101981	ENST00000218099;ENST00000394090	D;D	0.95724	-3.79;-3.79	5.31	5.31	0.75309	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.106395	0.64402	D	0.000003	D	0.98689	0.9560	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.976	D	0.99802	1.1036	10	0.87932	D	0	.	16.5357	0.84372	0.0:0.0:1.0:0.0	.	191;229	Q5FBE1;P00740	.;FA9_HUMAN	V	229;191	ENSP00000218099:G229V;ENSP00000377650:G191V	ENSP00000218099:G229V	G	+	2	0	F9	138461052	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.858000	0.69532	2.211000	0.71520	0.600000	0.82982	GGT		0.448	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1			
FAM13B	51306	hgsc.bcm.edu;ucsc.edu	37	5	137347568	137347568	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr5:137347568T>G	ENST00000033079.3	-	5	888	c.437A>C	c.(436-438)aAt>aCt	p.N146T	FAM13B_ENST00000420893.2_Missense_Mutation_p.N146T|FAM13B_ENST00000425075.2_Missense_Mutation_p.N28T	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	146	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						CAAACTATAATTAACAGGTGG	0.323																																																	0													48.0	51.0	50.0					5																	137347568		2203	4300	6503	SO:0001583	missense	51306			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.437A>C	5.37:g.137347568T>G	ENSP00000033079:p.Asn146Thr	Somatic		WXS	SOLID	Phase_I	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.538722	0.85917	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.54675	0.56;1.53;0.56	5.52	5.52	0.82312	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.73458	0.3589	M	0.79123	2.44	0.80722	D	1	P;D;D	0.76494	0.747;0.998;0.999	P;D;D	0.85130	0.479;0.995;0.997	T	0.77525	-0.2555	10	0.87932	D	0	-17.0208	15.655	0.77126	0.0:0.0:0.0:1.0	.	28;146;146	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	T	146;28;146	ENSP00000033079:N146T;ENSP00000394669:N28T;ENSP00000388521:N146T	ENSP00000033079:N146T	N	-	2	0	FAM13B	137375467	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.491000	0.81471	2.106000	0.64143	0.519000	0.50382	AAT		0.323	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1			
FGF20	26281	hgsc.bcm.edu;ucsc.edu	37	8	16850793	16850793	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr8:16850793G>C	ENST00000180166.5	-	3	572	c.424C>G	c.(424-426)Cag>Gag	p.Q142E		NM_019851.2	NP_062825.1	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	142					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of cardiac muscle cell proliferation (GO:0060043)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	11				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		TCTTCAAACTGCTCCCTAAAG	0.353																																																	0													134.0	137.0	136.0					8																	16850793		2203	4300	6503	SO:0001583	missense	26281			AB030648	CCDS5998.1	8p22	2008-05-15			ENSG00000078579	ENSG00000078579			3677	protein-coding gene	gene with protein product		605558				10913340	Standard	NM_019851		Approved		uc003wxc.1	Q9NP95	OTTHUMG00000096964	ENST00000180166.5:c.424C>G	8.37:g.16850793G>C	ENSP00000180166:p.Gln142Glu	Somatic		WXS	SOLID	Phase_I	B2RPH5	Missense_Mutation	SNP	ENST00000180166.5	37	CCDS5998.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.35|16.35	3.098579|3.098579	0.56183|0.56183	.|.	.|.	ENSG00000078579|ENSG00000078579	ENST00000519941|ENST00000180166	.|T	.|0.80566	.|-1.39	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77082|0.77082	0.4078|0.4078	L|L	0.39566|0.39566	1.225|1.225	0.58432|0.58432	D|D	0.999999|0.999999	.|B	.|0.19706	.|0.038	.|B	.|0.20384	.|0.029	T|T	0.69359|0.69359	-0.5166|-0.5166	5|10	.|0.40728	.|T	.|0.16	.|.	20.5471|20.5471	0.99284|0.99284	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|142	.|Q9NP95	.|FGF20_HUMAN	G|E	43|142	.|ENSP00000180166:Q142E	.|ENSP00000180166:Q142E	A|Q	-|-	2|1	0|0	FGF20|FGF20	16895164|16895164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	7.928000|7.928000	0.87587|0.87587	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|CAG		0.353	FGF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214030.1			
GPRIN1	114787	hgsc.bcm.edu	37	5	176026129	176026129	+	Missense_Mutation	SNP	C	C	A	rs142779818|rs550332435|rs199714570|rs371149640|rs386695335	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr5:176026129C>A	ENST00000303991.4	-	2	884	c.707G>T	c.(706-708)gGg>gTg	p.G236V		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	236				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTCAAAGACCCAGGATCCTC	0.498																																																	0													89.0	92.0	91.0					5																	176026129		2140	4202	6342	SO:0001583	missense	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.707G>T	5.37:g.176026129C>A	ENSP00000305839:p.Gly236Val	Somatic		WXS	SOLID	Phase_I	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	CCDS4405.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489235	0.26686	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.08193	3.12	4.31	-5.97	0.02227	.	0.829122	0.09843	N	0.748618	T	0.07143	0.0181	M	0.74881	2.28	0.21256	N	0.999744	B	0.18013	0.025	B	0.18871	0.023	T	0.45600	-0.9250	10	0.24483	T	0.36	3.7158	0.2113	0.00156	0.3574:0.1616:0.2179:0.2631	.	236	Q7Z2K8	GRIN1_HUMAN	V	236	ENSP00000305839:G236V	ENSP00000305839:G236V	G	-	2	0	GPRIN1	175958735	0.000000	0.05858	0.001000	0.08648	0.496000	0.33645	-2.182000	0.01256	-0.780000	0.04553	0.313000	0.20887	GGG		0.498	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1		NM_052899	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32552039	32552039	+	Missense_Mutation	SNP	C	C	T	rs150747106		TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr6:32552039C>T	ENST00000360004.5	-	2	322	c.217G>A	c.(217-219)Gtg>Atg	p.V73M		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	73	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						AACTCCCCCACGTCGCTGTCG	0.632										Multiple Myeloma(14;0.17)																																							0													37.0	38.0	37.0					6																	32552039		2197	4292	6489	SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.217G>A	6.37:g.32552039C>T	ENSP00000353099:p.Val73Met	Somatic		WXS	SOLID	Phase_I	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	368	0.1684981684981685	37	0.07520325203252033	75	0.20718232044198895	112	0.1958041958041958	144	0.18997361477572558	.	12.23	1.876883	0.33162	.	.	ENSG00000196126	ENST00000360004	T	0.00402	7.56	3.52	0.0987	0.14499	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	0.657385	0.14883	N	0.292848	T	0.00695	0.0023	H	0.95679	3.705	0.32016	N	0.601387	D	0.89917	1.0	D	0.85130	0.997	T	0.33343	-0.9872	10	0.72032	D	0.01	.	6.8224	0.23864	0.3354:0.4996:0.1649:0.0	.	73	P01911	2B1F_HUMAN	M	73	ENSP00000353099:V73M	ENSP00000353099:V73M	V	-	1	0	HLA-DRB1	32660017	0.053000	0.20554	0.990000	0.47175	0.053000	0.15095	-0.110000	0.10824	0.237000	0.21200	0.453000	0.30009	GTG		0.632	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3		NM_002124	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32552079	32552079	+	Silent	SNP	G	G	A	rs17884729	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr6:32552079G>A	ENST00000360004.5	-	2	282	c.177C>T	c.(175-177)taC>taT	p.Y59Y		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	59	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GGTTATAGAAGTATCTGTCCA	0.612										Multiple Myeloma(14;0.17)																																							0													34.0	32.0	33.0					6																	32552079		2188	4254	6442	SO:0001819	synonymous_variant	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.177C>T	6.37:g.32552079G>A		Somatic		WXS	SOLID	Phase_I	P01914|Q9MYF5	Silent	SNP	ENST00000360004.5	37	CCDS47409.1																																																																																				0.612	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3		NM_002124	
