#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC9	10060	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	22068794	22068794	+	Silent	SNP	G	G	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr12:22068794G>T	ENST00000261201.4	-	5	623	c.624C>A	c.(622-624)ctC>ctA	p.L208L	ABCC9_ENST00000261200.4_Silent_p.L208L|ABCC9_ENST00000345162.2_Silent_p.L208L	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	208					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.L208L(2)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CCAGATCCTGGAGGTCTTCAG	0.368																																																	2	Substitution - coding silent(2)	kidney(2)											61.0	59.0	60.0					12																	22068794		2203	4300	6503	SO:0001819	synonymous_variant	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.624C>A	12.37:g.22068794G>T		Somatic		WXS	Illumina HiSeq	Phase_I	O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																				0.368	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1		NM_005691	
ACTL8	81569	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	18149661	18149661	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr1:18149661T>C	ENST00000375406.1	+	2	374	c.158T>C	c.(157-159)cTg>cCg	p.L53P		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	53					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.L53P(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CGTGTGAGCCTGGGCATCGAC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											130.0	115.0	120.0					1																	18149661		2203	4300	6503	SO:0001583	missense	81569			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.158T>C	1.37:g.18149661T>C	ENSP00000364555:p.Leu53Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q13104|Q96M75	Missense_Mutation	SNP	ENST00000375406.1	37	CCDS183.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572386	0.86542	.	.	ENSG00000117148	ENST00000375406	D	0.94828	-3.53	5.51	3.08	0.35506	.	0.265787	0.19679	N	0.108548	D	0.90648	0.7067	L	0.54323	1.7	0.22562	N	0.998982	B	0.32543	0.375	B	0.34301	0.179	D	0.84847	0.0811	10	0.87932	D	0	-31.2905	4.3504	0.11153	0.175:0.0936:0.0:0.7314	.	53	Q9H568	ACTL8_HUMAN	P	53	ENSP00000364555:L53P	ENSP00000364555:L53P	L	+	2	0	ACTL8	18022248	0.506000	0.26139	0.171000	0.22900	0.987000	0.75469	2.340000	0.43974	2.089000	0.63090	0.533000	0.62120	CTG		0.587	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007143.1		NM_030812	
ADAM33	80332	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	3655259	3655259	+	Silent	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr20:3655259G>A	ENST00000356518.2	-	6	733	c.492C>T	c.(490-492)caC>caT	p.H164H	ADAM33_ENST00000379861.4_Silent_p.H164H|ADAM33_ENST00000466620.1_5'Flank|ADAM33_ENST00000350009.2_Silent_p.H164H	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	164					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H164H(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GAAAGATCTCGTGGGTTGAGA	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											85.0	96.0	93.0					20																	3655259		2203	4300	6503	SO:0001819	synonymous_variant	80332			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.492C>T	20.37:g.3655259G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	37	CCDS13058.1																																																																																				0.607	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2		NM_025220	
ALDH2	217	broad.mit.edu;hgsc.bcm.edu	37	12	112221085	112221085	+	Missense_Mutation	SNP	G	G	A	rs376099569		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr12:112221085G>A	ENST00000261733.2	+	3	404	c.343G>A	c.(343-345)Gac>Aac	p.D115N	RP11-162P23.2_ENST00000546840.2_Silent_p.G111G|ALDH2_ENST00000416293.3_Intron	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	115					alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)	p.D115N(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	GATCGAGCGGGACCGGACCTA	0.662			T	HMGA2	leiomyoma								g|||	1	0.000199681	0.0	0.0	5008	,	,		16748	0.0		0.001	False		,,,				2504	0.0							Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	2	Substitution - Missense(2)	kidney(2)							ASN/ASP,	1,4405	2.1+/-5.4	0,1,2202	42.0	47.0	45.0		343,	5.6	1.0	12		45	0,8600		0,0,4300	no	missense,intron	ALDH2	NM_000690.3,NM_001204889.1	23,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,	115/518,	112221085	1,13005	2203	4300	6503	SO:0001583	missense	217			M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.343G>A	12.37:g.112221085G>A	ENSP00000261733:p.Asp115Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Missense_Mutation	SNP	ENST00000261733.2	37	CCDS9155.1	.	.	.	.	.	.	.	.	.	.	g	33	5.283351	0.95489	2.27E-4	0.0	ENSG00000257767;ENSG00000111275;ENSG00000111275	ENST00000546840;ENST00000261733;ENST00000553044	T	0.75260	-0.92	5.64	5.64	0.86602	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.58004	0.2092	N	0.03154	-0.405	0.80722	D	1	B;B	0.32507	0.373;0.131	B;B	0.34931	0.192;0.069	T	0.60198	-0.7310	10	0.36615	T	0.2	.	19.7095	0.96089	0.0:0.0:1.0:0.0	.	115;115	F8VXI5;P05091	.;ALDH2_HUMAN	N	96;115;115	ENSP00000261733:D115N	ENSP00000261733:D115N	D	+	1	0	ALDH2;RP11-162P23.2	110705468	1.000000	0.71417	0.998000	0.56505	0.917000	0.54804	7.498000	0.81546	2.655000	0.90218	0.651000	0.88453	GAC		0.662	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1		NM_000690	
ARSI	340075	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	149677720	149677720	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr5:149677720delC	ENST00000328668.7	-	2	1346	c.767delG	c.(766-768)ggcfs	p.G256fs		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	256					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCACATTGCCCATGGTGCG	0.612																																																	0													51.0	47.0	49.0					5																	149677720		2203	4300	6503	SO:0001589	frameshift_variant	340075			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.767delG	5.37:g.149677720delC	ENSP00000333395:p.Gly256fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3B0|B3KV22|B7XD03	Frame_Shift_Del	DEL	ENST00000328668.7	37	CCDS34275.1																																																																																				0.612	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1		NM_001012301	
ASNSD1	54529	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	190532647	190532647	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr2:190532647T>A	ENST00000260952.4	+	5	2035	c.1622T>A	c.(1621-1623)aTt>aAt	p.I541N	ASNSD1_ENST00000607062.1_Missense_Mutation_p.I60N	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	541	Asparagine synthetase.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)	p.I541N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			GACAGAGTTATTGGTGATCAT	0.373																																																	1	Substitution - Missense(1)	kidney(1)											123.0	128.0	126.0					2																	190532647		2203	4300	6503	SO:0001583	missense	54529			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.1622T>A	2.37:g.190532647T>A	ENSP00000260952:p.Ile541Asn	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	ENST00000260952.4	37	CCDS2300.1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.526133	0.64860	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.52295	0.67;0.67	5.67	4.5	0.54988	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.047928	0.85682	D	0.000000	T	0.71533	0.3351	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76321	-0.3002	10	0.87932	D	0	-16.8553	12.9487	0.58388	0.0:0.0:0.1355:0.8645	.	541	Q9NWL6	ASND1_HUMAN	N	541	ENSP00000260952:I541N;ENSP00000406790:I541N	ENSP00000260952:I541N	I	+	2	0	ASNSD1	190240892	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.698000	0.84413	0.958000	0.37956	0.533000	0.62120	ATT		0.373	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255919.3		NM_019048	
ATP13A5	344905	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	193052840	193052840	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr3:193052840G>C	ENST00000342358.4	-	10	1109	c.992C>G	c.(991-993)aCt>aGt	p.T331S		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	331						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.T331S(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CCAAGGCATAGTGTTCTCCAT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											195.0	182.0	186.0					3																	193052840		2203	4300	6503	SO:0001583	missense	344905			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.992C>G	3.37:g.193052840G>C	ENSP00000341942:p.Thr331Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.825186	0.00589	.	.	ENSG00000187527	ENST00000342358	D	0.84516	-1.86	6.11	3.28	0.37604	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.335977	0.29459	N	0.012093	T	0.73489	0.3593	N	0.12569	0.235	0.09310	N	1	B	0.25105	0.118	B	0.32393	0.145	T	0.53215	-0.8470	10	0.08381	T	0.77	-18.0096	16.8057	0.85626	0.0:0.3602:0.6398:0.0	.	331	Q4VNC0	AT135_HUMAN	S	331	ENSP00000341942:T331S	ENSP00000341942:T331S	T	-	2	0	ATP13A5	194535534	0.001000	0.12720	0.167000	0.22817	0.042000	0.13812	0.722000	0.25925	0.915000	0.36847	-0.127000	0.14921	ACT		0.443	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1		NM_198505	
