#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;ucsc.edu	37	7	48556371	48556371	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr7:48556371C>T	ENST00000435803.1	+	52	13715	c.13691C>T	c.(13690-13692)tCg>tTg	p.S4564L	ABCA13_ENST00000544596.1_Missense_Mutation_p.S294L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4564					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTTCCAGTTCGGACGTGGCT	0.393																																																	0													286.0	280.0	282.0					7																	48556371		1916	4125	6041	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13691C>T	7.37:g.48556371C>T	ENSP00000411096:p.Ser4564Leu	Somatic		WXS	SOLID	Phase_I	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434536	0.62955	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.87729	-2.29;-2.29;-2.29	5.35	4.47	0.54385	.	0.000000	0.42172	D	0.000744	D	0.92231	0.7536	M	0.80183	2.485	0.23519	N	0.997502	P;D;D	0.89917	0.936;0.98;1.0	B;B;D	0.65323	0.388;0.418;0.934	D	0.85959	0.1469	10	0.87932	D	0	.	11.3508	0.49587	0.0:0.916:0.0:0.084	.	294;2266;4564	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	L	4564;337;294	ENSP00000411096:S4564L;ENSP00000391042:S337L;ENSP00000442634:S294L	ENSP00000391042:S337L	S	+	2	0	ABCA13	48526917	0.051000	0.20477	0.009000	0.14445	0.708000	0.40852	3.476000	0.53143	1.227000	0.43598	0.655000	0.94253	TCG		0.393	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2		NM_152701	
ABCC6	368	hgsc.bcm.edu	37	16	16282704	16282704	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr16:16282704A>G	ENST00000205557.7	-	13	1792	c.1763T>C	c.(1762-1764)aTc>aCc	p.I588T	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	588	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	GAGGGAGTGGATGGAGAAGGG	0.577																																																	0													70.0	62.0	64.0					16																	16282704		2196	4300	6496	SO:0001583	missense	368			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1763T>C	16.37:g.16282704A>G	ENSP00000205557:p.Ile588Thr	Somatic		WXS	SOLID	Phase_I	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.471188	0.43942	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	D;D	0.91464	-2.85;-2.85	5.47	3.19	0.36642	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.734910	0.11062	U	0.603857	D	0.91985	0.7461	M	0.79343	2.45	0.80722	D	1	P;P	0.44429	0.835;0.736	P;B	0.48400	0.576;0.221	D	0.87707	0.2564	10	0.66056	D	0.02	.	8.3586	0.32346	0.8345:0.0:0.1655:0.0	.	600;588	F5GWQ0;O95255	.;MRP6_HUMAN	T	588;588;600	ENSP00000205557:I588T;ENSP00000405002:I588T	ENSP00000205557:I588T	I	-	2	0	ABCC6	16190205	1.000000	0.71417	0.855000	0.33649	0.841000	0.47740	4.626000	0.61269	0.362000	0.24319	0.533000	0.62120	ATC		0.577	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2			
ACTN2	88	hgsc.bcm.edu;ucsc.edu	37	1	236912534	236912534	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr1:236912534G>T	ENST00000366578.4	+	14	1792	c.1626G>T	c.(1624-1626)atG>atT	p.M542I	ACTN2_ENST00000546208.1_Missense_Mutation_p.M36I|ACTN2_ENST00000542672.1_Missense_Mutation_p.M542I	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	542					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGCAAGATATGTTCATTGTCC	0.448																																																	0													114.0	103.0	107.0					1																	236912534		2203	4300	6503	SO:0001583	missense	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1626G>T	1.37:g.236912534G>T	ENSP00000355537:p.Met542Ile	Somatic		WXS	SOLID	Phase_I	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688114	0.48097	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.50277	0.75;0.75;0.75	5.55	5.55	0.83447	.	0.193717	0.64402	D	0.000005	T	0.60932	0.2307	M	0.66939	2.045	0.80722	D	1	B;B;B;P	0.39071	0.203;0.011;0.172;0.658	B;B;B;P	0.51055	0.173;0.015;0.078;0.657	T	0.52328	-0.8590	10	0.15952	T	0.53	.	19.5083	0.95130	0.0:0.0:1.0:0.0	.	327;542;312;542	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	I	542;542;36;311	ENSP00000443495:M542I;ENSP00000355537:M542I;ENSP00000438384:M36I	ENSP00000355537:M542I	M	+	3	0	ACTN2	234979157	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	6.725000	0.74752	2.600000	0.87896	0.655000	0.94253	ATG		0.448	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1		NM_001103	
ADAMTS1	9510	hgsc.bcm.edu;ucsc.edu	37	21	28214876	28214876	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr21:28214876A>T	ENST00000284984.3	-	2	1313	c.859T>A	c.(859-861)Tcg>Acg	p.S287T		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	287	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		GCTGCCACCGAAAACAACGTG	0.512																																																	0													93.0	78.0	83.0					21																	28214876		2203	4300	6503	SO:0001583	missense	9510			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.859T>A	21.37:g.28214876A>T	ENSP00000284984:p.Ser287Thr	Somatic		WXS	SOLID	Phase_I	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.9|26.9	4.785959|4.785959	0.90282|0.90282	.|.	.|.	ENSG00000154734|ENSG00000154734	ENST00000451462|ENST00000284984;ENST00000517777;ENST00000517452	T|D;D;D	0.61627|0.87103	0.09|-2.21;-2.21;-2.21	5.38|5.38	5.38|5.38	0.77491|0.77491	.|Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.|.	.|.	.|.	.|.	D|D	0.93265|0.93265	0.7854|0.7854	M|M	0.79258|0.79258	2.445|2.445	0.80722|0.80722	D|D	1|1	.|P	.|0.43094	.|0.799	.|D	.|0.64877	.|0.93	D|D	0.93827|0.93827	0.7124|0.7124	7|9	0.46703|0.72032	T|D	0.11|0.01	.|.	15.5408|15.5408	0.76043|0.76043	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|287	.|Q9UHI8	.|ATS1_HUMAN	L|T	68|287;25;49	ENSP00000403404:F68L|ENSP00000284984:S287T;ENSP00000429557:S25T;ENSP00000431065:S49T	ENSP00000403404:F68L|ENSP00000284984:S287T	F|S	-|-	3|1	2|0	ADAMTS1|ADAMTS1	27136747|27136747	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.995000|0.995000	0.86356|0.86356	5.548000|5.548000	0.67255|0.67255	2.252000|2.252000	0.74401|0.74401	0.533000|0.533000	0.62120|0.62120	TTT|TCG		0.512	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			
ADCY8	114	hgsc.bcm.edu;ucsc.edu	37	8	131848556	131848556	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr8:131848556A>T	ENST00000286355.5	-	12	4734	c.2642T>A	c.(2641-2643)tTt>tAt	p.F881Y	ADCY8_ENST00000377928.3_Missense_Mutation_p.F750Y	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	881			F -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATAACGCAGAAAGAGGCCTGC	0.532										HNSCC(32;0.087)																																							0													151.0	120.0	131.0					8																	131848556		2203	4300	6503	SO:0001583	missense	114			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2642T>A	8.37:g.131848556A>T	ENSP00000286355:p.Phe881Tyr	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.038701	0.55003	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.81247	-1.47;-1.44	5.29	5.29	0.74685	.	0.058536	0.64402	D	0.000002	T	0.78084	0.4228	L	0.40543	1.245	0.34893	D	0.745707	P;B	0.46621	0.881;0.293	P;B	0.48166	0.569;0.093	T	0.81024	-0.1120	10	0.23302	T	0.38	.	14.4064	0.67086	1.0:0.0:0.0:0.0	.	750;881	E7EVL1;P40145	.;ADCY8_HUMAN	Y	881;750	ENSP00000286355:F881Y;ENSP00000367161:F750Y	ENSP00000286355:F881Y	F	-	2	0	ADCY8	131917738	1.000000	0.71417	0.999000	0.59377	0.199000	0.23934	6.901000	0.75693	2.000000	0.58554	0.459000	0.35465	TTT		0.532	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			
AHNAK2	113146	hgsc.bcm.edu	37	14	105408995	105408995	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr14:105408995C>A	ENST00000333244.5	-	7	12912	c.12793G>T	c.(12793-12795)Gag>Tag	p.E4265*	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4265						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACGTCCACCTCCATGCTGGGC	0.637																																																	0													130.0	144.0	139.0					14																	105408995		1953	4142	6095	SO:0001587	stop_gained	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12793G>T	14.37:g.105408995C>A	ENSP00000353114:p.Glu4265*	Somatic		WXS	SOLID	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Nonsense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	53	21.266554	0.99939	.	.	ENSG00000185567	ENST00000333244	.	.	.	3.82	1.47	0.22746	.	0.203934	0.22669	U	0.057097	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-22.1568	9.8674	0.41152	0.0:0.7902:0.0:0.2098	.	.	.	.	X	4265	.	ENSP00000353114:E4265X	E	-	1	0	AHNAK2	104480040	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.072000	0.11486	0.582000	0.29556	0.313000	0.20887	GAG		0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1		NM_138420	