HLA-DQB1	3119	hgsc.bcm.edu	37	6	32629891	32629891	+	Missense_Mutation	SNP	C	C	T	rs386699585|rs1063323	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr6:32629891C>T	ENST00000399082.3	-	2	288	c.244G>A	c.(244-246)Gcc>Acc	p.A82T	HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.A172T|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.A172T|HLA-DQB1_ENST00000460185.1_5'Flank|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.A172T|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399084.1_Missense_Mutation_p.A172T			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	172	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	ACAACGCCGGCTGTCTCCTCC	0.547									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				.|||	1979	0.395168	0.3154	0.5447	5008	,	,		15401	0.4782		0.3946	False		,,,				2504	0.3119				Esophageal Squamous(151;720 1825 15000 40336 43415)												0								T	THR/ALA	1264,3120		198,868,1126	45.0	47.0	47.0		514	1.8	0.0	6	dbSNP_86	47	3012,5578		578,1856,1861	no	missense	HLA-DQB1	NM_002123.4	58	776,2724,2987	TT,TC,CC		35.064,28.8321,32.9582	benign	172/262	32629891	4276,8698	2192	4295	6487	SO:0001583	missense	3119	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.244G>A	6.37:g.32629891C>T	ENSP00000382032:p.Ala82Thr	Somatic		WXS	SOLID	Phase_I	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399082.3	37		927	0.42445054945054944	152	0.3089430894308943	189	0.5220994475138122	281	0.49125874125874125	305	0.4023746701846966	.	0.892	-0.725235	0.03158	0.288321	0.35064	ENSG00000179344	ENST00000399082;ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084;ENST00000447884	T;T;T;T;T	0.02812	4.15;4.15;4.15;4.15;4.15	4.52	1.78	0.24846	.	0.459394	0.20863	N	0.084310	T	0.00815	0.0027	.	.	.	0.80722	P	0.0	B;B;B;B	0.13594	0.002;0.001;0.008;0.0	B;B;B;B	0.12837	0.003;0.003;0.008;0.003	T	0.48969	-0.8987	8	0.31617	T	0.26	.	8.6058	0.33773	0.0:0.7426:0.0:0.2574	rs1063323;rs3204390;rs9280014;rs17840143;rs28724256;rs34109183	172;137;172;172	A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.	T	82;172;172;172;172;108	ENSP00000382032:A82T;ENSP00000382029:A172T;ENSP00000364080:A172T;ENSP00000407332:A172T;ENSP00000382034:A172T	ENSP00000364080:A172T	A	-	1	0	HLA-DQB1	32737869	0.000000	0.05858	0.034000	0.17996	0.001000	0.01503	0.431000	0.21444	0.057000	0.16193	-1.922000	0.00515	GCC		0.547	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000276131.1		NM_002123	
MTCL1	23255	hgsc.bcm.edu	37	18	8819154	8819154	+	Missense_Mutation	SNP	C	C	T	rs367943286		TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr18:8819154C>T	ENST00000306329.11	+	11	4010	c.4010C>T	c.(4009-4011)tCg>tTg	p.S1337L	SOGA2_ENST00000359865.3_Missense_Mutation_p.S1018L|SOGA2_ENST00000518815.1_Missense_Mutation_p.S343L|SOGA2_ENST00000400050.3_Missense_Mutation_p.S977L|SOGA2_ENST00000306285.7_Missense_Mutation_p.S343L|SOGA2_ENST00000517570.1_Missense_Mutation_p.S977L																							GACAGGTGCTCGGCCAGTGAG	0.622																																																	0								C	LEU/SER	0,4406		0,0,2203	53.0	50.0	51.0		3053	5.8	1.0	18		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC165	NM_015210.3	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1018/1587	8819154	1,13005	2203	4300	6503	SO:0001583	missense	0																														ENST00000306329.11:c.4010C>T	18.37:g.8819154C>T	ENSP00000305027:p.Ser1337Leu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000306329.11	37		.	.	.	.	.	.	.	.	.	.	C	17.79	3.476085	0.63737	0.0	1.16E-4	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.77	5.77	0.91146	.	0.163302	0.29572	N	0.011768	T	0.33147	0.0853	M	0.65975	2.015	0.26939	N	0.966293	D;D	0.55172	0.97;0.962	B;B	0.33042	0.122;0.157	T	0.50363	-0.8837	10	0.33141	T	0.24	-9.8281	9.3862	0.38345	0.0:0.6702:0.254:0.0758	.	1328;1018	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	L	1039;977;1018;977;343	ENSP00000429556:S977L;ENSP00000352927:S1018L;ENSP00000382924:S977L;ENSP00000303670:S343L	ENSP00000303670:S343L	S	+	2	0	CCDC165	8809154	0.948000	0.32251	0.970000	0.41538	0.998000	0.95712	1.860000	0.39428	2.884000	0.98904	0.655000	0.94253	TCG		0.622	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			
LOXHD1	125336	hgsc.bcm.edu	37	18	44104452	44104452	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr18:44104452G>T	ENST00000398722.4	-	24	4018	c.4019C>A	c.(4018-4020)gCt>gAt	p.A1340D	LOXHD1_ENST00000441551.2_Missense_Mutation_p.A1412D|LOXHD1_ENST00000536736.1_Missense_Mutation_p.A1618D|LOXHD1_ENST00000582408.1_Missense_Mutation_p.A507D|LOXHD1_ENST00000300591.6_Missense_Mutation_p.A507D|LOXHD1_ENST00000441893.2_Missense_Mutation_p.A551D|LOXHD1_ENST00000579038.1_Missense_Mutation_p.A411D			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1340					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						AACGTAGTCAGCCATGGGCCC	0.567																																																	0													67.0	63.0	64.0					18																	44104452		692	1591	2283	SO:0001583	missense	125336			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.4019C>A	18.37:g.44104452G>T	ENSP00000381707:p.Ala1340Asp	Somatic		WXS	SOLID	Phase_I	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	37		.	.	.	.	.	.	.	.	.	.	G	7.153	0.584210	0.13749	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730	T;T;T;T	0.24908	1.83;3.3;3.34;3.35	5.06	-1.19	0.09585	.	0.856445	0.10564	N	0.659990	T	0.23766	0.0575	N	0.08118	0	0.25177	N	0.990237	D;B;P;D	0.71674	0.998;0.384;0.801;0.996	P;B;P;P	0.62649	0.905;0.362;0.561;0.755	T	0.31110	-0.9955	10	0.48119	T	0.1	.	9.1193	0.36778	0.6093:0.0:0.3907:0.0	.	1618;551;1340;1340	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	D	507;1340;1618;551;1340	ENSP00000300591:A507D;ENSP00000381707:A1340D;ENSP00000444586:A1618D;ENSP00000409062:A551D	ENSP00000300591:A507D	A	-	2	0	LOXHD1	42358450	0.009000	0.17119	0.428000	0.26697	0.380000	0.30137	-0.292000	0.08332	-0.176000	0.10707	0.462000	0.41574	GCT		0.567	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding			NM_144612	
