#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACAN	176	hgsc.bcm.edu;ucsc.edu	37	15	89402128	89402128	+	Silent	SNP	C	C	A	rs368590289		TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr15:89402128C>A	ENST00000561243.1	+	11	6312	c.6312C>A	c.(6310-6312)tcC>tcA	p.S2104S	ACAN_ENST00000439576.2_Silent_p.S2104S|ACAN_ENST00000352105.7_Silent_p.S2104S|ACAN_ENST00000559004.1_Silent_p.S2104S			P16112	PGCA_HUMAN	aggrecan	1989	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTGAGACGTCCGCCTATCCTG	0.567																																																	0													42.0	43.0	42.0					15																	89402128		1904	4115	6019	SO:0001819	synonymous_variant	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6312C>A	15.37:g.89402128C>A		Somatic		WXS	SOLID	Phase_I	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																				0.567	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2		NM_001135	
AKAP11	11215	hgsc.bcm.edu;ucsc.edu	37	13	42875949	42875949	+	Silent	SNP	C	C	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr13:42875949C>T	ENST00000025301.2	+	8	3242	c.3067C>T	c.(3067-3069)Ctg>Ttg	p.L1023L		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1023					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CCTAGAGACACTGCCATCTTG	0.418																																																	0													78.0	74.0	75.0					13																	42875949		2203	4300	6503	SO:0001819	synonymous_variant	11215			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3067C>T	13.37:g.42875949C>T		Somatic		WXS	SOLID	Phase_I	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1																																																																																				0.418	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2		NM_016248	
APOB	338	hgsc.bcm.edu;ucsc.edu	37	2	21227505	21227505	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:21227505T>C	ENST00000233242.1	-	27	11958	c.11831A>G	c.(11830-11832)aAg>aGg	p.K3944R		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3944					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTTTAGTCTTAGAGGCTAA	0.358																																																	0													171.0	161.0	164.0					2																	21227505		2203	4300	6503	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11831A>G	2.37:g.21227505T>C	ENSP00000233242:p.Lys3944Arg	Somatic		WXS	SOLID	Phase_I	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	15.70	2.912012	0.52439	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.19394	2.15	5.99	3.6	0.41247	.	0.663889	0.14427	N	0.320264	T	0.12518	0.0304	N	0.17474	0.49	0.19575	N	0.999969	B	0.20887	0.049	B	0.17433	0.018	T	0.26849	-1.0091	10	0.34782	T	0.22	.	7.9648	0.30091	0.0:0.1647:0.0:0.8353	.	3944	P04114	APOB_HUMAN	R	3944	ENSP00000233242:K3944R	ENSP00000233242:K3944R	K	-	2	0	APOB	21081010	0.003000	0.15002	0.001000	0.08648	0.504000	0.33889	1.282000	0.33226	0.506000	0.28125	0.533000	0.62120	AAG		0.358	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			
ARF3	377	hgsc.bcm.edu;ucsc.edu	37	12	49333860	49333860	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr12:49333860T>C	ENST00000256682.4	-	3	513	c.179A>G	c.(178-180)aAc>aGc	p.N60S	RP11-302B13.5_ENST00000398092.4_Missense_Mutation_p.N60S|ARF3_ENST00000541967.1_5'Flank|ARF3_ENST00000447318.2_Intron|AC073610.5_ENST00000537495.1_5'Flank|ARF3_ENST00000541959.1_Missense_Mutation_p.N60S	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3	60					GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						AAAGCTGATGTTCTTATACTC	0.507																																					Pancreas(189;1862 2134 4419 30933 49364)												0													184.0	151.0	162.0					12																	49333860		2203	4300	6503	SO:0001583	missense	377			M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.179A>G	12.37:g.49333860T>C	ENSP00000256682:p.Asn60Ser	Somatic		WXS	SOLID	Phase_I	A8K6G8|B7ZB63|P16587	Missense_Mutation	SNP	ENST00000256682.4	37	CCDS8774.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.252761	0.39797	.	.	ENSG00000134287	ENST00000398092;ENST00000256682;ENST00000541959;ENST00000541236	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	4.72	4.72	0.59763	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.86414	0.5927	M	0.90425	3.115	0.80722	D	1	B	0.27264	0.173	B	0.31016	0.123	D	0.86952	0.2086	10	0.72032	D	0.01	.	13.4987	0.61440	0.0:0.0:0.0:1.0	.	60	P61204	ARF3_HUMAN	S	60	ENSP00000438507:N60S;ENSP00000256682:N60S;ENSP00000438510:N60S;ENSP00000438063:N60S	ENSP00000256682:N60S	N	-	2	0	ARF3	47620127	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.036000	0.88901	1.887000	0.54652	0.379000	0.24179	AAC		0.507	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258242.2		NM_001659	
DIEXF	27042	hgsc.bcm.edu	37	1	210010524	210010524	+	Missense_Mutation	SNP	G	G	A	rs41274840	byFrequency	TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr1:210010524G>A	ENST00000491415.2	+	6	1087	c.1030G>A	c.(1030-1032)Gac>Aac	p.D344N		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	344	Poly-Asp.				multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						TGATGATGATGACTTCAGAGA	0.527													G|||	43	0.00858626	0.0	0.0274	5008	,	,		17783	0.0		0.0229	False		,,,				2504	0.001																0								G	ASN/ASP	22,4384		0,22,2181	49.0	40.0	43.0		1030	5.0	1.0	1	dbSNP_127	43	209,8391		2,205,4093	yes	missense	DIEXF	NM_014388.6	23	2,227,6274	AA,AG,GG		2.4302,0.4993,1.7761	possibly-damaging	344/757	210010524	231,12775	2203	4300	6503	SO:0001583	missense	0			BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.1030G>A	1.37:g.210010524G>A	ENSP00000419005:p.Asp344Asn	Somatic		WXS	SOLID	Phase_I	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	37	CCDS1493.1	30	0.013736263736263736	0	0.0	14	0.03867403314917127	0	0.0	16	0.021108179419525065	G	33	5.255086	0.95336	0.004993	0.024302	ENSG00000117597	ENST00000491415	T	0.45276	0.9	5.91	5.0	0.66597	.	0.116765	0.56097	D	0.000021	T	0.22589	0.0545	M	0.65498	2.005	0.58432	D	0.999995	P	0.49783	0.928	P	0.52031	0.688	T	0.40098	-0.9581	10	0.54805	T	0.06	-26.6669	15.1828	0.72972	0.0673:0.0:0.9327:0.0	rs41274840;rs61740237	344	Q68CQ4	DIEXF_HUMAN	N	344	ENSP00000419005:D344N	ENSP00000419005:D344N	D	+	1	0	DIEXF	208077147	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	9.640000	0.98453	1.503000	0.48686	0.655000	0.94253	GAC		0.527	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2		NM_014388	
