#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTSL3	57188	hgsc.bcm.edu;ucsc.edu	37	15	84651469	84651469	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr15:84651469G>T	ENST00000286744.5	+	21	3313	c.3089G>T	c.(3088-3090)tGg>tTg	p.W1030L	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.W1030L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1030						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGAGTCACATGGCACAAAATG	0.498																																																	0													82.0	80.0	80.0					15																	84651469		2203	4300	6503	SO:0001583	missense	57188			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3089G>T	15.37:g.84651469G>T	ENSP00000286744:p.Trp1030Leu	Somatic		WXS	SOLID	Phase_I	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701534	0.48307	.	.	ENSG00000156218	ENST00000286744	T	0.62639	0.01	5.18	5.18	0.71444	.	0.627741	0.13329	N	0.396102	T	0.79423	0.4443	M	0.66939	2.045	0.54753	D	0.999984	P;D	0.89917	0.941;1.0	P;D	0.83275	0.74;0.996	T	0.77789	-0.2456	10	0.49607	T	0.09	.	18.7118	0.91659	0.0:0.0:1.0:0.0	.	1030;1030	P82987-2;P82987	.;ATL3_HUMAN	L	1030	ENSP00000286744:W1030L	ENSP00000286744:W1030L	W	+	2	0	ADAMTSL3	82442473	1.000000	0.71417	0.994000	0.49952	0.245000	0.25701	5.771000	0.68881	2.406000	0.81754	0.563000	0.77884	TGG		0.498	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2		NM_207517	
ARID4B	51742	hgsc.bcm.edu	37	1	235345429	235345429	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr1:235345429C>T	ENST00000264183.3	-	20	3302	c.2805G>A	c.(2803-2805)tgG>tgA	p.W935*	ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000349213.3_Nonsense_Mutation_p.W849*|ARID4B_ENST00000366603.2_Nonsense_Mutation_p.W935*	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	935					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.W935*(2)		NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTTTTTTAGGCCACTGTCCCT	0.463																																																	2	Substitution - Nonsense(2)	ovary(2)											65.0	69.0	68.0					1																	235345429		2203	4300	6503	SO:0001587	stop_gained	51742			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2805G>A	1.37:g.235345429C>T	ENSP00000264183:p.Trp935*	Somatic		WXS	SOLID	Phase_I	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Nonsense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.628944|4.628944	0.87560|0.87560	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|.	.|.	.|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.76343|.	0.3974|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.76971|.	-0.2761|.	3|.	.|0.51188	.|T	.|0.08	-4.2182|-4.2182	18.7115|18.7115	0.91658|0.91658	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	335|935;849;935;935	.|.	.|ENSP00000264183:W935X	G|W	-|-	2|3	0|0	ARID4B|ARID4B	233412052|233412052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.763000|0.763000	0.43281|0.43281	7.320000|7.320000	0.79064|0.79064	2.654000|2.654000	0.90174|0.90174	0.585000|0.585000	0.79938|0.79938	GGC|TGG		0.463	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3		NM_016374	
ATP11C	286410	hgsc.bcm.edu;ucsc.edu	37	X	138908947	138908947	+	Silent	SNP	T	T	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chrX:138908947T>C	ENST00000327569.3	-	2	170	c.72A>G	c.(70-72)acA>acG	p.T24T	ATP11C_ENST00000359686.2_Silent_p.T24T|ATP11C_ENST00000361648.2_Silent_p.T24T|ATP11C_ENST00000370557.1_Silent_p.T21T|ATP11C_ENST00000370543.1_Silent_p.T24T	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	24					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T24T(2)|p.T24fs*21(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					CAACAAACACTGTGCGTGTGC	0.388																																																	3	Substitution - coding silent(2)|Deletion - Frameshift(1)	lung(3)											142.0	118.0	126.0					X																	138908947		2203	4300	6503	SO:0001819	synonymous_variant	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.72A>G	X.37:g.138908947T>C		Somatic		WXS	SOLID	Phase_I	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Silent	SNP	ENST00000327569.3	37	CCDS14668.1																																																																																				0.388	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1		NM_173694	
