#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC3	8714	hgsc.bcm.edu;ucsc.edu	37	17	48761334	48761334	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr17:48761334G>T	ENST00000285238.8	+	28	4059	c.3979G>T	c.(3979-3981)Gct>Tct	p.A1327S		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1327	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CCGCACTGGGGCTGGCAAGTC	0.622																																																	0													49.0	50.0	50.0					17																	48761334		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3979G>T	17.37:g.48761334G>T	ENSP00000285238:p.Ala1327Ser	Somatic		WXS	SOLID	Phase_I	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	g	35	5.477608	0.96291	.	.	ENSG00000108846	ENST00000285238	D	0.94687	-3.49	5.38	5.38	0.77491	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.91998	0.7465	N	0.03917	-0.325	0.80722	D	1	D	0.62365	0.991	P	0.57204	0.815	D	0.94450	0.7666	10	0.87932	D	0	-11.7779	19.4929	0.95059	0.0:0.0:1.0:0.0	.	1327	O15438	MRP3_HUMAN	S	1327	ENSP00000285238:A1327S	ENSP00000285238:A1327S	A	+	1	0	ABCC3	46116333	1.000000	0.71417	0.969000	0.41365	0.976000	0.68499	9.734000	0.98822	2.672000	0.90937	0.651000	0.88453	GCT		0.622	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2		NM_020038	
ADAMTS18	170692	hgsc.bcm.edu;ucsc.edu	37	16	77401389	77401389	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr16:77401389A>T	ENST00000282849.5	-	4	1145	c.727T>A	c.(727-729)Tat>Aat	p.Y243N	ADAMTS18_ENST00000567121.1_5'UTR	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	243					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CGATGGTGATACTCTGTCTCT	0.488																																																	0													89.0	83.0	85.0					16																	77401389		2198	4300	6498	SO:0001583	missense	170692			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.727T>A	16.37:g.77401389A>T	ENSP00000282849:p.Tyr243Asn	Somatic		WXS	SOLID	Phase_I	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.390661	0.25118	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.59083	0.29;2.85	4.57	1.02	0.19986	.	0.891438	0.09836	N	0.749521	T	0.45256	0.1333	L	0.43152	1.355	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.30149	-0.9988	10	0.27785	T	0.31	.	6.7511	0.23487	0.6061:0.0:0.3939:0.0	.	243	Q8TE60	ATS18_HUMAN	N	243	ENSP00000282849:Y243N;ENSP00000392540:Y243N	ENSP00000282849:Y243N	Y	-	1	0	ADAMTS18	75958890	0.998000	0.40836	0.003000	0.11579	0.845000	0.48019	3.536000	0.53582	0.020000	0.15106	0.454000	0.30748	TAT		0.488	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			
ADAMTS20	80070	hgsc.bcm.edu;ucsc.edu	37	12	43819454	43819454	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr12:43819454C>T	ENST00000389420.3	-	28	4146	c.4147G>A	c.(4147-4149)Gta>Ata	p.V1383I	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.V501I|ADAMTS20_ENST00000553158.1_Missense_Mutation_p.V1383I	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1383	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TGACATATTACAAGTCTTGAT	0.343																																																	0													145.0	126.0	132.0					12																	43819454		2203	4300	6503	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4147G>A	12.37:g.43819454C>T	ENSP00000374071:p.Val1383Ile	Somatic		WXS	SOLID	Phase_I	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403056	0.83230	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	4.71	4.71	0.59529	.	0.000000	0.45867	D	0.000331	T	0.76856	0.4046	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.80355	-0.1417	10	0.52906	T	0.07	.	18.5834	0.91180	0.0:1.0:0.0:0.0	.	1383;501	P59510;E9PBD5	ATS20_HUMAN;.	I	1383;513;501;1383;1383	ENSP00000374071:V1383I;ENSP00000447427:V513I;ENSP00000378911:V501I;ENSP00000448341:V1383I	ENSP00000374068:V1383I	V	-	1	0	ADAMTS20	42105721	1.000000	0.71417	0.968000	0.41197	0.819000	0.46315	7.252000	0.78309	2.546000	0.85860	0.650000	0.86243	GTA		0.343	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1		NM_025003	
ADCY2	108	hgsc.bcm.edu;ucsc.edu	37	5	7706858	7706858	+	Splice_Site	SNP	A	A	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr5:7706858A>T	ENST00000338316.4	+	8	1200	c.1111A>T	c.(1111-1113)Aaa>Taa	p.K371*	ADCY2_ENST00000537121.1_Splice_Site_p.K191*|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	371					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCTCTTTAGGAAAGTGAGGGA	0.418																																																	0													227.0	204.0	212.0					5																	7706858		2203	4300	6503	SO:0001630	splice_region_variant	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1110-1A>T	5.37:g.7706858A>T		Somatic		WXS	SOLID	Phase_I	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Nonsense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	A	34	5.305217	0.95601	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	15.1404	0.72607	1.0:0.0:0.0:0.0	.	.	.	.	X	371;222;191	.	ENSP00000342952:K371X	K	+	1	0	ADCY2	7759858	1.000000	0.71417	1.000000	0.80357	0.092000	0.18411	7.117000	0.77129	1.980000	0.57719	0.533000	0.62120	AAA		0.418	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2		NM_020546	Nonsense_Mutation
AKAP1	8165	hgsc.bcm.edu	37	17	55184151	55184151	+	Silent	SNP	T	T	C			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr17:55184151T>C	ENST00000337714.3	+	2	1559	c.1326T>C	c.(1324-1326)ctT>ctC	p.L442L	AKAP1_ENST00000539273.1_Silent_p.L442L|AKAP1_ENST00000571629.1_Silent_p.L442L|AKAP1_ENST00000314126.3_Silent_p.L442L|AKAP1_ENST00000572557.1_Silent_p.L442L	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	442					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					TGAAGAGCCTTCTGTCCAGCC	0.622																																																	0													90.0	74.0	79.0					17																	55184151		2203	4300	6503	SO:0001819	synonymous_variant	8165			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1326T>C	17.37:g.55184151T>C		Somatic		WXS	SOLID	Phase_I	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Silent	SNP	ENST00000337714.3	37	CCDS11594.1																																																																																				0.622	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1			
AMY1B	277	hgsc.bcm.edu	37	1	104238207	104238207	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:104238207A>G	ENST00000330330.5	-	2	349	c.55T>C	c.(55-57)Tca>Cca	p.S19P	AMY1B_ENST00000370080.3_Missense_Mutation_p.S19P|AMY1B_ENST00000464691.1_5'Flank	NM_001008218.1	NP_001008219.1	P04745	AMY1_HUMAN	amylase, alpha 1B (salivary)	19					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		TGTGTATTTGAGGAATACTGA	0.398																																																	0													1.0	1.0	1.0					1																	104238207		3	6	9	SO:0001583	missense	277				CCDS30783.1	1p21	2012-10-02	2007-05-03		ENSG00000174876	ENSG00000174876	3.2.1.1		475	protein-coding gene	gene with protein product		104701	"""amylase, alpha 1B; salivary"""	AMY1			Standard	XM_005270758		Approved			P04745	OTTHUMG00000011021	ENST00000330330.5:c.55T>C	1.37:g.104238207A>G	ENSP00000330484:p.Ser19Pro	Somatic		WXS	SOLID	Phase_I	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	ENST00000330330.5	37	CCDS30783.1	.	.	.	.	.	.	.	.	.	.	-	0.011	-1.704669	0.00719	.	.	ENSG00000174876	ENST00000416771;ENST00000370080;ENST00000330330;ENST00000446703;ENST00000425410	.	.	.	2.08	2.08	0.27032	.	0.000000	0.85682	N	0.000000	T	0.03608	0.0103	.	.	.	0.23802	N	0.996809	.	.	.	.	.	.	T	0.45659	-0.9246	6	0.02654	T	1	.	8.8097	0.34961	0.121:0.0:0.879:0.0	.	.	.	.	P	19	.	ENSP00000330484:S19P	S	-	1	0	AMY1B	104039730	1.000000	0.71417	0.014000	0.15608	0.178000	0.23041	6.955000	0.76007	0.210000	0.20664	-1.160000	0.01791	TCA		0.398	AMY1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030309.1		NM_001008218	