B4GALNT3	283358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	657232	657232	+	Silent	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr12:657232G>A	ENST00000266383.5	+	8	763	c.750G>A	c.(748-750)aaG>aaA	p.K250K	B4GALNT3_ENST00000544638.1_3'UTR	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	250					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.K250K(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TGCTGCACAAGCAGAATGAGG	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											66.0	60.0	63.0					12																	657232		2203	4300	6503	SO:0001819	synonymous_variant	283358			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.750G>A	12.37:g.657232G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZNC1|Q8N7T6	Silent	SNP	ENST00000266383.5	37	CCDS8504.1																																																																																				0.632	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2		NM_173593	
BCAM	4059	broad.mit.edu;hgsc.bcm.edu	37	19	45324077	45324077	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr19:45324077G>A	ENST00000270233.6	+	14	1901	c.1879G>A	c.(1879-1881)Gag>Aag	p.E627K		NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	627					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)	p.E627K(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CTTCGGAGACGAGGTGGGTGA	0.706																																																	1	Substitution - Missense(1)	kidney(1)											24.0	23.0	23.0					19																	45324077		2171	4246	6417	SO:0001583	missense	4059			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1879G>A	19.37:g.45324077G>A	ENSP00000270233:p.Glu627Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	20.1	3.932927	0.73442	.	.	ENSG00000187244	ENST00000270233	T	0.60672	0.17	4.39	3.26	0.37387	.	.	.	.	.	T	0.39358	0.1075	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	P	0.52159	0.691	T	0.20840	-1.0263	9	0.07030	T	0.85	-21.2733	9.1054	0.36694	0.0:0.0:0.7819:0.2181	.	627	P50895	BCAM_HUMAN	K	627	ENSP00000270233:E627K	ENSP00000270233:E627K	E	+	1	0	BCAM	50015917	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	2.800000	0.47900	2.171000	0.68590	0.549000	0.68633	GAG		0.706	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1		NM_005581	
BCLAF1	9774	hgsc.bcm.edu	37	6	136599885	136599885	+	Missense_Mutation	SNP	C	C	A	rs150873394	byFrequency	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr6:136599885C>A	ENST00000531224.1	-	4	386	c.134G>T	c.(133-135)aGg>aTg	p.R45M	BCLAF1_ENST00000527536.1_Missense_Mutation_p.R45M|BCLAF1_ENST00000530767.1_Missense_Mutation_p.R45M|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R43M|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R43M|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R43M	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	45					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACTACGAGACCTTGAATATGT	0.363																																					Colon(142;1534 1789 5427 7063 28491)												0													47.0	47.0	47.0					6																	136599885		2203	4299	6502	SO:0001583	missense	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.134G>T	6.37:g.136599885C>A	ENSP00000435210:p.Arg45Met	Somatic		WXS	Illumina HiSeq	Phase_I	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	56	0.02564102564102564	2	0.0040650406504065045	5	0.013812154696132596	0	0.0	49	0.06464379947229551	C	16.46	3.130493	0.56828	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.18016	2.64;2.53;2.63;2.24;2.55;2.53;2.44	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000004	T	0.29524	0.0736	L	0.42245	1.32	0.80722	D	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	D;D;D;D	0.74348	0.983;0.983;0.983;0.983	T	0.01587	-1.1318	10	0.87932	D	0	-9.7833	20.1392	0.98050	0.0:1.0:0.0:0.0	.	43;43;45;45	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	M	45;43;45;45;43;43;45	ENSP00000435210:R45M;ENSP00000229446:R43M;ENSP00000435441:R45M;ENSP00000436501:R45M;ENSP00000434826:R43M;ENSP00000376159:R43M;ENSP00000431734:R45M	ENSP00000229446:R43M	R	-	2	0	BCLAF1	136641578	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.677000	0.68142	2.765000	0.95021	0.557000	0.71058	AGG		0.363	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2		NM_014739	
TRAPPC13	80006	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	64960063	64960063	+	Splice_Site	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr5:64960063G>A	ENST00000399438.3	+	12	1343		c.e12-1		TRAPPC13_ENST00000438419.2_Missense_Mutation_p.S334N|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.S328N|TRAPPC13_ENST00000231526.4_Splice_Site|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.S335N	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13									p.?(2)									TCCTCCAGCAGTGAAAGGACT	0.393																																																	2	Unknown(2)	kidney(2)											152.0	148.0	150.0					5																	64960063		1857	4098	5955	SO:0001630	splice_region_variant	80006				CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.999-1G>A	5.37:g.64960063G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	ENST00000399438.3	37	CCDS47222.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.228204|4.228204	0.79576|0.79576	.|.	.|.	ENSG00000113597|ENSG00000113597	ENST00000399438;ENST00000231526|ENST00000438419;ENST00000505553;ENST00000545191	.|.	.|.	.|.	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73791	.|0.3632	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.998;0.998	.|D;D	.|0.76575	.|0.98;0.988	.|T	.|0.69698	.|-0.5075	.|8	.|0.37606	.|T	.|0.19	.|-23.27	20.3368|20.3368	0.98748|0.98748	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|328;334	.|A5PLN9-4;A5PLN9-5	.|.;.	.|N	-1|334;328;335	.|.	.|ENSP00000409231:S334N	.|S	+|+	.|2	.|0	C5orf44|C5orf44	64995819|64995819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.407000|9.407000	0.97325|0.97325	2.805000|2.805000	0.96524|0.96524	0.655000|0.655000	0.94253|0.94253	.|AGT		0.393	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370113.1		NM_024941	Intron
TRAPPC13	80006	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	64960070	64960070	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr5:64960070G>T	ENST00000399438.3	+	12	1350	c.1005G>T	c.(1003-1005)agG>agT	p.R335S	TRAPPC13_ENST00000438419.2_Missense_Mutation_p.R336S|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.R330S|TRAPPC13_ENST00000231526.4_Missense_Mutation_p.R329S|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.R337S	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	335								p.R335S(2)									GCAGTGAAAGGACTATGGATC	0.398																																																	2	Substitution - Missense(2)	kidney(2)											157.0	153.0	154.0					5																	64960070		1862	4104	5966	SO:0001583	missense	80006				CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.1005G>T	5.37:g.64960070G>T	ENSP00000382367:p.Arg335Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	ENST00000399438.3	37	CCDS47222.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950102	0.73787	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.93	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.76835	0.4043	M	0.77313	2.365	0.80722	D	1	D;D;D;D	0.65815	0.995;0.995;0.995;0.992	D;D;D;P	0.66847	0.947;0.947;0.947;0.885	T	0.79478	-0.1787	9	0.72032	D	0.01	-29.7394	11.2085	0.48784	0.1395:0.0:0.8605:0.0	.	330;329;336;335	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	S	335;336;329;330;337	.	ENSP00000231526:R329S	R	+	3	2	C5orf44	64995826	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.735000	0.47377	1.517000	0.48917	0.655000	0.94253	AGG		0.398	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370113.1		NM_024941	
CABIN1	23523	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	24563174	24563174	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr22:24563174C>A	ENST00000398319.2	+	32	5960	c.5575C>A	c.(5575-5577)Ctt>Att	p.L1859I	CABIN1_ENST00000263119.5_Missense_Mutation_p.L1859I|CABIN1_ENST00000337989.7_Missense_Mutation_p.L284I|CABIN1_ENST00000405822.2_Missense_Mutation_p.L1780I	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1859					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.L1859I(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AGGCAAGACACTTCTGTTGGA	0.632																																																	1	Substitution - Missense(1)	kidney(1)											44.0	43.0	44.0					22																	24563174		2202	4300	6502	SO:0001583	missense	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.5575C>A	22.37:g.24563174C>A	ENSP00000381364:p.Leu1859Ile	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.350941	0.61183	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000003	D	0.90017	0.6883	L	0.34521	1.04	0.54753	D	0.999984	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.77557	0.978;0.99;0.978	D	0.90345	0.4362	10	0.49607	T	0.09	.	17.7539	0.88444	0.0:1.0:0.0:0.0	.	284;1780;1859	B5MEB3;G5E9F3;Q9Y6J0	.;.;CABIN_HUMAN	I	1859;1780;1859;284;284	ENSP00000263119:L1859I;ENSP00000384694:L1780I;ENSP00000381364:L1859I;ENSP00000336991:L284I	ENSP00000263119:L1859I	L	+	1	0	CABIN1	22893174	1.000000	0.71417	0.856000	0.33681	0.527000	0.34593	4.513000	0.60476	2.503000	0.84419	0.558000	0.71614	CTT		0.632	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2		NM_012295	