ATP2A2	488	hgsc.bcm.edu;ucsc.edu	37	12	110778740	110778740	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr12:110778740C>A	ENST00000539276.2	+	14	2147	c.2038C>A	c.(2038-2040)Ccc>Acc	p.P680T	ATP2A2_ENST00000308664.6_Missense_Mutation_p.P680T|ATP2A2_ENST00000395494.2_Missense_Mutation_p.P653T			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	680					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TCGAGTTGAACCCTCCCACAA	0.498																																																	0													55.0	56.0	55.0					12																	110778740		2203	4300	6503	SO:0001583	missense	488				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2038C>A	12.37:g.110778740C>A	ENSP00000440045:p.Pro680Thr	Somatic		WXS	SOLID	Phase_I	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	CCDS9144.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.088293|5.088293	0.94100|0.94100	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276|ENST00000548169	D;D;D|.	0.98987|.	-5.3;-5.3;-5.3|.	5.81|5.81	5.81|5.81	0.92471|0.92471	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.92312|0.92312	0.7561|0.7561	H|H	0.99770|0.99770	4.765|4.765	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.996;0.998|.	D|D	0.95346|0.95346	0.8442|0.8442	10|5	0.87932|.	D|.	0|.	.|.	20.0784|20.0784	0.97758|0.97758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	653;680;680|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	T|N	680;653;680|570	ENSP00000311186:P680T;ENSP00000378872:P653T;ENSP00000440045:P680T|.	ENSP00000311186:P680T|.	P|T	+|+	1|2	0|0	ATP2A2|ATP2A2	109263123|109263123	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.990000|0.990000	0.78478|0.78478	7.818000|7.818000	0.86416|0.86416	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	CCC|ACC		0.498	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1		NM_001681	
CLTC	1213	hgsc.bcm.edu;ucsc.edu	37	17	57763155	57763155	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr17:57763155G>A	ENST00000269122.3	+	30	5087	c.4813G>A	c.(4813-4815)Gag>Aag	p.E1605K	CLTC_ENST00000579456.1_Missense_Mutation_p.E542K|CLTC_ENST00000393043.1_Missense_Mutation_p.E1605K	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1605	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GGTCATGAAGGAGTACTTGAC	0.368			T	"""ALK, TFE3"""	"""ALCL, renal """																																			Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													130.0	118.0	122.0					17																	57763155		2203	4300	6503	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.4813G>A	17.37:g.57763155G>A	ENSP00000269122:p.Glu1605Lys	Somatic		WXS	SOLID	Phase_I	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496267	0.85069	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.32988	1.43;1.43	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.60650	0.2285	M	0.88241	2.94	0.80722	D	1	B;B	0.31413	0.207;0.322	B;P	0.49332	0.124;0.607	T	0.65442	-0.6167	10	0.87932	D	0	.	19.1348	0.93422	0.0:0.0:1.0:0.0	.	1605;1605	Q00610;Q00610-2	CLH1_HUMAN;.	K	1605	ENSP00000269122:E1605K;ENSP00000376763:E1605K	ENSP00000269122:E1605K	E	+	1	0	CLTC	55117937	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.594000	0.87642	0.585000	0.79938	GAG		0.368	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1		NM_004859	
COPB1	1315	hgsc.bcm.edu	37	11	14520433	14520433	+	Silent	SNP	C	C	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr11:14520433C>T	ENST00000249923.3	-	2	342	c.42G>A	c.(40-42)gtG>gtA	p.V14V	PSMA1_ENST00000555531.1_3'UTR|PSMA1_ENST00000419365.2_3'UTR|COPB1_ENST00000439561.2_Silent_p.V14V	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	14					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						AATCCATTGGCACGTTAATTA	0.333																																																	0													89.0	88.0	88.0					11																	14520433		2200	4294	6494	SO:0001819	synonymous_variant	1315			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.42G>A	11.37:g.14520433C>T		Somatic		WXS	SOLID	Phase_I	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Silent	SNP	ENST00000249923.3	37	CCDS7815.1																																																																																				0.333	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1		NM_016451	