LTF	4057	hgsc.bcm.edu	37	3	46479585	46479585	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr3:46479585G>T	ENST00000231751.4	-	16	2239	c.1944C>A	c.(1942-1944)gaC>gaA	p.D648E	LTF_ENST00000426532.2_Missense_Mutation_p.D604E|LTF_ENST00000493056.1_5'UTR|LTF_ENST00000417439.1_Missense_Mutation_p.D646E	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	648	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		AGCAAAACTTGTCCGGGCAGT	0.418																																																	0													135.0	137.0	136.0					3																	46479585		2203	4300	6503	SO:0001583	missense	4057				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1944C>A	3.37:g.46479585G>T	ENSP00000231751:p.Asp648Glu	Somatic		WXS	SOLID	Phase_I	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	g	4.562	0.104290	0.08731	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.06294	3.32;3.32;3.32;3.32	5.1	-3.59	0.04583	.	1.206060	0.05621	N	0.579881	T	0.03739	0.0106	N	0.25031	0.7	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.45366	-0.9266	10	0.23302	T	0.38	-2.5142	2.7529	0.05286	0.1822:0.4364:0.2116:0.1698	.	646;635;648	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	E	648;604;646;635	ENSP00000231751:D648E;ENSP00000405719:D604E;ENSP00000405546:D646E;ENSP00000397427:D635E	ENSP00000231751:D648E	D	-	3	2	LTF	46454589	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.473000	0.06615	-0.445000	0.07159	-0.127000	0.14921	GAC		0.418	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2		NM_002343	
LYPLAL1	127018	hgsc.bcm.edu	37	1	219347283	219347283	+	Silent	SNP	A	A	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr1:219347283A>G	ENST00000366928.5	+	1	98	c.51A>G	c.(49-51)gcA>gcG	p.A17A	LYPLAL1_ENST00000483635.1_3'UTR|LYPLAL1_ENST00000366927.3_Silent_p.A17A|RP11-135J2.4_ENST00000441331.1_RNA	NM_138794.3	NP_620149	Q5VWZ2	LYPL1_HUMAN	lysophospholipase-like 1	17					negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|protein depalmitoylation (GO:0002084)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	lysophospholipase activity (GO:0004622)			large_intestine(1)|lung(5)	6				GBM - Glioblastoma multiforme(131;0.055)|all cancers(67;0.105)|OV - Ovarian serous cystadenocarcinoma(81;0.116)		TGTCGCCGGCAGGGAGGCATA	0.612																																																	0													83.0	74.0	77.0					1																	219347283		2203	4300	6503	SO:0001819	synonymous_variant	127018			BC016711	CCDS1522.1, CCDS73032.1	1q41	2008-02-05			ENSG00000143353	ENSG00000143353			20440	protein-coding gene	gene with protein product							Standard	XM_005273046		Approved	Q96AV0	uc001hlq.4	Q5VWZ2	OTTHUMG00000037141	ENST00000366928.5:c.51A>G	1.37:g.219347283A>G		Somatic		WXS	SOLID	Phase_I	A8K677|Q5VWZ3|Q7Z4A3|Q96AV0	Silent	SNP	ENST00000366928.5	37	CCDS1522.1																																																																																				0.612	LYPLAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090208.1		NM_138794	
MTHFD1	4522	hgsc.bcm.edu;ucsc.edu	37	14	64882205	64882205	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr14:64882205G>A	ENST00000545908.1	+	5	767	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	MTHFD1_ENST00000216605.8_Missense_Mutation_p.V124M			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	124	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	CGAGAAGGATGTGGATGGGTA	0.388																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)												0													233.0	215.0	221.0					14																	64882205		2203	4300	6503	SO:0001583	missense	4522			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.538G>A	14.37:g.64882205G>A	ENSP00000438588:p.Val180Met	Somatic		WXS	SOLID	Phase_I	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37		.	.	.	.	.	.	.	.	.	.	G	19.40	3.820520	0.71028	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.45668	1.61;1.7;1.64;0.89	4.96	4.96	0.65561	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75939	0.3918	H	0.95328	3.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.84316	0.0513	10	0.87932	D	0	-17.7092	18.5926	0.91218	0.0:0.0:1.0:0.0	.	180;124;124	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	M	180;124;180;104	ENSP00000438588:V180M;ENSP00000450560:V124M;ENSP00000216605:V180M;ENSP00000451309:V104M	ENSP00000216605:V124M	V	+	1	0	MTHFD1	63951958	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	7.506000	0.81665	2.462000	0.83206	0.455000	0.32223	GTG		0.388	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1			
MYO18A	399687	hgsc.bcm.edu;ucsc.edu	37	17	27417887	27417887	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr17:27417887C>G	ENST00000527372.1	-	35	5425	c.5245G>C	c.(5245-5247)Gag>Cag	p.E1749Q	MYO18A_ENST00000533112.1_Missense_Mutation_p.E1712Q|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000531253.1_Missense_Mutation_p.E1749Q|TIAF1_ENST00000408971.2_5'UTR|MYO18A_ENST00000354329.4_Missense_Mutation_p.E1749Q	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1749					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.E1749Q(1)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TGATCTTCCTCCAGCCGGTTC	0.582																																					Esophageal Squamous(182;472 2015 7001 15270 22562)												1	Substitution - Missense(1)	ovary(1)											179.0	175.0	176.0					17																	27417887		2068	4215	6283	SO:0001583	missense	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5245G>C	17.37:g.27417887C>G	ENSP00000437073:p.Glu1749Gln	Somatic		WXS	SOLID	Phase_I	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976249	0.53720	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105	T;D;T;T	0.83673	-1.42;-1.75;-1.42;-1.42	4.93	3.95	0.45737	Myosin tail (1);	0.047186	0.85682	D	0.000000	D	0.90324	0.6973	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.76494	0.976;0.999;0.998;0.999	P;D;P;D	0.70487	0.743;0.943;0.898;0.969	D	0.91686	0.5362	10	0.66056	D	0.02	.	15.3615	0.74478	0.0:0.8597:0.1403:0.0	.	1352;1712;1749;1749	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	Q	1749;1712;1712;1749;1749;645;645;1352;30	ENSP00000346291:E1749Q;ENSP00000435932:E1712Q;ENSP00000434228:E1749Q;ENSP00000437073:E1749Q	ENSP00000346291:E1749Q	E	-	1	0	MYO18A	24442013	1.000000	0.71417	0.992000	0.48379	0.052000	0.14988	7.261000	0.78400	1.423000	0.47198	-0.176000	0.13171	GAG		0.582	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1		NM_078471	