BBX	56987	hgsc.bcm.edu;ucsc.edu	37	3	107429337	107429337	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr3:107429337T>G	ENST00000325805.8	+	4	317	c.30T>G	c.(28-30)caT>caG	p.H10Q	BBX_ENST00000416476.2_Missense_Mutation_p.H10Q|BBX_ENST00000415149.2_Missense_Mutation_p.H10Q|BBX_ENST00000406780.1_Missense_Mutation_p.H10Q|BBX_ENST00000402543.1_Missense_Mutation_p.H10Q			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	10					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ATAAGGATCATTCAGCAGAAG	0.418																																																	0													107.0	101.0	103.0					3																	107429337		2203	4300	6503	SO:0001583	missense	56987			AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.30T>G	3.37:g.107429337T>G	ENSP00000319974:p.His10Gln	Somatic		WXS	SOLID	Phase_I	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	T	18.68	3.676146	0.67928	.	.	ENSG00000114439	ENST00000415149;ENST00000402543;ENST00000325805;ENST00000427402;ENST00000416476;ENST00000454540;ENST00000431630;ENST00000449335;ENST00000456817;ENST00000458458;ENST00000437908;ENST00000456419;ENST00000402163;ENST00000406780;ENST00000413213;ENST00000449271;ENST00000425868;ENST00000449213;ENST00000457496;ENST00000429270	D;D;D;D;D;D;D;D;D;D;D;D;D	0.98978	-4.67;-4.69;-4.7;-4.99;-5.19;-4.97;-5.0;-5.29;-4.67;-4.44;-1.72;-4.55;-4.56	5.66	3.28	0.37604	.	0.090097	0.85682	D	0.000000	D	0.98245	0.9419	L	0.29908	0.895	0.33454	D	0.584098	D;D;P;D	0.76494	0.999;0.999;0.868;0.984	D;D;B;D	0.73708	0.958;0.981;0.312;0.974	D	0.99406	1.0929	10	0.87932	D	0	-1.1274	9.8178	0.40862	0.0:0.2007:0.0:0.7993	.	10;10;10;10	C9JA69;Q8WY36;A2RRM7;Q8WY36-2	.;BBX_HUMAN;.;.	Q	10	ENSP00000408358:H10Q;ENSP00000385317:H10Q;ENSP00000319974:H10Q;ENSP00000413320:H10Q;ENSP00000403860:H10Q;ENSP00000408297:H10Q;ENSP00000413274:H10Q;ENSP00000385518:H10Q;ENSP00000385530:H10Q;ENSP00000403806:H10Q;ENSP00000406554:H10Q;ENSP00000407662:H10Q;ENSP00000414673:H10Q	ENSP00000319974:H10Q	H	+	3	2	BBX	108912027	0.984000	0.35163	1.000000	0.80357	0.998000	0.95712	0.119000	0.15626	0.515000	0.28320	0.528000	0.53228	CAT		0.418	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1		NM_020235	
BFSP1	631	hgsc.bcm.edu;ucsc.edu	37	20	17475631	17475631	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr20:17475631T>A	ENST00000377873.3	-	8	1125	c.1086A>T	c.(1084-1086)agA>agT	p.R362S	BFSP1_ENST00000377868.2_Missense_Mutation_p.R237S|BFSP1_ENST00000544874.1_Missense_Mutation_p.R223S|BFSP1_ENST00000536626.1_Missense_Mutation_p.R223S	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	362	Tail.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						GGGCTTTTTGTCTTGGTTTTG	0.398																																																	0													126.0	132.0	130.0					20																	17475631		2203	4300	6503	SO:0001583	missense	631			Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1086A>T	20.37:g.17475631T>A	ENSP00000367104:p.Arg362Ser	Somatic		WXS	SOLID	Phase_I	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	ENST00000377873.3	37	CCDS13126.1	.	.	.	.	.	.	.	.	.	.	T	18.33	3.599835	0.66332	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	D;T;T;T	0.94232	-3.38;0.46;0.45;0.45	5.33	3.04	0.35103	.	0.000000	0.85682	D	0.000000	D	0.95287	0.8471	M	0.75264	2.295	0.42656	D	0.993467	D;D	0.89917	0.999;1.0	D;D	0.74023	0.982;0.972	D	0.93643	0.6966	10	0.87932	D	0	-18.7643	7.1474	0.25591	0.0:0.0777:0.1477:0.7746	.	237;362	Q12934-2;Q12934	.;BFSP1_HUMAN	S	362;237;223;223	ENSP00000367104:R362S;ENSP00000367099:R237S;ENSP00000442522:R223S;ENSP00000439870:R223S	ENSP00000367099:R237S	R	-	3	2	BFSP1	17423631	0.987000	0.35691	0.975000	0.42487	0.976000	0.68499	0.109000	0.15417	0.322000	0.23283	0.533000	0.62120	AGA		0.398	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078119.6		NM_001195	
C15orf27	123591	hgsc.bcm.edu;ucsc.edu	37	15	76449034	76449034	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr15:76449034C>T	ENST00000388942.3	+	4	593	c.317C>T	c.(316-318)gCc>gTc	p.A106V		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	106					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						TTCCTGGTAGCCTGTGTAATA	0.463																																																	0													138.0	137.0	137.0					15																	76449034		1947	4155	6102	SO:0001583	missense	123591			AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.317C>T	15.37:g.76449034C>T	ENSP00000373594:p.Ala106Val	Somatic		WXS	SOLID	Phase_I	Q8N993|Q96LL5	Missense_Mutation	SNP	ENST00000388942.3	37	CCDS10289.2	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804146	0.90623	.	.	ENSG00000169758	ENST00000388942	D	0.97279	-4.32	5.3	5.3	0.74995	.	0.070453	0.53938	D	0.000054	D	0.96562	0.8878	M	0.75264	2.295	0.58432	D	0.999998	P	0.39326	0.668	B	0.41374	0.355	D	0.96010	0.9001	10	0.29301	T	0.29	-17.038	17.9623	0.89089	0.0:1.0:0.0:0.0	.	106	Q2M3C6	CO027_HUMAN	V	106	ENSP00000373594:A106V	ENSP00000373594:A106V	A	+	2	0	C15orf27	74236089	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.216000	0.77974	2.490000	0.84030	0.655000	0.94253	GCC		0.463	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2		NM_152335	
PRR14L	253143	hgsc.bcm.edu;ucsc.edu	37	22	32113207	32113207	+	Silent	SNP	C	C	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr22:32113207C>G	ENST00000327423.6	-	4	807	c.618G>C	c.(616-618)ggG>ggC	p.G206G	PRR14L_ENST00000397493.2_Silent_p.G206G|PRR14L_ENST00000434485.1_Silent_p.G206G|PRR14L_ENST00000461722.1_5'UTR	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	206										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						CCGTCTTAGTCCCATTGACCT	0.373																																																	0													346.0	274.0	296.0					22																	32113207		692	1591	2283	SO:0001819	synonymous_variant	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.618G>C	22.37:g.32113207C>G		Somatic		WXS	SOLID	Phase_I	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Silent	SNP	ENST00000327423.6	37	CCDS13900.2																																																																																				0.373	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074993.2		NM_173566	
C6orf132	647024	hgsc.bcm.edu	37	6	42072710	42072715	+	In_Frame_Del	DEL	CTCCTC	CTCCTC	-	rs150599390	byFrequency	TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	CTCCTC	CTCCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr6:42072710_42072715delCTCCTC	ENST00000341865.4	-	4	2934_2939	c.2935_2940delGAGGAG	c.(2935-2940)gaggagdel	p.EE979del		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	979								p.E979_E980delEE(2)		breast(1)	1						CGAAGTTGAACTCCTCCTCCTCCTCC	0.655														215	0.0429313	0.0038	0.0793	5008	,	,		12586	0.001		0.1392	False		,,,				2504	0.0143																2	Deletion - In frame(2)	breast(2)								38,19,2223		3,0,32,4,11,1090						3.3	1.0		dbSNP_134	56	399,18,4063		56,0,287,2,14,1881	no	codingComplex	C6orf132	NM_001164446.1		59,0,319,6,25,2971	A1A1,A1A2,A1R,A2A2,A2R,RR		9.308,2.5,7.0118				437,37,6286				SO:0001651	inframe_deletion	647024				CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.2935_2940delGAGGAG	6.37:g.42072716_42072721delCTCCTC	ENSP00000341368:p.Glu979_Glu980del	Somatic		WXS	SOLID	Phase_I	A6NI05	In_Frame_Del	DEL	ENST00000341865.4	37	CCDS47428.1																																																																																				0.655	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040548.2		NM_001164446	