C8G	733	hgsc.bcm.edu	37	9	139839785	139839785	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr9:139839785G>A	ENST00000224181.3	+	1	73	c.13G>A	c.(13-15)Ggg>Agg	p.G5R	FBXW5_ENST00000325285.3_5'Flank|FBXW5_ENST00000483559.1_5'Flank	NM_000606.2	NP_000597.2	P07360	CO8G_HUMAN	complement component 8, gamma polypeptide	5					complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	retinol binding (GO:0019841)			NS(1)|prostate(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.88e-06)|Epithelial(140;0.000107)		GCTGCCCCCTGGGACTGCGAC	0.667											OREG0019623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													27.0	31.0	29.0					9																	139839785		2202	4299	6501	SO:0001583	missense	733			X06465	CCDS7017.1	9q	2011-11-15			ENSG00000176919	ENSG00000176919		"""Complement system"", ""Lipocalins"""	1354	protein-coding gene	gene with protein product		120930					Standard	NM_000606		Approved		uc004cka.2	P07360	OTTHUMG00000020955	ENST00000224181.3:c.13G>A	9.37:g.139839785G>A	ENSP00000224181:p.Gly5Arg	Somatic	1651	WXS	SOLID	Phase_I	Q14CT8|Q14CU0|Q5SQ07	Missense_Mutation	SNP	ENST00000224181.3	37	CCDS7017.1	.	.	.	.	.	.	.	.	.	.	G	5.373	0.254003	0.10185	.	.	ENSG00000176919	ENST00000371634;ENST00000224181	T;T	0.21734	1.99;2.83	5.21	-2.54	0.06307	.	0.654477	0.14051	N	0.344750	T	0.05181	0.0138	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32877	-0.9890	10	0.06625	T	0.88	-2.4209	0.1873	0.00130	0.2958:0.1582:0.2622:0.2837	.	5	P07360	CO8G_HUMAN	R	5	ENSP00000360697:G5R;ENSP00000224181:G5R	ENSP00000224181:G5R	G	+	1	0	C8G	138959606	0.007000	0.16637	0.000000	0.03702	0.038000	0.13279	0.143000	0.16115	-0.480000	0.06803	0.561000	0.74099	GGG		0.667	C8G-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055178.1			
CCDC108	255101	hgsc.bcm.edu;ucsc.edu	37	2	219875305	219875305	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:219875305T>C	ENST00000341552.5	-	26	4354	c.4271A>G	c.(4270-4272)aAc>aGc	p.N1424S	CCDC108_ENST00000453220.1_Missense_Mutation_p.N1424S|CCDC108_ENST00000441968.1_Missense_Mutation_p.N1424S|AC097468.4_ENST00000441450.1_RNA	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1424						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATGGAACTGTTGTCCCACGA	0.607																																																	0													88.0	66.0	73.0					2																	219875305		2203	4300	6503	SO:0001583	missense	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4271A>G	2.37:g.219875305T>C	ENSP00000340776:p.Asn1424Ser	Somatic		WXS	SOLID	Phase_I	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	T	0.131	-1.113813	0.01799	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04809	3.55;3.55;3.55	5.19	-3.61	0.04556	.	0.997181	0.08123	N	0.994396	T	0.01835	0.0058	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.48445	-0.9035	10	0.07175	T	0.84	-9.3636	6.9112	0.24336	0.0:0.4327:0.2629:0.3045	.	1424	Q6ZU64	CC108_HUMAN	S	1424	ENSP00000340776:N1424S;ENSP00000413377:N1424S;ENSP00000409117:N1424S	ENSP00000340776:N1424S	N	-	2	0	CCDC108	219583549	0.001000	0.12720	0.010000	0.14722	0.657000	0.38888	0.455000	0.21843	-0.540000	0.06265	0.413000	0.27773	AAC		0.607	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4		NM_194302	
CD93	22918	hgsc.bcm.edu;ucsc.edu	37	20	23066400	23066400	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr20:23066400G>T	ENST00000246006.4	-	1	577	c.430C>A	c.(430-432)Ctg>Atg	p.L144M		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	144	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TCCAGCAGCAGAGACACACAG	0.652																																																	0													24.0	30.0	28.0					20																	23066400		2203	4299	6502	SO:0001583	missense	22918			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.430C>A	20.37:g.23066400G>T	ENSP00000246006:p.Leu144Met	Somatic		WXS	SOLID	Phase_I	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048917	0.36181	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.22336	1.96	5.38	3.43	0.39272	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.46758	D	0.000280	T	0.28962	0.0719	L	0.47016	1.485	0.09310	N	1	D	0.57899	0.981	P	0.60236	0.871	T	0.05370	-1.0889	10	0.33940	T	0.23	-21.583	6.244	0.20807	0.1545:0.0:0.6968:0.1486	.	144	Q9NPY3	C1QR1_HUMAN	M	144	ENSP00000246006:L144M	ENSP00000246006:L144M	L	-	1	2	CD93	23014400	0.999000	0.42202	0.526000	0.27913	0.911000	0.54048	1.525000	0.35953	0.736000	0.32559	0.655000	0.94253	CTG		0.652	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2		NM_012072	
CENPF	1063	hgsc.bcm.edu	37	1	214818442	214818442	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr1:214818442T>G	ENST00000366955.3	+	13	5697	c.5529T>G	c.(5527-5529)agT>agG	p.S1843R		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1939					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CAGATTTAAGTGAAAAATTGG	0.338																																					Colon(80;575 1284 11000 14801 43496)												0													33.0	36.0	35.0					1																	214818442		2189	4294	6483	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5529T>G	1.37:g.214818442T>G	ENSP00000355922:p.Ser1843Arg	Somatic		WXS	SOLID	Phase_I	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.715848	0.48622	.	.	ENSG00000117724	ENST00000366955	T	0.03607	3.87	5.38	2.96	0.34315	.	0.547764	0.15415	N	0.263527	T	0.04272	0.0118	L	0.50333	1.59	0.33324	D	0.56771	B	0.12630	0.006	B	0.12156	0.007	T	0.21552	-1.0242	10	0.20046	T	0.44	.	8.3086	0.32058	0.123:0.0:0.2569:0.62	.	1939	P49454	CENPF_HUMAN	R	1843	ENSP00000355922:S1843R	ENSP00000355922:S1843R	S	+	3	2	CENPF	212885065	0.623000	0.27094	0.891000	0.34965	0.974000	0.67602	0.644000	0.24766	0.305000	0.22832	0.496000	0.49642	AGT		0.338	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1		NM_016343	
CHRNA4	1137	hgsc.bcm.edu;ucsc.edu	37	20	61981905	61981905	+	Silent	SNP	G	G	A	rs121912257		TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr20:61981905G>A	ENST00000370263.4	-	5	1079	c.858C>T	c.(856-858)acC>acT	p.T286T	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	286					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GCAGGAAGACGGTGAGCGACA	0.592																																																	0													267.0	195.0	219.0					20																	61981905		2203	4300	6503	SO:0001819	synonymous_variant	1137				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.858C>T	20.37:g.61981905G>A		Somatic		WXS	SOLID	Phase_I	Q4JGR7|Q4VAQ5|Q4VAQ6	Silent	SNP	ENST00000370263.4	37	CCDS13517.1																																																																																				0.592	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			
COL15A1	1306	hgsc.bcm.edu	37	9	101777794	101777794	+	Silent	SNP	A	A	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr9:101777794A>C	ENST00000375001.3	+	10	1872	c.1449A>C	c.(1447-1449)acA>acC	p.T483T		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	483	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GGGTCCCCACAGATGGCCTGG	0.567																																																	0													61.0	56.0	58.0					9																	101777794		2203	4300	6503	SO:0001819	synonymous_variant	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1449A>C	9.37:g.101777794A>C		Somatic		WXS	SOLID	Phase_I	Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	CCDS35081.1																																																																																				0.567	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3		NM_001855	
COL1A2	1278	hgsc.bcm.edu;ucsc.edu	37	7	94040381	94040381	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr7:94040381G>C	ENST00000297268.6	+	23	1736	c.1265G>C	c.(1264-1266)aGt>aCt	p.S422T		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	422					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CCTCCTGGTAGTCGTGGTGCA	0.522										HNSCC(75;0.22)																																							0													42.0	42.0	42.0					7																	94040381		2203	4300	6503	SO:0001583	missense	1278			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1265G>C	7.37:g.94040381G>C	ENSP00000297268:p.Ser422Thr	Somatic		WXS	SOLID	Phase_I	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	7.549	0.662287	0.14645	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93604	-3.25	5.84	-7.84	0.01196	.	0.778434	0.13020	N	0.420164	D	0.84915	0.5578	L	0.35793	1.09	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.68573	-0.5373	10	0.32370	T	0.25	.	8.3746	0.32436	0.4988:0.2595:0.2418:0.0	.	422	P08123	CO1A2_HUMAN	T	422;423	ENSP00000297268:S422T	ENSP00000297268:S422T	S	+	2	0	COL1A2	93878317	0.053000	0.20554	0.000000	0.03702	0.025000	0.11179	0.150000	0.16263	-1.396000	0.02071	-0.312000	0.09012	AGT		0.522	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2		NM_000089	