CREBBP	1387	hgsc.bcm.edu	37	16	3807365	3807365	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr16:3807365G>T	ENST00000262367.5	-	19	4431	c.3622C>A	c.(3622-3624)Cca>Aca	p.P1208T	CREBBP_ENST00000382070.3_Missense_Mutation_p.P1170T	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1208	Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AAAGTCTGTGGGGAAAACTCA	0.388			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													54.0	49.0	51.0					16																	3807365		2197	4300	6497	SO:0001583	missense	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3622C>A	16.37:g.3807365G>T	ENSP00000262367:p.Pro1208Thr	Somatic		WXS	SOLID	Phase_I	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100575	0.56183	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.88431	-2.38;-2.31	6.04	6.04	0.98038	Domain of unknown function DUF902, CREBbp (1);	0.000000	0.85682	D	0.000000	D	0.94679	0.8284	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94043	0.7311	10	0.62326	D	0.03	-17.7344	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1238;1208	Q4LE28;Q92793	.;CBP_HUMAN	T	1208;1238;1170	ENSP00000262367:P1208T;ENSP00000371502:P1170T	ENSP00000262367:P1208T	P	-	1	0	CREBBP	3747366	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.813000	0.99286	2.873000	0.98535	0.563000	0.77884	CCA		0.388	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2		NM_004380	
CYFIP2	26999	hgsc.bcm.edu;ucsc.edu	37	5	156742017	156742017	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr5:156742017A>G	ENST00000521420.1	+	12	1284	c.1193A>G	c.(1192-1194)aAc>aGc	p.N398S	CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000435847.2_Missense_Mutation_p.N98S|CYFIP2_ENST00000318218.6_Missense_Mutation_p.N424S|CYFIP2_ENST00000522463.1_Missense_Mutation_p.N228S|CYFIP2_ENST00000347377.6_Missense_Mutation_p.N424S|CYFIP2_ENST00000377576.3_Missense_Mutation_p.N424S|CYFIP2_ENST00000541131.1_Missense_Mutation_p.N349S					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGTTCTGCAACAAGGACTGT	0.498																																																	0													58.0	58.0	58.0					5																	156742017		2032	4193	6225	SO:0001583	missense	26999			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.1193A>G	5.37:g.156742017A>G	ENSP00000430904:p.Asn398Ser	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000521420.1	37		.	.	.	.	.	.	.	.	.	.	A	27.3	4.815901	0.90790	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	L	0.60455	1.87	0.80722	D	1	B;B;D;D;P;P	0.63046	0.142;0.45;0.975;0.992;0.858;0.646	B;B;P;P;P;P	0.61722	0.099;0.394;0.739;0.889;0.577;0.893	T	0.44221	-0.9342	10	0.45353	T	0.12	-37.4899	15.578	0.76408	1.0:0.0:0.0:0.0	.	288;228;398;424;424;424	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	S	424;228;398;424;424;349;98	ENSP00000325817:N424S;ENSP00000428009:N228S;ENSP00000430904:N398S;ENSP00000313567:N424S;ENSP00000366799:N424S;ENSP00000444645:N349S;ENSP00000403793:N98S	ENSP00000325817:N424S	N	+	2	0	CYFIP2	156674595	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.230000	0.95299	2.085000	0.62840	0.459000	0.35465	AAC		0.498	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1		NM_001037332	
DBI	1622	hgsc.bcm.edu	37	2	120128350	120128350	+	Silent	SNP	C	C	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr2:120128350C>A	ENST00000355857.3	+	3	293	c.162C>A	c.(160-162)gcC>gcA	p.A54A	DBI_ENST00000409094.1_Silent_p.A71A|DBI_ENST00000535617.1_Silent_p.A96A|DBI_ENST00000311521.4_Silent_p.A71A|DBI_ENST00000393103.2_Silent_p.A55A|DBI_ENST00000535757.1_Silent_p.A71A|DBI_ENST00000460901.1_3'UTR|DBI_ENST00000542275.1_Silent_p.A115A	NM_001079862.1|NM_001178043.1	NP_001073331.1|NP_001171514.1	P07108	ACBP_HUMAN	diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)	54	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				hair follicle development (GO:0001942)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|transport (GO:0006810)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear endoplasmic reticulum (GO:0097038)	benzodiazepine receptor binding (GO:0030156)|lipid binding (GO:0008289)|long-chain fatty acyl-CoA binding (GO:0036042)|protein dimerization activity (GO:0046983)			kidney(1)|lung(4)|skin(1)	6						CGGGCAAGGCCAAGTGGGATG	0.423																																																	0													75.0	72.0	73.0					2																	120128350		2203	4300	6503	SO:0001819	synonymous_variant	1622			L76366	CCDS2126.1, CCDS42740.1, CCDS42741.1, CCDS74568.1	2q12-q21	2010-10-20	2010-04-30		ENSG00000155368	ENSG00000155368			2690	protein-coding gene	gene with protein product	"""endozepine"""	125950	"""diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)"""			1440058	Standard	NM_001079863		Approved	ACBP, ACBD1	uc021vnj.1	P07108	OTTHUMG00000131403	ENST00000355857.3:c.162C>A	2.37:g.120128350C>A		Somatic		WXS	SOLID	Phase_I	B8ZWD2|B8ZWD6|B8ZWD7|P08869|Q4VWZ6|Q53SQ7|Q6IB48|Q9UCI8	Silent	SNP	ENST00000355857.3	37	CCDS42740.1																																																																																				0.423	DBI-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330590.1		NM_020548	