MPLKIP	136647	hgsc.bcm.edu;ucsc.edu	37	7	40172756	40172756	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr7:40172756G>T	ENST00000306984.6	-	2	533	c.442C>A	c.(442-444)Cct>Act	p.P148T	C7orf10_ENST00000540834.1_5'Flank|C7orf10_ENST00000335693.4_5'Flank|C7orf10_ENST00000309930.5_5'Flank|C7orf10_ENST00000401647.2_5'Flank	NM_138701.3	NP_619646.1	Q8TAP9	MPLKI_HUMAN	M-phase specific PLK1 interacting protein	148					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)											CCAGCCCAAGGATCTTCAAGC	0.383																																																	0													155.0	152.0	153.0					7																	40172756		2203	4300	6503	SO:0001583	missense	0			AX048113	CCDS5463.1	7p14	2014-09-17	2012-03-01	2012-03-01	ENSG00000168303	ENSG00000168303			16002	protein-coding gene	gene with protein product	tricothiodystrophy, non-photosensitive 1	609188	"""chromosome 7 open reading frame 11"""	C7orf11		11829489	Standard	NM_138701		Approved	ORF20, TTDN1	uc003thl.4	Q8TAP9	OTTHUMG00000128797	ENST00000306984.6:c.442C>A	7.37:g.40172756G>T	ENSP00000304553:p.Pro148Thr	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000306984.6	37	CCDS5463.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293097	0.80914	.	.	ENSG00000168303	ENST00000306984	D	0.98987	-5.3	5.55	5.55	0.83447	.	0.397675	0.27604	N	0.018636	D	0.99105	0.9692	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99901	1.1163	10	0.87932	D	0	-13.9474	19.7069	0.96076	0.0:0.0:1.0:0.0	.	148	Q8TAP9	TTDN1_HUMAN	T	148	ENSP00000304553:P148T	ENSP00000304553:P148T	P	-	1	0	C7orf11	40139281	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.344000	0.79328	2.894000	0.99253	0.591000	0.81541	CCT		0.383	MPLKIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250729.3		NM_138701	
CPAMD8	27151	hgsc.bcm.edu	37	19	17104239	17104239	+	Missense_Mutation	SNP	T	T	C	rs151335087	byFrequency	TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr19:17104239T>C	ENST00000443236.1	-	12	1425	c.1394A>G	c.(1393-1395)cAc>cGc	p.H465R	CPAMD8_ENST00000388925.4_Missense_Mutation_p.H418R	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	418						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CAGCCACACGTGCTGGGCTGA	0.587													T|||	24	0.00479233	0.0008	0.0115	5008	,	,		19735	0.0		0.007	False		,,,				2504	0.0082																0								T	ARG/HIS	13,3909		0,13,1948	46.0	45.0	45.0		1394	1.8	0.7	19	dbSNP_134	45	122,8178		3,116,4031	yes	missense	CPAMD8	NM_015692.2	29	3,129,5979	CC,CT,TT		1.4699,0.3315,1.1046	possibly-damaging	465/1933	17104239	135,12087	1961	4150	6111	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1394A>G	19.37:g.17104239T>C	ENSP00000402505:p.His465Arg	Somatic		WXS	SOLID	Phase_I	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	9|9	0.004120879120879121|0.004120879120879121	0|0	0.0|0.0	4|4	0.011049723756906077|0.011049723756906077	0|0	0.0|0.0	5|5	0.006596306068601583|0.006596306068601583	T|T	10.97|10.97	1.501383|1.501383	0.26861|0.26861	0.003315|0.003315	0.014699|0.014699	ENSG00000160111|ENSG00000160111	ENST00000291440;ENST00000388925|ENST00000443236	T;T|.	0.51071|.	0.72;0.74|.	2.86|2.86	1.82|1.82	0.25136|0.25136	.|.	0.203094|.	0.33670|.	N|.	0.004673|.	T|T	0.26268|0.26268	0.0641|0.0641	L|L	0.36672|0.36672	1.1|1.1	0.27826|0.27826	N|N	0.941622|0.941622	P|.	0.39665|.	0.682|.	B|.	0.34489|.	0.184|.	T|T	0.20207|0.20207	-1.0282|-1.0282	10|5	0.25106|.	T|.	0.35|.	.|.	7.5834|7.5834	0.27978|0.27978	0.0:0.108:0.0:0.892|0.0:0.108:0.0:0.892	.|.	418|.	Q8IZJ3|.	CPMD8_HUMAN|.	R|A	465;418|476	ENSP00000291440:H465R;ENSP00000373577:H418R|.	ENSP00000291440:H465R|.	H|T	-|-	2|1	0|0	CPAMD8|CPAMD8	16965239|16965239	1.000000|1.000000	0.71417|0.71417	0.727000|0.727000	0.30756|0.30756	0.980000|0.980000	0.70556|0.70556	4.878000|4.878000	0.63093|0.63093	0.184000|0.184000	0.20083|0.20083	0.533000|0.533000	0.62120|0.62120	CAC|ACG		0.587	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2		NM_015692	
DICER1	23405	hgsc.bcm.edu;ucsc.edu	37	14	95582928	95582928	+	Silent	SNP	A	A	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr14:95582928A>G	ENST00000526495.1	-	12	1905	c.1614T>C	c.(1612-1614)gaT>gaC	p.D538D	DICER1_ENST00000527414.1_Silent_p.D538D|DICER1_ENST00000343455.3_Silent_p.D538D|DICER1_ENST00000393063.1_Silent_p.D538D|DICER1_ENST00000541352.1_Silent_p.D538D			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	538	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CTGTGGGCAAATCAAAACGAA	0.373			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													162.0	173.0	169.0					14																	95582928		2203	4300	6503	SO:0001819	synonymous_variant	23405	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1614T>C	14.37:g.95582928A>G		Somatic		WXS	SOLID	Phase_I	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Silent	SNP	ENST00000526495.1	37	CCDS9931.1																																																																																				0.373	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1			
EXOSC8	11340	hgsc.bcm.edu;ucsc.edu	37	13	37580087	37580087	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr13:37580087C>T	ENST00000389704.3	+	6	534	c.269C>T	c.(268-270)tCa>tTa	p.S90L	EXOSC8_ENST00000489088.1_3'UTR	NM_181503.2	NP_852480.1	Q96B26	EXOS8_HUMAN	exosome component 8	90					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)			biliary_tract(1)|breast(1)|kidney(2)|pancreas(1)|prostate(1)|skin(1)	7		Lung NSC(96;6.57e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.67e-07)|Epithelial(112;1.31e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00699)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0411)		CCCCTGTGTTCATCGAGATTC	0.398																																																	0													94.0	93.0	93.0					13																	37580087		2203	4300	6503	SO:0001583	missense	11340			AF025438	CCDS31958.1	13q13.1	2010-05-07			ENSG00000120699	ENSG00000120699	3.1.13.-		17035	protein-coding gene	gene with protein product	"""CBP-interacting protein 3"", ""Opa interacting protein 2"""	606019				9466265, 11929972	Standard	NM_181503		Approved	OIP2, RRP43, bA421P11.3, Rrp43p, EAP2, p9, CIP3	uc001uwa.3	Q96B26	OTTHUMG00000016742	ENST00000389704.3:c.269C>T	13.37:g.37580087C>T	ENSP00000374354:p.Ser90Leu	Somatic		WXS	SOLID	Phase_I	O43480|Q5TBA5	Missense_Mutation	SNP	ENST00000389704.3	37	CCDS31958.1	.	.	.	.	.	.	.	.	.	.	C	35	5.476686	0.96291	.	.	ENSG00000120699	ENST00000389704	T	0.66815	-0.23	5.93	5.93	0.95920	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.85682	D	0.000000	D	0.86531	0.5955	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87282	0.2293	10	0.52906	T	0.07	-13.5948	20.3539	0.98825	0.0:1.0:0.0:0.0	.	90	Q96B26	EXOS8_HUMAN	L	90	ENSP00000374354:S90L	ENSP00000374354:S90L	S	+	2	0	EXOSC8	36478087	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	7.433000	0.80362	2.826000	0.97356	0.655000	0.94253	TCA		0.398	EXOSC8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044535.2		NM_181503	
FAF1	11124	hgsc.bcm.edu;ucsc.edu	37	1	50941223	50941223	+	Silent	SNP	G	G	A			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:50941223G>A	ENST00000396153.2	-	18	2233	c.1782C>T	c.(1780-1782)aaC>aaT	p.N594N	FAF1_ENST00000545823.1_Silent_p.N352N|FAF1_ENST00000371778.4_Silent_p.N594N	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	594	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TCTGGAGCTTGTTGCTGGCCA	0.507																																																	0													87.0	90.0	89.0					1																	50941223		2203	4300	6503	SO:0001819	synonymous_variant	11124			AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1782C>T	1.37:g.50941223G>A		Somatic		WXS	SOLID	Phase_I	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Silent	SNP	ENST00000396153.2	37	CCDS554.1																																																																																				0.507	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1		NM_007051	