NAA35	60560	hgsc.bcm.edu;ucsc.edu	37	9	88631485	88631485	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr9:88631485A>G	ENST00000361671.5	+	18	1733	c.1600A>G	c.(1600-1602)Atg>Gtg	p.M534V		NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	534					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						CGCATGGTTGATGTCAACATT	0.363																																																	0													115.0	107.0	110.0					9																	88631485		2203	4300	6503	SO:0001583	missense	60560			AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.1600A>G	9.37:g.88631485A>G	ENSP00000354972:p.Met534Val	Somatic		WXS	SOLID	Phase_I	Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	ENST00000361671.5	37	CCDS6673.1	.	.	.	.	.	.	.	.	.	.	A	6.275	0.418909	0.11870	.	.	ENSG00000135040	ENST00000361671	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.19327	0.0464	N	0.00332	-1.63	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.25984	-1.0116	9	0.11485	T	0.65	-14.7879	15.4186	0.74991	1.0:0.0:0.0:0.0	.	534	Q5VZE5	NAA35_HUMAN	V	534	.	ENSP00000354972:M534V	M	+	1	0	NAA35	87821305	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.033000	0.93741	2.044000	0.60594	0.402000	0.26972	ATG		0.363	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052906.1		NM_024635	
NBEA	26960	hgsc.bcm.edu;ucsc.edu	37	13	35758117	35758117	+	Silent	SNP	G	G	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr13:35758117G>T	ENST00000400445.3	+	30	5370	c.4836G>T	c.(4834-4836)gtG>gtT	p.V1612V	NBEA_ENST00000379939.2_Silent_p.V1609V|NBEA_ENST00000310336.4_Silent_p.V1612V|NBEA_ENST00000540320.1_Silent_p.V1612V	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1612					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CCACAGTTGTGGTCATACCAT	0.418																																																	0													114.0	104.0	108.0					13																	35758117		1926	4131	6057	SO:0001819	synonymous_variant	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4836G>T	13.37:g.35758117G>T		Somatic		WXS	SOLID	Phase_I	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																				0.418	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_015678	
NDUFS2	4720	hgsc.bcm.edu;ucsc.edu	37	1	161183209	161183209	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr1:161183209A>C	ENST00000367993.3	+	12	1604	c.1156A>C	c.(1156-1158)Act>Cct	p.T386P	NDUFS2_ENST00000465923.1_3'UTR|FCER1G_ENST00000289902.1_5'Flank|FCER1G_ENST00000367992.3_5'Flank|NDUFS2_ENST00000392179.4_Missense_Mutation_p.T386P	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	386					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	TAAGTTGTATACTGAGGGCTA	0.468																																																	0													74.0	67.0	70.0					1																	161183209		2203	4300	6503	SO:0001583	missense	4720			BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.1156A>C	1.37:g.161183209A>C	ENSP00000356972:p.Thr386Pro	Somatic		WXS	SOLID	Phase_I	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Missense_Mutation	SNP	ENST00000367993.3	37	CCDS1224.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.823693	0.90873	.	.	ENSG00000158864	ENST00000367993;ENST00000392179	D;D	0.86366	-2.11;-2.11	5.53	5.53	0.82687	NADH-quinone oxidoreductase, subunit D (1);	0.103999	0.64402	D	0.000004	D	0.93327	0.7873	M	0.89478	3.035	0.53005	D	0.999966	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.74674	0.976;0.984;0.984	D	0.94538	0.7742	9	0.87932	D	0	.	14.7802	0.69760	1.0:0.0:0.0:0.0	.	335;386;386	B7Z792;Q53HG2;O75306	.;.;NDUS2_HUMAN	P	386	ENSP00000356972:T386P;ENSP00000376018:T386P	ENSP00000356972:T386P	T	+	1	0	NDUFS2	159449833	1.000000	0.71417	0.486000	0.27416	0.971000	0.66376	8.200000	0.89733	2.324000	0.78689	0.533000	0.62120	ACT		0.468	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083015.1		NM_004550	
OR6S1	341799	hgsc.bcm.edu;ucsc.edu	37	14	21109071	21109071	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr14:21109071A>T	ENST00000320704.3	-	1	779	c.780T>A	c.(778-780)ttT>ttA	p.F260L		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		GCACATAGAGAAAAATGGCAC	0.498																																																	0													126.0	111.0	116.0					14																	21109071		2203	4300	6503	SO:0001583	missense	341799			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.780T>A	14.37:g.21109071A>T	ENSP00000313110:p.Phe260Leu	Somatic		WXS	SOLID	Phase_I	Q6IFJ9	Missense_Mutation	SNP	ENST00000320704.3	37	CCDS32038.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019787	0.75275	.	.	ENSG00000181803	ENST00000320704	T	0.00241	8.46	5.7	0.965	0.19661	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000109	T	0.00384	0.0012	L	0.58925	1.835	0.32904	D	0.513609	D	0.89917	1.0	D	0.97110	1.0	T	0.61252	-0.7100	10	0.87932	D	0	-18.5856	8.2284	0.31584	0.6714:0.0:0.3286:0.0	.	260	Q8NH40	OR6S1_HUMAN	L	260	ENSP00000313110:F260L	ENSP00000313110:F260L	F	-	3	2	OR6S1	20178911	0.829000	0.29322	1.000000	0.80357	0.994000	0.84299	0.040000	0.13905	0.450000	0.26774	0.533000	0.62120	TTT		0.498	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411227.1			
PAGE1	8712	hgsc.bcm.edu	37	X	49454063	49454063	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chrX:49454063A>T	ENST00000376150.3	-	5	508	c.376T>A	c.(376-378)Ttg>Atg	p.L126M		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	126					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					GGCAGGCCCAACTCCTGGACA	0.488																																																	0													104.0	91.0	96.0					X																	49454063		2203	4300	6503	SO:0001583	missense	8712			AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.376T>A	X.37:g.49454063A>T	ENSP00000365320:p.Leu126Met	Somatic		WXS	SOLID	Phase_I	Q6FGM3|Q9BSS7	Missense_Mutation	SNP	ENST00000376150.3	37	CCDS14327.1	.	.	.	.	.	.	.	.	.	.	A	0.034	-1.319359	0.01320	.	.	ENSG00000068985	ENST00000376150	T	0.09163	3.01	1.03	-2.06	0.07298	.	.	.	.	.	T	0.02649	0.0080	N	0.01297	-0.9	0.09310	N	1	B	0.31383	0.321	B	0.29785	0.107	T	0.35375	-0.9791	9	0.34782	T	0.22	.	1.4793	0.02433	0.3268:0.2577:0.0:0.4155	.	126	O75459	GAGB1_HUMAN	M	126	ENSP00000365320:L126M	ENSP00000365320:L126M	L	-	1	2	PAGE1	49341017	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	0.199000	0.17237	-1.071000	0.03145	-1.432000	0.01085	TTG		0.488	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081210.1			