BAZ2B	29994	hgsc.bcm.edu;ucsc.edu	37	2	160289486	160289486	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr2:160289486C>T	ENST00000392783.2	-	9	2177	c.1682G>A	c.(1681-1683)aGt>aAt	p.S561N	BAZ2B_ENST00000355831.2_Missense_Mutation_p.S561N|BAZ2B_ENST00000343439.5_Missense_Mutation_p.S559N|BAZ2B_ENST00000392782.1_Missense_Mutation_p.S559N	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	561					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CTTCCCTTGACTATGCAGGAT	0.453																																																	0													193.0	179.0	184.0					2																	160289486		1911	4122	6033	SO:0001583	missense	29994			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1682G>A	2.37:g.160289486C>T	ENSP00000376534:p.Ser561Asn	Somatic		WXS	SOLID	Phase_I	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	10.93	1.491194	0.26774	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.92	2.11	0.27256	.	0.199018	0.25291	U	0.031724	T	0.34890	0.0913	L	0.36672	1.1	0.21105	N	0.99978	B;B;B;B;B	0.25169	0.119;0.001;0.0;0.0;0.0	B;B;B;B;B	0.26202	0.067;0.003;0.002;0.002;0.001	T	0.21484	-1.0244	10	0.44086	T	0.13	-2.9636	8.2314	0.31601	0.0:0.6976:0.1136:0.1888	.	561;365;559;559;561	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	N	559;561;561;559;498	ENSP00000376533:S559N;ENSP00000376534:S561N;ENSP00000348087:S561N;ENSP00000339670:S559N	ENSP00000339670:S559N	S	-	2	0	BAZ2B	159997732	0.101000	0.21875	0.998000	0.56505	0.987000	0.75469	0.454000	0.21827	0.111000	0.17947	0.655000	0.94253	AGT		0.453	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			
BAZ2B	29994	hgsc.bcm.edu;ucsc.edu	37	2	160289488	160289488	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr2:160289488A>T	ENST00000392783.2	-	9	2175	c.1680T>A	c.(1678-1680)caT>caA	p.H560Q	BAZ2B_ENST00000355831.2_Missense_Mutation_p.H560Q|BAZ2B_ENST00000343439.5_Missense_Mutation_p.H558Q|BAZ2B_ENST00000392782.1_Missense_Mutation_p.H558Q	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	560					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TCCCTTGACTATGCAGGATGG	0.453																																																	0													191.0	177.0	181.0					2																	160289488		1909	4122	6031	SO:0001583	missense	29994			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1680T>A	2.37:g.160289488A>T	ENSP00000376534:p.His560Gln	Somatic		WXS	SOLID	Phase_I	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	A	13.50	2.256776	0.39896	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.92	3.53	0.40419	.	0.000000	0.38217	U	0.001767	T	0.41213	0.1149	L	0.27053	0.805	0.21675	N	0.999597	D;B;B;B;B	0.62365	0.991;0.001;0.0;0.001;0.0	D;B;B;B;B	0.68943	0.961;0.003;0.001;0.003;0.001	T	0.18524	-1.0334	10	0.25106	T	0.35	-5.8967	3.5489	0.07839	0.6541:0.1403:0.0716:0.1341	.	560;364;558;558;560	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	Q	558;560;560;558;497	ENSP00000376533:H558Q;ENSP00000376534:H560Q;ENSP00000348087:H560Q;ENSP00000339670:H558Q	ENSP00000339670:H558Q	H	-	3	2	BAZ2B	159997734	0.024000	0.19004	1.000000	0.80357	0.973000	0.67179	0.500000	0.22562	0.490000	0.27771	0.533000	0.62120	CAT		0.453	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			
BCOR	54880	hgsc.bcm.edu	37	X	39911578	39911578	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chrX:39911578A>C	ENST00000378444.4	-	15	5280	c.5052T>G	c.(5050-5052)ttT>ttG	p.F1684L	BCOR_ENST00000378455.4_Missense_Mutation_p.F1632L|BCOR_ENST00000397354.3_Missense_Mutation_p.F1650L|BCOR_ENST00000342274.4_Missense_Mutation_p.F1650L|BCOR_ENST00000378463.1_Missense_Mutation_p.F527L	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1684	Necessary and sufficient for interaction with PCGF1.				heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CCACGTTTGGAAAATTGCAGC	0.438			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																	Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													52.0	50.0	50.0					X																	39911578		2202	4300	6502	SO:0001583	missense	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.5052T>G	X.37:g.39911578A>C	ENSP00000367705:p.Phe1684Leu	Somatic		WXS	SOLID	Phase_I	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.077194	0.55753	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274	T;T;T;T;T;T	0.73897	-0.79;0.54;0.74;0.72;0.65;0.72	5.5	0.959	0.19624	.	.	.	.	.	T	0.74741	0.3756	L	0.61218	1.895	0.42929	D	0.994315	P;B;P	0.41673	0.759;0.214;0.759	P;B;P	0.47251	0.542;0.123;0.542	T	0.74917	-0.3501	9	0.72032	D	0.01	-15.6225	10.5775	0.45235	0.2407:0.0:0.7593:0.0	.	1632;1684;1650	Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;BCOR_HUMAN;.	L	554;527;1632;1650;1684;1650	ENSP00000408006:F554L;ENSP00000367724:F527L;ENSP00000367716:F1632L;ENSP00000380512:F1650L;ENSP00000367705:F1684L;ENSP00000345923:F1650L	ENSP00000345923:F1650L	F	-	3	2	BCOR	39796522	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	4.173000	0.58249	0.305000	0.22832	0.481000	0.45027	TTT		0.438	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2		NM_017745	
BZRAP1	9256	hgsc.bcm.edu	37	17	56386671	56386672	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr17:56386671_56386672insG	ENST00000343736.4	-	22	4124_4125	c.3961_3962insC	c.(3961-3963)ctcfs	p.L1321fs	BZRAP1_ENST00000268893.6_Frame_Shift_Ins_p.L1261fs|BZRAP1_ENST00000355701.3_Frame_Shift_Ins_p.L1321fs			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1321						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAACTGCTGGAGGGGCAGCTCC	0.584																																																	0																																										SO:0001589	frameshift_variant	9256			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.3962dupC	17.37:g.56386675_56386675dupG	ENSP00000345824:p.Leu1321fs	Somatic		WXS	SOLID	Phase_I	O75111|Q8N5W3	Frame_Shift_Ins	INS	ENST00000343736.4	37	CCDS11605.1																																																																																				0.584	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1		NM_004758	
C5	727	hgsc.bcm.edu;ucsc.edu	37	9	123797085	123797085	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr9:123797085G>C	ENST00000223642.1	-	5	609	c.580C>G	c.(580-582)Cct>Gct	p.P194A		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	194					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	ACATACCTAGGATTAGACGGA	0.358																																																	0													59.0	56.0	57.0					9																	123797085		2203	4300	6503	SO:0001583	missense	727			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.580C>G	9.37:g.123797085G>C	ENSP00000223642:p.Pro194Ala	Somatic		WXS	SOLID	Phase_I	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935196	0.73442	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.69306	-0.39	5.87	5.87	0.94306	Alpha-2-macroglobulin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79941	0.4533	L	0.58925	1.835	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75789	-0.3194	10	0.36615	T	0.2	.	19.1458	0.93467	0.0:0.0:1.0:0.0	.	265;194	Q59GS8;P01031	.;CO5_HUMAN	A	194;265	ENSP00000223642:P194A	ENSP00000223642:P194A	P	-	1	0	C5	122836906	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	6.191000	0.72063	2.941000	0.99782	0.655000	0.94253	CCT		0.358	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1		NM_001735	
CNOT3	4849	hgsc.bcm.edu	37	19	54649542	54649542	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr19:54649542T>A	ENST00000406403.1	+	7	2295	c.692T>A	c.(691-693)cTc>cAc	p.L231H	CNOT3_ENST00000221232.5_Missense_Mutation_p.L231H|CNOT3_ENST00000358389.3_Missense_Mutation_p.L50H			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	231					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GACCTGGACCTCGAGGACATT	0.577																																																	0													98.0	86.0	90.0					19																	54649542		2203	4300	6503	SO:0001583	missense	4849			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.692T>A	19.37:g.54649542T>A	ENSP00000383954:p.Leu231His	Somatic		WXS	SOLID	Phase_I	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.0|25.0	4.594981|4.594981	0.86953|0.86953	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000221232;ENST00000358389;ENST00000406403|ENST00000440571	T;T;T|.	0.63744|.	0.17;-0.06;0.17|.	5.19|5.19	5.19|5.19	0.71726|0.71726	Not CCR4-Not complex component, N-terminal (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.79975|0.79975	0.4539|0.4539	M|M	0.88842|0.88842	2.985|2.985	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.79784|.	0.993;0.989;0.993|.	D|D	0.83531|0.83531	0.0091|0.0091	10|5	0.87932|.	D|.	0|.	-28.751|-28.751	14.3342|14.3342	0.66578|0.66578	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	231;231;155|.	B7Z6J7;O75175;Q6ZMJ6|.	.;CNOT3_HUMAN;.|.	H|T	231;50;231|153	ENSP00000221232:L231H;ENSP00000351159:L50H;ENSP00000383954:L231H|.	ENSP00000221232:L231H|.	L|S	+|+	2|1	0|0	CNOT3|CNOT3	59341354|59341354	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.801000|7.801000	0.85960|0.85960	2.102000|2.102000	0.63906|0.63906	0.533000|0.533000	0.62120|0.62120	CTC|TCG		0.577	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3		NM_014516	