FAR1	84188	hgsc.bcm.edu;ucsc.edu	37	11	13734516	13734516	+	Silent	SNP	A	A	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr11:13734516A>T	ENST00000354817.3	+	8	1035	c.891A>T	c.(889-891)ccA>ccT	p.P297P	FAR1_ENST00000527202.1_3'UTR	NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	297					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						TTTGCAGACCAAGAAACATCA	0.358																																																	0													207.0	202.0	204.0					11																	13734516		2200	4294	6494	SO:0001819	synonymous_variant	84188			AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.891A>T	11.37:g.13734516A>T		Somatic		WXS	SOLID	Phase_I	D3DQW8|Q5CZA3	Silent	SNP	ENST00000354817.3	37	CCDS7813.1																																																																																				0.358	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2		NM_032228	
FBXO9	26268	hgsc.bcm.edu	37	6	52957228	52957228	+	Splice_Site	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr6:52957228G>T	ENST00000244426.6	+	7	857	c.685G>T	c.(685-687)Gac>Tac	p.D229Y	FBXO9_ENST00000323557.7_Splice_Site_p.D219Y|RN7SL244P_ENST00000493405.2_RNA|FBXO9_ENST00000370939.3_Splice_Site_p.D185Y	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	229	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					ATTCCCTAGAGACCCTGAAAT	0.388																																																	0													115.0	105.0	108.0					6																	52957228		1844	4089	5933	SO:0001630	splice_region_variant	26268			AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.684-1G>T	6.37:g.52957228G>T		Somatic		WXS	SOLID	Phase_I	A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Missense_Mutation	SNP	ENST00000244426.6	37	CCDS55023.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823958	0.90873	.	.	ENSG00000112146	ENST00000370939;ENST00000323557;ENST00000244426	T;T;T	0.34667	1.35;1.35;1.35	5.41	5.41	0.78517	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.996	T	0.70575	-0.4834	10	0.87932	D	0	-24.2157	19.5526	0.95328	0.0:0.0:1.0:0.0	.	219;336;229	Q9UK97-2;Q59EH8;Q9UK97	.;.;FBX9_HUMAN	Y	185;219;229	ENSP00000359977:D185Y;ENSP00000326968:D219Y;ENSP00000244426:D229Y	ENSP00000244426:D229Y	D	+	1	0	FBXO9	53065187	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.701000	0.92244	0.563000	0.77884	GAC		0.388	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040950.3			Missense_Mutation
FERMT3	83706	hgsc.bcm.edu;ucsc.edu	37	11	63990880	63990880	+	Silent	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr11:63990880C>T	ENST00000279227.5	+	15	2015	c.1920C>T	c.(1918-1920)ttC>ttT	p.F640F	NUDT22_ENST00000279206.3_5'Flank|NUDT22_ENST00000441250.2_5'Flank|TRPT1_ENST00000540472.1_5'Flank|FERMT3_ENST00000345728.5_Silent_p.F636F	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	640					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GCTACATTTTCCTGTCGACGC	0.587																																																	0													64.0	63.0	63.0					11																	63990880		2201	4297	6498	SO:0001819	synonymous_variant	83706			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1920C>T	11.37:g.63990880C>T		Somatic		WXS	SOLID	Phase_I	Q8IUA1|Q8N207|Q9BT48	Silent	SNP	ENST00000279227.5	37	CCDS8060.1																																																																																				0.587	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1		NM_031471	
IARS	3376	hgsc.bcm.edu;ucsc.edu	37	9	95050488	95050488	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr9:95050488C>T	ENST00000375643.3	-	3	462	c.196G>A	c.(196-198)Gat>Aat	p.D66N	IARS_ENST00000447699.2_Intron|IARS_ENST00000375629.3_5'UTR|IARS_ENST00000443024.2_Missense_Mutation_p.D66N	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	66					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	GTAACTATATCTTTAATTGTA	0.393																																																	0													108.0	100.0	103.0					9																	95050488		2203	4300	6503	SO:0001583	missense	3376			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.196G>A	9.37:g.95050488C>T	ENSP00000364794:p.Asp66Asn	Somatic		WXS	SOLID	Phase_I	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	ENST00000375643.3	37	CCDS6694.1	.	.	.	.	.	.	.	.	.	.	C	36	5.930980	0.97116	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000375660;ENST00000395554	T;T;T	0.43294	0.95;0.95;0.95	6.03	6.03	0.97812	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	D	0.83825	0.5338	H	0.99949	5.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91363	0.5113	10	0.87932	D	0	-28.7695	20.1519	0.98089	0.0:1.0:0.0:0.0	.	66	P41252	SYIC_HUMAN	N	66	ENSP00000364794:D66N;ENSP00000406448:D66N;ENSP00000378922:D66N	ENSP00000364794:D66N	D	-	1	0	IARS	94090309	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.765000	0.85310	2.861000	0.98227	0.655000	0.94253	GAT		0.393	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2		NM_002161	
IRX6	79190	hgsc.bcm.edu	37	16	55360271	55360271	+	Silent	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr16:55360271C>T	ENST00000290552.7	+	2	1401	c.69C>T	c.(67-69)agC>agT	p.S23S	RP11-26L20.3_ENST00000558730.2_RNA|IRX6_ENST00000558315.1_3'UTR	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	23					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						CAAGTTCCAGCACCACATGCT	0.642																																																	0													53.0	51.0	52.0					16																	55360271		2198	4300	6498	SO:0001819	synonymous_variant	79190			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.69C>T	16.37:g.55360271C>T		Somatic		WXS	SOLID	Phase_I	B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	37	CCDS32449.1																																																																																				0.642	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4		NM_024335	
FOCAD	54914	hgsc.bcm.edu;ucsc.edu	37	9	20758088	20758088	+	Splice_Site	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr9:20758088G>T	ENST00000380249.1	+	8	756		c.e8-1		FOCAD_ENST00000338382.6_Splice_Site	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin							focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GTGTCTTTCAGAAATCATCCT	0.433																																																	0													113.0	101.0	105.0					9																	20758088		2203	4300	6503	SO:0001630	splice_region_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.393-1G>T	9.37:g.20758088G>T		Somatic		WXS	SOLID	Phase_I	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Splice_Site	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608174	0.66558	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8915	0.86088	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1797	20748088	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.575000	0.74018	2.521000	0.84997	0.555000	0.69702	.		0.433	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1		NM_017794	Intron