CD207	50489	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	71060814	71060814	+	Silent	SNP	G	G	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr2:71060814G>C	ENST00000410009.3	-	3	573	c.528C>G	c.(526-528)ggC>ggG	p.G176G		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	176					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)	p.G176G(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						TCTCCAAGCTGCCCTGGAGTG	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											79.0	70.0	73.0					2																	71060814		1868	4105	5973	SO:0001819	synonymous_variant	50489			AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.528C>G	2.37:g.71060814G>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000410009.3	37																																																																																					0.448	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000329959.4		NM_015717	
CLEC4C	170482	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7890118	7890118	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr12:7890118A>T	ENST00000542353.1	-	5	778	c.288T>A	c.(286-288)ttT>ttA	p.F96L	CLEC4C_ENST00000540085.1_Missense_Mutation_p.F65L|CLEC4C_ENST00000360345.3_Missense_Mutation_p.F96L|CLEC4C_ENST00000354629.5_Missense_Mutation_p.F65L	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	96	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.F96L(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		CAGTAGAAATAAAGTAGCAAC	0.418																																																	1	Substitution - Missense(1)	kidney(1)											92.0	92.0	92.0					12																	7890118		2203	4300	6503	SO:0001583	missense	170482			AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.288T>A	12.37:g.7890118A>T	ENSP00000440428:p.Phe96Leu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Missense_Mutation	SNP	ENST00000542353.1	37	CCDS8583.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382390	0.24944	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345;ENST00000537530;ENST00000543765	T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37	2.62	1.44	0.22558	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	.	.	.	.	T	0.12178	0.0296	L	0.43598	1.365	0.24118	N	0.995814	B;P	0.43519	0.193;0.809	B;B	0.37943	0.089;0.261	T	0.17198	-1.0377	9	0.38643	T	0.18	.	4.7469	0.13042	0.8442:0.0:0.1558:0.0	.	65;96	Q8WTT0-2;Q8WTT0	.;CLC4C_HUMAN	L	96;65;65;96;18;56	ENSP00000440428:F96L;ENSP00000346648:F65L;ENSP00000445338:F65L;ENSP00000353500:F96L;ENSP00000438649:F18L;ENSP00000442457:F56L	ENSP00000346648:F65L	F	-	3	2	CLEC4C	7781385	0.018000	0.18449	0.666000	0.29783	0.136000	0.21042	-0.221000	0.09202	0.410000	0.25675	0.491000	0.48974	TTT		0.418	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1		NM_203503	
COL11A1	1301	broad.mit.edu;ucsc.edu	37	1	103404625	103404625	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr1:103404625C>T	ENST00000370096.3	-	44	3716	c.3404G>A	c.(3403-3405)gGa>gAa	p.G1135E	COL11A1_ENST00000512756.1_Missense_Mutation_p.G1019E|COL11A1_ENST00000358392.2_Missense_Mutation_p.G1147E|COL11A1_ENST00000353414.4_Missense_Mutation_p.G1096E	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1135	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.G1135E(1)|p.G1147E(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCCTTTTTGTCCCGGCTCACC	0.333																																																	2	Substitution - Missense(2)	kidney(2)											146.0	147.0	147.0					1																	103404625		2203	4300	6503	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3404G>A	1.37:g.103404625C>T	ENSP00000359114:p.Gly1135Glu	Somatic		WXS	Illumina GAIIx	Phase_I	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380383	0.61845	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99619	-6.28;-6.28;-6.28;-6.28	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	H	0.96142	3.775	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.999;1.0	D	0.97022	0.9744	10	0.87932	D	0	.	19.2688	0.94000	0.0:1.0:0.0:0.0	.	1019;1096;1147;1135;355	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	E	1135;1147;1096;355;1019	ENSP00000359114:G1135E;ENSP00000351163:G1147E;ENSP00000302551:G1096E;ENSP00000426533:G1019E	ENSP00000302551:G1096E	G	-	2	0	COL11A1	103177213	1.000000	0.71417	0.987000	0.45799	0.602000	0.36980	7.750000	0.85110	2.639000	0.89480	0.591000	0.81541	GGA		0.333	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1		NM_080630	
DIP2C	22982	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	375379	375379	+	Silent	SNP	G	G	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr10:375379G>T	ENST00000280886.6	-	30	3834	c.3747C>A	c.(3745-3747)tcC>tcA	p.S1249S		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1249						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S1249S(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTACCTTGAGGGACTCTGTTT	0.547																																																	1	Substitution - coding silent(1)	kidney(1)											41.0	37.0	38.0					10																	375379		2203	4300	6503	SO:0001819	synonymous_variant	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3747C>A	10.37:g.375379G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DPI5|Q5SS78	Silent	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	7.123	0.578341	0.13686	.	.	ENSG00000151240	ENST00000434695	.	.	.	5.85	0.321	0.15883	.	.	.	.	.	T	0.41834	0.1176	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21930	-1.0231	4	.	.	.	-29.0172	1.421	0.02312	0.1591:0.2128:0.3392:0.2889	.	.	.	.	T	55	.	.	P	-	1	0	DIP2C	365379	0.023000	0.18921	0.994000	0.49952	0.573000	0.36030	-0.959000	0.03853	-0.135000	0.11495	-0.165000	0.13383	CCT		0.547	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1		NM_014974	
FAM111B	374393	hgsc.bcm.edu	37	11	58892377	58892377	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr11:58892377delA	ENST00000343597.3	+	4	998	c.807delA	c.(805-807)tcafs	p.S269fs	FAM111B_ENST00000529618.1_Frame_Shift_Del_p.S239fs|FAM111B_ENST00000411426.1_Frame_Shift_Del_p.S239fs	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	269							catalytic activity (GO:0003824)	p.A273fs*9(1)|p.K272delK(1)|p.A273fs*26(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TGGACATTTCAAAAAAAAAAG	0.313																																																	3	Deletion - Frameshift(1)|Deletion - In frame(1)|Insertion - Frameshift(1)	kidney(2)|ovary(1)																																								SO:0001589	frameshift_variant	374393			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.807delA	11.37:g.58892377delA	ENSP00000341565:p.Ser269fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4E2G2|Q6P661	Frame_Shift_Del	DEL	ENST00000343597.3	37	CCDS7972.1																																																																																				0.313	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1		NM_198947	
BRINP3	339479	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	190067353	190067353	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr1:190067353G>T	ENST00000367462.3	-	8	2327	c.2096C>A	c.(2095-2097)gCa>gAa	p.A699E	BRINP3_ENST00000534846.1_Missense_Mutation_p.A597E	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	699					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.A699E(1)									TTGCAAAAGTGCTGAATCCTG	0.473																																																	1	Substitution - Missense(1)	kidney(1)											103.0	102.0	102.0					1																	190067353		2203	4300	6503	SO:0001583	missense	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2096C>A	1.37:g.190067353G>T	ENSP00000356432:p.Ala699Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.332927	0.60853	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.21031	2.28;2.03	5.72	5.72	0.89469	.	0.111293	0.64402	D	0.000011	T	0.47691	0.1459	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.42396	-0.9454	10	0.72032	D	0.01	-30.537	17.3704	0.87376	0.0:0.0:1.0:0.0	.	597;699	B7Z260;Q76B58	.;FAM5C_HUMAN	E	699;597	ENSP00000356432:A699E;ENSP00000438022:A597E	ENSP00000356432:A699E	A	-	2	0	FAM5C	188333976	1.000000	0.71417	0.973000	0.42090	0.901000	0.52897	7.958000	0.87877	2.695000	0.91970	0.650000	0.86243	GCA		0.473	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1		NM_199051	