COG7	91949	hgsc.bcm.edu;ucsc.edu	37	16	23409386	23409386	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr16:23409386G>T	ENST00000307149.5	-	14	2053	c.1868C>A	c.(1867-1869)cCt>cAt	p.P623H		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	623					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		GTACTCGAGAGGGGTGAGACT	0.502																																																	0													169.0	134.0	146.0					16																	23409386		2197	4300	6497	SO:0001583	missense	91949			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1868C>A	16.37:g.23409386G>T	ENSP00000305442:p.Pro623His	Somatic		WXS	SOLID	Phase_I	Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	37	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766814	0.90020	.	.	ENSG00000168434	ENST00000307149	T	0.75938	-0.98	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86778	0.1977	10	0.87932	D	0	-26.5482	16.7811	0.85563	0.0:0.0:1.0:0.0	.	623	P83436	COG7_HUMAN	H	623	ENSP00000305442:P623H	ENSP00000305442:P623H	P	-	2	0	COG7	23316887	1.000000	0.71417	0.747000	0.31113	0.943000	0.58893	9.341000	0.97041	2.636000	0.89361	0.655000	0.94253	CCT		0.502	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1			
DEFB4A	1673	hgsc.bcm.edu	37	8	7754021	7754021	+	Silent	SNP	T	T	C	rs200885320		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr8:7754021T>C	ENST00000302247.2	+	2	168	c.84T>C	c.(82-84)ccT>ccC	p.P28P		NM_004942.2	NP_004933.1	O15263	DFB4A_HUMAN	defensin, beta 4A	28					chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				lung(1)	1						TAGGCGATCCTGTTACCTGCC	0.428																																					Ovarian(105;1718 2131 4132 11552)												0													1.0	1.0	1.0					8																	7754021		178	237	415	SO:0001819	synonymous_variant	1673			AJ000152	CCDS5971.1	8p23.1	2014-01-30	2010-03-01	2010-03-01	ENSG00000171711	ENSG00000171711		"""Defensins, beta"", ""Endogenous ligands"""	2767	protein-coding gene	gene with protein product		602215	"""defensin, beta 2"", ""defensin, beta 4"""	DEFB102, DEFB2, DEFB4		9202117	Standard	NM_004942		Approved	SAP1, HBD-2, DEFB-2	uc003wsd.3	O15263	OTTHUMG00000129314	ENST00000302247.2:c.84T>C	8.37:g.7754021T>C		Somatic		WXS	SOLID	Phase_I	Q52LC0	Silent	SNP	ENST00000302247.2	37	CCDS5971.1																																																																																				0.428	DEFB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251446.1		NM_004942	
DNAH10	196385	hgsc.bcm.edu;ucsc.edu	37	12	124317763	124317763	+	Missense_Mutation	SNP	G	G	A	rs373563221		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr12:124317763G>A	ENST00000409039.3	+	26	4319	c.4294G>A	c.(4294-4296)Gaa>Aaa	p.E1432K		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1432	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E1432K(1)|p.E24K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTCTGTTGACGAAATTATTCA	0.433																																																	2	Substitution - Missense(2)	large_intestine(2)						G	LYS/GLU	0,3868		0,0,1934	72.0	69.0	70.0		4294	5.8	0.1	12		70	1,8303		0,1,4151	no	missense	DNAH10	NM_207437.3	56	0,1,6085	AA,AG,GG		0.012,0.0,0.0082	probably-damaging	1432/4472	124317763	1,12171	1934	4152	6086	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.4294G>A	12.37:g.124317763G>A	ENSP00000386770:p.Glu1432Lys	Somatic		WXS	SOLID	Phase_I	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327240	0.60743	0.0	1.2E-4	ENSG00000197653	ENST00000409039	T	0.64618	-0.11	5.83	5.83	0.93111	Dynein heavy chain, domain-2 (1);	0.304390	0.30302	U	0.009923	D	0.85124	0.5625	H	0.95712	3.71	0.51482	D	0.99992	D	0.64830	0.994	P	0.62382	0.901	D	0.88730	0.3236	10	0.72032	D	0.01	.	20.1162	0.97934	0.0:0.0:1.0:0.0	.	1432	Q8IVF4	DYH10_HUMAN	K	1432	ENSP00000386770:E1432K	ENSP00000386770:E1432K	E	+	1	0	DNAH10	122883716	1.000000	0.71417	0.085000	0.20634	0.008000	0.06430	8.010000	0.88615	2.756000	0.94617	0.655000	0.94253	GAA		0.433	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			
DSP	1832	hgsc.bcm.edu	37	6	7559606	7559606	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr6:7559606A>C	ENST00000379802.3	+	4	911	c.570A>C	c.(568-570)gaA>gaC	p.E190D	DSP_ENST00000418664.2_Missense_Mutation_p.E190D	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	190	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TCACCAGTGAATGTTTGGGGT	0.572																																																	0													98.0	90.0	93.0					6																	7559606		2203	4300	6503	SO:0001583	missense	1832			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.570A>C	6.37:g.7559606A>C	ENSP00000369129:p.Glu190Asp	Somatic		WXS	SOLID	Phase_I	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.447342	0.25987	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	D;D	0.94576	-3.46;-3.46	5.66	-10.8	0.00216	.	0.261068	0.32987	N	0.005410	T	0.66187	0.2764	N	0.24115	0.695	0.28759	N	0.901039	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.67090	-0.5758	10	0.09084	T	0.74	.	5.6032	0.17365	0.5795:0.1704:0.1702:0.0799	.	237;190	Q4LE79;P15924	.;DESP_HUMAN	D	190	ENSP00000369129:E190D;ENSP00000396591:E190D	ENSP00000369129:E190D	E	+	3	2	DSP	7504605	0.066000	0.20996	0.469000	0.27204	0.912000	0.54170	-1.088000	0.03379	-1.947000	0.01034	-0.331000	0.08364	GAA		0.572	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2		NM_004415	
DZIP1L	199221	hgsc.bcm.edu;ucsc.edu	37	3	137787177	137787177	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr3:137787177C>T	ENST00000327532.2	-	13	2010	c.1648G>A	c.(1648-1650)Gag>Aag	p.E550K	DZIP1L_ENST00000488595.1_5'UTR	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	550					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						GGCTGGGCCTCTCTGGTGACC	0.577											OREG0015830	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													68.0	76.0	73.0					3																	137787177		2203	4300	6503	SO:0001583	missense	199221			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.1648G>A	3.37:g.137787177C>T	ENSP00000332148:p.Glu550Lys	Somatic	1636	WXS	SOLID	Phase_I	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174601	0.57692	.	.	ENSG00000158163	ENST00000327532	T	0.36699	1.24	4.91	3.14	0.36123	.	0.576719	0.16944	N	0.193146	T	0.39708	0.1088	L	0.56769	1.78	0.22213	N	0.999287	D	0.57257	0.979	P	0.49252	0.604	T	0.24368	-1.0162	10	0.72032	D	0.01	-15.4977	7.354	0.26709	0.0:0.8044:0.0:0.1956	.	550	Q8IYY4	DZI1L_HUMAN	K	550	ENSP00000332148:E550K	ENSP00000332148:E550K	E	-	1	0	DZIP1L	139269867	0.027000	0.19231	0.020000	0.16555	0.131000	0.20780	0.316000	0.19469	0.669000	0.31146	0.650000	0.86243	GAG		0.577	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1		NM_173543	
EFCAB1	79645	hgsc.bcm.edu;ucsc.edu	37	8	49643118	49643118	+	Silent	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr8:49643118A>T	ENST00000262103.3	-	3	380	c.300T>A	c.(298-300)tcT>tcA	p.S100S	EFCAB1_ENST00000433756.1_Silent_p.S48S|EFCAB1_ENST00000523092.1_Silent_p.S48S|EFCAB1_ENST00000521002.1_Intron	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	100	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TTTCTTCCAAAGATCCTCGAA	0.353																																																	0													111.0	99.0	103.0					8																	49643118		2203	4300	6503	SO:0001819	synonymous_variant	79645				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.300T>A	8.37:g.49643118A>T		Somatic		WXS	SOLID	Phase_I	B4DSB4|E7EVN7	Silent	SNP	ENST00000262103.3	37	CCDS6145.1	.	.	.	.	.	.	.	.	.	.	A	9.665	1.145240	0.21288	.	.	ENSG00000034239	ENST00000522254	.	.	.	4.44	1.95	0.26073	.	.	.	.	.	T	0.51702	0.1690	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38265	-0.9669	4	.	.	.	.	4.8758	0.13655	0.7421:0.0:0.0938:0.1641	.	.	.	.	I	18	.	.	F	-	1	0	EFCAB1	49805671	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	1.776000	0.38594	0.290000	0.22444	0.460000	0.39030	TTT		0.353	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1		NM_024593	