DBR1	51163	hgsc.bcm.edu	37	3	137893493	137893493	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr3:137893493G>T	ENST00000260803.4	-	1	298	c.145C>A	c.(145-147)Cta>Ata	p.L49I	DBR1_ENST00000505015.2_5'UTR|DBR1_ENST00000463982.2_5'UTR	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	49					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						ATGCAGCGTAGATCCGCCTCG	0.687																																																	0													27.0	25.0	25.0					3																	137893493		2203	4298	6501	SO:0001583	missense	51163			AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.145C>A	3.37:g.137893493G>T	ENSP00000260803:p.Leu49Ile	Somatic		WXS	SOLID	Phase_I	Q96GH0|Q9NXQ6	Missense_Mutation	SNP	ENST00000260803.4	37	CCDS33863.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770182	0.69992	.	.	ENSG00000138231	ENST00000260803	T	0.34472	1.36	5.18	4.3	0.51218	Metallophosphoesterase domain (1);	0.057543	0.64402	D	0.000003	T	0.65249	0.2673	H	0.96518	3.835	0.80722	D	1	D	0.61697	0.99	D	0.64321	0.924	T	0.70788	-0.4777	10	0.72032	D	0.01	-11.1435	6.4619	0.21960	0.0906:0.0:0.7297:0.1797	.	49	Q9UK59	DBR1_HUMAN	I	49	ENSP00000260803:L49I	ENSP00000260803:L49I	L	-	1	2	DBR1	139376183	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	1.489000	0.35562	1.398000	0.46701	0.557000	0.71058	CTA		0.687	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1			
DPP10	57628	hgsc.bcm.edu;ucsc.edu	37	2	116510852	116510852	+	Silent	SNP	C	C	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:116510852C>G	ENST00000410059.1	+	11	1533	c.1053C>G	c.(1051-1053)acC>acG	p.T351T	DPP10_ENST00000310323.8_Silent_p.T344T|DPP10_ENST00000409163.1_Silent_p.T301T|DPP10_ENST00000393147.2_Silent_p.T355T	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	351						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TCTGTGAGACCACTACAGGTG	0.373																																																	0													117.0	106.0	110.0					2																	116510852		2203	4300	6503	SO:0001819	synonymous_variant	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1053C>G	2.37:g.116510852C>G		Somatic		WXS	SOLID	Phase_I	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																				0.373	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4		NM_020868	
ELOVL7	79993	hgsc.bcm.edu;ucsc.edu	37	5	60050500	60050500	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr5:60050500C>T	ENST00000508821.1	-	9	1111	c.797G>A	c.(796-798)aGg>aAg	p.R266K	ELOVL7_ENST00000425382.1_Missense_Mutation_p.R266K|ELOVL7_ENST00000438340.1_Missense_Mutation_p.R266K|ELOVL7_ENST00000505959.1_Missense_Mutation_p.R253K	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	266					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				TTTGGGCAACCTCTGACCTTT	0.383																																																	0													114.0	101.0	105.0					5																	60050500		2203	4300	6503	SO:0001583	missense	79993			AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.797G>A	5.37:g.60050500C>T	ENSP00000424123:p.Arg266Lys	Somatic		WXS	SOLID	Phase_I	Q589T3|Q9H5D0|Q9NT66	Missense_Mutation	SNP	ENST00000508821.1	37	CCDS34164.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570057	0.86542	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000505959	T;T;T;T	0.20738	2.05;2.05;2.05;2.05	5.74	4.87	0.63330	.	0.046339	0.85682	D	0.000000	T	0.26629	0.0651	L	0.37850	1.14	0.48975	D	0.999736	P;P	0.50710	0.846;0.938	P;P	0.55303	0.557;0.773	T	0.02320	-1.1177	10	0.08381	T	0.77	-8.4519	14.8608	0.70379	0.0:0.931:0.0:0.069	.	253;266	D6RHD0;A1L3X0	.;ELOV7_HUMAN	K	266;266;266;253	ENSP00000424123:R266K;ENSP00000411255:R266K;ENSP00000402634:R266K;ENSP00000421043:R253K	ENSP00000402634:R266K	R	-	2	0	ELOVL7	60086257	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.424000	0.80242	1.424000	0.47217	0.555000	0.69702	AGG		0.383	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1			
FUT3	2525	hgsc.bcm.edu	37	19	5843822	5843822	+	Silent	SNP	T	T	C	rs199931170	byFrequency	TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr19:5843822T>C	ENST00000303225.6	-	3	1663	c.1029A>G	c.(1027-1029)aaA>aaG	p.K343K	FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000589620.1_Silent_p.K343K|FUT3_ENST00000589918.1_Silent_p.K343K|FUT3_ENST00000458379.2_Silent_p.K343K	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	343					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CCTGCTGCAGTTTCCAGCAGG	0.632																																					Esophageal Squamous(82;745 1728 24593 44831)												0													61.0	65.0	64.0					19																	5843822		2203	4300	6503	SO:0001819	synonymous_variant	2525				CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.1029A>G	19.37:g.5843822T>C		Somatic		WXS	SOLID	Phase_I	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Silent	SNP	ENST00000303225.6	37	CCDS12153.1																																																																																				0.632	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1		NM_000149	
FBN3	84467	hgsc.bcm.edu	37	19	8183871	8183871	+	Missense_Mutation	SNP	G	G	A	rs35579498	byFrequency	TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr19:8183871G>A	ENST00000600128.1	-	26	3661	c.3247C>T	c.(3247-3249)Cgg>Tgg	p.R1083W	FBN3_ENST00000270509.2_Missense_Mutation_p.R1083W|FBN3_ENST00000601739.1_Missense_Mutation_p.R1083W			Q75N90	FBN3_HUMAN	fibrillin 3	1083	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		R -> W (in dbSNP:rs35579498). {ECO:0000269|PubMed:15221638}.			proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GTGCCTCCCCGGCAGAGCAGC	0.612													G|||	400	0.0798722	0.0061	0.1988	5008	,	,		22125	0.1796		0.0388	False		,,,				2504	0.0348																0								G	TRP/ARG	64,4342	61.7+/-98.7	1,62,2140	105.0	78.0	87.0		3247	0.4	0.9	19	dbSNP_126	87	333,8267	115.0+/-174.9	6,321,3973	yes	missense	FBN3	NM_032447.3	101	7,383,6113	AA,AG,GG		3.8721,1.4526,3.0524	probably-damaging	1083/2810	8183871	397,12609	2203	4300	6503	SO:0001583	missense	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3247C>T	19.37:g.8183871G>A	ENSP00000470498:p.Arg1083Trp	Somatic		WXS	SOLID	Phase_I	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	213	0.09752747252747253	4	0.008130081300813009	54	0.14917127071823205	125	0.21853146853146854	30	0.0395778364116095	G	16.29	3.080514	0.55753	0.014526	0.038721	ENSG00000142449	ENST00000270509	D	0.92397	-3.03	3.98	0.394	0.16299	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.072291	0.56097	U	0.000023	T	0.00300	0.0009	M	0.68952	2.095	0.23657	P	0.99718307	B	0.19817	0.039	B	0.10450	0.005	T	0.40850	-0.9541	9	0.87932	D	0	.	6.2741	0.20971	0.1651:0.0:0.6871:0.1478	rs35579498;rs61476762	1083	Q75N90	FBN3_HUMAN	W	1083	ENSP00000270509:R1083W	ENSP00000270509:R1083W	R	-	1	2	FBN3	8089871	1.000000	0.71417	0.912000	0.35992	0.429000	0.31625	2.788000	0.47806	-0.036000	0.13669	0.313000	0.20887	CGG		0.612	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2		NM_032447	