DBX1	120237	hgsc.bcm.edu	37	11	20177783	20177783	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr11:20177783G>A	ENST00000524983.2	-	4	1297	c.1009C>T	c.(1009-1011)Cag>Tag	p.Q337*	DBX1_ENST00000227256.3_Nonsense_Mutation_p.Q376*			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	337	Poly-Glu.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						ATTTCCTCCTGTTCCTCGCCC	0.597																																																	0													150.0	168.0	161.0					11																	20177783		2203	4300	6503	SO:0001587	stop_gained	120237					11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.1009C>T	11.37:g.20177783G>A	ENSP00000436881:p.Gln337*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000524983.2	37		.	.	.	.	.	.	.	.	.	.	G	28.9	4.962900	0.92791	.	.	ENSG00000109851	ENST00000524983;ENST00000227256	.	.	.	5.33	4.42	0.53409	.	0.395806	0.22688	N	0.056845	.	.	.	.	.	.	0.43149	D	0.994911	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-16.3187	15.1685	0.72850	0.0:0.8577:0.1423:0.0	.	.	.	.	X	337;376	.	ENSP00000227256:Q376X	Q	-	1	0	DBX1	20134359	0.763000	0.28462	0.754000	0.31244	0.205000	0.24178	2.056000	0.41355	1.255000	0.44051	-0.128000	0.14901	CAG		0.597	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387585.2		NM_001029865	
DFNB31	25861	hgsc.bcm.edu	37	9	117165103	117165103	+	Silent	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr9:117165103G>T	ENST00000362057.3	-	12	2823	c.2655C>A	c.(2653-2655)gcC>gcA	p.A885A	DFNB31_ENST00000374059.3_Silent_p.A534A|DFNB31_ENST00000265134.6_Silent_p.A502A	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	885	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGAAGGCCTCGGCGATAATGC	0.587																																																	0													70.0	64.0	67.0					9																	117165103		2203	4300	6503	SO:0001819	synonymous_variant	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2655C>A	9.37:g.117165103G>T		Somatic		WXS	SOLID	Phase_I	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	ENST00000362057.3	37	CCDS6806.1																																																																																				0.587	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2		NM_015404	
ETV3L	440695	hgsc.bcm.edu	37	1	157062696	157062696	+	Silent	SNP	G	G	T	rs1176537	byFrequency	TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr1:157062696G>T	ENST00000454449.2	-	5	1115	c.831C>A	c.(829-831)ctC>ctA	p.L277L		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	277	Pro-rich.				cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				AGGCCCCTGGGAGGCTCCTAG	0.652													G|||	1121	0.223842	0.0908	0.2637	5008	,	,		16092	0.2381		0.3728	False		,,,				2504	0.2076																0								G		613,3793	255.5+/-260.7	31,551,1621	25.0	29.0	27.0		831	2.8	0.5	1	dbSNP_87	27	3231,5369	457.8+/-364.4	621,1989,1690	no	coding-synonymous	ETV3L	NM_001004341.2		652,2540,3311	TT,TG,GG		37.5698,13.9128,29.5556		277/362	157062696	3844,9162	2203	4300	6503	SO:0001819	synonymous_variant	440695			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.831C>A	1.37:g.157062696G>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000454449.2	37	CCDS30893.1																																																																																				0.652	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2		NM_001004341	
HDLBP	3069	hgsc.bcm.edu;ucsc.edu	37	2	242203956	242203956	+	Silent	SNP	A	A	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr2:242203956A>C	ENST00000391975.1	-	4	368	c.141T>G	c.(139-141)ctT>ctG	p.L47L	HDLBP_ENST00000391976.2_Silent_p.L47L|HDLBP_ENST00000427183.2_Silent_p.L83L|HDLBP_ENST00000310931.4_Silent_p.L47L	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	47					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CTTTCTCAGGAAGTGGAGGGA	0.522																																																	0													158.0	157.0	158.0					2																	242203956		2203	4300	6503	SO:0001819	synonymous_variant	3069				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.141T>G	2.37:g.242203956A>C		Somatic		WXS	SOLID	Phase_I	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Silent	SNP	ENST00000391975.1	37	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	A	5.691	0.312054	0.10789	.	.	ENSG00000115677	ENST00000449864	.	.	.	5.64	-4.82	0.03171	.	.	.	.	.	T	0.58495	0.2126	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63363	-0.6654	5	0.87932	D	0	-18.3814	7.7423	0.28848	0.2604:0.3678:0.3718:0.0	.	