EIF3G	8666	hgsc.bcm.edu;ucsc.edu	37	19	10229837	10229837	+	Silent	SNP	G	G	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr19:10229837G>T	ENST00000253108.4	-	3	120	c.78C>A	c.(76-78)gtC>gtA	p.V26V	EIF3G_ENST00000587168.1_5'UTR	NM_003755.3	NP_003746.2			eukaryotic translation initiation factor 3, subunit G											central_nervous_system(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			GCTCGCTGGTGACACATTTGT	0.617																																					Colon(124;1100 1638 3822 4510 4876)												0													29.0	26.0	27.0					19																	10229837		2201	4300	6501	SO:0001819	synonymous_variant	8666			U96074	CCDS12227.1	19p13.2	2013-02-12	2007-07-27	2007-07-27		ENSG00000130811		"""RNA binding motif (RRM) containing"""	3274	protein-coding gene	gene with protein product		603913	"""eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa"""	EIF3S4		9822659	Standard	NM_003755		Approved	eIF3-delta, eIF3-p44, eIF3g	uc002mnd.3	O75821		ENST00000253108.4:c.78C>A	19.37:g.10229837G>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000253108.4	37	CCDS12227.1																																																																																				0.617	EIF3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451144.1			
FAM65B	9750	hgsc.bcm.edu;ucsc.edu	37	6	24843257	24843257	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr6:24843257A>T	ENST00000259698.4	-	14	1928	c.1753T>A	c.(1753-1755)Tct>Act	p.S585T	FAM65B_ENST00000473070.1_5'UTR|AL512428.1_ENST00000583229.1_RNA|FAM65B_ENST00000510784.2_Missense_Mutation_p.S569T|FAM65B_ENST00000378023.4_Missense_Mutation_p.S535T|FAM65B_ENST00000538035.1_Missense_Mutation_p.S564T|FAM65B_ENST00000540914.1_Missense_Mutation_p.S535T	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	585					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GAACCCTCAGAGAGCAGCCTG	0.493																																																	0													163.0	167.0	166.0					6																	24843257		1960	4165	6125	SO:0001583	missense	9750			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1753T>A	6.37:g.24843257A>T	ENSP00000259698:p.Ser585Thr	Somatic		WXS	SOLID	Phase_I	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	A	0.771	-0.765887	0.02974	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.39	4.24	0.50183	.	0.850236	0.10802	N	0.632635	T	0.09686	0.0238	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.31625	0.332;0.082;0.163;0.163	B;B;B;B	0.35510	0.204;0.075;0.102;0.064	T	0.21759	-1.0236	10	0.11794	T	0.64	0.3556	10.6415	0.45596	0.9247:0.0:0.0753:0.0	.	569;564;535;585	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	T	585;564;535;535;569	ENSP00000259698:S585T;ENSP00000441138:S564T;ENSP00000367262:S535T;ENSP00000438425:S535T;ENSP00000441305:S569T	ENSP00000259698:S585T	S	-	1	0	FAM65B	24951236	0.031000	0.19500	0.006000	0.13384	0.082000	0.17680	3.055000	0.49916	2.032000	0.59987	0.460000	0.39030	TCT		0.493	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			
GOLGA6A	342096	hgsc.bcm.edu	37	15	74370974	74370974	+	Silent	SNP	T	T	C			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr15:74370974T>C	ENST00000290438.3	-	3	301	c.261A>G	c.(259-261)caA>caG	p.Q87Q		NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	87						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						TTTCATTGAGTTGACTGATTG	0.512																																																	0													1.0	1.0	1.0					15																	74370974		1	2	3	SO:0001819	synonymous_variant	342096			AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.261A>G	15.37:g.74370974T>C		Somatic		WXS	SOLID	Phase_I	A8K959|Q9NYA7	Silent	SNP	ENST00000290438.3	37	CCDS32290.1																																																																																				0.512	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1		XM_292357	
GRM3	2913	hgsc.bcm.edu	37	7	86416162	86416162	+	Missense_Mutation	SNP	C	C	T	rs184377536		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr7:86416162C>T	ENST00000361669.2	+	3	2153	c.1054C>T	c.(1054-1056)Cgg>Tgg	p.R352W	GRM3_ENST00000394720.2_Missense_Mutation_p.R350W|GRM3_ENST00000536043.1_Missense_Mutation_p.R224W|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.R352W|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	352					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R352W(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CCCCTGGTTCCGGGACTTCTG	0.612																																					GBM(52;969 1098 3139 52280)												1	Substitution - Missense(1)	skin(1)											46.0	47.0	46.0					7																	86416162		2203	4300	6503	SO:0001583	missense	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1054C>T	7.37:g.86416162C>T	ENSP00000355316:p.Arg352Trp	Somatic		WXS	SOLID	Phase_I	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	21.0	4.088000	0.76642	.	.	ENSG00000198822	ENST00000361669;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14	5.93	4.98	0.66077	Extracellular ligand-binding receptor (1);	0.276343	0.41605	D	0.000856	D	0.93281	0.7859	M	0.87180	2.865	0.45554	D	0.9985	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.73708	0.968;0.916;0.981	D	0.93435	0.6789	10	0.72032	D	0.01	.	11.3639	0.49660	0.3424:0.6576:0.0:0.0	.	224;352;352	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	W	352;224;352;350	ENSP00000355316:R352W;ENSP00000441407:R224W;ENSP00000398767:R352W;ENSP00000378209:R350W	ENSP00000355316:R352W	R	+	1	2	GRM3	86254098	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.653000	0.67967	2.805000	0.96524	0.655000	0.94253	CGG		0.612	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			
HS2ST1	9653	hgsc.bcm.edu	37	1	87380814	87380814	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr1:87380814A>G	ENST00000370550.5	+	1	458	c.95A>G	c.(94-96)cAg>cGg	p.Q32R	SEP15_ENST00000331835.5_5'Flank|SEP15_ENST00000370554.1_5'Flank|SEP15_ENST00000401030.3_5'Flank|HS2ST1_ENST00000370551.4_Missense_Mutation_p.Q32R|SEP15_ENST00000469566.1_5'Flank	NM_012262.3	NP_036394.1	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1	32					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)	9		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		AACCAGATCCAGAAACTGGAG	0.622																																																	0													63.0	68.0	66.0					1																	87380814		2203	4300	6503	SO:0001583	missense	9653			AB007917	CCDS711.1, CCDS44171.1	1p22.3	2008-02-05			ENSG00000153936	ENSG00000153936		"""Sulfotransferases, membrane-bound"""	5193	protein-coding gene	gene with protein product		604844				9455484	Standard	NM_012262		Approved	KIAA0448	uc010osk.2	Q7LGA3	OTTHUMG00000010255	ENST00000370550.5:c.95A>G	1.37:g.87380814A>G	ENSP00000359581:p.Gln32Arg	Somatic		WXS	SOLID	Phase_I	D3DT22|O75036|Q32NB5|Q8TAC5|Q9H441|Q9NUJ9	Missense_Mutation	SNP	ENST00000370550.5	37	CCDS711.1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.256694	0.59321	.	.	ENSG00000153936	ENST00000370551;ENST00000370550	.	.	.	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	L	0.27053	0.805	0.80722	D	1	D	0.54601	0.967	P	0.62382	0.901	T	0.37619	-0.9698	9	0.13853	T	0.58	-0.3694	13.3976	0.60863	1.0:0.0:0.0:0.0	.	32	Q7LGA3	HS2ST_HUMAN	R	32	.	ENSP00000359581:Q32R	Q	+	2	0	HS2ST1	87153402	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.330000	0.90019	1.838000	0.53458	0.260000	0.18958	CAG		0.622	HS2ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028279.2		NM_012262	
HCN3	57657	hgsc.bcm.edu;ucsc.edu	37	1	155256964	155256964	+	Splice_Site	SNP	A	A	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr1:155256964A>G	ENST00000368358.3	+	7	1486	c.1478A>G	c.(1477-1479)gAg>gGg	p.E493G	HCN3_ENST00000496230.1_Intron	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	493					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ATTTCTGCAGAGATCTGCCTG	0.567																																																	0													54.0	53.0	53.0					1																	155256964		2203	4300	6503	SO:0001630	splice_region_variant	57657			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1478-1A>G	1.37:g.155256964A>G		Somatic		WXS	SOLID	Phase_I	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	ENST00000368358.3	37	CCDS1108.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.741613	0.89573	.	.	ENSG00000143630	ENST00000368358	D	0.98264	-4.83	4.75	4.75	0.60458	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.46758	D	0.000278	D	0.99402	0.9789	H	0.99273	4.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98285	1.0510	9	.	.	.	.	12.4986	0.55942	1.0:0.0:0.0:0.0	.	188;493	B7Z5R8;Q9P1Z3	.;HCN3_HUMAN	G	493	ENSP00000357342:E493G	.	E	+	2	0	HCN3	153523588	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.910000	0.92685	1.906000	0.55180	0.460000	0.39030	GAG		0.567	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087388.1		NM_020897	Missense_Mutation