KRT75	9119	hgsc.bcm.edu	37	12	52824455	52824455	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr12:52824455G>T	ENST00000252245.5	-	5	1125	c.905C>A	c.(904-906)aCa>aAa	p.T302K	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	302	Linker 12.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CACCACGGATGTGTCACCGAC	0.527																																																	0													161.0	138.0	146.0					12																	52824455		2203	4300	6503	SO:0001583	missense	9119			Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.905C>A	12.37:g.52824455G>T	ENSP00000252245:p.Thr302Lys	Somatic		WXS	SOLID	Phase_I	B4DQU4|Q9NSA9	Missense_Mutation	SNP	ENST00000252245.5	37	CCDS8827.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382134	0.61845	.	.	ENSG00000170454	ENST00000252245	D	0.86694	-2.16	5.62	5.62	0.85841	Prefoldin (1);Filament (1);	0.000000	0.56097	D	0.000033	D	0.94948	0.8366	H	0.94698	3.57	0.54753	D	0.99998	D	0.76494	0.999	D	0.76071	0.987	D	0.95684	0.8734	10	0.87932	D	0	.	12.9223	0.58239	0.0741:0.0:0.9259:0.0	.	302	O95678	K2C75_HUMAN	K	302	ENSP00000252245:T302K	ENSP00000252245:T302K	T	-	2	0	KRT75	51110722	1.000000	0.71417	0.958000	0.39756	0.066000	0.16364	6.622000	0.74233	2.647000	0.89833	0.655000	0.94253	ACA		0.527	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1		NM_004693	
LAMP2	3920	hgsc.bcm.edu;ucsc.edu	37	X	119581775	119581775	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chrX:119581775C>A	ENST00000200639.4	-	5	798	c.662G>T	c.(661-663)gGa>gTa	p.G221V	LAMP2_ENST00000538785.1_Missense_Mutation_p.G110V|LAMP2_ENST00000371335.4_Missense_Mutation_p.G221V|LAMP2_ENST00000434600.2_Missense_Mutation_p.G221V|LAMP2_ENST00000540603.1_Missense_Mutation_p.G174V			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	221	Hinge.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						TGAATAGGTTCCAGCTTCTGG	0.443																																																	0													273.0	228.0	243.0					X																	119581775		2203	4300	6503	SO:0001583	missense	3920			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.662G>T	X.37:g.119581775C>A	ENSP00000200639:p.Gly221Val	Somatic		WXS	SOLID	Phase_I	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Missense_Mutation	SNP	ENST00000200639.4	37	CCDS14599.1	.	.	.	.	.	.	.	.	.	.	c	22.5	4.293192	0.80914	.	.	ENSG00000005893	ENST00000434600;ENST00000538785;ENST00000200639;ENST00000371335;ENST00000540603	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.67841	0.2936	M	0.76838	2.35	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.70274	-0.4917	10	0.72032	D	0.01	-14.0679	18.3507	0.90337	0.0:1.0:0.0:0.0	.	174;110;221;221;221	B4E2S7;B7Z2R9;P13473-2;P13473;Q6Q3G8	.;.;.;LAMP2_HUMAN;.	V	221;110;221;221;174	ENSP00000408411:G221V;ENSP00000440506:G110V;ENSP00000200639:G221V;ENSP00000360386:G221V;ENSP00000440479:G174V	ENSP00000200639:G221V	G	-	2	0	LAMP2	119465803	1.000000	0.71417	0.166000	0.22797	0.065000	0.16274	4.372000	0.59530	2.559000	0.86315	0.597000	0.82753	GGA		0.443	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058099.1			
LONP2	83752	hgsc.bcm.edu;ucsc.edu	37	16	48385510	48385510	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr16:48385510A>G	ENST00000285737.4	+	15	2449	c.2356A>G	c.(2356-2358)Aaa>Gaa	p.K786E	LONP2_ENST00000535754.1_Missense_Mutation_p.K742E|LONP2_ENST00000564259.1_3'UTR	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AATTAAAGACAAAGTGCTGGC	0.453																																																	0													57.0	60.0	59.0					16																	48385510		2200	4300	6500	SO:0001583	missense	83752			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2356A>G	16.37:g.48385510A>G	ENSP00000285737:p.Lys786Glu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000285737.4	37	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	A	30	5.057851	0.93846	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754	T;T	0.49139	0.79;0.79	5.78	5.78	0.91487	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.042329	0.85682	D	0.000000	T	0.81903	0.4921	H	0.98996	4.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.89462	0.3737	10	0.87932	D	0	-25.0464	16.1579	0.81677	1.0:0.0:0.0:0.0	.	742;786	B7ZKL7;Q86WA8	.;LONP2_HUMAN	E	786;515;742	ENSP00000285737:K786E;ENSP00000445426:K742E	ENSP00000285737:K786E	K	+	1	0	LONP2	46943011	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.300000	0.96151	2.220000	0.72140	0.477000	0.44152	AAA		0.453	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2		NM_031490	
MAP4K3	8491	hgsc.bcm.edu;ucsc.edu	37	2	39552914	39552914	+	Missense_Mutation	SNP	G	G	A	rs182117796		TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr2:39552914G>A	ENST00000263881.3	-	11	1088	c.764C>T	c.(763-765)aCc>aTc	p.T255I	MAP4K3_ENST00000536018.1_5'UTR|RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000437545.1_Missense_Mutation_p.T192I|MAP4K3_ENST00000341681.5_Missense_Mutation_p.T255I	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	255	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				CGGATTTTTGGTAAGTGCCAT	0.259																																																	0													61.0	69.0	67.0					2																	39552914		2200	4291	6491	SO:0001583	missense	8491			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.764C>T	2.37:g.39552914G>A	ENSP00000263881:p.Thr255Ile	Somatic		WXS	SOLID	Phase_I	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	CCDS1803.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	24.3	4.519891	0.85495	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.66460	-0.21;-0.21;-0.21	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	N	0.13327	0.33	0.80722	D	1	P;P	0.40638	0.555;0.725	B;P	0.54706	0.211;0.759	T	0.62793	-0.6779	9	.	.	.	.	20.1739	0.98173	0.0:0.0:1.0:0.0	.	255;255	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	I	255;192;255	ENSP00000263881:T255I;ENSP00000416958:T192I;ENSP00000345434:T255I	.	T	-	2	0	MAP4K3	39406418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.155000	0.71833	2.774000	0.95407	0.585000	0.79938	ACC		0.259	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2		NM_003618	
MTOR	2475	hgsc.bcm.edu;ucsc.edu	37	1	11189847	11189847	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:11189847A>T	ENST00000361445.4	-	40	5738	c.5662T>A	c.(5662-5664)Ttc>Atc	p.F1888I	MTOR_ENST00000376838.1_Missense_Mutation_p.F93I|MTOR_ENST00000495435.1_5'Flank	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1888	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GAACGGAAGAAGCCCTGGACG	0.522																																																	0													177.0	141.0	153.0					1																	11189847		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.5662T>A	1.37:g.11189847A>T	ENSP00000354558:p.Phe1888Ile	Somatic		WXS	SOLID	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	35	5.581516	0.96565	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.76839	-1.05;-1.05	5.79	5.79	0.91817	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.000000	0.85682	D	0.000000	D	0.91693	0.7374	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94029	0.7299	10	0.87932	D	0	-25.9408	16.1354	0.81481	1.0:0.0:0.0:0.0	.	1888	P42345	MTOR_HUMAN	I	1888;93	ENSP00000354558:F1888I;ENSP00000366034:F93I	ENSP00000354558:F1888I	F	-	1	0	MTOR	11112434	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.920000	0.92779	2.207000	0.71202	0.533000	0.62120	TTC		0.522	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
NBPF4	148545	hgsc.bcm.edu	37	1	108786261	108786261	+	Silent	SNP	T	T	C	rs6697615		TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:108786261T>C	ENST00000415641.3	-	2	326	c.123A>G	c.(121-123)aaA>aaG	p.K41K		NM_001143989.2	NP_001137461.1	Q96M43	NBPF4_HUMAN	neuroblastoma breakpoint family, member 4	41						cytoplasm (GO:0005737)				endometrium(2)|lung(1)|skin(1)	4						TTATAAGGAATTTCTCTTTGA	0.463																																																	0																																										SO:0001819	synonymous_variant	148545			AK057395	CCDS44182.1	1p13.3	2013-01-17			ENSG00000196427	ENSG00000196427		"""neuroblastoma breakpoint family"""	26550	protein-coding gene	gene with protein product		613994				16079250	Standard	NM_001143989		Approved	FLJ32833	uc009weo.2	Q96M43	OTTHUMG00000011318	ENST00000415641.3:c.123A>G	1.37:g.108786261T>C		Somatic		WXS	SOLID	Phase_I	Q5T483	Silent	SNP	ENST00000415641.3	37	CCDS44182.1																																																																																				0.463	NBPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031255.5		NM_152488	