GATA2	2624	hgsc.bcm.edu	37	3	128204641	128204641	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr3:128204641G>A	ENST00000341105.2	-	3	1131	c.800C>T	c.(799-801)cCc>cTc	p.P267L	GATA2_ENST00000487848.1_Missense_Mutation_p.P267L|GATA2_ENST00000430265.2_Missense_Mutation_p.P267L	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	267					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GAAGCCTCCGGGGTGGAAGAG	0.647			Mis		AML(CML blast transformation)																																			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0													38.0	43.0	41.0					3																	128204641		2203	4300	6503	SO:0001583	missense	2624			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.800C>T	3.37:g.128204641G>A	ENSP00000345681:p.Pro267Leu	Somatic		WXS	SOLID	Phase_I	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Missense_Mutation	SNP	ENST00000341105.2	37	CCDS3049.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787728	0.90367	.	.	ENSG00000179348	ENST00000341105;ENST00000430265;ENST00000487848	D;D;D	0.97575	-4.43;-4.44;-4.43	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.98362	0.9456	M	0.79693	2.465	0.80722	D	1	D;P	0.89917	1.0;0.81	D;B	0.91635	0.999;0.212	D	0.99264	1.0891	10	0.56958	D	0.05	-13.2977	17.4411	0.87565	0.0:0.0:1.0:0.0	.	267;267	P23769-2;P23769	.;GATA2_HUMAN	L	267	ENSP00000345681:P267L;ENSP00000400259:P267L;ENSP00000417074:P267L	ENSP00000345681:P267L	P	-	2	0	GATA2	129687331	1.000000	0.71417	0.924000	0.36721	0.808000	0.45660	7.843000	0.86859	2.099000	0.63709	0.491000	0.48974	CCC		0.647	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1		NM_032638	
HIC2	23119	hgsc.bcm.edu	37	22	21800836	21800836	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr22:21800836A>G	ENST00000443632.2	+	2	2024	c.1652A>G	c.(1651-1653)cAc>cGc	p.H551R	HIC2_ENST00000407464.2_Missense_Mutation_p.H551R|HIC2_ENST00000407598.2_Missense_Mutation_p.H551R			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	551					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				ATGACGCGTCACATGCGGAGC	0.642																																					NSCLC(23;437 858 2282 27947 40366)												0													71.0	60.0	64.0					22																	21800836		2203	4300	6503	SO:0001583	missense	23119			AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1652A>G	22.37:g.21800836A>G	ENSP00000387757:p.His551Arg	Somatic		WXS	SOLID	Phase_I	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Missense_Mutation	SNP	ENST00000443632.2	37	CCDS13789.1	.	.	.	.	.	.	.	.	.	.	A	17.77	3.472185	0.63737	.	.	ENSG00000169635	ENST00000407464;ENST00000407598;ENST00000443632	D;D;D	0.99974	-10.2;-10.2;-10.2	4.48	3.42	0.39159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	M	0.93978	3.48	0.58432	D	0.999992	D	0.56746	0.977	P	0.59357	0.856	D	0.95057	0.8192	10	0.87932	D	0	.	9.2921	0.37793	0.8181:0.1819:0.0:0.0	.	551	Q96JB3	HIC2_HUMAN	R	551	ENSP00000385319:H551R;ENSP00000384889:H551R;ENSP00000387757:H551R	ENSP00000385319:H551R	H	+	2	0	HIC2	20130836	1.000000	0.71417	0.997000	0.53966	0.891000	0.51852	9.026000	0.93700	0.736000	0.32559	0.529000	0.55759	CAC		0.642	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2			
INPP5E	56623	hgsc.bcm.edu	37	9	139333264	139333264	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr9:139333264G>A	ENST00000371712.3	-	1	1010	c.608C>T	c.(607-609)tCc>tTc	p.S203F	SEC16A_ENST00000467838.1_5'Flank	NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.S203F(1)		NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		CAGGGAGTCGGAGGCGATGTC	0.716																																																	1	Substitution - Missense(1)	skin(1)											19.0	21.0	20.0					9																	139333264		2197	4300	6497	SO:0001583	missense	56623			AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.608C>T	9.37:g.139333264G>A	ENSP00000360777:p.Ser203Phe	Somatic		WXS	SOLID	Phase_I	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371712.3	37	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054085	0.75960	.	.	ENSG00000148384	ENST00000371712	D	0.98362	-4.89	3.32	3.32	0.38043	.	0.447607	0.20968	N	0.082460	D	0.98365	0.9457	M	0.63843	1.955	0.58432	D	0.999991	D;D	0.89917	1.0;0.999	D;D	0.68943	0.961;0.915	D	0.98528	1.0626	10	0.56958	D	0.05	-19.7137	14.1328	0.65266	0.0:0.0:1.0:0.0	.	203;203	Q9NRR6-2;Q9NRR6	.;INP5E_HUMAN	F	203	ENSP00000360777:S203F	ENSP00000360777:S203F	S	-	2	0	INPP5E	138453085	1.000000	0.71417	0.032000	0.17829	0.177000	0.22998	5.270000	0.65547	1.853000	0.53794	0.462000	0.41574	TCC		0.716	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1		NM_019892	
KIAA1731	85459	hgsc.bcm.edu	37	11	93400881	93400881	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr11:93400881G>A	ENST00000325212.6	+	3	379	c.217G>A	c.(217-219)Gaa>Aaa	p.E73K	KIAA1731_ENST00000344196.4_5'UTR|KIAA1731_ENST00000411936.1_Missense_Mutation_p.E73K			Q9C0D2	K1731_HUMAN	KIAA1731	73						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGAATGGGAAGAATCACAAAC	0.393																																																	0													81.0	72.0	75.0					11																	93400881		692	1591	2283	SO:0001583	missense	85459			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.217G>A	11.37:g.93400881G>A	ENSP00000316681:p.Glu73Lys	Somatic		WXS	SOLID	Phase_I	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	37	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838929	0.32513	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.09817	2.94;2.95	5.02	3.12	0.35913	.	0.273625	0.31531	N	0.007493	T	0.09468	0.0233	L	0.48362	1.52	0.80722	D	1	B	0.31790	0.34	B	0.31245	0.126	T	0.14671	-1.0464	10	0.37606	T	0.19	-13.8923	7.3262	0.26557	0.1427:0.1727:0.6847:0.0	.	73	Q9C0D2	K1731_HUMAN	K	73	ENSP00000316681:E73K;ENSP00000406505:E73K	ENSP00000316681:E73K	E	+	1	0	KIAA1731	93040529	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.755000	0.38379	1.253000	0.44018	-0.127000	0.14921	GAA		0.393	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1		NM_033395	
KIF24	347240	hgsc.bcm.edu;ucsc.edu	37	9	34271874	34271874	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr9:34271874C>A	ENST00000402558.2	-	6	1294	c.1270G>T	c.(1270-1272)Gac>Tac	p.D424Y	KIF24_ENST00000379174.3_Missense_Mutation_p.D290Y|KIF24_ENST00000379166.2_Missense_Mutation_p.D424Y|KIF24_ENST00000345050.2_Missense_Mutation_p.D290Y			Q5T7B8	KIF24_HUMAN	kinesin family member 24	424	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CGGGAGGAGTCTGCATTAACT	0.478																																																	0													71.0	70.0	70.0					9																	34271874		1988	4177	6165	SO:0001583	missense	347240			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.1270G>T	9.37:g.34271874C>A	ENSP00000384433:p.Asp424Tyr	Somatic		WXS	SOLID	Phase_I	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	C	14.24	2.475376	0.43942	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92	5.61	5.61	0.85477	Kinesin, motor domain (5);	0.151685	0.30911	N	0.008622	D	0.84428	0.5470	L	0.60845	1.875	0.40022	D	0.975428	D;D	0.89917	1.0;1.0	D;D	0.81914	0.989;0.995	D	0.83418	0.0031	10	0.41790	T	0.15	.	19.2975	0.94129	0.0:1.0:0.0:0.0	.	424;424	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	Y	424;290;424;290;424	ENSP00000384433:D424Y;ENSP00000368472:D290Y;ENSP00000368464:D424Y;ENSP00000340179:D290Y	ENSP00000340179:D290Y	D	-	1	0	KIF24	34261874	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.212000	0.51145	2.675000	0.91044	0.650000	0.86243	GAC		0.478	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			