KCNB2	9312	hgsc.bcm.edu	37	8	73849010	73849010	+	Missense_Mutation	SNP	G	G	A	rs140088625		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr8:73849010G>A	ENST00000523207.1	+	3	2008	c.1420G>A	c.(1420-1422)Gag>Aag	p.E474K		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	474					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.E474K(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GAAGGCCGGAGAGTCCGCCAA	0.532																																																	2	Substitution - Missense(2)	skin(2)											70.0	77.0	75.0					8																	73849010		2203	4300	6503	SO:0001583	missense	9312			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1420G>A	8.37:g.73849010G>A	ENSP00000430846:p.Glu474Lys	Somatic		WXS	SOLID	Phase_I	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968467	0.53614	.	.	ENSG00000182674	ENST00000523207	T	0.30182	1.54	5.74	5.74	0.90152	.	1.435080	0.04497	N	0.380571	T	0.47875	0.1469	L	0.55990	1.75	0.58432	D	0.999997	P	0.38020	0.615	P	0.44696	0.458	T	0.31024	-0.9958	10	0.38643	T	0.18	.	19.91	0.97023	0.0:0.0:1.0:0.0	.	474	Q92953	KCNB2_HUMAN	K	474	ENSP00000430846:E474K	ENSP00000430846:E474K	E	+	1	0	KCNB2	74011564	1.000000	0.71417	0.941000	0.38009	0.162000	0.22319	6.621000	0.74228	2.702000	0.92279	0.655000	0.94253	GAG		0.532	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1		NM_004770	
KDELC1	79070	hgsc.bcm.edu;ucsc.edu	37	13	103450921	103450921	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr13:103450921T>A	ENST00000376004.4	-	1	436	c.100A>T	c.(100-102)Ata>Tta	p.I34L	KDELC1_ENST00000460338.1_5'UTR|BIVM_ENST00000448849.2_5'Flank|BIVM_ENST00000257336.1_5'Flank|BIVM_ENST00000419638.1_5'Flank	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	34						endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GGTCCCCATATTTCGCTCTTC	0.522																																																	0													74.0	70.0	71.0					13																	103450921		2203	4300	6503	SO:0001583	missense	79070			BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.100A>T	13.37:g.103450921T>A	ENSP00000365172:p.Ile34Leu	Somatic		WXS	SOLID	Phase_I	Q53HL3|Q9BVD2	Missense_Mutation	SNP	ENST00000376004.4	37	CCDS9504.1	.	.	.	.	.	.	.	.	.	.	T	18.14	3.557743	0.65425	.	.	ENSG00000134901	ENST00000376004	T	0.22134	1.97	5.32	-5.5	0.02576	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.507646	0.23243	N	0.050323	T	0.10852	0.0265	N	0.19112	0.55	0.20074	N	0.999936	B	0.02656	0.0	B	0.06405	0.002	T	0.16958	-1.0385	10	0.52906	T	0.07	.	11.7162	0.51655	0.0:0.5733:0.1138:0.3129	.	34	Q6UW63	KDEL1_HUMAN	L	34	ENSP00000365172:I34L	ENSP00000365172:I34L	I	-	1	0	KDELC1	102248922	0.099000	0.21834	0.946000	0.38457	0.998000	0.95712	0.071000	0.14594	-0.742000	0.04790	0.528000	0.53228	ATA		0.522	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045699.1			
KRT82	3888	hgsc.bcm.edu	37	12	52797691	52797691	+	Silent	SNP	G	G	A	rs145667835		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr12:52797691G>A	ENST00000257974.2	-	2	491	c.414C>T	c.(412-414)gtC>gtT	p.V138V	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	138	Coil 1A.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.V138V(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		CCAGGAAACGGACCTGCAGCC	0.542																																																	1	Substitution - coding silent(1)	skin(1)											30.0	28.0	29.0					12																	52797691		2203	4300	6503	SO:0001819	synonymous_variant	3888			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.414C>T	12.37:g.52797691G>A		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000257974.2	37	CCDS8826.1																																																																																				0.542	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1		NM_033033	
LTA4H	4048	hgsc.bcm.edu	37	12	96421314	96421314	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr12:96421314A>G	ENST00000228740.2	-	3	460	c.319T>C	c.(319-321)Ttt>Ctt	p.F107L	RP11-256L6.2_ENST00000547346.1_RNA|LTA4H_ENST00000413268.2_Missense_Mutation_p.F83L|LTA4H_ENST00000552789.1_Missense_Mutation_p.F83L	NM_000895.2	NP_000886.1	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	107					arachidonic acid metabolic process (GO:0019369)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|peptide catabolic process (GO:0043171)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|leukotriene-A4 hydrolase activity (GO:0004463)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(3)|lung(4)|skin(2)|stomach(1)	12					Captopril(DB01197)	GAGGTCTCAAAAGAAATTTCT	0.348																																																	0													56.0	59.0	58.0					12																	96421314		2203	4300	6503	SO:0001583	missense	4048			BC032528	CCDS9059.1, CCDS58266.1, CCDS58267.1	12q22	2005-10-06				ENSG00000111144	3.3.2.6		6710	protein-coding gene	gene with protein product		151570				7628486	Standard	NM_000895		Approved		uc001ten.2	P09960	OTTHUMG00000170355	ENST00000228740.2:c.319T>C	12.37:g.96421314A>G	ENSP00000228740:p.Phe107Leu	Somatic		WXS	SOLID	Phase_I	B4DNQ9|F8VV40|Q6IAT6|Q9UCT7	Missense_Mutation	SNP	ENST00000228740.2	37	CCDS9059.1	.	.	.	.	.	.	.	.	.	.	A	14.58	2.579180	0.46006	.	.	ENSG00000111144	ENST00000228740;ENST00000552789;ENST00000413268	T;T;T	0.03441	3.93;3.93;3.93	5.79	5.79	0.91817	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.305862	0.38058	N	0.001827	T	0.04182	0.0116	N	0.17474	0.49	0.50313	D	0.999863	B;B;B	0.28667	0.219;0.099;0.022	B;B;B	0.32583	0.148;0.096;0.098	T	0.52533	-0.8563	10	0.59425	D	0.04	-24.7051	16.1376	0.81497	1.0:0.0:0.0:0.0	.	83;83;107	P09960-3;F8VV40;P09960	.;.;LKHA4_HUMAN	L	107;83;83	ENSP00000228740:F107L;ENSP00000449958:F83L;ENSP00000395051:F83L	ENSP00000228740:F107L	F	-	1	0	LTA4H	94945445	1.000000	0.71417	0.974000	0.42286	0.021000	0.10359	6.907000	0.75724	2.212000	0.71576	0.533000	0.62120	TTT		0.348	LTA4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408655.1		NM_000895	
LUZP1	7798	hgsc.bcm.edu;ucsc.edu	37	1	23418897	23418897	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr1:23418897A>G	ENST00000302291.4	-	4	2659	c.1858T>C	c.(1858-1860)Tca>Cca	p.S620P	LUZP1_ENST00000314174.5_Missense_Mutation_p.S620P|LUZP1_ENST00000374623.3_Missense_Mutation_p.S620P|LUZP1_ENST00000418342.1_Missense_Mutation_p.S620P			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	620					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TGTGAGGTTGAAAATCCCTGA	0.473																																																	0													161.0	163.0	162.0					1																	23418897		2203	4300	6503	SO:0001583	missense	7798			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.1858T>C	1.37:g.23418897A>G	ENSP00000303758:p.Ser620Pro	Somatic		WXS	SOLID	Phase_I	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	37	CCDS30628.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.357239	0.41801	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.17054	2.51;2.51;2.51;2.3	5.88	2.3	0.28687	.	0.192895	0.25848	N	0.027910	T	0.12050	0.0293	L	0.51422	1.61	0.18873	N	0.999987	B;B	0.14438	0.002;0.01	B;B	0.11329	0.006;0.006	T	0.20605	-1.0270	10	0.54805	T	0.06	.	0.4807	0.00547	0.4469:0.1476:0.1592:0.2464	.	620;620	Q86V48-2;Q86V48	.;LUZP1_HUMAN	P	620	ENSP00000393460:S620P;ENSP00000363752:S620P;ENSP00000303758:S620P;ENSP00000313705:S620P	ENSP00000303758:S620P	S	-	1	0	LUZP1	23291484	0.987000	0.35691	0.996000	0.52242	0.654000	0.38779	1.030000	0.30153	2.262000	0.75019	0.529000	0.55759	TCA		0.473	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3		NM_033631	
MBTD1	54799	hgsc.bcm.edu;ucsc.edu	37	17	49281222	49281222	+	Silent	SNP	A	A	G			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr17:49281222A>G	ENST00000586178.1	-	8	1012	c.669T>C	c.(667-669)aaT>aaC	p.N223N	MBTD1_ENST00000376381.2_Silent_p.N223N|MBTD1_ENST00000415868.1_Silent_p.N223N	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	223					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			AACCACATATATTGCACCAGA	0.383																																																	0													162.0	162.0	162.0					17																	49281222		2203	4300	6503	SO:0001819	synonymous_variant	54799			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.669T>C	17.37:g.49281222A>G		Somatic		WXS	SOLID	Phase_I	Q6ZVU7|Q9NXU1	Silent	SNP	ENST00000586178.1	37	CCDS11581.2																																																																																				0.383	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318124.1			