.	.	.	C	6	.	ENSP00000396202:F6C	F	-	2	0	HDLBP	241852629	1.000000	0.71417	0.000000	0.03702	0.023000	0.10783	0.680000	0.25306	-0.980000	0.03524	-0.376000	0.06991	TTC		0.522	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5		NM_203346	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056015	26056015	+	Silent	SNP	C	C	T	rs11540003		TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr6:26056015C>T	ENST00000343677.2	-	1	684	c.642G>A	c.(640-642)taG>taA	p.*214*		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	0					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.*214Y(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						AGGCGTTCGCCTATTTCTTCT	0.473																																																	1	Nonstop extension(1)	ovary(1)																																								SO:0001819	synonymous_variant	3006			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.642G>A	6.37:g.26056015C>T		Somatic		WXS	SOLID	Phase_I	A8K4I2	Silent	SNP	ENST00000343677.2	37	CCDS4577.1																																																																																				0.473	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1		NM_005319	
HTRA4	203100	hgsc.bcm.edu;ucsc.edu	37	8	38840017	38840017	+	Splice_Site	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr8:38840017G>T	ENST00000302495.4	+	7	1215	c.1115G>T	c.(1114-1116)gGa>gTa	p.G372V		NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	372					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			TCCTTTCCAGGAAAGGCGTTT	0.433																																																	0													147.0	145.0	146.0					8																	38840017		2203	4300	6503	SO:0001630	splice_region_variant	203100			AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.1115-1G>T	8.37:g.38840017G>T		Somatic		WXS	SOLID	Phase_I	Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.500163	0.44455	.	.	ENSG00000169495	ENST00000302495	T	0.32272	1.46	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000005	T	0.34337	0.0894	L	0.55103	1.725	0.80722	D	1	P	0.45986	0.87	B	0.43194	0.411	T	0.06215	-1.0839	9	.	.	.	.	16.6077	0.84835	0.0:0.0:1.0:0.0	.	372	P83105	HTRA4_HUMAN	V	372	ENSP00000305919:G372V	.	G	+	2	0	HTRA4	38959174	1.000000	0.71417	0.991000	0.47740	0.287000	0.27160	7.519000	0.81809	2.595000	0.87683	0.561000	0.74099	GGA		0.433	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1		NM_153692	Missense_Mutation
IMMT	10989	hgsc.bcm.edu;ucsc.edu	37	2	86406617	86406617	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr2:86406617T>A	ENST00000410111.3	-	3	635	c.248A>T	c.(247-249)gAc>gTc	p.D83V	IMMT_ENST00000449247.2_Missense_Mutation_p.D83V|IMMT_ENST00000254636.5_5'UTR|IMMT_ENST00000442664.2_Missense_Mutation_p.D83V|IMMT_ENST00000409051.2_Missense_Mutation_p.D83V	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	83					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GAAGAGTTTGTCTGAGTAAGG	0.398																																																	0													59.0	56.0	57.0					2																	86406617		1843	4104	5947	SO:0001583	missense	10989			D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.248A>T	2.37:g.86406617T>A	ENSP00000387262:p.Asp83Val	Somatic		WXS	SOLID	Phase_I	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.153184	0.78114	.	.	ENSG00000132305	ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.94	4.94	0.65067	.	0.097205	0.64402	D	0.000002	T	0.53610	0.1807	M	0.67953	2.075	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.995;0.981;0.996;1.0;0.999;0.997;0.995;0.997;0.996	D;D;D;D;D;D;D;D;D	0.91635	0.972;0.924;0.984;0.999;0.992;0.962;0.972;0.962;0.984	T	0.56842	-0.7912	10	0.59425	D	0.04	-16.0134	14.6142	0.68537	0.0:0.0:0.0:1.0	.	83;83;83;83;83;83;83;83;83	F5GZ32;B9A067;B4DKR1;Q05DN3;B4E2B5;F8W9I1;Q16891-2;Q16891-3;Q16891	.;.;.;.;.;.;.;.;IMMT_HUMAN	V	83	ENSP00000396899:D83V;ENSP00000387262:D83V;ENSP00000407788:D83V;ENSP00000387227:D83V	ENSP00000366526:D83V	D	-	2	0	IMMT	86260128	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.606000	0.74159	1.856000	0.53863	0.460000	0.39030	GAC		0.398	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2		NM_006839	