FBN3	84467	hgsc.bcm.edu;ucsc.edu	37	19	8148162	8148162	+	Silent	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr19:8148162G>A	ENST00000600128.1	-	57	7596	c.7182C>T	c.(7180-7182)taC>taT	p.Y2394Y	FBN3_ENST00000270509.2_Silent_p.Y2394Y|FBN3_ENST00000601739.1_Silent_p.Y2394Y			Q75N90	FBN3_HUMAN	fibrillin 3	2394	EGF-like 38; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CATCCGGTGTGTACCCGGCCT	0.607																																																	0													164.0	121.0	135.0					19																	8148162		2203	4300	6503	SO:0001819	synonymous_variant	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7182C>T	19.37:g.8148162G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	CCDS12196.1																																																																																				0.607	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2		NM_032447	
FGFR4	2264	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	176520705	176520705	+	Missense_Mutation	SNP	G	G	T	rs141384037		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr5:176520705G>T	ENST00000292408.4	+	11	1693	c.1448G>T	c.(1447-1449)cGt>cTt	p.R483L	FGFR4_ENST00000393637.1_Missense_Mutation_p.R443L|FGFR4_ENST00000502906.1_Missense_Mutation_p.R483L|FGFR4_ENST00000393648.2_Missense_Mutation_p.R415L|FGFR4_ENST00000292410.3_Missense_Mutation_p.R443L	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	483	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)	p.R443L(1)|p.R483L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CAGGTAGTACGTGCAGAGGCC	0.627										TSP Lung(9;0.080)																																							2	Substitution - Missense(2)	kidney(2)											60.0	50.0	53.0					5																	176520705		2203	4300	6503	SO:0001583	missense	2264			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1448G>T	5.37:g.176520705G>T	ENSP00000292408:p.Arg483Leu	Somatic		WXS	Illumina HiSeq	Phase_I	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	37	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	G	8.419	0.845927	0.16963	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69	4.48	4.48	0.54585	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.218876	0.44483	D	0.000456	T	0.80358	0.4608	N	0.03324	-0.35	0.20196	N	0.999923	B;B;P	0.49862	0.1;0.082;0.929	B;B;B	0.42214	0.041;0.024;0.38	T	0.74321	-0.3703	10	0.33940	T	0.23	.	16.9773	0.86316	0.0:0.0:1.0:0.0	.	415;443;483	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	L	483;415;483;443;443;711	ENSP00000292408:R483L;ENSP00000377259:R415L;ENSP00000424960:R483L;ENSP00000292410:R443L;ENSP00000377254:R443L	ENSP00000292408:R483L	R	+	2	0	FGFR4	176453311	0.862000	0.29867	0.192000	0.23308	0.127000	0.20565	4.447000	0.60020	2.332000	0.79248	0.462000	0.41574	CGT		0.627	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1			
FZD4	8322	hgsc.bcm.edu;ucsc.edu	37	11	86663464	86663464	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr11:86663464T>C	ENST00000531380.1	-	2	639	c.334A>G	c.(334-336)Atc>Gtc	p.I112V	PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	112	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCAATGGGGATGTTGATCTTC	0.448																																																	0													115.0	124.0	121.0					11																	86663464		2201	4299	6500	SO:0001583	missense	8322			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.334A>G	11.37:g.86663464T>C	ENSP00000434034:p.Ile112Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	ENST00000531380.1	37	CCDS8279.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.264958	0.40095	.	.	ENSG00000174804	ENST00000531380	T	0.74947	-0.89	5.82	4.69	0.59074	Frizzled domain (5);	0.000000	0.85682	D	0.000000	T	0.53981	0.1830	N	0.08118	0	0.53688	D	0.999975	B	0.13594	0.008	B	0.23716	0.048	T	0.44097	-0.9350	9	.	.	.	.	11.8577	0.52449	0.0:0.0682:0.0:0.9317	.	112	Q9ULV1	FZD4_HUMAN	V	112	ENSP00000434034:I112V	.	I	-	1	0	FZD4	86341112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.139000	0.58024	1.033000	0.39918	0.533000	0.62120	ATC		0.448	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2		NM_012193	
GCN1L1	10985	broad.mit.edu;ucsc.edu	37	12	120574466	120574466	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr12:120574466G>A	ENST00000300648.6	-	51	6860	c.6848C>T	c.(6847-6849)gCa>gTa	p.A2283V		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2283					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.A2283V(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCTTTGGCTGCCTCCTCCTT	0.602																																																	1	Substitution - Missense(1)	kidney(1)											55.0	60.0	58.0					12																	120574466		2055	4188	6243	SO:0001583	missense	10985			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.6848C>T	12.37:g.120574466G>A	ENSP00000300648:p.Ala2283Val	Somatic		WXS	Illumina GAIIx	Phase_I	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	35	5.485811	0.96323	.	.	ENSG00000089154	ENST00000300648	T	0.65364	-0.15	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82462	0.5042	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.84520	0.0627	10	0.87932	D	0	.	19.8555	0.96756	0.0:0.0:1.0:0.0	.	2283	Q92616	GCN1L_HUMAN	V	2283	ENSP00000300648:A2283V	ENSP00000300648:A2283V	A	-	2	0	GCN1L1	119058849	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	9.229000	0.95273	2.697000	0.92050	0.591000	0.81541	GCA		0.602	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			
IFI27L2	83982	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	94594972	94594972	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr14:94594972C>A	ENST00000238609.3	-	3	177	c.78G>T	c.(76-78)atG>atT	p.M26I	IFI27L2_ENST00000556727.1_Start_Codon_SNP_p.M1I	NM_032036.2	NP_114425.1	Q9H2X8	I27L2_HUMAN	interferon, alpha-inducible protein 27-like 2	26						integral component of membrane (GO:0016021)		p.M26I(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	8						CAGTGAAGCCCATGGCACTGA	0.657																																																	1	Substitution - Missense(1)	kidney(1)											50.0	39.0	42.0					14																	94594972		2203	4300	6503	SO:0001583	missense	83982			AF208232	CCDS9920.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000119632			19753	protein-coding gene	gene with protein product		611319	"""family with sequence similarity 14, member A"""	FAM14A			Standard	NM_032036		Approved	TLH29	uc001ycq.3	Q9H2X8		ENST00000238609.3:c.78G>T	14.37:g.94594972C>A	ENSP00000238609:p.Met26Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TBD7|Q9NYL0	Missense_Mutation	SNP	ENST00000238609.3	37	CCDS9920.1	.	.	.	.	.	.	.	.	.	.	C	5.266	0.234591	0.09969	.	.	ENSG00000119632	ENST00000238609;ENST00000556727	T;T	0.27256	1.68;1.68	4.01	2.09	0.27110	.	0.691372	0.13147	U	0.410219	T	0.16727	0.0402	N	0.26042	0.785	0.34878	D	0.744301	B	0.02656	0.0	B	0.04013	0.001	T	0.11251	-1.0595	10	0.44086	T	0.13	.	7.2888	0.26354	0.1928:0.6205:0.1866:0.0	.	26	Q9H2X8	I27L2_HUMAN	I	26;1	ENSP00000238609:M26I;ENSP00000451717:M1I	ENSP00000238609:M26I	M	-	3	0	IFI27L2	93664725	0.000000	0.05858	0.693000	0.30195	0.026000	0.11368	-1.102000	0.03332	0.378000	0.24764	0.655000	0.94253	ATG		0.657	IFI27L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412935.1		NM_032036	
IL1F10	84639	hgsc.bcm.edu	37	2	113832829	113832829	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr2:113832829C>A	ENST00000393197.2	+	4	768	c.347C>A	c.(346-348)gCc>gAc	p.A116D	IL1F10_ENST00000337569.3_Missense_Mutation_p.A116D|IL1F10_ENST00000341010.2_Missense_Mutation_p.A116D	NM_032556.5	NP_115945.4	Q8WWZ1	IL1FA_HUMAN	interleukin 1 family, member 10 (theta)	116						extracellular space (GO:0005615)				endometrium(1)|lung(6)|ovary(1)	8						GAGGCTGCTGCCTGGCCTGGC	0.577																																																	0													70.0	75.0	73.0					2																	113832829		2203	4300	6503	SO:0001583	missense	84639			AY026753	CCDS2112.1	2q13	2011-07-14			ENSG00000136697	ENSG00000136697		"""Interleukins and interleukin receptors"""	15552	protein-coding gene	gene with protein product	"""FIL1- theta"", ""interleukin-1 receptor antagonist FKSG75"""	615296				11747621, 11991723, 11991722	Standard	NM_173161		Approved	FKSG75, IL-1HY2, IL-1F10, IL1-theta, MGC11983, MGC119832, MGC119833	uc002tiu.3	Q8WWZ1	OTTHUMG00000131339	ENST00000393197.2:c.347C>A	2.37:g.113832829C>A	ENSP00000376893:p.Ala116Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q53SR9|Q56AT8|Q7RTZ5|Q969H5|Q9BYX1	Missense_Mutation	SNP	ENST00000393197.2	37	CCDS2112.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174427	0.78452	.	.	ENSG00000136697	ENST00000341010;ENST00000337569;ENST00000393197	T;T;T	0.19806	2.12;2.12;2.12	4.87	4.87	0.63330	.	0.460846	0.25561	N	0.029835	T	0.48447	0.1500	M	0.88979	2.995	0.39967	D	0.974741	D;D	0.64830	0.993;0.994	P;P	0.61132	0.884;0.836	T	0.57980	-0.7717	10	0.52906	T	0.07	-20.9552	13.8703	0.63615	0.0:1.0:0.0:0.0	.	116;116	Q8WWZ1-2;Q8WWZ1	.;IL1FA_HUMAN	D	116	ENSP00000341794:A116D;ENSP00000338418:A116D;ENSP00000376893:A116D	ENSP00000338418:A116D	A	+	2	0	IL1F10	113549300	0.988000	0.35896	0.999000	0.59377	0.852000	0.48524	3.813000	0.55636	2.421000	0.82119	0.655000	0.94253	GCC		0.577	IL1F10-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330725.1		NM_173161	