MUC4	4585	hgsc.bcm.edu	37	3	195510773	195510773	+	Missense_Mutation	SNP	A	A	G	rs2911272	byFrequency	TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr3:195510773A>G	ENST00000463781.3	-	2	8137	c.7678T>C	c.(7678-7680)Tct>Cct	p.S2560P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2560P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCGTGA	0.582													.|||	3259	0.650759	0.6006	0.5951	5008	,	,		11675	0.8194		0.6074	False		,,,				2504	0.6288																0													61.0	50.0	53.0					3																	195510773		679	1590	2269	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7678T>C	3.37:g.195510773A>G	ENSP00000417498:p.Ser2560Pro	Somatic		WXS	SOLID	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.455	-0.111246	0.06881	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39592	1.07;1.2	.	.	.	.	.	.	.	.	T	0.12603	0.0306	N	0.02539	-0.55	0.80722	P	0.0	B	0.26876	0.162	B	0.08055	0.003	T	0.23297	-1.0192	6	.	.	.	.	3.917	0.09227	0.4174:0.0:0.0:0.5826	.	2560	E7ESK3	.	P	2560	ENSP00000417498:S2560P;ENSP00000420243:S2560P	.	S	-	1	0	MUC4	196995168	0.000000	0.05858	0.009000	0.14445	0.000000	0.00434	-0.290000	0.08354	-0.942000	0.03695	0.000000	0.15137	TCT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
TRPC4AP	26133	hgsc.bcm.edu	37	20	33587603	33587603	+	IGR	SNP	G	G	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr20:33587603G>T	ENST00000252015.2	-	0	3226				MYH7B_ENST00000262873.7_Nonsense_Mutation_p.E1601*			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GGGGGCCCTGGAGCTGGAGGA	0.652																																																	0													41.0	48.0	46.0					20																	33587603		1930	4130	6060	SO:0001628	intergenic_variant	57644			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319		20.37:g.33587603G>T		Somatic		WXS	SOLID	Phase_I	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Nonsense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	44	10.681059	0.99449	.	.	ENSG00000078814	ENST00000262873	.	.	.	4.57	4.57	0.56435	.	0.000000	0.35179	N	0.003391	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6036	0.88032	0.0:0.0:1.0:0.0	.	.	.	.	X	1601	.	ENSP00000262873:E1601X	E	+	1	0	MYH7B	33051264	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.597000	0.98273	2.381000	0.81170	0.558000	0.71614	GAG		0.652	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2		NM_015638	
OR10G3	26533	hgsc.bcm.edu	37	14	22038056	22038056	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr14:22038056C>T	ENST00000303532.1	-	1	819	c.820G>A	c.(820-822)Gcc>Acc	p.A274T		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		GGGACTAGGGCAGCTGCCCCA	0.567																																																	0													74.0	78.0	76.0					14																	22038056		2203	4300	6503	SO:0001583	missense	26533				CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.820G>A	14.37:g.22038056C>T	ENSP00000302437:p.Ala274Thr	Somatic		WXS	SOLID	Phase_I	Q6IET7|Q96R77	Missense_Mutation	SNP	ENST00000303532.1	37	CCDS32046.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870642	0.51588	.	.	ENSG00000169208	ENST00000303532	T	0.37752	1.18	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	D	0.000501	T	0.43545	0.1252	L	0.29908	0.895	0.37615	D	0.921092	D	0.71674	0.998	D	0.67382	0.951	T	0.43097	-0.9412	10	0.42905	T	0.14	-9.6368	10.922	0.47169	0.1877:0.8123:0.0:0.0	.	274	Q8NGC4	O10G3_HUMAN	T	274	ENSP00000302437:A274T	ENSP00000302437:A274T	A	-	1	0	OR10G3	21107896	0.211000	0.23529	1.000000	0.80357	0.401000	0.30781	0.838000	0.27572	2.376000	0.81061	0.305000	0.20034	GCC		0.567	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1			
OR4F4	26682	hgsc.bcm.edu	37	15	102462857	102462857	+	Missense_Mutation	SNP	C	C	T	rs200667206	byFrequency	TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr15:102462857C>T	ENST00000326183.3	-	1	441	c.406G>A	c.(406-408)Ggc>Agc	p.G136S		NM_001004195.2	NP_001004195.2	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F, member 4	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GCCATAATGCCGACACATGCG	0.493													c|||	154	0.0307508	0.0182	0.0187	5008	,	,		39921	0.006		0.0239	False		,,,				2504	0.089																0													2.0	2.0	2.0					15																	102462857		514	1891	2405	SO:0001583	missense	26682				CCDS32343.1	15q26.3	2012-08-09			ENSG00000177693	ENSG00000177693		"""GPCR / Class A : Olfactory receptors"""	8301	protein-coding gene	gene with protein product							Standard	NM_001004195		Approved	OR4F18	uc002cdf.1	Q96R69		ENST00000326183.3:c.406G>A	15.37:g.102462857C>T	ENSP00000317482:p.Gly136Ser	Somatic		WXS	SOLID	Phase_I	B2RNI5|Q6IFN9	Missense_Mutation	SNP	ENST00000326183.3	37	CCDS32343.1	.	.	.	.	.	.	.	.	.	.	.	0.556	-0.847333	0.02651	.	.	ENSG00000177693	ENST00000326183	T	0.00063	8.78	2.81	-0.391	0.12446	GPCR, rhodopsin-like superfamily (1);	0.377447	0.19878	N	0.104026	T	0.00073	0.0002	N	0.11341	0.13	0.09310	N	1	B	0.33198	0.401	B	0.25506	0.061	T	0.02721	-1.1119	9	.	.	.	.	4.6638	0.12655	0.3767:0.5061:0.0:0.1172	.	136	Q96R69	OR4F4_HUMAN	S	136	ENSP00000317482:G136S	.	G	-	1	0	OR4F4	100280380	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-2.532000	0.00943	-0.069000	0.12931	0.298000	0.19748	GGC		0.493	OR4F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417599.1		NM_001004195	
PALB2	79728	hgsc.bcm.edu;ucsc.edu	37	16	23634440	23634440	+	Missense_Mutation	SNP	C	C	G	rs587778588		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr16:23634440C>G	ENST00000261584.4	-	9	2998	c.2846G>C	c.(2845-2847)tGt>tCt	p.C949S	CTD-2196E14.3_ENST00000561764.1_RNA	NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	949	Interaction with RAD51, BRCA2 and POLH.|Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		ATCAGAGGAACAAAACAATGC	0.363			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0													56.0	51.0	53.0					16																	23634440		2197	4300	6497	SO:0001583	missense	79728				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.2846G>C	16.37:g.23634440C>G	ENSP00000261584:p.Cys949Ser	Somatic		WXS	SOLID	Phase_I	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	C	9.361	1.067898	0.20067	.	.	ENSG00000083093	ENST00000261584	T	0.39406	1.08	5.93	0.156	0.14910	WD40 repeat-like-containing domain (1);	0.305729	0.36134	N	0.002767	T	0.31199	0.0789	L	0.59436	1.845	0.22226	N	0.999272	B	0.32507	0.373	B	0.31812	0.136	T	0.12630	-1.0540	10	0.34782	T	0.22	0.1867	4.3792	0.11286	0.0:0.444:0.1615:0.3945	.	949	Q86YC2	PALB2_HUMAN	S	949	ENSP00000261584:C949S	ENSP00000261584:C949S	C	-	2	0	PALB2	23541941	0.977000	0.34250	0.149000	0.22428	0.203000	0.24098	0.039000	0.13884	0.020000	0.15106	0.555000	0.69702	TGT		0.363	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2		NM_024675	
PANK2	80025	hgsc.bcm.edu;ucsc.edu	37	20	3891254	3891254	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr20:3891254G>A	ENST00000316562.4	+	3	1018	c.1012G>A	c.(1012-1014)Gaa>Aaa	p.E338K	PANK2_ENST00000497424.1_Missense_Mutation_p.E47K|PANK2_ENST00000610179.1_Missense_Mutation_p.E215K|PANK2_ENST00000464452.1_3'UTR	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	338					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CAAACTGGATGAACTAGATTG	0.348																																																	0													121.0	121.0	121.0					20																	3891254		2203	4300	6503	SO:0001583	missense	80025			AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1012G>A	20.37:g.3891254G>A	ENSP00000313377:p.Glu338Lys	Somatic		WXS	SOLID	Phase_I	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	.	.	.	.	.	.	.	.	.	.	G	34	5.367201	0.95900	.	.	ENSG00000125779	ENST00000497424;ENST00000316562;ENST00000399552	D;D	0.99488	-6.0;-6.0	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.99661	0.9874	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97556	1.0095	10	0.87932	D	0	.	15.622	0.76813	0.0:0.0:1.0:0.0	.	338	Q9BZ23	PANK2_HUMAN	K	47;338;154	ENSP00000417609:E47K;ENSP00000313377:E338K	ENSP00000313377:E338K	E	+	1	0	PANK2	3839254	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.563000	0.98148	2.555000	0.86185	0.591000	0.81541	GAA		0.348	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2		NM_024960	
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52643328	52643328	+	Splice_Site	SNP	C	C	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr3:52643328C>T	ENST00000296302.7	-	16	2569		c.e16+1		PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGAAAACATACCGATTCATCC	0.318			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													49.0	50.0	50.0					3																	52643328		2203	4300	6503	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2567+1G>A	3.37:g.52643328C>T		Somatic		WXS	SOLID	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	22.9	4.353189	0.82132	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52618368	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.792000	0.85828	2.894000	0.99253	0.655000	0.94253	.		0.318	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Intron