PCSK2	5126	hgsc.bcm.edu	37	20	17437054	17437054	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr20:17437054C>A	ENST00000262545.2	+	10	1478	c.1163C>A	c.(1162-1164)cCc>cAc	p.P388H	PCSK2_ENST00000536609.1_Missense_Mutation_p.P353H|PCSK2_ENST00000377899.1_Missense_Mutation_p.P369H	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	388	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GCAGCTGCCCCCGAGGCAGCT	0.532																																																	0													143.0	146.0	145.0					20																	17437054		2203	4300	6503	SO:0001583	missense	5126			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1163C>A	20.37:g.17437054C>A	ENSP00000262545:p.Pro388His	Somatic		WXS	SOLID	Phase_I	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028029	0.93518	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.79454	-1.27;-1.27;-1.27	5.93	5.93	0.95920	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.93106	0.7805	H	0.97806	4.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95012	0.8152	10	0.87932	D	0	-25.567	18.8972	0.92429	0.0:1.0:0.0:0.0	.	353;388	B4DFQ3;P16519	.;NEC2_HUMAN	H	369;388;353	ENSP00000367131:P369H;ENSP00000262545:P388H;ENSP00000437458:P353H	ENSP00000262545:P388H	P	+	2	0	PCSK2	17385054	1.000000	0.71417	0.970000	0.41538	0.905000	0.53344	7.744000	0.85034	2.818000	0.97014	0.591000	0.81541	CCC		0.532	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2		NM_002594	
PGS1	9489	hgsc.bcm.edu;ucsc.edu	37	17	76396757	76396757	+	Splice_Site	SNP	G	G	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr17:76396757G>A	ENST00000262764.6	+	6	727		c.e6-1		PGS1_ENST00000588281.1_Splice_Site|SNORA30_ENST00000363193.1_RNA|PGS1_ENST00000329897.7_Splice_Site	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CCTCCCTGTAGTGCAAACCTG	0.587																																					Esophageal Squamous(45;182 1126 10685 43198)												0													116.0	124.0	121.0					17																	76396757		2152	4242	6394	SO:0001630	splice_region_variant	9489				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.702-1G>A	17.37:g.76396757G>A		Somatic		WXS	SOLID	Phase_I	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Splice_Site	SNP	ENST00000262764.6	37	CCDS42391.1	.	.	.	.	.	.	.	.	.	.	G	34	5.384841	0.95967	.	.	ENSG00000087157	ENST00000262764;ENST00000329897;ENST00000335081	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.905	0.92456	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PGS1	73908352	1.000000	0.71417	0.607000	0.28956	0.927000	0.56198	9.116000	0.94341	2.626000	0.88956	0.557000	0.71058	.		0.587	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1		NM_024419	Intron
POMT2	29954	hgsc.bcm.edu;ucsc.edu	37	14	77746380	77746380	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr14:77746380T>G	ENST00000261534.4	-	17	1971	c.1769A>C	c.(1768-1770)tAt>tCt	p.Y590S		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	590						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		GCCAAGCAGATAGACTCGGAA	0.597																																																	0													129.0	110.0	117.0					14																	77746380		2203	4300	6503	SO:0001583	missense	29954			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1769A>C	14.37:g.77746380T>G	ENSP00000261534:p.Tyr590Ser	Somatic		WXS	SOLID	Phase_I	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.2|26.2	4.714966|4.714966	0.89112|0.89112	.|.	.|.	ENSG00000009830|ENSG00000009830	ENST00000556171|ENST00000261534	.|D	.|0.95377	.|-3.69	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98232|0.98232	0.9415|0.9415	M|M	0.92412|0.92412	3.305|3.305	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.99429|0.99429	1.0935|1.0935	5|10	.|0.87932	.|D	.|0	-11.6585|-11.6585	15.9165|15.9165	0.79524|0.79524	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|590	.|Q9UKY4	.|POMT2_HUMAN	L|S	58|590	.|ENSP00000261534:Y590S	.|ENSP00000261534:Y590S	I|Y	-|-	1|2	0|0	POMT2|POMT2	76816133|76816133	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.982000|0.982000	0.71751|0.71751	7.707000|7.707000	0.84623|0.84623	2.169000|2.169000	0.68431|0.68431	0.460000|0.460000	0.39030|0.39030	ATC|TAT		0.597	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1		NM_013382	
PPP1R3A	5506	hgsc.bcm.edu	37	7	113518387	113518387	+	Silent	SNP	A	A	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr7:113518387A>G	ENST00000284601.3	-	4	2828	c.2760T>C	c.(2758-2760)caT>caC	p.H920H		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	920					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AAATTTCAGTATGATGTTTGG	0.373																																																	0													100.0	101.0	100.0					7																	113518387		2203	4299	6502	SO:0001819	synonymous_variant	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2760T>C	7.37:g.113518387A>G		Somatic		WXS	SOLID	Phase_I	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	37	CCDS5759.1																																																																																				0.373	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1		NM_002711	
PPP2R3A	5523	hgsc.bcm.edu;ucsc.edu	37	3	135820908	135820908	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr3:135820908A>T	ENST00000264977.3	+	11	3604	c.2987A>T	c.(2986-2988)gAg>gTg	p.E996V	PPP2R3A_ENST00000490467.1_Missense_Mutation_p.E260V|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.E375V	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	996	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TCCATGTATGAGCTGGAGTAC	0.473																																																	0													194.0	165.0	174.0					3																	135820908		2203	4300	6503	SO:0001583	missense	5523			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2987A>T	3.37:g.135820908A>T	ENSP00000264977:p.Glu996Val	Somatic		WXS	SOLID	Phase_I	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.746494	0.89663	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546	D;D;D	0.86865	-2.18;-2.18;-2.18	5.34	5.34	0.76211	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.95698	0.8601	H	0.96916	3.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96963	0.9703	10	0.66056	D	0.02	.	14.7926	0.69854	1.0:0.0:0.0:0.0	.	375;996	Q06190-2;Q06190	.;P2R3A_HUMAN	V	996;260;375	ENSP00000264977:E996V;ENSP00000419344:E260V;ENSP00000334748:E375V	ENSP00000264977:E996V	E	+	2	0	PPP2R3A	137303598	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	9.287000	0.95975	2.131000	0.65755	0.460000	0.39030	GAG		0.473	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1		NM_002718	
RIMBP2	23504	hgsc.bcm.edu;ucsc.edu	37	12	130897239	130897239	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr12:130897239C>T	ENST00000261655.4	-	15	2909	c.2746G>A	c.(2746-2748)Gca>Aca	p.A916T		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	916	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCATCATCTGCTTGTATCTCA	0.478																																																	0													121.0	115.0	117.0					12																	130897239		2203	4300	6503	SO:0001583	missense	23504			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2746G>A	12.37:g.130897239C>T	ENSP00000261655:p.Ala916Thr	Somatic		WXS	SOLID	Phase_I	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	5.756	0.323892	0.10900	.	.	ENSG00000060709	ENST00000261655;ENST00000536632	T;T	0.29397	1.57;1.57	5.06	5.06	0.68205	Src homology-3 domain (2);	0.057706	0.64402	D	0.000001	T	0.17280	0.0415	N	0.04636	-0.2	0.80722	D	1	P	0.47677	0.899	B	0.42112	0.376	T	0.10222	-1.0639	10	0.13853	T	0.58	-24.594	18.4389	0.90658	0.0:1.0:0.0:0.0	.	916	O15034	RIMB2_HUMAN	T	916;53	ENSP00000261655:A916T;ENSP00000439030:A53T	ENSP00000261655:A916T	A	-	1	0	RIMBP2	129463192	1.000000	0.71417	0.127000	0.21898	0.064000	0.16182	4.678000	0.61641	2.339000	0.79563	0.655000	0.94253	GCA		0.478	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1		NM_015347	