LENG1	79165	hgsc.bcm.edu	37	19	54663351	54663351	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr19:54663351C>G	ENST00000222224.3	-	1	269	c.83G>C	c.(82-84)cGg>cCg	p.R28P		NM_024316.1	NP_077292.1	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	28										breast(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	8	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTCCTCCTCCCGGGCCTGGGC	0.682																																																	0													27.0	23.0	24.0					19																	54663351		2203	4298	6501	SO:0001583	missense	79165			AF211966	CCDS12881.1	19q13.4	2008-02-05			ENSG00000105617	ENSG00000105617			15502	protein-coding gene	gene with protein product						10941842	Standard	NM_024316		Approved		uc002qdm.3	Q96BZ8	OTTHUMG00000066486	ENST00000222224.3:c.83G>C	19.37:g.54663351C>G	ENSP00000222224:p.Arg28Pro	Somatic		WXS	SOLID	Phase_I	Q9HCU7	Missense_Mutation	SNP	ENST00000222224.3	37	CCDS12881.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139150	0.77775	.	.	ENSG00000105617	ENST00000222224	T	0.48522	0.81	4.76	4.76	0.60689	.	0.130652	0.49916	D	0.000138	T	0.64283	0.2584	M	0.87547	2.89	0.33554	D	0.596461	D	0.64830	0.994	P	0.59889	0.865	T	0.75393	-0.3333	10	0.52906	T	0.07	-25.9682	6.9929	0.24765	0.0:0.7311:0.1774:0.0915	.	28	Q96BZ8	LENG1_HUMAN	P	28	ENSP00000222224:R28P	ENSP00000222224:R28P	R	-	2	0	LENG1	59355163	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.165000	0.58196	2.657000	0.90304	0.650000	0.86243	CGG		0.682	LENG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142159.1		NM_024316	
MAGED1	9500	hgsc.bcm.edu	37	X	51640358	51640358	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chrX:51640358A>G	ENST00000375722.1	+	5	1729	c.1477A>G	c.(1477-1479)Aag>Gag	p.K493E	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Missense_Mutation_p.K549E|MAGED1_ENST00000375772.3_Missense_Mutation_p.K493E|MAGED1_ENST00000326587.7_Missense_Mutation_p.K493E			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	493	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					GGTGCCCATCAAGCGCTCAGG	0.458										Multiple Myeloma(10;0.10)																																							0													102.0	71.0	81.0					X																	51640358		2203	4300	6503	SO:0001583	missense	9500			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1477A>G	X.37:g.51640358A>G	ENSP00000364874:p.Lys493Glu	Somatic		WXS	SOLID	Phase_I	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	37	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.699654	0.48307	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.05081	3.5;3.5;3.5;3.5	3.54	3.54	0.40534	.	0.000000	0.39687	N	0.001285	T	0.09202	0.0227	M	0.81112	2.525	0.36715	D	0.880855	P;B	0.40534	0.72;0.294	B;B	0.35353	0.201;0.132	T	0.08868	-1.0701	10	0.72032	D	0.01	.	7.7128	0.28688	1.0:0.0:0.0:0.0	.	549;493	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	E	493;493;493;549	ENSP00000364927:K493E;ENSP00000364874:K493E;ENSP00000325333:K493E;ENSP00000364847:K549E	ENSP00000325333:K493E	K	+	1	0	MAGED1	51657098	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.089000	0.30890	1.634000	0.50500	0.350000	0.21858	AAG		0.458	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1		NM_001005332	
NCAPH2	29781	hgsc.bcm.edu	37	22	50961541	50961541	+	Silent	SNP	G	G	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr22:50961541G>A	ENST00000420993.2	+	19	1745	c.1623G>A	c.(1621-1623)gtG>gtA	p.V541V	CTA-384D8.36_ENST00000608319.1_RNA|NCAPH2_ENST00000299821.11_Silent_p.V542V|NCAPH2_ENST00000395701.3_Silent_p.V541V	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	541					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		CGGAGCTGGTGGCTGGCCAGC	0.637																																																	0													56.0	44.0	48.0					22																	50961541		2202	4300	6502	SO:0001819	synonymous_variant	29781			BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1623G>A	22.37:g.50961541G>A		Somatic		WXS	SOLID	Phase_I	B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Silent	SNP	ENST00000420993.2	37	CCDS14094.2	.	.	.	.	.	.	.	.	.	.	G	9.363	1.068425	0.20067	.	.	ENSG00000025770	ENST00000522304	.	.	.	4.79	-0.187	0.13268	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-29.8022	6.3941	0.21603	0.2332:0.1329:0.6339:0.0	.	.	.	.	X	77	.	.	W	+	2	0	NCAPH2	49308407	0.385000	0.25172	0.991000	0.47740	0.955000	0.61496	0.008000	0.13197	0.177000	0.19895	0.561000	0.74099	TGG		0.637	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317012.1		NM_152299	
NCKAP1L	3071	hgsc.bcm.edu;ucsc.edu	37	12	54914587	54914587	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr12:54914587A>G	ENST00000293373.6	+	17	1814	c.1735A>G	c.(1735-1737)Act>Gct	p.T579A	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.T529A	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	579					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TGTCCACTGCACTCATGAGAT	0.468																																																	0													406.0	348.0	368.0					12																	54914587		2203	4300	6503	SO:0001583	missense	3071			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1735A>G	12.37:g.54914587A>G	ENSP00000293373:p.Thr579Ala	Somatic		WXS	SOLID	Phase_I	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	A	10.60	1.396816	0.25205	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.28895	1.59;1.59	5.46	2.86	0.33363	.	0.433261	0.27266	N	0.020142	T	0.16471	0.0396	L	0.29908	0.895	0.24399	N	0.994711	B	0.25351	0.124	B	0.28385	0.089	T	0.31081	-0.9956	10	0.02654	T	1	-6.2925	6.1527	0.20320	0.775:0.0:0.0815:0.1434	.	579	P55160	NCKPL_HUMAN	A	579;529	ENSP00000293373:T579A;ENSP00000445596:T529A	ENSP00000293373:T579A	T	+	1	0	NCKAP1L	53200854	0.267000	0.24122	1.000000	0.80357	0.994000	0.84299	1.471000	0.35365	0.982000	0.38575	0.449000	0.29647	ACT		0.468	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1		NM_005337	
NEB	4703	hgsc.bcm.edu;ucsc.edu	37	2	152552137	152552137	+	Silent	SNP	A	A	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:152552137A>T	ENST00000172853.10	-	18	1776	c.1629T>A	c.(1627-1629)acT>acA	p.T543T	NEB_ENST00000427231.2_Silent_p.T543T|NEB_ENST00000604864.1_Silent_p.T543T|NEB_ENST00000409198.1_Silent_p.T543T|NEB_ENST00000397345.3_Silent_p.T543T|NEB_ENST00000603639.1_Silent_p.T543T			P20929	NEBU_HUMAN	nebulin	543					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAAAAGCAGGAGTATCAGGGG	0.383																																																	0													126.0	124.0	124.0					2																	152552137		1920	4128	6048	SO:0001819	synonymous_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1629T>A	2.37:g.152552137A>T		Somatic		WXS	SOLID	Phase_I	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																					0.383	NEB-201	KNOWN	basic	protein_coding	protein_coding			NM_004543	