PLEKHA6	22874	hgsc.bcm.edu	37	1	204210581	204210581	+	Silent	SNP	C	C	T	rs151293148	byFrequency	TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr1:204210581C>T	ENST00000272203.3	-	17	2647	c.2331G>A	c.(2329-2331)tcG>tcA	p.S777S	PLEKHA6_ENST00000414478.1_Silent_p.S797S	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	777								p.S777S(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CATCAGTGGGCGATTTTGTCC	0.562													C|||	10	0.00199681	0.0	0.0	5008	,	,		19258	0.0		0.003	False		,,,				2504	0.0072																1	Substitution - coding silent(1)	pancreas(1)						C		4,4402	8.1+/-20.4	0,4,2199	43.0	36.0	39.0		2331	-6.9	0.4	1	dbSNP_134	39	23,8577	16.0+/-53.3	0,23,4277	no	coding-synonymous	PLEKHA6	NM_014935.2		0,27,6476	TT,TC,CC		0.2674,0.0908,0.2076		777/1049	204210581	27,12979	2203	4300	6503	SO:0001819	synonymous_variant	22874			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2331G>A	1.37:g.204210581C>T		Somatic		WXS	SOLID	Phase_I	A7MD51|Q5VTI6	Silent	SNP	ENST00000272203.3	37	CCDS1444.1																																																																																				0.562	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3		NM_014935	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43991494	43991494	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr2:43991494C>A	ENST00000282406.4	+	29	4396	c.4286C>A	c.(4285-4287)gCa>gAa	p.A1429E		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1429	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTTGCCATGGCAAAACCCAAG	0.373																																																	0													78.0	81.0	80.0					2																	43991494		2203	4300	6503	SO:0001583	missense	130271			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.4286C>A	2.37:g.43991494C>A	ENSP00000282406:p.Ala1429Glu	Somatic		WXS	SOLID	Phase_I	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455204	0.63401	.	.	ENSG00000152527	ENST00000282406	T	0.72615	-0.67	5.64	5.64	0.86602	FERM domain (1);	0.231012	0.43260	D	0.000598	T	0.69424	0.3109	L	0.46614	1.455	0.45567	D	0.998518	P	0.38455	0.632	B	0.40825	0.341	T	0.66312	-0.5955	10	0.30854	T	0.27	-25.5431	19.7009	0.96052	0.0:1.0:0.0:0.0	.	1429	Q8IVE3	PKHH2_HUMAN	E	1429	ENSP00000282406:A1429E	ENSP00000282406:A1429E	A	+	2	0	PLEKHH2	43844998	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.511000	0.53400	2.646000	0.89796	0.563000	0.77884	GCA		0.373	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1		NM_172069	
PTPN3	5774	hgsc.bcm.edu	37	9	112151594	112151594	+	Silent	SNP	G	G	C			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr9:112151594G>C	ENST00000374541.2	-	22	2276	c.2172C>G	c.(2170-2172)acC>acG	p.T724T	PTPN3_ENST00000497739.1_5'UTR|PTPN3_ENST00000412145.1_Silent_p.T593T|PTPN3_ENST00000446349.1_Silent_p.T548T|PTPN3_ENST00000262539.3_Silent_p.T570T|PTPN3_ENST00000394827.3_Silent_p.T192T	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	724	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						ACTGTGCACAGGTATGCGGCA	0.468																																																	0													86.0	77.0	80.0					9																	112151594		2203	4300	6503	SO:0001819	synonymous_variant	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.2172C>G	9.37:g.112151594G>C		Somatic		WXS	SOLID	Phase_I	A0AUW9|E7EN99|E9PGU7	Silent	SNP	ENST00000374541.2	37	CCDS6776.1																																																																																				0.468	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4			
RASGRF1	5923	hgsc.bcm.edu;ucsc.edu	37	15	79356835	79356835	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr15:79356835G>T	ENST00000419573.3	-	2	584	c.310C>A	c.(310-312)Cag>Aag	p.Q104K	RASGRF1_ENST00000558480.2_Missense_Mutation_p.Q104K|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	104	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AAGGCTTTCTGGTTCTCATGG	0.502																																																	0													303.0	247.0	266.0					15																	79356835		2196	4293	6489	SO:0001583	missense	5923			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.310C>A	15.37:g.79356835G>T	ENSP00000405963:p.Gln104Lys	Somatic		WXS	SOLID	Phase_I	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722041	0.89298	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.39997	1.05	4.95	4.95	0.65309	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.144057	0.48767	D	0.000170	T	0.62816	0.2459	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.71674	0.996;0.998;0.998;0.997	D;D;D;D	0.75484	0.953;0.986;0.986;0.977	T	0.66089	-0.6010	10	0.87932	D	0	.	15.7119	0.77635	0.0:0.0:1.0:0.0	.	104;104;104;104	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	K	104	ENSP00000405963:Q104K	ENSP00000378224:Q104K	Q	-	1	0	RASGRF1	77143890	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.865000	0.92300	2.564000	0.86499	0.561000	0.74099	CAG		0.502	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3		NM_002891	
RSPH10B	222967	hgsc.bcm.edu	37	7	5984721	5984721	+	Silent	SNP	C	C	T	rs201017159	byFrequency	TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr7:5984721C>T	ENST00000405415.1	-	12	1889	c.1503G>A	c.(1501-1503)gcG>gcA	p.A501A	RSPH10B_ENST00000535104.1_Intron|RSPH10B_ENST00000539903.1_Silent_p.A267A|RSPH10B_ENST00000337579.3_Silent_p.A501A|RSPH10B_ENST00000404406.1_Silent_p.A501A|RSPH10B_ENST00000441023.2_Silent_p.A501A			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	501										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		AAATGTGGTACGCCAAATGCA	0.368																																																	0													3.0	4.0	4.0					7																	5984721		1780	3764	5544	SO:0001819	synonymous_variant	222967				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.1503G>A	7.37:g.5984721C>T		Somatic		WXS	SOLID	Phase_I	A6NMW7|Q86ST9|Q8NE68	Silent	SNP	ENST00000405415.1	37	CCDS34598.1																																																																																				0.368	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325465.2		NM_173565	
RSPH10B2	728194	hgsc.bcm.edu	37	7	6806405	6806405	+	Missense_Mutation	SNP	T	T	C	rs201147032		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr7:6806405T>C	ENST00000403107.1	+	7	1064	c.677T>C	c.(676-678)aTa>aCa	p.I226T	RSPH10B2_ENST00000359718.3_5'UTR|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.I226T|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.I226T|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.I226T			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	226										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						TCTGGAAATATATACGAAGGC	0.473																																																	0																																										SO:0001583	missense	728194				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.677T>C	7.37:g.6806405T>C	ENSP00000384766:p.Ile226Thr	Somatic		WXS	SOLID	Phase_I	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	CCDS43552.1	132	0.06043956043956044	60	0.12195121951219512	10	0.027624309392265192	12	0.02097902097902098	50	0.06596306068601583	T	8.283	0.816055	0.16607	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859;ENST00000540958	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	3.55	3.55	0.40652	.	0.278846	0.33217	N	0.005148	T	0.00412	0.0013	N	0.12471	0.22	0.80722	D	1	B	0.21520	0.057	B	0.24269	0.052	T	0.02781	-1.1111	10	0.41790	T	0.15	.	10.2518	0.43372	0.0:0.0:0.0:1.0	.	226	B2RC85	R10B2_HUMAN	T	226;226;226;226;85	ENSP00000384766:I226T;ENSP00000386102:I226T;ENSP00000297186:I226T;ENSP00000416710:I226T	ENSP00000297186:I226T	I	+	2	0	RSPH10B2	6772930	0.253000	0.23982	0.974000	0.42286	0.840000	0.47671	1.481000	0.35476	1.491000	0.48482	0.310000	0.20435	ATA		0.473	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4		NM_001099697	
SLC27A6	28965	hgsc.bcm.edu;ucsc.edu	37	5	128302059	128302059	+	Missense_Mutation	SNP	G	G	A	rs200731740		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr5:128302059G>A	ENST00000262462.4	+	1	1239	c.229G>A	c.(229-231)Gga>Aga	p.G77R	SLC27A6_ENST00000395266.1_Missense_Mutation_p.G77R|SLC27A6_ENST00000506176.1_Missense_Mutation_p.G77R			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	77					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CATCTATGAGGGAGACATCTA	0.478																																																	0													114.0	109.0	111.0					5																	128302059		2203	4300	6503	SO:0001583	missense	28965			AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.229G>A	5.37:g.128302059G>A	ENSP00000262462:p.Gly77Arg	Somatic		WXS	SOLID	Phase_I	Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	ENST00000262462.4	37	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878096	0.51801	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.52754	0.65;0.65;0.65	4.18	4.18	0.49190	.	0.051230	0.85682	D	0.000000	T	0.58032	0.2094	M	0.74258	2.255	0.58432	D	0.999997	P	0.41748	0.761	P	0.46320	0.512	T	0.65158	-0.6236	10	0.56958	D	0.05	-3.8213	17.8102	0.88613	0.0:0.0:1.0:0.0	.	77	Q9Y2P4	S27A6_HUMAN	R	77	ENSP00000262462:G77R;ENSP00000378684:G77R;ENSP00000421024:G77R	ENSP00000262462:G77R	G	+	1	0	SLC27A6	128329958	1.000000	0.71417	0.983000	0.44433	0.271000	0.26615	5.926000	0.70070	2.619000	0.88677	0.557000	0.71058	GGA		0.478	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1		NM_014031	