MEX3C	51320	hgsc.bcm.edu;ucsc.edu	37	18	48703023	48703023	+	5'Flank	DEL	C	C	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr18:48703023delC	ENST00000591040.1	-	0	799							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		TCGCTCCTAACCCTCCGAGCA	0.478																																																	0													80.0	78.0	79.0					18																	48703023		2203	4300	6503	SO:0001631	upstream_gene_variant	51320			BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693		18.37:g.48703023delC	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	A1L022|Q9NZE3	Frame_Shift_Del	DEL	ENST00000591040.1	37																																																																																					0.478	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1		NM_016626	
NOL8	55035	hgsc.bcm.edu;ucsc.edu	37	9	95070141	95070141	+	Intron	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr9:95070141G>A	ENST00000535387.1	-	9	2572				NOL8_ENST00000442668.2_Intron|NOL8_ENST00000358855.4_Intron|NOL8_ENST00000542053.1_Intron|NOL8_ENST00000545558.1_Intron					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						GAGGTGGTAGGAAAGCATGCT	0.328																																																	0													228.0	205.0	212.0					9																	95070141		692	1591	2283	SO:0001627	intron_variant	55035			AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.2573-835C>T	9.37:g.95070141G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000535387.1	37	CCDS47993.1																																																																																				0.328	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2		NM_017948	
OR52J3	119679	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	5068523	5068523	+	Silent	SNP	A	A	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr11:5068523A>T	ENST00000380370.1	+	1	768	c.768A>T	c.(766-768)tcA>tcT	p.S256S		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S256S(1)		NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATATCCCTTCAGTCTTCTCTT	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											278.0	251.0	260.0					11																	5068523		2201	4298	6499	SO:0001819	synonymous_variant	119679			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.768A>T	11.37:g.5068523A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFE4	Silent	SNP	ENST00000380370.1	37	CCDS31370.1																																																																																				0.458	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1		NM_001001916	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52668817	52668817	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr3:52668817C>A	ENST00000296302.7	-	11	1103	c.1102G>T	c.(1102-1104)Gag>Tag	p.E368*	PBRM1_ENST00000356770.4_Nonsense_Mutation_p.E336*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.E368*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.E368*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.E368*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.E368*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.E368*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.E368*			Q86U86	PB1_HUMAN	polybromo 1	368					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E368*(4)|p.E336*(2)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GACTCTCCCTCTTCATAGCGT	0.373			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	6	Substitution - Nonsense(6)	kidney(6)											72.0	70.0	71.0					3																	52668817		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1102G>T	3.37:g.52668817C>A	ENSP00000296302:p.Glu368*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	38	7.060397	0.98036	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-22.6802	20.2566	0.98424	0.0:1.0:0.0:0.0	.	.	.	.	X	336;368;368;368;368;368;368;368;368;312	.	ENSP00000296302:E368X	E	-	1	0	PBRM1	52643857	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.793000	0.96121	0.561000	0.74099	GAG		0.373	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCYOX1L	78991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	148742273	148742273	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr5:148742273G>C	ENST00000274569.4	+	2	224	c.162G>C	c.(160-162)caG>caC	p.Q54H	PCYOX1L_ENST00000514349.1_5'UTR	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	54					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)	p.Q54H(1)		breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGGGTGCAGATCGACGTGT	0.622																																					Ovarian(62;1136 1477 27277 27495)												1	Substitution - Missense(1)	kidney(1)											96.0	95.0	95.0					5																	148742273		2203	4300	6503	SO:0001583	missense	78991				CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.162G>C	5.37:g.148742273G>C	ENSP00000274569:p.Gln54His	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	ENST00000274569.4	37	CCDS4296.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445923	0.25987	.	.	ENSG00000145882	ENST00000274569	T	0.09911	2.93	5.23	4.34	0.51931	.	0.134965	0.52532	D	0.000076	T	0.19248	0.0462	L	0.39692	1.235	0.80722	D	1	D	0.57571	0.98	P	0.57425	0.82	T	0.00722	-1.1594	10	0.49607	T	0.09	-18.5976	13.2269	0.59919	0.0783:0.0:0.9217:0.0	.	54	Q8NBM8	PCYXL_HUMAN	H	54	ENSP00000274569:Q54H	ENSP00000274569:Q54H	Q	+	3	2	PCYOX1L	148722466	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.501000	0.60393	1.304000	0.44892	0.561000	0.74099	CAG		0.622	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252331.2		NM_024028	
PDK3	5165	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	24537120	24537120	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chrX:24537120A>C	ENST00000379162.4	+	6	901	c.666A>C	c.(664-666)gaA>gaC	p.E222D	PDK3_ENST00000441463.2_Missense_Mutation_p.E222D|AC004656.1_ENST00000580722.1_RNA	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	222	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.E222D(2)		NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AAGTTGAAGAATTCAATGGTA	0.358																																																	2	Substitution - Missense(2)	kidney(2)											73.0	65.0	68.0					X																	24537120		2203	4300	6503	SO:0001583	missense	5165			L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.666A>C	X.37:g.24537120A>C	ENSP00000368460:p.Glu222Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DXG6	Missense_Mutation	SNP	ENST00000379162.4	37	CCDS14212.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.780140	0.49891	.	.	ENSG00000067992	ENST00000379162;ENST00000441463	T;T	0.48836	0.81;0.8	5.46	5.46	0.80206	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.56062	0.1960	M	0.91196	3.185	0.54753	D	0.99998	P;P	0.34587	0.458;0.458	B;B	0.37650	0.198;0.255	T	0.59241	-0.7491	10	0.31617	T	0.26	.	8.4396	0.32808	0.9101:0.0:0.0899:0.0	.	222;222	B4DXG6;Q15120	.;PDK3_HUMAN	D	222	ENSP00000368460:E222D;ENSP00000387536:E222D	ENSP00000368460:E222D	E	+	3	2	PDK3	24447041	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.488000	0.35551	1.941000	0.56285	0.481000	0.45027	GAA		0.358	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1		NM_005391	
PDS5B	23047	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	33275559	33275559	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr13:33275559G>A	ENST00000315596.10	+	17	2026	c.1840G>A	c.(1840-1842)Gat>Aat	p.D614N		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	614					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.D614N(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TGTGCACATAGATACCGAATC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											82.0	77.0	78.0					13																	33275559		1836	4079	5915	SO:0001583	missense	23047			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1840G>A	13.37:g.33275559G>A	ENSP00000313851:p.Asp614Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174633	0.94807	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.18	5.18	0.71444	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75012	0.3792	M	0.74647	2.275	0.80722	D	1	D	0.71674	0.998	D	0.66847	0.947	T	0.70908	-0.4744	9	0.02654	T	1	-17.6639	19.0456	0.93018	0.0:0.0:1.0:0.0	.	614	Q9NTI5	PDS5B_HUMAN	N	614	.	ENSP00000313851:D614N	D	+	1	0	PDS5B	32173559	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.700000	0.98707	2.580000	0.87095	0.655000	0.94253	GAT		0.388	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3		NM_015032	