NOMO2	283820	hgsc.bcm.edu	37	16	18522873	18522873	+	Silent	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr16:18522873C>T	ENST00000381474.3	-	27	3281	c.3216G>A	c.(3214-3216)acG>acA	p.T1072T	NOMO2_ENST00000543392.1_Silent_p.T905T|NOMO2_ENST00000330537.6_Silent_p.T1072T	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	1072						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						TTACCCATAACGTAGGAAGGT	0.393																																																	0													1.0	1.0	1.0					16																	18522873		2	1	3	SO:0001819	synonymous_variant	283820			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.3216G>A	16.37:g.18522873C>T		Somatic		WXS	SOLID	Phase_I	Q4G177	Silent	SNP	ENST00000381474.3	37	CCDS32394.1																																																																																				0.393	NOMO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435858.1		NM_001004060	
P2RY8	286530	hgsc.bcm.edu	37	X	1585211	1585211	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chrX:1585211A>C	ENST00000381297.4	-	2	451	c.241T>G	c.(241-243)Tac>Gac	p.Y81D	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAATGGTAGTAGATTTGGAAA	0.567			T	CRLF2	"""B-ALL, Downs associated ALL"""																																			Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	0													139.0	126.0	131.0					X																	1585211		2202	4296	6498	SO:0001583	missense	286530			AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.241T>G	X.37:g.1585211A>C	ENSP00000370697:p.Tyr81Asp	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	a	1.181	-0.638132	0.03557	.	.	ENSG00000182162	ENST00000381297	T	0.37058	1.22	2.1	0.629	0.17687	GPCR, rhodopsin-like superfamily (1);	0.678111	0.13104	U	0.413553	T	0.23210	0.0561	L	0.33137	0.985	0.09310	N	1	B	0.30973	0.302	B	0.33121	0.158	T	0.17410	-1.0370	10	0.35671	T	0.21	.	3.6011	0.08024	0.4296:0.1917:0.0:0.3787	.	81	Q86VZ1	P2RY8_HUMAN	D	81	ENSP00000370697:Y81D	ENSP00000370697:Y81D	Y	-	1	0	P2RY8	1545211	0.124000	0.22315	0.676000	0.29932	0.022000	0.10575	-0.142000	0.10311	0.528000	0.28580	0.230000	0.17803	TAC		0.567	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1		NM_178129	
PARP15	165631	hgsc.bcm.edu;ucsc.edu	37	3	122324838	122324838	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr3:122324838C>A	ENST00000464300.2	+	2	308	c.242C>A	c.(241-243)gCt>gAt	p.A81D	PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000483793.1_Missense_Mutation_p.A81D	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	81	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		AATGTTGTAGCTTCAATCCAA	0.388																																																	0													220.0	186.0	197.0					3																	122324838		692	1591	2283	SO:0001583	missense	165631			AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.242C>A	3.37:g.122324838C>A	ENSP00000417214:p.Ala81Asp	Somatic		WXS	SOLID	Phase_I	J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	CCDS46893.1	.	.	.	.	.	.	.	.	.	.	C	7.161	0.585773	0.13749	.	.	ENSG00000173200	ENST00000464300;ENST00000483793	T;T	0.16324	2.65;2.35	2.34	1.42	0.22433	Appr-1-p processing (1);	.	.	.	.	T	0.10809	0.0264	N	0.24115	0.695	0.09310	N	1	B;B	0.14805	0.004;0.011	B;B	0.10450	0.005;0.005	T	0.31223	-0.9951	9	0.35671	T	0.21	.	7.4671	0.27328	0.2585:0.7415:0.0:0.0	.	81;59	C9J7L3;Q460N3	.;PAR15_HUMAN	D	81	ENSP00000417214:A81D;ENSP00000417785:A81D	ENSP00000417214:A81D	A	+	2	0	PARP15	123807528	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.145000	0.10265	0.316000	0.23135	-0.182000	0.12963	GCT		0.388	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2		NM_152615	
PDE4C	5143	hgsc.bcm.edu	37	19	18327665	18327665	+	Silent	SNP	C	C	A			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr19:18327665C>A	ENST00000355502.3	-	16	2242	c.1371G>T	c.(1369-1371)ctG>ctT	p.L457L	PDE4C_ENST00000594465.3_Silent_p.L457L|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000447275.3_Silent_p.L351L|PDE4C_ENST00000598111.2_Silent_p.L172L|PDE4C_ENST00000597297.1_Silent_p.L227L|PDE4C_ENST00000594617.3_Silent_p.L457L|PDE4C_ENST00000262805.12_Silent_p.L425L|PDE4C_ENST00000539010.1_Silent_p.L226L			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	457					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GATGGTTCTCCAGCACCGAGG	0.587																																																	0													93.0	86.0	88.0					19																	18327665		2203	4300	6503	SO:0001819	synonymous_variant	5143				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1371G>T	19.37:g.18327665C>A		Somatic		WXS	SOLID	Phase_I	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	ENST00000355502.3	37	CCDS12373.1																																																																																				0.587	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1			
PTGFR	5737	hgsc.bcm.edu;ucsc.edu	37	1	78958563	78958563	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:78958563C>G	ENST00000370757.3	+	2	372	c.135C>G	c.(133-135)agC>agG	p.S45R	PTGFR_ENST00000370758.1_Missense_Mutation_p.S45R|PTGFR_ENST00000370756.3_Missense_Mutation_p.S45R	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	45					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	TGTCAAACAGCCTTGCCATCG	0.458																																																	0													106.0	105.0	105.0					1																	78958563		2203	4300	6503	SO:0001583	missense	5737			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.135C>G	1.37:g.78958563C>G	ENSP00000359793:p.Ser45Arg	Somatic		WXS	SOLID	Phase_I	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895528	0.52121	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.39056	1.1;1.1;1.1	5.55	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.193604	0.53938	D	0.000056	T	0.36166	0.0957	L	0.40543	1.245	0.48762	D	0.999709	D;D	0.76494	0.998;0.999	D;D	0.72075	0.976;0.973	T	0.13229	-1.0517	10	0.27785	T	0.31	-18.9624	7.9512	0.30017	0.0:0.7308:0.0:0.2692	.	45;45	P43088;P43088-2	PF2R_HUMAN;.	R	45	ENSP00000359794:S45R;ENSP00000359793:S45R;ENSP00000359792:S45R	ENSP00000359792:S45R	S	+	3	2	PTGFR	78731151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.853000	0.39358	1.488000	0.48433	0.655000	0.94253	AGC		0.458	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1		NM_000959	
PKN2	5586	hgsc.bcm.edu;ucsc.edu	37	1	89298945	89298945	+	Silent	SNP	T	T	C			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:89298945T>C	ENST00000370521.3	+	22	3128	c.2769T>C	c.(2767-2769)gcT>gcC	p.A923A	PKN2_ENST00000495119.1_3'UTR|PKN2_ENST00000370505.3_Silent_p.A766A|PKN2_ENST00000370513.5_Silent_p.A875A|PKN2_ENST00000544045.1_Silent_p.A597A	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	923	AGC-kinase C-terminal.|Necessary for the catalytic activity.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		ATTGGAGCGCTCTGATGGACA	0.318																																																	0													103.0	94.0	97.0					1																	89298945		1834	4080	5914	SO:0001819	synonymous_variant	5586			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2769T>C	1.37:g.89298945T>C		Somatic		WXS	SOLID	Phase_I	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Silent	SNP	ENST00000370521.3	37	CCDS714.1																																																																																				0.318	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3		NM_006256	