NRK	203447	hgsc.bcm.edu;ucsc.edu	37	X	105132390	105132390	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chrX:105132390C>G	ENST00000243300.9	+	5	659	c.356C>G	c.(355-357)cCt>cGt	p.P119R	NRK_ENST00000428173.2_Missense_Mutation_p.P119R|NRK_ENST00000536164.1_Missense_Mutation_p.P119R	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CTGAGTCCCCCTGGTCAGCGG	0.398										HNSCC(51;0.14)																																							0													110.0	86.0	94.0					X																	105132390		1877	4101	5978	SO:0001583	missense	203447			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.356C>G	X.37:g.105132390C>G	ENSP00000434830:p.Pro119Arg	Somatic		WXS	SOLID	Phase_I	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	C	18.06	3.540307	0.65085	.	.	ENSG00000123572	ENST00000243300;ENST00000428173;ENST00000536164	T;T;T	0.79033	-1.22;-1.23;0.81	5.1	4.22	0.49857	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.355441	0.20791	N	0.085609	T	0.73892	0.3645	N	0.12887	0.27	0.80722	D	1	D	0.58970	0.984	P	0.60541	0.876	T	0.76828	-0.2815	10	0.62326	D	0.03	.	11.0482	0.47872	0.0:0.9057:0.0:0.0943	.	119	Q7Z2Y5	NRK_HUMAN	R	119	ENSP00000434830:P119R;ENSP00000438378:P119R;ENSP00000438785:P119R	ENSP00000434830:P119R	P	+	2	0	NRK	105019046	0.983000	0.35010	0.997000	0.53966	0.996000	0.88848	3.928000	0.56506	2.241000	0.73720	0.594000	0.82650	CCT		0.398	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6		NM_198465	
OBSL1	23363	hgsc.bcm.edu	37	2	220431631	220431631	+	Silent	SNP	G	G	T	rs1043537	byFrequency	TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:220431631G>T	ENST00000404537.1	-	5	2111	c.2055C>A	c.(2053-2055)gcC>gcA	p.A685A	OBSL1_ENST00000265318.4_Silent_p.A685A|OBSL1_ENST00000603926.1_Silent_p.A685A|OBSL1_ENST00000373873.4_Silent_p.A685A|OBSL1_ENST00000373876.1_Silent_p.A685A|OBSL1_ENST00000289656.3_Silent_p.A272A	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	685					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGTGCTTGACGGCATGCAGGA	0.632													G|||	856	0.170927	0.0439	0.2003	5008	,	,		19484	0.1151		0.2425	False		,,,				2504	0.3057																0								G	,,	336,3798		8,320,1739	51.0	56.0	55.0		2055,2055,2055	-9.8	0.0	2	dbSNP_86	55	2110,6292		272,1566,2363	no	coding-synonymous,coding-synonymous,coding-synonymous	OBSL1	NM_001173408.1,NM_001173431.1,NM_015311.2	,,	280,1886,4102	TT,TG,GG		25.1131,8.1277,19.5118	,,	685/1026,685/1544,685/1897	220431631	2446,10090	2067	4201	6268	SO:0001819	synonymous_variant	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2055C>A	2.37:g.220431631G>T		Somatic		WXS	SOLID	Phase_I	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	ENST00000404537.1	37	CCDS46520.1																																																																																				0.632	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1			
PES1	23481	hgsc.bcm.edu;ucsc.edu	37	22	30983297	30983299	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr22:30983297_30983299delTTG	ENST00000354694.7	-	4	448_450	c.342_344delCAA	c.(340-345)tacaaa>taa	p.114_115YK>*	PES1_ENST00000335214.6_In_Frame_Del_p.114_115YK>*|PES1_ENST00000405677.1_5'UTR|PES1_ENST00000402284.3_In_Frame_Del_p.114_115YK>*|PES1_ENST00000402281.1_5'UTR	NM_001243225.1|NM_014303.3	NP_001230154.1|NP_055118.1			pescadillo ribosomal biogenesis factor 1											breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						GTGGTCGAGTTTGTAGTTGGGCT	0.498																																																	0																																										SO:0001651	inframe_deletion	23481			U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000354694.7:c.342_344delCAA	22.37:g.30983297_30983299delTTG	ENSP00000346725:p.Tyr114_Lys115delins*	Somatic		WXS	SOLID	Phase_I		In_Frame_Del	DEL	ENST00000354694.7	37	CCDS13880.1																																																																																				0.498	PES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321188.3		NM_014303	
PRF1	5551	hgsc.bcm.edu;ucsc.edu	37	10	72357903	72357903	+	Missense_Mutation	SNP	C	C	T	rs141702424		TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr10:72357903C>T	ENST00000441259.1	-	3	1734	c.1574G>A	c.(1573-1575)tGc>tAc	p.C525Y	PRF1_ENST00000373209.2_Missense_Mutation_p.C525Y	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	525					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						GTGGGGCAAGCACCTGGCATG	0.587			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																														yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0			GRCh37	CM080512	PRF1	M	rs141702424	C	TYR/CYS,TYR/CYS	0,4406		0,0,2203	103.0	97.0	99.0		1574,1574	6.0	0.1	10	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PRF1	NM_001083116.1,NM_005041.4	194,194	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	525/556,525/556	72357903	1,13005	2203	4300	6503	SO:0001583	missense	5551	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1574G>A	10.37:g.72357903C>T	ENSP00000398568:p.Cys525Tyr	Somatic		WXS	SOLID	Phase_I	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	37	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244747	0.79912	0.0	1.16E-4	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.97378	-4.36;-4.36	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.98692	0.9561	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99466	1.0944	10	0.87932	D	0	-44.4699	17.9177	0.88957	0.0:1.0:0.0:0.0	.	525	P14222	PERF_HUMAN	Y	525	ENSP00000362305:C525Y;ENSP00000398568:C525Y	ENSP00000316746:C525Y	C	-	2	0	PRF1	72027909	1.000000	0.71417	0.149000	0.22428	0.003000	0.03518	6.524000	0.73791	2.828000	0.97474	0.655000	0.94253	TGC		0.587	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2		NM_005041	
PROCR	10544	hgsc.bcm.edu	37	20	33764031	33764031	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr20:33764031A>T	ENST00000216968.4	+	3	465	c.383A>T	c.(382-384)cAt>cTt	p.H128L	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	128					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	TCTAGAGCCCATGTCTTCTTC	0.602																																																	0													81.0	82.0	82.0					20																	33764031		2203	4300	6503	SO:0001583	missense	10544			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.383A>T	20.37:g.33764031A>T	ENSP00000216968:p.His128Leu	Somatic		WXS	SOLID	Phase_I	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	ENST00000216968.4	37	CCDS13248.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.332982	0.60853	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	T	0.00672	5.89	5.61	-4.11	0.03928	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.020640	0.07782	N	0.953481	T	0.01835	0.0058	M	0.76838	2.35	0.09310	N	0.999998	P	0.48350	0.909	P	0.45099	0.469	T	0.11084	-1.0602	10	0.72032	D	0.01	-5.048	12.9208	0.58230	0.4238:0.0:0.5762:0.0	.	128	Q9UNN8	EPCR_HUMAN	L	128	ENSP00000216968:H128L	ENSP00000216968:H128L	H	+	2	0	PROCR	33227692	0.000000	0.05858	0.001000	0.08648	0.931000	0.56810	-1.118000	0.03280	-1.210000	0.02627	0.459000	0.35465	CAT		0.602	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078843.3			