IRAK3	11213	hgsc.bcm.edu;ucsc.edu	37	12	66597547	66597547	+	Missense_Mutation	SNP	C	C	G	rs572325225	byFrequency	TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr12:66597547C>G	ENST00000261233.4	+	2	611	c.190C>G	c.(190-192)Caa>Gaa	p.Q64E	IRAK3_ENST00000457197.2_Intron	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		GTATGTAGACCAAGGTAAAAG	0.418													C|||	2	0.000399361	0.0	0.0	5008	,	,		17494	0.0		0.0	False		,,,				2504	0.002																0													87.0	82.0	84.0					12																	66597547		2203	4300	6503	SO:0001583	missense	11213			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.190C>G	12.37:g.66597547C>G	ENSP00000261233:p.Gln64Glu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000261233.4	37	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582987	0.65992	.	.	ENSG00000090376	ENST00000261233	D	0.85013	-1.93	5.93	5.93	0.95920	Death (3);DEATH-like (2);	0.155482	0.43747	D	0.000534	D	0.90817	0.7116	L	0.61218	1.895	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.89648	0.3867	9	.	.	.	-20.5588	15.8335	0.78778	0.0:1.0:0.0:0.0	.	64	Q9Y616	IRAK3_HUMAN	E	64	ENSP00000261233:Q64E	.	Q	+	1	0	IRAK3	64883814	0.983000	0.35010	0.998000	0.56505	0.408000	0.30992	2.655000	0.46707	2.818000	0.97014	0.591000	0.81541	CAA		0.418	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1			
ITGAM	3684	hgsc.bcm.edu	37	16	31309271	31309271	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr16:31309271G>A	ENST00000287497.8	+	14	1778	c.1703G>A	c.(1702-1704)aGc>aAc	p.S568N	ITGAM_ENST00000544665.3_Missense_Mutation_p.S569N			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	568					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CCCTCCCATAGCCAGGTGAGA	0.552																																																	0													43.0	46.0	45.0					16																	31309271		2193	4298	6491	SO:0001583	missense	3684			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1703G>A	16.37:g.31309271G>A	ENSP00000287497:p.Ser568Asn	Somatic		WXS	SOLID	Phase_I	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452389	0.43531	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.61980	0.06;0.06	3.91	3.91	0.45181	.	.	.	.	.	T	0.80154	0.4571	H	0.97465	4.01	0.40083	D	0.976162	D;D	0.57257	0.979;0.979	P;P	0.51866	0.682;0.682	D	0.86884	0.2044	9	0.72032	D	0.01	.	11.5956	0.50970	0.0:0.0:1.0:0.0	.	568;568	Q4VAK1;P11215	.;ITAM_HUMAN	N	569;568	ENSP00000441691:S569N;ENSP00000287497:S568N	ENSP00000287497:S568N	S	+	2	0	ITGAM	31216772	1.000000	0.71417	1.000000	0.80357	0.205000	0.24178	5.459000	0.66685	2.159000	0.67721	0.655000	0.94253	AGC		0.552	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1		NM_000632	
ITPR2	3709	hgsc.bcm.edu;ucsc.edu	37	12	26589195	26589195	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr12:26589195G>T	ENST00000381340.3	-	48	7144	c.6728C>A	c.(6727-6729)gCt>gAt	p.A2243D		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2243					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GAGAGCAACAGCTAAATTGAT	0.408																																																	0													53.0	55.0	54.0					12																	26589195		1920	4127	6047	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6728C>A	12.37:g.26589195G>T	ENSP00000370744:p.Ala2243Asp	Somatic		WXS	SOLID	Phase_I	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900897	0.72754	.	.	ENSG00000123104	ENST00000381340	D	0.91631	-2.88	4.83	4.83	0.62350	.	0.110325	0.64402	D	0.000010	D	0.90277	0.6959	N	0.22421	0.69	0.80722	D	1	D	0.55605	0.972	P	0.55749	0.783	D	0.90396	0.4399	10	0.59425	D	0.04	.	11.9268	0.52825	0.0793:0.0:0.9207:0.0	.	2243	Q14571	ITPR2_HUMAN	D	2243	ENSP00000370744:A2243D	ENSP00000370744:A2243D	A	-	2	0	ITPR2	26480462	0.571000	0.26659	0.974000	0.42286	0.996000	0.88848	2.808000	0.47963	2.679000	0.91253	0.650000	0.86243	GCT		0.408	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1		NM_002223	
CEMIP	57214	hgsc.bcm.edu;ucsc.edu	37	15	81224218	81224218	+	Silent	SNP	A	A	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr15:81224218A>T	ENST00000394685.3	+	22	3050	c.2631A>T	c.(2629-2631)ggA>ggT	p.G877G	KIAA1199_ENST00000356249.5_Silent_p.G877G|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.G877G			Q8WUJ3	CEMIP_HUMAN		877					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CAATTAGAGGAATTCAGTTAT	0.468																																																	0													80.0	87.0	85.0					15																	81224218		2203	4300	6503	SO:0001819	synonymous_variant	57214																														ENST00000394685.3:c.2631A>T	15.37:g.81224218A>T		Somatic		WXS	SOLID	Phase_I	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1																																																																																				0.468	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			