PGK1	5230	broad.mit.edu;hgsc.bcm.edu	37	X	77373615	77373615	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chrX:77373615T>A	ENST00000373316.4	+	6	756	c.589T>A	c.(589-591)Ttt>Att	p.F197I	PGK1_ENST00000442431.1_Intron|PGK1_ENST00000537456.1_Missense_Mutation_p.F169I	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	197					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.F197I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	GCTGAACTACTTTGCAAAGGC	0.468																																																	1	Substitution - Missense(1)	kidney(1)											131.0	120.0	124.0					X																	77373615		2203	4296	6499	SO:0001583	missense	5230			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.589T>A	X.37:g.77373615T>A	ENSP00000362413:p.Phe197Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Missense_Mutation	SNP	ENST00000373316.4	37	CCDS14438.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846691	0.51164	.	.	ENSG00000102144	ENST00000373316;ENST00000450919;ENST00000537456	D;D	0.91894	-2.93;-2.93	4.83	3.64	0.41730	Phosphoglycerate kinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95233	0.8454	M	0.80508	2.5	0.48185	D	0.999604	D	0.71674	0.998	D	0.78314	0.991	D	0.94286	0.7524	10	0.87932	D	0	-37.0658	9.5357	0.39220	0.1599:0.0:0.0:0.8401	.	197	P00558	PGK1_HUMAN	I	197;22;169	ENSP00000362413:F197I;ENSP00000444708:F169I	ENSP00000362413:F197I	F	+	1	0	PGK1	77260271	1.000000	0.71417	0.953000	0.39169	0.001000	0.01503	7.961000	0.87903	0.594000	0.29761	-0.567000	0.04161	TTT		0.468	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1			
PTPN14	5784	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	214549669	214549669	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr1:214549669C>T	ENST00000366956.5	-	15	2994	c.2800G>A	c.(2800-2802)Gcc>Acc	p.A934T	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	934	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.A934T(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CTGCGCTCGGCGTTTTCTGGC	0.453																																					Colon(92;557 1424 24372 34121 40073)												1	Substitution - Missense(1)	kidney(1)											161.0	157.0	159.0					1																	214549669		2203	4300	6503	SO:0001583	missense	5784			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2800G>A	1.37:g.214549669C>T	ENSP00000355923:p.Ala934Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381141	0.24944	.	.	ENSG00000152104	ENST00000366956	T	0.14022	2.54	5.22	3.33	0.38152	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.530452	0.21039	N	0.081220	T	0.07143	0.0181	L	0.31664	0.95	0.09310	N	0.999997	B	0.13145	0.007	B	0.06405	0.002	T	0.32981	-0.9886	10	0.14656	T	0.56	.	1.4327	0.02337	0.21:0.432:0.2038:0.1542	.	934	Q15678	PTN14_HUMAN	T	934	ENSP00000355923:A934T	ENSP00000355923:A934T	A	-	1	0	PTPN14	212616292	0.008000	0.16893	0.960000	0.40013	0.620000	0.37586	0.817000	0.27281	1.193000	0.43086	-0.169000	0.13324	GCC		0.453	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2		NM_005401	
ROS1	6098	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	117647553	117647553	+	Silent	SNP	C	C	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr6:117647553C>T	ENST00000368508.3	-	33	5589	c.5391G>A	c.(5389-5391)caG>caA	p.Q1797Q	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Silent_p.Q1791Q	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1797	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Q1797Q(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AATTCTGGTTCTGTAAATTAT	0.318			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	2	Substitution - coding silent(2)	kidney(2)											63.0	61.0	62.0					6																	117647553		2202	4296	6498	SO:0001819	synonymous_variant	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5391G>A	6.37:g.117647553C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	CCDS5116.1																																																																																				0.318	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			
SETD2	29072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	47164613	47164613	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr3:47164613C>A	ENST00000409792.3	-	3	1555	c.1513G>T	c.(1513-1515)Gaa>Taa	p.E505*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	505					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.E2*(1)|p.E505*(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCTCTTCTTTCCATCTCTAAG	0.388			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Nonsense(2)	kidney(2)											63.0	59.0	60.0					3																	47164613		2118	4090	6208	SO:0001587	stop_gained	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1513G>T	3.37:g.47164613C>A	ENSP00000386759:p.Glu505*	Somatic		WXS	Illumina HiSeq	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	36	5.846444	0.97016	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	.	.	.	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.836	0.92162	0.0:1.0:0.0:0.0	.	.	.	.	X	505;505;505;461	.	ENSP00000386759:E505X	E	-	1	0	SETD2	47139617	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.278000	0.78587	2.754000	0.94517	0.650000	0.86243	GAA		0.388	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
SETD6	79918	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	58550759	58550759	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr16:58550759C>G	ENST00000219315.4	+	5	769	c.719C>G	c.(718-720)tCc>tGc	p.S240C	SETD6_ENST00000418480.1_3'UTR|SETD6_ENST00000310682.2_Missense_Mutation_p.S216C|SETD6_ENST00000394266.4_Missense_Mutation_p.S171C			Q8TBK2	SETD6_HUMAN	SET domain containing 6	240	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)	p.S216C(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						GAGCCCAACTCCCCCGTGATG	0.532																																																	1	Substitution - Missense(1)	kidney(1)											192.0	192.0	192.0					16																	58550759		2198	4300	6498	SO:0001583	missense	79918			AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.719C>G	16.37:g.58550759C>G	ENSP00000219315:p.Ser240Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	37	CCDS54013.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137469	0.77775	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315	D;D;D	0.81908	-1.55;-1.55;-1.55	5.42	5.42	0.78866	SET domain (2);	0.237430	0.42548	D	0.000700	D	0.85691	0.5755	L	0.39147	1.195	0.37610	D	0.920887	D;D;D	0.58970	0.97;0.984;0.983	P;P;P	0.57152	0.701;0.814;0.657	D	0.87476	0.2417	10	0.49607	T	0.09	-8.8586	18.2026	0.89843	0.0:1.0:0.0:0.0	.	216;240;216	E9PC53;Q8TBK2;Q8TBK2-2	.;SETD6_HUMAN;.	C	216;171;240	ENSP00000310082:S216C;ENSP00000377809:S171C;ENSP00000219315:S240C	ENSP00000219315:S240C	S	+	2	0	SETD6	57108260	0.999000	0.42202	0.999000	0.59377	0.850000	0.48378	4.512000	0.60469	2.531000	0.85337	0.491000	0.48974	TCC		0.532	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2		NM_024860	
MKL1	57591	hgsc.bcm.edu	37	22	40804077	40804078	+	IGR	INS	-	-	G	rs200384598		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr22:40804077_40804078insG	ENST00000355630.3	-	0	4496				SGSM3_ENST00000248929.9_Frame_Shift_Ins_p.W528fs|SGSM3_ENST00000454798.2_Frame_Shift_Ins_p.W461fs	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						TCCCACAGGCTGGTTTCCAGCC	0.644			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0																																										SO:0001628	intergenic_variant	27352			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40804079_40804079dupG		Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Frame_Shift_Ins	INS	ENST00000355630.3	37	CCDS14003.1																																																																																				0.644	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1		NM_020831	
STAT1	6772	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	191864399	191864399	+	Missense_Mutation	SNP	T	T	G	rs387906764		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr2:191864399T>G	ENST00000361099.3	-	7	881	c.494A>C	c.(493-495)gAt>gCt	p.D165A	STAT1_ENST00000540176.1_Missense_Mutation_p.D165A|STAT1_ENST00000409465.1_Missense_Mutation_p.D165A|STAT1_ENST00000392323.2_Missense_Mutation_p.D167A|STAT1_ENST00000392322.3_Missense_Mutation_p.D165A	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	165			D -> G (in CANDF7; gain of function mutation associated with increased STAT1 phosphorylation due to impaired nuclear dephosphorylation). {ECO:0000269|PubMed:21727188}.|D -> H (in CANDF7). {ECO:0000269|PubMed:21727188}.		apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)	p.D165A(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			ATCTTGTAAATCTTCCAGGCT	0.388																																																	1	Substitution - Missense(1)	kidney(1)											136.0	126.0	129.0					2																	191864399		2203	4299	6502	SO:0001583	missense	6772				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.494A>C	2.37:g.191864399T>G	ENSP00000354394:p.Asp165Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	t	26.1	4.704151	0.88924	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000544783;ENST00000424722	T;T;D;T;T;D	0.84223	0.03;0.03;-1.82;0.03;0.03;-1.82	5.79	5.79	0.91817	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.088198	0.85682	D	0.000000	D	0.90957	0.7157	M	0.85197	2.74	0.58432	D	0.999999	P;B	0.38280	0.625;0.084	P;B	0.49683	0.619;0.259	D	0.90615	0.4555	10	0.42905	T	0.14	-27.1384	16.1354	0.81481	0.0:0.0:0.0:1.0	.	165;165	P42224-2;P42224	.;STAT1_HUMAN	A	165;165;165;165;167;73;165	ENSP00000354394:D165A;ENSP00000386244:D165A;ENSP00000438703:D165A;ENSP00000376136:D165A;ENSP00000376137:D167A;ENSP00000402548:D165A	ENSP00000354394:D165A	D	-	2	0	STAT1	191572644	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	7.816000	0.86201	2.207000	0.71202	0.533000	0.62120	GAT		0.388	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3		NM_007315	