PTGS1	5742	hgsc.bcm.edu;ucsc.edu	37	9	125140798	125140798	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr9:125140798G>T	ENST00000362012.2	+	4	303	c.298G>T	c.(298-300)Gag>Tag	p.E100*	PTGS1_ENST00000373698.5_5'UTR|PTGS1_ENST00000223423.4_Nonsense_Mutation_p.E100*|PTGS1_ENST00000540753.1_Nonsense_Mutation_p.E75*	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	100					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGGTTCTGGGAGTTTGTCAA	0.632																																																	0													73.0	73.0	73.0					9																	125140798		2203	4300	6503	SO:0001587	stop_gained	5742			M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.298G>T	9.37:g.125140798G>T	ENSP00000354612:p.Glu100*	Somatic		WXS	SOLID	Phase_I	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Nonsense_Mutation	SNP	ENST00000362012.2	37	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	G	35	5.592948	0.96602	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000426608	.	.	.	5.68	3.82	0.43975	.	0.179894	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-15.2044	11.8864	0.52604	0.1276:0.0:0.8724:0.0	.	.	.	.	X	75;100;100;58	.	ENSP00000223423:E100X	E	+	1	0	PTGS1	124180619	0.880000	0.30214	1.000000	0.80357	0.986000	0.74619	0.131000	0.15870	2.677000	0.91161	0.563000	0.77884	GAG		0.632	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1			
RIMBP3B	440804	hgsc.bcm.edu	37	22	21742389	21742389	+	Silent	SNP	G	G	C	rs202011105		TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr22:21742389G>C	ENST00000434111.1	+	1	4727	c.4242G>C	c.(4240-4242)gtG>gtC	p.V1414V	SCARNA18_ENST00000516505.1_RNA|RN7SKP63_ENST00000363187.1_RNA|SCARNA17_ENST00000516211.1_RNA	NM_001128635.1	NP_001122107.1	A6NNM3	RIM3B_HUMAN	RIMS binding protein 3B	1414																	CTCTGGGGGTGAAGAGAGGGT	0.642																																																	0																																										SO:0001819	synonymous_variant	440804				CCDS46668.1	22q11.21	2008-10-23			ENSG00000196934	ENSG00000274600			33891	protein-coding gene	gene with protein product		612700				17855024	Standard	NM_001128635		Approved			A6NNM3	OTTHUMG00000150819	ENST00000434111.1:c.4242G>C	22.37:g.21742389G>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000434111.1	37	CCDS46668.1																																																																																				0.642	RIMBP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320196.2		XM_036936	
SEMA4C	54910	hgsc.bcm.edu	37	2	97526749	97526749	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:97526749C>A	ENST00000305476.5	-	15	2248	c.2116G>T	c.(2116-2118)Gtg>Ttg	p.V706L	ANKRD39_ENST00000393537.4_5'Flank	NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	706					cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						AGGGGGTACACCAAGGTCCTC	0.622																																																	0													26.0	31.0	30.0					2																	97526749		2203	4298	6501	SO:0001583	missense	54910			AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.2116G>T	2.37:g.97526749C>A	ENSP00000306844:p.Val706Leu	Somatic		WXS	SOLID	Phase_I	Q32MJ3|Q7Z5X0	Missense_Mutation	SNP	ENST00000305476.5	37	CCDS2029.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885388	0.72410	.	.	ENSG00000168758	ENST00000305476	T	0.77358	-1.09	4.98	4.98	0.66077	.	0.546751	0.19482	N	0.113194	T	0.80401	0.4616	L	0.27053	0.805	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.999	D;D;D	0.76071	0.978;0.987;0.987	T	0.74694	-0.3579	10	0.15952	T	0.53	.	17.1884	0.86872	0.0:1.0:0.0:0.0	.	706;416;247	Q9C0C4;Q6P5A5;Q71RG3	SEM4C_HUMAN;.;.	L	706	ENSP00000306844:V706L	ENSP00000306844:V706L	V	-	1	0	SEMA4C	96890476	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	4.301000	0.59086	2.579000	0.87056	0.561000	0.74099	GTG		0.622	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1		NM_017789	
SNTG1	54212	hgsc.bcm.edu;ucsc.edu	37	8	51705388	51705388	+	Nonstop_Mutation	SNP	G	G	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr8:51705388G>T	ENST00000522124.1	+	19	2214	c.1553G>T	c.(1552-1554)tGa>tTa	p.*518L	SNTG1_ENST00000276467.5_Nonstop_Mutation_p.*481L|SNTG1_ENST00000517473.1_Nonstop_Mutation_p.*481L|SNTG1_ENST00000518864.1_Nonstop_Mutation_p.*518L	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	0					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TATACAACTTGACATACTGAA	0.433																																																	0													131.0	122.0	125.0					8																	51705388		2203	4300	6503	SO:0001578	stop_lost	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1553G>T	8.37:g.51705388G>T	ENSP00000429842:p.*518Leuext*58	Somatic		WXS	SOLID	Phase_I	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762139	0.49468	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5303	0.50604	0.0821:0.0:0.9179:0.0	.	.	.	.	L	518;518;481;481	.	.	X	+	2	2	SNTG1	51867941	1.000000	0.71417	0.595000	0.28798	0.081000	0.17604	6.410000	0.73294	2.497000	0.84241	0.573000	0.79308	TGA		0.433	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			
SYNE1	23345	hgsc.bcm.edu;ucsc.edu	37	6	152716701	152716701	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr6:152716701T>G	ENST00000367255.5	-	51	8263	c.7662A>C	c.(7660-7662)aaA>aaC	p.K2554N	SYNE1_ENST00000341594.5_Missense_Mutation_p.K2593N|SYNE1_ENST00000265368.4_Missense_Mutation_p.K2554N|SYNE1_ENST00000423061.1_Missense_Mutation_p.K2561N|SYNE1_ENST00000448038.1_Missense_Mutation_p.K2561N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2554					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAACTTCATTTTTCTTCTCAG	0.393										HNSCC(10;0.0054)																																							0													174.0	165.0	168.0					6																	152716701		2203	4300	6503	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.7662A>C	6.37:g.152716701T>G	ENSP00000356224:p.Lys2554Asn	Somatic		WXS	SOLID	Phase_I	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	16.02	3.004872	0.54254	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	5.56	3.11	0.35812	.	0.000000	0.64402	D	0.000005	T	0.34978	0.0916	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.76494	0.999;0.972;0.972;0.991	D;P;P;P	0.63488	0.915;0.635;0.635;0.799	T	0.11567	-1.0582	10	0.25751	T	0.34	.	9.1187	0.36773	0.0:0.2104:0.0:0.7896	.	2537;2554;2554;2561	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	N	2554;2561;2554;2561;2593	ENSP00000356224:K2554N;ENSP00000396024:K2561N;ENSP00000265368:K2554N;ENSP00000390975:K2561N;ENSP00000341887:K2593N	ENSP00000265368:K2554N	K	-	3	2	SYNE1	152758394	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.099000	0.31013	0.369000	0.24510	0.533000	0.62120	AAA		0.393	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2		NM_182961	
TLR9	54106	hgsc.bcm.edu;ucsc.edu	37	3	52256548	52256548	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr3:52256548A>T	ENST00000360658.2	-	2	2417	c.1784T>A	c.(1783-1785)cTc>cAc	p.L595H	TLR9_ENST00000597542.1_Missense_Mutation_p.L619H|TLR9_ENST00000494383.1_Silent_p.A748A	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	595					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CGTACTGCAGAGCTGCTGGGA	0.632																																																	0													51.0	46.0	48.0					3																	52256548		2203	4300	6503	SO:0001583	missense	54106			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1784T>A	3.37:g.52256548A>T	ENSP00000353874:p.Leu595His	Somatic		WXS	SOLID	Phase_I	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083657	0.55861	.	.	ENSG00000239732	ENST00000360658	D	0.84070	-1.8	5.54	5.54	0.83059	.	0.000000	0.37053	N	0.002278	D	0.91192	0.7225	M	0.82630	2.6	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.92385	0.5916	10	0.87932	D	0	.	13.6148	0.62101	1.0:0.0:0.0:0.0	.	692;595	B4E0A1;Q9NR96	.;TLR9_HUMAN	H	595	ENSP00000353874:L595H	ENSP00000353874:L595H	L	-	2	0	TLR9	52231588	1.000000	0.71417	0.659000	0.29680	0.211000	0.24417	7.823000	0.86660	2.103000	0.63969	0.459000	0.35465	CTC		0.632	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1			