KLK2	3817	hgsc.bcm.edu	37	19	51378101	51378101	+	Silent	SNP	C	C	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr19:51378101C>A	ENST00000325321.3	+	2	396	c.171C>A	c.(169-171)ccC>ccA	p.P57P	KLK2_ENST00000597509.1_3'UTR|KLK2_ENST00000391810.2_Intron|KLK2_ENST00000358049.4_Silent_p.P57P|AC037199.1_ENST00000594218.1_5'Flank			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	57	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)		KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		TGGTGCACCCCCAGTGGGTGC	0.587			T	ETV4	prostate																																			Dom	yes		19	19q13.41	3817	kallikrein-related peptidase 2		E	0													67.0	56.0	59.0					19																	51378101		2203	4300	6503	SO:0001819	synonymous_variant	3817			M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.171C>A	19.37:g.51378101C>A		Somatic		WXS	SOLID	Phase_I	B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Silent	SNP	ENST00000325321.3	37	CCDS12808.1																																																																																				0.587	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3		NM_005551.3	
LOX	4015	hgsc.bcm.edu;ucsc.edu	37	5	121411209	121411209	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr5:121411209A>C	ENST00000231004.4	-	3	1067	c.768T>G	c.(766-768)gaT>gaG	p.D256E	SRFBP1_ENST00000504881.1_3'UTR|LOX_ENST00000513319.1_5'UTR	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	256	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		TGTGATCATAATCTCTGACAT	0.368																																																	0													123.0	119.0	121.0					5																	121411209		2203	4300	6503	SO:0001583	missense	4015				CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.768T>G	5.37:g.121411209A>C	ENSP00000231004:p.Asp256Glu	Somatic		WXS	SOLID	Phase_I	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	37	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.353264	0.61293	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.32515	1.45	5.61	-1.92	0.07618	.	0.000000	0.85682	D	0.000000	T	0.32194	0.0821	L	0.58302	1.8	0.44807	D	0.997814	B	0.29188	0.236	B	0.37091	0.241	T	0.37454	-0.9705	10	0.56958	D	0.05	.	13.8038	0.63218	0.4381:0.0:0.5619:0.0	.	256	P28300	LYOX_HUMAN	E	256;216	ENSP00000231004:D256E	ENSP00000231004:D256E	D	-	3	2	LOX	121439108	0.985000	0.35326	0.997000	0.53966	0.955000	0.61496	0.245000	0.18142	-0.120000	0.11809	-0.290000	0.09829	GAT		0.368	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2			
MDGA2	161357	hgsc.bcm.edu	37	14	47566320	47566320	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr14:47566320G>T	ENST00000399232.2	-	6	1089	c.725C>A	c.(724-726)cCg>cAg	p.P242Q	MDGA2_ENST00000357362.3_Missense_Mutation_p.P13Q|MDGA2_ENST00000439988.3_Missense_Mutation_p.P311Q|MDGA2_ENST00000426342.1_Missense_Mutation_p.P13Q	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	242	Ig-like 3.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTTAATTGACGGTGATGCTAA	0.373																																																	0													110.0	101.0	104.0					14																	47566320		1866	4098	5964	SO:0001583	missense	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.725C>A	14.37:g.47566320G>T	ENSP00000382178:p.Pro242Gln	Somatic		WXS	SOLID	Phase_I	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		.	.	.	.	.	.	.	.	.	.	G	27.7	4.859539	0.91433	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.72725	-0.68;0.9;-0.68;0.9	5.65	5.65	0.86999	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.51477	U	0.000092	D	0.90535	0.7034	H	0.98089	4.145	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.93475	0.6822	10	0.87932	D	0	.	18.6475	0.91416	0.0:0.0:1.0:0.0	.	242	Q7Z553	MDGA2_HUMAN	Q	242;13;311;13	ENSP00000400011:P242Q;ENSP00000405456:P13Q;ENSP00000382178:P311Q;ENSP00000349925:P13Q	ENSP00000349925:P13Q	P	-	2	0	MDGA2	46636070	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.067000	0.93955	2.821000	0.97095	0.650000	0.86243	CCG		0.373	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5		NM_182830	
MED14	9282	hgsc.bcm.edu;ucsc.edu	37	X	40570475	40570475	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chrX:40570475A>T	ENST00000324817.1	-	8	1086	c.968T>A	c.(967-969)cTt>cAt	p.L323H		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	323	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CACCTGCACAAGGTCTCCCCA	0.403																																																	0													124.0	98.0	107.0					X																	40570475		2203	4300	6503	SO:0001583	missense	9282			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.968T>A	X.37:g.40570475A>T	ENSP00000323720:p.Leu323His	Somatic		WXS	SOLID	Phase_I	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	A	12.43	1.935876	0.34189	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.28001	0.0690	N	0.03154	-0.405	0.80722	D	1	B	0.23990	0.095	B	0.15484	0.013	T	0.18085	-1.0348	9	0.11182	T	0.66	.	14.8338	0.70166	1.0:0.0:0.0:0.0	.	323	O60244	MED14_HUMAN	H	323	.	ENSP00000323720:L323H	L	-	2	0	MED14	40455419	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.962000	0.93254	1.884000	0.54569	0.486000	0.48141	CTT		0.403	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1		NM_004229	