ARHGEF28	64283	hgsc.bcm.edu;ucsc.edu	37	5	73144821	73144821	+	Silent	SNP	T	T	C			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr5:73144821T>C	ENST00000426542.2	+	12	1676	c.1656T>C	c.(1654-1656)gtT>gtC	p.V552V	ARHGEF28_ENST00000545377.1_Silent_p.V552V|ARHGEF28_ENST00000513042.2_Silent_p.V552V|ARHGEF28_ENST00000287898.5_Silent_p.V552V|ARHGEF28_ENST00000513841.1_3'UTR|ARHGEF28_ENST00000296794.6_Silent_p.V552V|ARHGEF28_ENST00000296799.4_Silent_p.V239V|ARHGEF28_ENST00000437974.1_Silent_p.V552V			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	552					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										TTTCTGGAGTTCGCTCACGTT	0.333																																																	0													55.0	51.0	52.0					5																	73144821		1820	4080	5900	SO:0001819	synonymous_variant	0				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1656T>C	5.37:g.73144821T>C		Somatic		WXS	SOLID	Phase_I	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	37	CCDS54870.1																																																																																				0.333	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1			
RIOK1	83732	hgsc.bcm.edu;ucsc.edu	37	6	7410657	7410657	+	Silent	SNP	G	G	A			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr6:7410657G>A	ENST00000379834.2	+	13	1749	c.1242G>A	c.(1240-1242)cgG>cgA	p.R414R		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	414	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					AGGAAGAACGGTCTAGCCAAG	0.373																																																	0													143.0	136.0	139.0					6																	7410657		2203	4300	6503	SO:0001819	synonymous_variant	83732			BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.1242G>A	6.37:g.7410657G>A		Somatic		WXS	SOLID	Phase_I	B2RB28|Q8NDC8|Q96NV9	Silent	SNP	ENST00000379834.2	37	CCDS4500.1																																																																																				0.373	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039780.2		NM_031480	
SETBP1	26040	hgsc.bcm.edu;ucsc.edu	37	18	42281648	42281648	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr18:42281648G>T	ENST00000282030.5	+	2	633	c.337G>T	c.(337-339)Gct>Tct	p.A113S	SETBP1_ENST00000426838.4_Missense_Mutation_p.A113S	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	113						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CACAAAGCGGGCTAAGAAACC	0.473									Schinzel-Giedion syndrome																																								0													80.0	84.0	83.0					18																	42281648		2203	4300	6503	SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.337G>T	18.37:g.42281648G>T	ENSP00000282030:p.Ala113Ser	Somatic		WXS	SOLID	Phase_I	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142668	0.77888	.	.	ENSG00000152217	ENST00000426838;ENST00000282030;ENST00000552979	T	0.70045	-0.45	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.77980	0.4212	L	0.47716	1.5	0.42866	D	0.994125	D;D	0.65815	0.994;0.995	D;D	0.68765	0.96;0.926	T	0.77247	-0.2658	10	0.49607	T	0.09	.	19.7784	0.96405	0.0:0.0:1.0:0.0	.	113;113	Q9Y6X0;Q9Y6X0-2	SETBP_HUMAN;.	S	113	ENSP00000282030:A113S	ENSP00000282030:A113S	A	+	1	0	SETBP1	40535646	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.302000	0.72788	2.658000	0.90341	0.591000	0.81541	GCT		0.473	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4		NM_001130110	
SLC25A44	9673	hgsc.bcm.edu;ucsc.edu	37	1	156169866	156169866	+	Silent	SNP	G	G	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:156169866G>T	ENST00000359511.4	+	2	400	c.228G>T	c.(226-228)ggG>ggT	p.G76G	SLC25A44_ENST00000423538.2_Silent_p.G76G|SLC25A44_ENST00000469537.1_3'UTR	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	76					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					TCTACCGAGGGTTCCTGGTCA	0.527																																																	0													114.0	105.0	108.0					1																	156169866		2203	4300	6503	SO:0001819	synonymous_variant	9673			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.228G>T	1.37:g.156169866G>T		Somatic		WXS	SOLID	Phase_I	O75034	Silent	SNP	ENST00000359511.4	37	CCDS1133.1																																																																																				0.527	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1		NM_014655	
SUPV3L1	6832	hgsc.bcm.edu;ucsc.edu	37	10	70960220	70960220	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr10:70960220A>C	ENST00000359655.4	+	11	1543	c.1483A>C	c.(1483-1485)Aag>Cag	p.K495Q		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	495	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CAGTTTATTAAAGGAAATTTT	0.443																																																	0													78.0	81.0	80.0					10																	70960220		2203	4300	6503	SO:0001583	missense	6832			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.1483A>C	10.37:g.70960220A>C	ENSP00000352678:p.Lys495Gln	Somatic		WXS	SOLID	Phase_I	A8K301|O43630	Missense_Mutation	SNP	ENST00000359655.4	37	CCDS7287.1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.170667	0.57584	.	.	ENSG00000156502	ENST00000359655	T	0.46451	0.87	5.77	5.77	0.91146	Helicase, C-terminal (1);	0.048339	0.85682	D	0.000000	T	0.37705	0.1013	L	0.45228	1.405	0.80722	D	1	B	0.19706	0.038	B	0.21708	0.036	T	0.13656	-1.0501	10	0.21540	T	0.41	-1.5678	16.0985	0.81148	1.0:0.0:0.0:0.0	.	495	Q8IYB8	SUV3_HUMAN	Q	495	ENSP00000352678:K495Q	ENSP00000352678:K495Q	K	+	1	0	SUPV3L1	70630226	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.090000	0.94144	2.197000	0.70478	0.455000	0.32223	AAG		0.443	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2		NM_003171	
SYNE2	23224	hgsc.bcm.edu;ucsc.edu	37	14	64493398	64493399	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr14:64493398_64493399insG	ENST00000344113.4	+	42	6566_6567	c.6354_6355insG	c.(6355-6357)atcfs	p.I2119fs	SYNE2_ENST00000358025.3_Frame_Shift_Ins_p.I2119fs|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Frame_Shift_Ins_p.I2119fs	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2119					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCCTCACTGACATCAGCAACCA	0.52																																																	0																																										SO:0001589	frameshift_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	Exception_encountered	14.37:g.64493398_64493399insG	ENSP00000341781:p.Ile2119fs	Somatic		WXS	SOLID	Phase_I	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Ins	INS	ENST00000344113.4	37	CCDS41963.1																																																																																				0.520	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2		NM_182914	
TGS1	96764	hgsc.bcm.edu	37	8	56717519	56717519	+	Silent	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr8:56717519C>T	ENST00000260129.5	+	10	2544	c.2067C>T	c.(2065-2067)ttC>ttT	p.F689F		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	689	Sufficient for catalytic activity.				7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			GTCAGTCCTTCAAGTGTGACG	0.443																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0													226.0	180.0	195.0					8																	56717519		2203	4300	6503	SO:0001819	synonymous_variant	96764			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.2067C>T	8.37:g.56717519C>T		Somatic		WXS	SOLID	Phase_I	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Silent	SNP	ENST00000260129.5	37	CCDS34894.1																																																																																				0.443	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1		NM_024831	