TMEM179	388021	hgsc.bcm.edu;ucsc.edu	37	14	105061450	105061450	+	Intron	SNP	A	A	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr14:105061450A>C	ENST00000556573.1	-	3	764				TMEM179_ENST00000341595.3_Missense_Mutation_p.L192V			Q6ZVK1	T179A_HUMAN	transmembrane protein 179							integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		TCCAGCAGTAAATGGCCCCCT	0.587																																																	0													69.0	61.0	64.0					14																	105061450		2203	4300	6503	SO:0001627	intron_variant	388021			AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.522+51T>G	14.37:g.105061450A>C		Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000556573.1	37		.	.	.	.	.	.	.	.	.	.	A	13.29	2.193927	0.38707	.	.	ENSG00000258986	ENST00000341595	.	.	.	2.44	2.44	0.29823	.	0.000000	0.64402	U	0.000005	T	0.29749	0.0743	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.27331	-1.0077	8	0.87932	D	0	.	6.7764	0.23622	1.0:0.0:0.0:0.0	.	192	Q6ZVK1-2	.	V	192	.	ENSP00000340477:L192V	L	-	1	2	TMEM179	104132495	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.324000	0.19610	0.858000	0.35431	0.374000	0.22700	TTA		0.587	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410585.1		NM_207379	
TPO	7173	hgsc.bcm.edu	37	2	1500518	1500518	+	Silent	SNP	C	C	T			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr2:1500518C>T	ENST00000345913.4	+	13	2458	c.2367C>T	c.(2365-2367)ttC>ttT	p.F789F	TPO_ENST00000382198.1_Silent_p.F616F|TPO_ENST00000329066.4_Silent_p.F789F|TPO_ENST00000382201.3_Silent_p.F732F|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Silent_p.F789F|TPO_ENST00000346956.3_Silent_p.F789F|TPO_ENST00000349624.3_Silent_p.F616F	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	789	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GATGGGATTTCCAGCCTCCCC	0.493																																																	0													126.0	124.0	125.0					2																	1500518		2203	4300	6503	SO:0001819	synonymous_variant	7173				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2367C>T	2.37:g.1500518C>T		Somatic		WXS	SOLID	Phase_I	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.469126	0.01053	.	.	ENSG00000115705	ENST00000446278	.	.	.	5.14	1.03	0.20045	.	.	.	.	.	T	0.24198	0.0586	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21793	-1.0235	4	.	.	.	-1.872	4.2682	0.10773	0.2972:0.4845:0.0:0.2183	.	.	.	.	F	264	.	.	S	+	2	0	TPO	1479525	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	-0.136000	0.10405	0.644000	0.30656	0.591000	0.81541	TCC		0.493	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2		NM_000547	
ZDHHC1	29800	hgsc.bcm.edu	37	16	67428940	67428940	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr16:67428940T>A	ENST00000348579.2	-	10	1536	c.1195A>T	c.(1195-1197)Aag>Tag	p.K399*	TPPP3_ENST00000290942.5_5'Flank|TPPP3_ENST00000562206.1_5'Flank|ZDHHC1_ENST00000566075.1_5'UTR|TPPP3_ENST00000393957.2_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	399					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CGTTCGCACTTTATACACGCG	0.627																																																	0													22.0	27.0	25.0					16																	67428940		2197	4300	6497	SO:0001587	stop_gained	29800			U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1195A>T	16.37:g.67428940T>A	ENSP00000340299:p.Lys399*	Somatic		WXS	SOLID	Phase_I	O15461	Nonsense_Mutation	SNP	ENST00000348579.2	37	CCDS10836.1	.	.	.	.	.	.	.	.	.	.	T	36	5.798216	0.96952	.	.	ENSG00000159714	ENST00000348579	.	.	.	3.9	2.8	0.32819	.	10.119200	0.01542	U	0.019280	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4082	0.16332	0.0:0.1356:0.0:0.8644	.	.	.	.	X	399	.	ENSP00000340299:K399X	K	-	1	0	ZDHHC1	65986441	1.000000	0.71417	0.394000	0.26270	0.015000	0.08874	1.436000	0.34980	0.682000	0.31407	0.459000	0.35465	AAG		0.627	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268845.1		NM_013304	
ZNF33B	7582	hgsc.bcm.edu	37	10	43088537	43088537	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr10:43088537T>C	ENST00000359467.3	-	5	1975	c.1861A>G	c.(1861-1863)Aag>Gag	p.K621E	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						AGTTGTGACTTCTGGCAGAAG	0.363																																					Melanoma(137;1247 1767 16772 25727 43810)												0													96.0	96.0	96.0					10																	43088537		2203	4300	6503	SO:0001583	missense	7582			X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1861A>G	10.37:g.43088537T>C	ENSP00000352444:p.Lys621Glu	Somatic		WXS	SOLID	Phase_I	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.215778	0.39102	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.00958	5.5	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35646	N	0.003071	T	0.02455	0.0075	L	0.44542	1.39	0.09310	N	0.999999	D	0.69078	0.997	D	0.70016	0.967	T	0.46925	-0.9156	10	0.37606	T	0.19	.	9.025	0.36224	0.0:0.0:0.0:1.0	.	621	Q06732	ZN33B_HUMAN	E	621;587	ENSP00000352444:K621E	ENSP00000352444:K621E	K	-	1	0	ZNF33B	42408543	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	0.848000	0.27710	1.446000	0.47643	0.336000	0.21669	AAG		0.363	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_006955	
HMCN1	83872	ucsc.edu	37	1	185958692	185958692	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4174-01A-02D-1366-10	TCGA-BP-4174-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	17bc5432-4fe4-4b0b-a99f-760bee5b9d15	65b270c5-362f-4159-9372-96a1abc44391	g.chr1:185958692C>A	ENST00000271588.4	+	21	3350	c.3121C>A	c.(3121-3123)Cct>Act	p.P1041T	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Missense_Mutation_p.P1041T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1041	Ig-like C2-type 7.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGTGGTATCACCTGGAGGAGA	0.507																																						.											0													122.0	110.0	114.0					1																	185958692		2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3121C>A	1.37:g.185958692C>A	ENSP00000271588:p.Pro1041Thr	Somatic		WXS	SOLID	.	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298858	0.81025	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66099	-0.19;-0.19	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	N	0.15975	0.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65446	-0.6166	10	0.27082	T	0.32	.	19.3079	0.94171	0.0:1.0:0.0:0.0	.	425;1041	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	T	1041	ENSP00000271588:P1041T;ENSP00000356462:P1041T	ENSP00000271588:P1041T	P	+	1	0	HMCN1	184225315	1.000000	0.71417	0.491000	0.27477	0.704000	0.40688	5.400000	0.66320	2.550000	0.86006	0.655000	0.94253	CCT		0.507	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