SALL1	6299	hgsc.bcm.edu	37	16	51171109	51171109	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr16:51171109G>T	ENST00000251020.4	-	3	3922	c.3889C>A	c.(3889-3891)Ctg>Atg	p.L1297M	SALL1_ENST00000541611.1_Missense_Mutation_p.L120M|SALL1_ENST00000566102.1_3'UTR|SALL1_ENST00000440970.1_Missense_Mutation_p.L1200M	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1297					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ATTTTCTCCAGGCCGGCCAGG	0.592																																					GBM(103;1352 1446 1855 4775 8890)												0													75.0	69.0	71.0					16																	51171109		2198	4300	6498	SO:0001583	missense	6299			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3889C>A	16.37:g.51171109G>T	ENSP00000251020:p.Leu1297Met	Somatic		WXS	SOLID	Phase_I	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316574	0.40996	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559;ENST00000541611	T;T;T	0.59364	0.27;0.27;0.27	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.69682	0.3138	L	0.36672	1.1	0.53005	D	0.999969	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.965	T	0.66590	-0.5885	10	0.40728	T	0.16	.	20.0486	0.97617	0.0:0.0:1.0:0.0	.	1297;120	Q9NSC2;F5H733	SALL1_HUMAN;.	M	1297;1200;1261;120	ENSP00000251020:L1297M;ENSP00000407914:L1200M;ENSP00000442827:L120M	ENSP00000251020:L1297M	L	-	1	2	SALL1	49728610	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.701000	0.61810	2.752000	0.94435	0.643000	0.83706	CTG		0.592	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2		NM_002968	
SGTA	6449	hgsc.bcm.edu	37	19	2769005	2769005	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr19:2769005T>G	ENST00000221566.2	-	2	223	c.62A>C	c.(61-63)cAc>cCc	p.H21P		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	21					viral process (GO:0016032)	cytoplasm (GO:0005737)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCCCCCGTGCCGGAGCTG	0.632																																																	0													75.0	81.0	79.0					19																	2769005		2203	4300	6503	SO:0001583	missense	6449			AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.62A>C	19.37:g.2769005T>G	ENSP00000221566:p.His21Pro	Somatic		WXS	SOLID	Phase_I	D6W610|Q6FIA9|Q9BTZ9	Missense_Mutation	SNP	ENST00000221566.2	37	CCDS12094.1	.	.	.	.	.	.	.	.	.	.	T	7.511	0.654722	0.14580	.	.	ENSG00000104969	ENST00000221566	T	0.34072	1.38	4.71	4.71	0.59529	.	0.178511	0.47455	D	0.000228	T	0.32255	0.0823	L	0.47716	1.5	0.30422	N	0.777993	B	0.19331	0.035	B	0.24394	0.053	T	0.24728	-1.0152	10	0.31617	T	0.26	-13.8022	12.1435	0.54010	0.0:0.0:0.0:1.0	.	21	O43765	SGTA_HUMAN	P	21	ENSP00000221566:H21P	ENSP00000221566:H21P	H	-	2	0	SGTA	2720005	0.605000	0.26941	1.000000	0.80357	0.488000	0.33401	1.553000	0.36255	1.758000	0.51981	0.402000	0.26972	CAC		0.632	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451448.2		NM_003021	
SIPA1L2	57568	hgsc.bcm.edu;ucsc.edu	37	1	232600814	232600814	+	Missense_Mutation	SNP	G	G	C	rs376260317		TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr1:232600814G>C	ENST00000366630.1	-	8	2950	c.2592C>G	c.(2590-2592)ttC>ttG	p.F864L	SIPA1L2_ENST00000308942.4_5'Flank|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.F864L			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	864					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CAGACTGGCCGAAGTCCCGGG	0.473																																																	0													103.0	102.0	102.0					1																	232600814		1968	4146	6114	SO:0001583	missense	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2592C>G	1.37:g.232600814G>C	ENSP00000355589:p.Phe864Leu	Somatic		WXS	SOLID	Phase_I	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913193	0.52439	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.43688	0.94;0.94	6.06	-2.08	0.07254	.	0.000000	0.85682	D	0.000000	T	0.41026	0.1141	L	0.55990	1.75	0.43430	D	0.995599	P	0.48589	0.912	P	0.49752	0.621	T	0.31724	-0.9933	10	0.26408	T	0.33	-24.3418	11.6055	0.51029	0.5504:0.0:0.4496:0.0	.	864	Q9P2F8	SI1L2_HUMAN	L	864	ENSP00000355589:F864L;ENSP00000262861:F864L	ENSP00000262861:F864L	F	-	3	2	SIPA1L2	230667437	0.079000	0.21365	0.992000	0.48379	0.923000	0.55619	-0.364000	0.07583	-0.343000	0.08351	-0.142000	0.14014	TTC		0.473	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1		XM_045839	
SLC36A1	206358	hgsc.bcm.edu	37	5	150847285	150847285	+	Missense_Mutation	SNP	T	T	A	rs144783326		TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr5:150847285T>A	ENST00000243389.3	+	7	745	c.522T>A	c.(520-522)aaT>aaA	p.N174K	SLC36A1_ENST00000429484.2_Missense_Mutation_p.N174K|SLC36A1_ENST00000520701.1_Missense_Mutation_p.N174K|SLC36A1_ENST00000521925.1_Missense_Mutation_p.N174K	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	174					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	AAGCGGCCAATGGGACCACCA	0.537																																					Melanoma(151;1534 1860 12947 32979 37872)												0													200.0	185.0	190.0					5																	150847285		2203	4300	6503	SO:0001583	missense	206358			AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.522T>A	5.37:g.150847285T>A	ENSP00000243389:p.Asn174Lys	Somatic		WXS	SOLID	Phase_I	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Missense_Mutation	SNP	ENST00000243389.3	37	CCDS4316.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.659715	0.67586	.	.	ENSG00000123643	ENST00000520701;ENST00000429484;ENST00000243389;ENST00000456739;ENST00000521925	T;T;T;T	0.02258	4.37;4.37;4.37;4.37	5.39	-7.09	0.01553	.	0.000000	0.85682	D	0.000000	T	0.04861	0.0131	L	0.37697	1.125	0.45307	D	0.998307	P;D	0.67145	0.891;0.996	P;D	0.67382	0.544;0.951	T	0.00091	-1.2084	10	0.29301	T	0.29	.	17.251	0.87042	0.0:0.6044:0.0:0.3956	.	174;174	E7EW39;Q7Z2H8	.;S36A1_HUMAN	K	174	ENSP00000428140:N174K;ENSP00000395640:N174K;ENSP00000243389:N174K;ENSP00000430305:N174K	ENSP00000243389:N174K	N	+	3	2	SLC36A1	150827478	0.058000	0.20735	0.852000	0.33557	0.910000	0.53928	-0.664000	0.05292	-1.310000	0.02312	-0.994000	0.02522	AAT		0.537	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1		NM_078483	