TNN	63923	hgsc.bcm.edu	37	1	175053032	175053032	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr1:175053032C>T	ENST00000239462.4	+	5	1308	c.1195C>T	c.(1195-1197)Ccc>Tcc	p.P399S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	399	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGTCACTGTGCCCAAGAGCAG	0.537																																																	0													132.0	107.0	116.0					1																	175053032		2203	4300	6503	SO:0001583	missense	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1195C>T	1.37:g.175053032C>T	ENSP00000239462:p.Pro399Ser	Somatic		WXS	SOLID	Phase_I	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738693	0.49045	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.57752	0.38	5.52	5.52	0.82312	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.381500	0.30732	N	0.008984	T	0.52789	0.1756	L	0.53617	1.68	0.30437	N	0.77655	P;P	0.36354	0.549;0.47	B;B	0.42138	0.228;0.377	T	0.58567	-0.7614	10	0.39692	T	0.17	.	12.4042	0.55430	0.0:0.9225:0.0:0.0775	.	399;399	B3KXB6;Q9UQP3	.;TENN_HUMAN	S	399	ENSP00000239462:P399S	ENSP00000239462:P399S	P	+	1	0	TNN	173319655	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	3.071000	0.50041	2.572000	0.86782	0.591000	0.81541	CCC		0.537	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1		XM_040527	
TOPBP1	11073	hgsc.bcm.edu;ucsc.edu	37	3	133347540	133347540	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr3:133347540C>T	ENST00000260810.5	-	15	2689	c.2558G>A	c.(2557-2559)aGc>aAc	p.S853N		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	853					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TTTCTGTTGGCTGGGACGTCC	0.458								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													77.0	77.0	77.0					3																	133347540		1979	4160	6139	SO:0001583	missense	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2558G>A	3.37:g.133347540C>T	ENSP00000260810:p.Ser853Asn	Somatic		WXS	SOLID	Phase_I	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	C	5.864	0.343511	0.11069	.	.	ENSG00000163781	ENST00000260810	T	0.22336	1.96	5.31	4.41	0.53225	.	0.626869	0.18913	N	0.127712	T	0.12518	0.0304	L	0.28192	0.835	0.34795	D	0.736168	B	0.12013	0.005	B	0.10450	0.005	T	0.18335	-1.0340	10	0.16420	T	0.52	.	6.4983	0.22153	0.0:0.662:0.1491:0.1889	.	853	Q92547	TOPB1_HUMAN	N	853	ENSP00000260810:S853N	ENSP00000260810:S853N	S	-	2	0	TOPBP1	134830230	0.134000	0.22483	0.490000	0.27465	0.137000	0.21094	0.085000	0.14912	1.298000	0.44778	0.650000	0.86243	AGC		0.458	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1		NM_007027	
TRIM29	23650	hgsc.bcm.edu	37	11	119996484	119996484	+	Silent	SNP	C	C	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr11:119996484C>G	ENST00000341846.5	-	4	1669	c.1248G>C	c.(1246-1248)ctG>ctC	p.L416L	TRIM29_ENST00000524816.3_5'Flank|TRIM29_ENST00000529044.1_Silent_p.L155L|TRIM29_ENST00000541857.1_Silent_p.L149L|TRIM29_ENST00000528870.1_5'Flank	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	416					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		ATACATTGAGCAGGTCGTCCT	0.567																																																	0													104.0	90.0	95.0					11																	119996484		2199	4295	6494	SO:0001819	synonymous_variant	23650			AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1248G>C	11.37:g.119996484C>G		Somatic		WXS	SOLID	Phase_I	Q96AA9|Q9BZY7	Silent	SNP	ENST00000341846.5	37	CCDS8428.1																																																																																				0.567	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2		NM_012101	
UPF3B	65109	hgsc.bcm.edu;ucsc.edu	37	X	118974623	118974623	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chrX:118974623C>T	ENST00000276201.2	-	8	901	c.832G>A	c.(832-834)Gtg>Atg	p.V278M	UPF3B_ENST00000478840.1_5'UTR|UPF3B_ENST00000345865.2_Intron	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	278	Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						TTCTGATTCACAGCTTGTAAC	0.373																																																	0													144.0	98.0	114.0					X																	118974623		2203	4300	6503	SO:0001583	missense	65109			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.832G>A	X.37:g.118974623C>T	ENSP00000276201:p.Val278Met	Somatic		WXS	SOLID	Phase_I	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	37	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820063	0.50633	.	.	ENSG00000125351	ENST00000276201	T	0.78126	-1.15	4.89	4.89	0.63831	.	0.420915	0.18866	N	0.128990	T	0.75049	0.3797	L	0.43152	1.355	0.80722	D	1	D	0.55385	0.971	P	0.47299	0.543	T	0.77464	-0.2578	10	0.59425	D	0.04	.	12.8007	0.57584	0.0:1.0:0.0:0.0	.	278	Q9BZI7	REN3B_HUMAN	M	278	ENSP00000276201:V278M	ENSP00000276201:V278M	V	-	1	0	UPF3B	118858651	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.663000	0.54518	2.168000	0.68352	0.415000	0.27848	GTG		0.373	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1			
VPS26B	112936	hgsc.bcm.edu	37	11	134095128	134095128	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr11:134095128T>G	ENST00000281187.5	+	1	590	c.112T>G	c.(112-114)Ttc>Gtc	p.F38V	NCAPD3_ENST00000534548.2_5'Flank|VPS26B_ENST00000525095.2_Missense_Mutation_p.F38V|NCAPD3_ENST00000526422.1_5'Flank	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	38					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		GGAGAAATATTTCCTCTTCTA	0.577																																					Colon(171;1263 1952 15904 45703 47982)												0													103.0	105.0	104.0					11																	134095128		2201	4297	6498	SO:0001583	missense	112936				CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.112T>G	11.37:g.134095128T>G	ENSP00000281187:p.Phe38Val	Somatic		WXS	SOLID	Phase_I	Q96A55	Missense_Mutation	SNP	ENST00000281187.5	37	CCDS8495.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.974624	0.74360	.	.	ENSG00000151502	ENST00000281187;ENST00000525095	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.67618	0.2912	L	0.56769	1.78	0.80722	D	1	B	0.31153	0.31	P	0.45946	0.498	T	0.62604	-0.6819	9	0.17369	T	0.5	-22.4865	14.5485	0.68050	0.0:0.0:0.0:1.0	.	38	Q4G0F5	VP26B_HUMAN	V	38	.	ENSP00000281187:F38V	F	+	1	0	VPS26B	133600338	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.832000	0.86757	1.828000	0.53243	0.460000	0.39030	TTC		0.577	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393591.1		NM_052875	
WWP1	11059	hgsc.bcm.edu;ucsc.edu	37	8	87424056	87424056	+	Silent	SNP	T	T	C			TCGA-B0-4846-01A-01D-1361-10	TCGA-B0-4846-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	808ee2fa-13a3-49c1-9814-622ece3fad6a	0f9057ba-aca4-4d39-b624-9a8e1464beed	g.chr8:87424056T>C	ENST00000517970.1	+	9	1321	c.1014T>C	c.(1012-1014)ccT>ccC	p.P338P	WWP1_ENST00000341922.2_Silent_p.P208P|WWP1_ENST00000349423.2_Silent_p.P120P|WWP1_ENST00000265428.4_Silent_p.P338P	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	338					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GTATGGATCCTGTACGGCAGC	0.428																																																	0													64.0	63.0	63.0					8																	87424056		2203	4300	6503	SO:0001819	synonymous_variant	11059			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1014T>C	8.37:g.87424056T>C		Somatic		WXS	SOLID	Phase_I	O00307|Q5YLC1|Q96BP4	Silent	SNP	ENST00000517970.1	37	CCDS6242.1																																																																																				0.428	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1		NM_007013	