SYVN1	84447	hgsc.bcm.edu	37	11	64897535	64897536	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr11:64897535_64897536insC	ENST00000377190.3	-	13	1440_1441	c.1346_1347insG	c.(1345-1347)ggcfs	p.G449fs	SYVN1_ENST00000526060.1_Frame_Shift_Ins_p.G448fs|SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000294256.8_Frame_Shift_Ins_p.G448fs|SYVN1_ENST00000307289.6_Frame_Shift_Ins_p.G397fs	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	449	Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CAGGGGCAGGGCCAGCCTCTGG	0.644																																																	0																																										SO:0001589	frameshift_variant	84447			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1347dupG	11.37:g.64897537_64897537dupC	ENSP00000366395:p.Gly449fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Frame_Shift_Ins	INS	ENST00000377190.3	37	CCDS31605.1																																																																																				0.644	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1		NM_032431	
TAF5	6877	broad.mit.edu;hgsc.bcm.edu	37	10	105139365	105139365	+	Splice_Site	SNP	G	G	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr10:105139365G>C	ENST00000369839.3	+	4	1137	c.1114G>C	c.(1114-1116)Gta>Cta	p.V372L	TAF5_ENST00000351396.4_Splice_Site_p.V372L	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	372					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V372L(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TGACTTGTAGGTATTTTTTGG	0.289																																																	1	Substitution - Missense(1)	kidney(1)											37.0	38.0	38.0					10																	105139365		2201	4296	6497	SO:0001630	splice_region_variant	6877			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1114-1G>C	10.37:g.105139365G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122642	0.56613	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.59906	0.5;0.23	5.46	5.46	0.80206	.	0.054803	0.64402	D	0.000001	T	0.52338	0.1728	M	0.74881	2.28	0.80722	D	1	P;P	0.37441	0.496;0.595	B;B	0.30572	0.117;0.079	T	0.55742	-0.8093	9	.	.	.	-12.8539	9.907	0.41381	0.1517:0.0:0.8483:0.0	.	372;372	Q15542-2;Q15542	.;TAF5_HUMAN	L	372	ENSP00000358854:V372L;ENSP00000311024:V372L	.	V	+	1	0	TAF5	105129355	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.502000	0.66956	2.559000	0.86315	0.650000	0.86243	GTA		0.289	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1			Missense_Mutation
TLN2	83660	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	62978977	62978977	+	Silent	SNP	A	A	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr15:62978977A>G	ENST00000561311.1	+	11	1325	c.1095A>G	c.(1093-1095)tcA>tcG	p.S365S	TLN2_ENST00000306829.6_Silent_p.S365S|RP11-625H11.2_ENST00000559589.1_RNA			Q9Y4G6	TLN2_HUMAN	talin 2	365	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with PIP5K1C. {ECO:0000250}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S365S(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GGGCAGCCTCACCCAAGAGCT	0.582																																																	1	Substitution - coding silent(1)	kidney(1)											70.0	53.0	59.0					15																	62978977		2203	4300	6503	SO:0001819	synonymous_variant	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.1095A>G	15.37:g.62978977A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				0.582	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			
ULBP2	80328	broad.mit.edu;hgsc.bcm.edu	37	6	150267506	150267506	+	Splice_Site	SNP	A	A	G	rs372949085		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr6:150267506A>G	ENST00000367351.3	+	3	422		c.e3-1			NM_025217.2	NP_079493.1	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2						antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular space (GO:0005615)	natural killer cell lectin-like receptor binding (GO:0046703)	p.?(1)		breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		TGATGGGGGCAGAACCCCTCA	0.512																																																	1	Unknown(1)	kidney(1)											72.0	69.0	70.0					6																	150267506		2202	4281	6483	SO:0001630	splice_region_variant	80328			AF304378	CCDS5222.1	6q25	2008-04-11			ENSG00000131015	ENSG00000131015			14894	protein-coding gene	gene with protein product		605698				11239445	Standard	NM_025217		Approved	RAET1H	uc003qno.3	Q9BZM5	OTTHUMG00000015803	ENST00000367351.3:c.350-1A>G	6.37:g.150267506A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VUN4	Splice_Site	SNP	ENST00000367351.3	37	CCDS5222.1	.	.	.	.	.	.	.	.	.	.	.	8.254	0.809671	0.16537	.	.	ENSG00000131015	ENST00000367351	.	.	.	2.26	2.26	0.28386	.	.	.	.	.	.	.	.	.	.	.	0.30082	N	0.809087	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4136	0.21704	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ULBP2	150309199	0.982000	0.34865	0.010000	0.14722	0.241000	0.25554	2.886000	0.48578	1.085000	0.41206	0.155000	0.16302	.		0.512	ULBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042669.1			Intron
VHL	7428	hgsc.bcm.edu	37	3	10183864	10183864	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5399-01A-01W-1528-10	TCGA-B0-5399-10A-01D-1501-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PacBio	.		Illumina GAIIx	83a76d98-c12a-4fe5-b3a3-9d74a3ae5179	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr3:10183864C>G	ENST00000256474.2	+	1	1173	c.333C>G	c.(331-333)agC>agG	p.S111R	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.S111R	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	111	Involved in binding to CCT complex.		S -> C (in VHLD; type II).|S -> N (in VHLD; type I). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829911}.|S -> R (in VHLD; type I). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.S111R(3)|p.S111S(2)|p.?(1)|p.I109_R113del(1)|p.S111fs*45(1)|p.H110_S111del(1)|p.S111_Y112del(1)|p.Y112fs*47(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCATCCACAGCTACCGAGGTA	0.692		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																													.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	11	Substitution - Missense(3)|Deletion - In frame(3)|Deletion - Frameshift(2)|Substitution - coding silent(2)|Unknown(1)	kidney(11)	GRCh37	CM951281	VHL	M							10.0	11.0	11.0					3																	10183864		1807	3766	5573	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.333C>G	3.37:g.10183864C>G	ENSP00000256474:p.Ser111Arg	Somatic		WXS	Illumina MiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917284	0.92249	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99773	-6.72;-6.72	5.17	4.3	0.51218	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.096185	0.64402	D	0.000001	D	0.99510	0.9825	L	0.46157	1.445	0.25235	N	0.989793	D;D	0.89917	0.991;1.0	P;D	0.85130	0.858;0.997	D	0.98010	1.0365	10	0.87932	D	0	-5.879	11.6184	0.51102	0.0:0.9134:0.0:0.0866	.	111;111	P40337-2;P40337	.;VHL_HUMAN	R	111;111;29	ENSP00000256474:S111R;ENSP00000344757:S111R	ENSP00000256474:S111R	S	+	3	2	VHL	10158864	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.672000	0.37523	1.199000	0.43173	0.479000	0.44913	AGC		0.692	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
XCL1	6375	broad.mit.edu;hgsc.bcm.edu	37	1	168550370	168550371	+	Missense_Mutation	DNP	GG	GG	AC			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr1:168550370_168550371GG>AC	ENST00000367818.3	+	3	422_423	c.257_258GG>AC	c.(256-258)aGG>aAC	p.R86N		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	86					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)	p.R86S(1)|p.R86K(1)		kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					AGCATGGACAGGAAATCCAACA	0.485																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	6375			D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	Exception_encountered	1.37:g.168550370_168550371delinsAC	ENSP00000356792:p.Arg86Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q52MA8	Missense_Mutation	SNP	ENST00000367818.3	37	CCDS1274.1																																																																																				0.485	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083612.1		NM_002995	