SMC3	9126	hgsc.bcm.edu;ucsc.edu	37	10	112328742	112328742	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr10:112328742A>T	ENST00000361804.4	+	2	188	c.62A>T	c.(61-63)gAt>gTt	p.D21V	SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	21					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ACAATTGTAGATCCCTTCAGT	0.308																																																	0													185.0	183.0	183.0					10																	112328742		2203	4298	6501	SO:0001583	missense	9126			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.62A>T	10.37:g.112328742A>T	ENSP00000354720:p.Asp21Val	Somatic		WXS	SOLID	Phase_I	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456533	0.84317	.	.	ENSG00000108055	ENST00000361804	D	0.91577	-2.87	5.53	5.53	0.82687	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.86083	0.5848	L	0.35414	1.06	0.80722	D	1	P	0.44877	0.845	B	0.39935	0.314	D	0.87838	0.2649	10	0.66056	D	0.02	.	14.8501	0.70289	1.0:0.0:0.0:0.0	.	21	Q9UQE7	SMC3_HUMAN	V	21	ENSP00000354720:D21V	ENSP00000354720:D21V	D	+	2	0	SMC3	112318732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.451000	0.90343	2.092000	0.63282	0.460000	0.39030	GAT		0.308	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1		NM_005445	
SPOCK1	6695	hgsc.bcm.edu	37	5	136403473	136403473	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr5:136403473T>A	ENST00000394945.1	-	6	689	c.520A>T	c.(520-522)Acc>Tcc	p.T174S	SPOCK1_ENST00000282223.7_Missense_Mutation_p.T174S	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	174	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCACAGAGGGTGGCGAGGCTT	0.522																																																	0													157.0	141.0	146.0					5																	136403473		2203	4300	6503	SO:0001583	missense	6695			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.520A>T	5.37:g.136403473T>A	ENSP00000378401:p.Thr174Ser	Somatic		WXS	SOLID	Phase_I	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	37	CCDS4191.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.224357	0.39300	.	.	ENSG00000152377	ENST00000394945;ENST00000282223;ENST00000510689	T;T;T	0.04156	3.69;3.69;3.69	5.29	1.56	0.23342	Proteinase inhibitor I1, Kazal (1);EF-hand-like domain (1);Protease inhibitor, Kazal-type (1);	0.539797	0.20296	N	0.095138	T	0.03827	0.0108	L	0.38175	1.15	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.37957	-0.9683	10	0.46703	T	0.11	.	3.5743	0.07929	0.1708:0.1815:0.0:0.6478	.	174	Q08629	TICN1_HUMAN	S	174;174;29	ENSP00000378401:T174S;ENSP00000282223:T174S;ENSP00000421677:T29S	ENSP00000282223:T174S	T	-	1	0	SPOCK1	136431372	0.644000	0.27277	0.764000	0.31436	0.905000	0.53344	0.644000	0.24766	0.307000	0.22880	0.459000	0.35465	ACC		0.522	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1		NM_004598	
SPTBN4	57731	hgsc.bcm.edu	37	19	41009982	41009982	+	Silent	SNP	C	C	T	rs71358911	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr19:41009982C>T	ENST00000352632.3	+	12	1694	c.1608C>T	c.(1606-1608)gcC>gcT	p.A536A	SPTBN4_ENST00000598249.1_Silent_p.A536A|SPTBN4_ENST00000338932.3_Silent_p.A536A|SPTBN4_ENST00000595535.1_Silent_p.A536A|SPTBN4_ENST00000344104.3_Silent_p.A536A			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	536					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGAACCTTGCCCTGCAGAAGG	0.677													c|||	122	0.024361	0.0061	0.0259	5008	,	,		11341	0.0		0.0865	False		,,,				2504	0.0092																0										80,4326	68.1+/-105.8	0,80,2123	44.0	52.0	50.0		1608	1.0	1.0	19	dbSNP_130	50	933,7667	203.5+/-246.5	50,833,3417	no	coding-synonymous	SPTBN4	NM_020971.2		50,913,5540	TT,TC,CC		10.8488,1.8157,7.7887		536/2565	41009982	1013,11993	2203	4300	6503	SO:0001819	synonymous_variant	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.1608C>T	19.37:g.41009982C>T		Somatic		WXS	SOLID	Phase_I	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																				0.677	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			
SYPL1	6856	hgsc.bcm.edu;ucsc.edu	37	7	105739686	105739686	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr7:105739686C>T	ENST00000011473.2	-	3	212	c.166G>A	c.(166-168)Ggc>Agc	p.G56S	SYPL1_ENST00000470347.1_Missense_Mutation_p.G38S|SYPL1_ENST00000455385.2_Missense_Mutation_p.G38S	NM_006754.3	NP_006745.1	Q16563	SYPL1_HUMAN	synaptophysin-like 1	56	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|integral component of synaptic vesicle membrane (GO:0030285)|secretory granule (GO:0030141)	transporter activity (GO:0005215)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	7						TCTGTTTGGCCCTTAAAACCT	0.338																																																	0													82.0	80.0	81.0					7																	105739686		2203	4300	6503	SO:0001583	missense	6856				CCDS5736.1, CCDS47685.1	7q22.2	2005-05-24	2005-05-24	2005-05-24	ENSG00000008282	ENSG00000008282			11507	protein-coding gene	gene with protein product			"""synaptophysin-like protein"""	SYPL			Standard	NM_006754		Approved		uc003vdp.4	Q16563	OTTHUMG00000157587	ENST00000011473.2:c.166G>A	7.37:g.105739686C>T	ENSP00000011473:p.Gly56Ser	Somatic		WXS	SOLID	Phase_I	A4D0R2|Q96AR8	Missense_Mutation	SNP	ENST00000011473.2	37	CCDS5736.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765473	0.90020	.	.	ENSG00000008282	ENST00000455385;ENST00000011473;ENST00000470347	T;T;T	0.26373	1.74;1.74;1.74	4.97	4.97	0.65823	Marvel (1);MARVEL-like domain (1);	0.000000	0.85682	D	0.000000	T	0.52500	0.1738	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.56938	-0.7896	10	0.62326	D	0.03	1.5793	17.3596	0.87346	0.0:1.0:0.0:0.0	.	56	Q16563	SYPL1_HUMAN	S	38;56;38	ENSP00000388336:G38S;ENSP00000011473:G56S;ENSP00000419070:G38S	ENSP00000011473:G56S	G	-	1	0	SYPL1	105526922	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	5.915000	0.69973	2.475000	0.83589	0.460000	0.39030	GGC		0.338	SYPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349221.1			
TANC1	85461	hgsc.bcm.edu;ucsc.edu	37	2	159992709	159992709	+	Silent	SNP	C	C	G	rs375201296	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr2:159992709C>G	ENST00000263635.6	+	5	501	c.264C>G	c.(262-264)ccC>ccG	p.P88P	TANC1_ENST00000454300.1_Silent_p.P88P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	88					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.P88P(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CTACAGGTCCCGTCAGGAAGC	0.483																																																	2	Substitution - coding silent(2)	lung(2)											140.0	144.0	143.0					2																	159992709		1921	4127	6048	SO:0001819	synonymous_variant	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.264C>G	2.37:g.159992709C>G		Somatic		WXS	SOLID	Phase_I	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1																																																																																				0.483	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			