SNRNP27	11017	hgsc.bcm.edu;ucsc.edu	37	2	70124540	70124540	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr2:70124540A>C	ENST00000244227.3	+	4	725	c.300A>C	c.(298-300)gaA>gaC	p.E100D	SNRNP27_ENST00000409116.1_Missense_Mutation_p.E100D|SNRNP27_ENST00000488986.1_3'UTR	NM_006857.2	NP_006848.1	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa (U4/U6.U5)	100					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	11						CAGAGGAAGAAATAGAAATGA	0.328																																																	0													108.0	118.0	115.0					2																	70124540		2203	4300	6503	SO:0001583	missense	11017			X76302	CCDS33219.1	2p14	2011-10-11			ENSG00000124380	ENSG00000124380			30240	protein-coding gene	gene with protein product	"""nucleic acid binding protein RY 1"""					7931148	Standard	NM_006857		Approved	RY1	uc002sfw.3	Q8WVK2	OTTHUMG00000152689	ENST00000244227.3:c.300A>C	2.37:g.70124540A>C	ENSP00000244227:p.Glu100Asp	Somatic		WXS	SOLID	Phase_I	Q15410	Missense_Mutation	SNP	ENST00000244227.3	37	CCDS33219.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.047488	0.75846	.	.	ENSG00000124380	ENST00000244227;ENST00000409116	T;T	0.34072	1.38;1.38	5.4	4.25	0.50352	Domain of unknown function DUF1777 (1);	0.000000	0.85682	D	0.000000	T	0.51941	0.1704	L	0.60845	1.875	0.80722	D	1	D;P	0.63046	0.992;0.941	D;D	0.77004	0.989;0.973	T	0.49000	-0.8984	10	0.46703	T	0.11	.	9.3024	0.37853	0.9158:0.0:0.0842:0.0	.	100;100	B8ZZ98;Q8WVK2	.;SNR27_HUMAN	D	100	ENSP00000244227:E100D;ENSP00000386608:E100D	ENSP00000244227:E100D	E	+	3	2	SNRNP27	69978044	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.466000	0.45084	1.072000	0.40860	0.477000	0.44152	GAA		0.328	SNRNP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327369.1		NM_006857	
SNX16	64089	hgsc.bcm.edu;ucsc.edu	37	8	82751992	82751992	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr8:82751992A>T	ENST00000345957.4	-	2	508	c.230T>A	c.(229-231)tTt>tAt	p.F77Y	SNX16_ENST00000396330.2_Missense_Mutation_p.F77Y|SNX16_ENST00000353788.4_Missense_Mutation_p.F77Y	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16	77					early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						TGTACCTGTAAATTTAGTCCT	0.378																																																	0													124.0	120.0	121.0					8																	82751992		2203	4300	6503	SO:0001583	missense	64089			AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.230T>A	8.37:g.82751992A>T	ENSP00000322652:p.Phe77Tyr	Somatic		WXS	SOLID	Phase_I	A8K4D8|Q658L0|Q8N4U3	Missense_Mutation	SNP	ENST00000345957.4	37	CCDS6234.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.546968	0.86022	.	.	ENSG00000104497	ENST00000353788;ENST00000396330;ENST00000345957;ENST00000520618;ENST00000521810;ENST00000519817;ENST00000518183	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.88	5.88	0.94601	.	0.207652	0.51477	D	0.000082	T	0.52693	0.1750	M	0.70595	2.14	0.39227	D	0.963612	D;D	0.62365	0.99;0.991	P;P	0.61003	0.882;0.834	T	0.52668	-0.8545	10	0.10111	T	0.7	-26.2165	15.4799	0.75517	1.0:0.0:0.0:0.0	.	77;77	Q658L0;P57768	.;SNX16_HUMAN	Y	77	ENSP00000322631:F77Y;ENSP00000379621:F77Y;ENSP00000322652:F77Y;ENSP00000428699:F77Y;ENSP00000428734:F77Y	ENSP00000322652:F77Y	F	-	2	0	SNX16	82914547	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	7.474000	0.81024	2.257000	0.74773	0.459000	0.35465	TTT		0.378	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379929.1		NM_022133	
TET2	54790	hgsc.bcm.edu;ucsc.edu	37	4	106156075	106156075	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr4:106156075A>T	ENST00000540549.1	+	3	1836	c.976A>T	c.(976-978)Aaa>Taa	p.K326*	TET2_ENST00000413648.2_Nonsense_Mutation_p.K326*|TET2_ENST00000305737.2_Nonsense_Mutation_p.K326*|TET2_ENST00000394764.1_Nonsense_Mutation_p.K326*|TET2_ENST00000380013.4_Nonsense_Mutation_p.K326*|TET2_ENST00000513237.1_Nonsense_Mutation_p.K347*|TET2_ENST00000545826.1_Nonsense_Mutation_p.K326*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	326					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		ACAACAACAAAAATCAGTTTT	0.428			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													84.0	79.0	81.0					4																	106156075		2203	4300	6503	SO:0001587	stop_gained	54790			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.976A>T	4.37:g.106156075A>T	ENSP00000442788:p.Lys326*	Somatic		WXS	SOLID	Phase_I	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	ENST00000540549.1	37	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.200031	0.79015	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	.	.	.	4.98	-0.502	0.12004	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6733	0.12699	0.5169:0.314:0.169:0.0	.	.	.	.	X	326;326;326;347;326;326;326;326	.	ENSP00000265149:K326X	K	+	1	0	TET2	106375524	0.005000	0.15991	0.002000	0.10522	0.377000	0.30045	0.591000	0.23969	0.252000	0.21531	0.533000	0.62120	AAA		0.428	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2		NM_017628	
VHL	7428	hgsc.bcm.edu;ucsc.edu	37	3	10191572	10191572	+	Nonsense_Mutation	SNP	G	G	T	rs121913345		TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr3:10191572G>T	ENST00000256474.2	+	3	1405	c.565G>T	c.(565-567)Gaa>Taa	p.E189*	VHL_ENST00000345392.2_Nonsense_Mutation_p.E148*|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	189					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.E189K(3)|p.E189*(2)|p.E189fs*12(1)|p.E189fs*13(1)|p.E189fs*25(1)|p.Y185fs*11(1)|p.L188>?(1)|p.D187_N193del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGAAGATCTGGAAGACCACCC	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	11	Deletion - Frameshift(4)|Substitution - Missense(3)|Substitution - Nonsense(2)|Complex(1)|Deletion - In frame(1)	kidney(11)	GRCh37	CD983007	VHL	D							77.0	70.0	72.0					3																	10191572		2203	4300	6503	SO:0001587	stop_gained	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.565G>T	3.37:g.10191572G>T	ENSP00000256474:p.Glu189*	Somatic		WXS	SOLID	Phase_I	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.850148	0.91277	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.97	4.97	0.65823	.	0.057481	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-3.955	16.1249	0.81386	0.0:0.0:1.0:0.0	.	.	.	.	X	189;148;107	.	ENSP00000256474:E189X	E	+	1	0	VHL	10166572	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.062000	0.76706	2.735000	0.93741	0.655000	0.94253	GAA		0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR35	57539	hgsc.bcm.edu	37	2	20133224	20133224	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4847-01A-01D-1361-10	TCGA-B0-4847-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfeaf113-e264-4df2-8e4f-cde34b625cad	a43f6665-39f0-460f-8b5d-2672f6adc253	g.chr2:20133224T>A	ENST00000345530.3	-	23	2744	c.2629A>T	c.(2629-2631)Act>Tct	p.T877S	WDR35_ENST00000281405.4_Missense_Mutation_p.T866S|WDR35_ENST00000416055.2_Intron	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	877					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAAATGCAGTCACTGCTTGT	0.383																																																	0													160.0	136.0	144.0					2																	20133224		2203	4300	6503	SO:0001583	missense	57539			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.2629A>T	2.37:g.20133224T>A	ENSP00000314444:p.Thr877Ser	Somatic		WXS	SOLID	Phase_I	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	37	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	T	4.940	0.174653	0.09391	.	.	ENSG00000118965	ENST00000345530;ENST00000281405	T;T	0.22134	1.97;1.97	5.29	0.152	0.14893	.	0.887914	0.10097	N	0.716483	T	0.07593	0.0191	N	0.02802	-0.49	0.09310	N	0.999994	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31888	-0.9927	10	0.40728	T	0.16	-1.0E-4	3.8587	0.08986	0.2447:0.3611:0.0:0.3942	.	866;877	Q9P2L0-2;Q9P2L0	.;WDR35_HUMAN	S	877;866	ENSP00000314444:T877S;ENSP00000281405:T866S	ENSP00000281405:T866S	T	-	1	0	WDR35	19996705	0.000000	0.05858	0.158000	0.22627	0.976000	0.68499	0.101000	0.15251	0.429000	0.26202	0.460000	0.39030	ACT		0.383	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2		NM_020779	