ELFN1	392617	broad.mit.edu	37	7	1785687	1785688	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr7:1785687_1785688delGG	ENST00000424383.2	+	3	1942_1943	c.1455_1456delGG	c.(1453-1458)cagggcfs	p.G486fs	ELFN1_ENST00000541472.1_Frame_Shift_Del_p.G486fs|ELFN1_ENST00000561626.1_Frame_Shift_Del_p.G486fs			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	486					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CGCTGTCCCAGGGCCCGCTGCT	0.713																																																	0																																										SO:0001589	frameshift_variant	392617				CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.1455_1456delGG	7.37:g.1785687_1785688delGG	ENSP00000456548:p.Gly486fs	Somatic		WXS	Illumina GAIIx	Phase_I	H3BS57	Frame_Shift_Del	DEL	ENST00000424383.2	37	CCDS59046.1																																																																																				0.713	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2		NM_001128636	
IGSF22	283284	broad.mit.edu	37	11	18738394	18738394	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr11:18738394G>T	ENST00000513874.1	-	10	1266	c.1127C>A	c.(1126-1128)aCg>aAg	p.T376K	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	376								p.T376K(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TTCGGACACCGTGATTTCATA	0.512																																																	2	Substitution - Missense(2)	kidney(2)											250.0	246.0	247.0					11																	18738394		2074	4193	6267	SO:0001583	missense	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1127C>A	11.37:g.18738394G>T	ENSP00000421191:p.Thr376Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640023	0.29157	.	.	ENSG00000179057	ENST00000513874	T	0.66815	-0.23	5.09	0.954	0.19595	.	2.103270	0.04210	U	0.331605	T	0.56920	0.2018	L	0.33293	1	0.09310	N	1	B	0.32620	0.378	B	0.36092	0.217	T	0.43523	-0.9386	10	0.27785	T	0.31	.	6.9198	0.24380	0.5876:0.0:0.4124:0.0	.	376	D6RGV7	.	K	376	ENSP00000421191:T376K	ENSP00000322422:T376K	T	-	2	0	IGSF22	18694970	0.000000	0.05858	0.620000	0.29132	0.883000	0.51084	0.406000	0.21032	0.133000	0.18654	-0.150000	0.13652	ACG		0.512	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2		NM_173588	
KCNE1L	23630	broad.mit.edu	37	X	108868069	108868069	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chrX:108868069G>T	ENST00000372101.2	-	1	324	c.181C>A	c.(181-183)Ctc>Atc	p.L61I		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	61					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)	p.L61I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						AGGATGTAGAGATAGGCGTCG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											46.0	41.0	42.0					X																	108868069		2203	4300	6503	SO:0001583	missense	23630			AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.181C>A	X.37:g.108868069G>T	ENSP00000361173:p.Leu61Ile	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000372101.2	37	CCDS14547.1	.	.	.	.	.	.	.	.	.	.	g	17.24	3.339565	0.60963	.	.	ENSG00000176076	ENST00000372101	T	0.74526	-0.85	4.68	1.52	0.23074	.	0.123963	0.34411	N	0.004000	T	0.64068	0.2565	L	0.36672	1.1	0.30413	N	0.778883	B	0.15930	0.015	B	0.23419	0.046	T	0.61118	-0.7127	10	0.41790	T	0.15	-21.7219	12.4802	0.55837	0.0:0.0:0.451:0.549	.	61	Q9UJ90	KCE1L_HUMAN	I	61	ENSP00000361173:L61I	ENSP00000361173:L61I	L	-	1	0	KCNE1L	108754725	1.000000	0.71417	0.981000	0.43875	0.979000	0.70002	1.104000	0.31074	0.429000	0.26202	0.431000	0.28591	CTC		0.662	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057892.1		NM_012282	
LINC01020	340094	broad.mit.edu	37	5	5057795	5057795	+	lincRNA	DEL	T	T	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr5:5057795delT	ENST00000508201.1	+	0	478									long intergenic non-protein coding RNA 1020																		CCAACACATATTTTTTTTGAA	0.498																																																	0																																												340094					5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5057795delT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000508201.1	37																																																																																					0.498	LINC01020-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000365595.1			
Unknown	0	broad.mit.edu	37	1	121306707	121306707	+	IGR	SNP	C	C	T	rs587677888		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr1:121306707C>T								RP11-344P13.6 (46080 upstream) : RP11-344P13.1 (9036 downstream)																							AAAAGAAGCACTCAGGTGGGA	0.323													C|||	1	0.000199681	0.0	0.0	5008	,	,		15800	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001628	intergenic_variant	0																															1.37:g.121306707C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.323									
SAMD5	389432	broad.mit.edu	37	6	147830411	147830411	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr6:147830411delC	ENST00000367474.1	+	1	349	c.347delC	c.(346-348)gccfs	p.A116fs		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	116													Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		CACACGACCGCCCCCCGCAGC	0.741																																																	0													15.0	14.0	15.0					6																	147830411		2194	4295	6489	SO:0001589	frameshift_variant	389432			AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.347delC	6.37:g.147830411delC	ENSP00000356444:p.Ala116fs	Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000367474.1	37	CCDS34548.1																																																																																				0.741	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042610.1		NM_001030060	
SETD2	29072	broad.mit.edu	37	3	47127737	47127737	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr3:47127737C>T	ENST00000409792.3	-	11	5387	c.5345G>A	c.(5344-5346)tGg>tAg	p.W1782*	SETD2_ENST00000492397.1_5'Flank|snoU13_ENST00000516129.1_RNA	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1782					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.W1279*(1)|p.W1782*(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTCTGCCATCCAGATCCACAA	0.478			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Nonsense(2)	kidney(2)											138.0	120.0	126.0					3																	47127737		2203	4300	6503	SO:0001587	stop_gained	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5345G>A	3.37:g.47127737C>T	ENSP00000386759:p.Trp1782*	Somatic		WXS	Illumina GAIIx	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	45	11.694268	0.99592	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.47	5.47	0.80525	.	0.000000	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3513	0.94387	0.0:1.0:0.0:0.0	.	.	.	.	X	1782	.	ENSP00000386759:W1782X	W	-	2	0	SETD2	47102741	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.737000	0.68606	2.571000	0.86741	0.650000	0.86243	TGG		0.478	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
Unknown	0	broad.mit.edu	37	12	92119	92119	+	IGR	SNP	T	T	C	rs371058037		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr12:92119T>C								AC215219.1 (18797 upstream) : AC026369.1 (54932 downstream)																							CGCCAGGCAGTGGTGCAGCTG	0.592																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.92119T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.592									
LINC01471	101927149	broad.mit.edu	37	3	127199650	127199650	+	lincRNA	DEL	G	G	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr3:127199650delG	ENST00000461398.2	-	0	2921																											AGATAACActggggacaactc	0.448																																																	0																																												0																															3.37:g.127199650delG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000461398.2	37																																																																																					0.448	RP11-59J16.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000396610.1			
LINC01410	103352539	broad.mit.edu	37	9	66466004	66466005	+	lincRNA	INS	-	-	A	rs57947559	byFrequency	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr9:66466004_66466005insA	ENST00000424345.1	+	0	637_638																											GATTCTTCAGTAAAAAAAAGTA	0.307																																																	0																																												0																															9.37:g.66466012_66466012dupA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS	ENST00000424345.1	37																																																																																					0.307	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000128851.1			
MIR4477B	100616194	broad.mit.edu	37	9	68414556	68414556	+	RNA	SNP	G	G	T	rs145693434		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0961a0cf-cc48-4648-899a-6bae189713be	ccca4bdb-ecc3-478a-ab84-47822fc05435	g.chr9:68414556G>T	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		cagcacatctgttaatagcat	0.358																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68414556G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581659.1	37																																																																																					0.358	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