TMPRSS13	84000	hgsc.bcm.edu	37	11	117772955	117772955	+	Silent	SNP	T	T	C	rs73020481	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr11:117772955T>C	ENST00000524993.1	-	13	1760	c.1703A>G	c.(1702-1704)tAa>tGa	p.*568*	TMPRSS13_ENST00000528626.1_Silent_p.*533*	NM_001077263.2	NP_001070731.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	0						blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GCCAGCTGGTTAGGATTTTCT	0.602													T|||	308	0.0615016	0.0802	0.0706	5008	,	,		17737	0.0069		0.0964	False		,,,				2504	0.0501																0								T	,	267,3769		7,253,1758	42.0	47.0	46.0		1703,1598	1.2	0.9	11	dbSNP_130	46	727,7661		36,655,3503	no	coding-synonymous,coding-synonymous	TMPRSS13	NM_001077263.2,NM_001206789.1	,	43,908,5261	CC,CT,TT		8.6671,6.6155,8.0006	,	568/568,533/533	117772955	994,11430	2018	4194	6212	SO:0001819	synonymous_variant	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000524993.1:c.1703A>G	11.37:g.117772955T>C		Somatic		WXS	SOLID	Phase_I	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	ENST00000524993.1	37	CCDS41721.1																																																																																				0.602	TMPRSS13-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392317.1		NM_032046	
UNC80	285175	hgsc.bcm.edu;ucsc.edu	37	2	210794632	210794632	+	Silent	SNP	A	A	C			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr2:210794632A>C	ENST00000439458.1	+	36	5726	c.5646A>C	c.(5644-5646)ctA>ctC	p.L1882L	UNC80_ENST00000272845.6_Silent_p.L1877L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1882					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GGAACTGTCTAATTGAAGATC	0.373																																																	0													159.0	130.0	139.0					2																	210794632		692	1591	2283	SO:0001819	synonymous_variant	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5646A>C	2.37:g.210794632A>C		Somatic		WXS	SOLID	Phase_I	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	ENST00000439458.1	37	CCDS46504.1																																																																																				0.373	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_182587	
VWA3A	146177	hgsc.bcm.edu	37	16	22135024	22135024	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr16:22135024A>C	ENST00000389398.5	+	16	1624	c.1528A>C	c.(1528-1530)Aaa>Caa	p.K510Q	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	510						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		AGTCTGTGAAAAAAGGTACCT	0.502																																																	0													101.0	105.0	104.0					16																	22135024		1983	4163	6146	SO:0001583	missense	146177			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1528A>C	16.37:g.22135024A>C	ENSP00000374049:p.Lys510Gln	Somatic		WXS	SOLID	Phase_I	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	A	19.45	3.829229	0.71258	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.22743	1.94	5.83	5.83	0.93111	.	0.257576	0.38897	N	0.001532	T	0.32675	0.0837	L	0.57536	1.79	0.80722	D	1	P;P	0.43024	0.735;0.798	P;B	0.48368	0.575;0.384	T	0.02797	-1.1109	10	0.56958	D	0.05	.	15.0387	0.71770	1.0:0.0:0.0:0.0	.	510;134	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	Q	510;133	ENSP00000374049:K510Q	ENSP00000299840:K133Q	K	+	1	0	VWA3A	22042525	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.412000	0.52679	2.231000	0.72958	0.460000	0.39030	AAA		0.502	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1			
ZNF574	64763	hgsc.bcm.edu	37	19	42584326	42584326	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr19:42584326T>A	ENST00000600245.1	+	2	2223	c.1568T>A	c.(1567-1569)tTc>tAc	p.F523Y	CTB-59C6.3_ENST00000594531.1_RNA|ZNF574_ENST00000359044.4_Missense_Mutation_p.F523Y|ZNF574_ENST00000222339.7_Missense_Mutation_p.F613Y			Q6ZN55	ZN574_HUMAN	zinc finger protein 574	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20		Prostate(69;0.059)				GAGCGGCCCTTCCCCTGCCCT	0.622																																																	0													168.0	186.0	180.0					19																	42584326		2203	4300	6503	SO:0001583	missense	64763			AK074788	CCDS12596.1	19q13.2	2013-09-20			ENSG00000105732	ENSG00000105732		"""Zinc fingers, C2H2-type"""	26166	protein-coding gene	gene with protein product						12477932	Standard	NM_022752		Approved	FLJ22059	uc002osm.4	Q6ZN55	OTTHUMG00000182751	ENST00000600245.1:c.1568T>A	19.37:g.42584326T>A	ENSP00000469029:p.Phe523Tyr	Somatic		WXS	SOLID	Phase_I	Q6IPE0|Q6ZN10|Q7L5Z5|Q8NCE3|Q9H6N0	Missense_Mutation	SNP	ENST00000600245.1	37	CCDS12596.1	.	.	.	.	.	.	.	.	.	.	T	10.73	1.432886	0.25813	.	.	ENSG00000105732	ENST00000222339;ENST00000359044;ENST00000535775	T;T	0.17054	2.3;2.3	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.067484	0.64402	D	0.000014	T	0.05044	0.0135	N	0.04335	-0.225	0.38491	D	0.947979	P;P	0.40619	0.561;0.724	B;B	0.30943	0.097;0.122	T	0.31752	-0.9932	10	0.02654	T	1	-15.8964	9.2006	0.37256	0.1621:0.0:0.0:0.8379	.	523;612	Q6ZN55;Q6ZN55-2	ZN574_HUMAN;.	Y	613;523;130	ENSP00000222339:F613Y;ENSP00000351939:F523Y	ENSP00000222339:F613Y	F	+	2	0	ZNF574	47276166	0.995000	0.38212	1.000000	0.80357	0.452000	0.32318	1.296000	0.33389	1.896000	0.54893	0.528000	0.53228	TTC		0.622	ZNF574-002	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463458.1		NM_022752	
ZNF717	100131827	hgsc.bcm.edu	37	3	75790797	75790797	+	De_novo_Start_InFrame	SNP	C	C	T	rs147946451	byFrequency	TCGA-B0-4838-01A-01D-1373-10	TCGA-B0-4838-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e9ffa47-f919-459c-bde8-0384d717db08	a4eff4fa-ce80-4e09-84b5-265feec77f84	g.chr3:75790797C>T	ENST00000478296.1	-	0	274				ZNF717_ENST00000477374.1_Missense_Mutation_p.V50M|ZNF717_ENST00000422325.1_Missense_Mutation_p.V50M|ZNF717_ENST00000400845.3_Missense_Mutation_p.V43M|ZNF717_ENST00000491507.1_5'UTR			Q9BY31	ZN717_HUMAN	zinc finger protein 717						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TCCAGCATCACGTCCCTGTAC	0.502																																																	0													16.0	13.0	14.0					3																	75790797		444	1237	1681			100131827			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965		3.37:g.75790797C>T		Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000478296.1	37		562	0.2573260073260073	83	0.16869918699186992	111	0.30662983425414364	134	0.23426573426573427	234	0.3087071240105541	.	14.80	2.645039	0.47258	.	.	ENSG00000227124	ENST00000477374;ENST00000422325;ENST00000400845;ENST00000468296	T;T;T;T	0.04015	3.73;3.73;3.73;3.73	1.97	1.97	0.26223	.	.	.	.	.	T	0.00012	0.0000	M	0.92833	3.35	0.36926	P	0.10836100000000004	D	0.89917	1.0	D	0.64776	0.929	T	0.22417	-1.0217	8	0.72032	D	0.01	.	9.6897	0.40120	0.0:1.0:0.0:0.0	.	50	C9JSV9	.	M	50;50;43;50	ENSP00000417902:V50M;ENSP00000409514:V50M;ENSP00000383643:V43M;ENSP00000418187:V50M	ENSP00000383643:V43M	V	-	1	0	ZNF717	75873487	0.243000	0.23878	0.981000	0.43875	0.552000	0.35366	1.184000	0.32053	1.127000	0.42034	0.545000	0.68477	GTG		0.502	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2		NM_001128223	