MYCBP2	23077	hgsc.bcm.edu;ucsc.edu	37	13	77730192	77730192	+	Splice_Site	SNP	C	C	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr13:77730192C>A	ENST00000544440.2	-	46	6819		c.e46+1		MYCBP2_ENST00000360084.5_Splice_Site|MYCBP2_ENST00000357337.6_Splice_Site|MYCBP2_ENST00000407578.2_Splice_Site					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTTATAATTACCTTCATATTG	0.383																																																	0													115.0	104.0	108.0					13																	77730192		2203	4300	6503	SO:0001630	splice_region_variant	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.6801+1G>T	13.37:g.77730192C>A		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	C	26.3	4.725864	0.89298	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2134	0.93766	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYCBP2	76628193	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.487000	0.81328	2.528000	0.85240	0.655000	0.94253	.		0.383	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1		NM_015057	Intron
MYH15	22989	hgsc.bcm.edu	37	3	108224621	108224621	+	Silent	SNP	T	T	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr3:108224621T>C	ENST00000273353.3	-	3	260	c.204A>G	c.(202-204)gtA>gtG	p.V68V		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	68						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CACTCCCTTTTACCTCAGCCT	0.353																																																	0													210.0	195.0	200.0					3																	108224621		1875	4133	6008	SO:0001819	synonymous_variant	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.204A>G	3.37:g.108224621T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000273353.3	37	CCDS43127.1																																																																																				0.353	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1		XM_036988	
NLRP11	204801	hgsc.bcm.edu	37	19	56321350	56321350	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr19:56321350T>C	ENST00000589093.1	-	3	719	c.626A>G	c.(625-627)gAc>gGc	p.D209G	NLRP11_ENST00000589824.2_Missense_Mutation_p.D209G|NLRP11_ENST00000592953.1_Missense_Mutation_p.D110G|NLRP11_ENST00000360133.3_Missense_Mutation_p.D209G|NLRP11_ENST00000443188.1_Missense_Mutation_p.D209G			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	209	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AGCCTGGCCGTCAGGCCAGTC	0.488																																																	0													89.0	85.0	86.0					19																	56321350		2203	4300	6503	SO:0001583	missense	204801			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.626A>G	19.37:g.56321350T>C	ENSP00000466285:p.Asp209Gly	Somatic		WXS	SOLID	Phase_I	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	T	2.914	-0.224760	0.06022	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.79247	-1.25;-1.25	2.48	-1.32	0.09201	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.62551	0.2437	L	0.38175	1.15	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.12837	0.008;0.003	T	0.48080	-0.9066	9	0.40728	T	0.16	.	3.5316	0.07778	0.0:0.2998:0.2035:0.4967	.	209;209	P59045;P59045-2	NAL11_HUMAN;.	G	209	ENSP00000409898:D209G;ENSP00000353251:D209G	ENSP00000353251:D209G	D	-	2	0	NLRP11	61013162	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.151000	0.10175	-0.372000	0.07992	0.496000	0.49642	GAC		0.488	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1		NM_145007	
NMUR2	56923	hgsc.bcm.edu;ucsc.edu	37	5	151784054	151784054	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr5:151784054G>C	ENST00000255262.3	-	1	786	c.621C>G	c.(619-621)atC>atG	p.I207M	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	207					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			ACATGGGCTTGATGACCGTAC	0.542																																																	0													178.0	170.0	173.0					5																	151784054		2203	4300	6503	SO:0001583	missense	56923			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.621C>G	5.37:g.151784054G>C	ENSP00000255262:p.Ile207Met	Somatic		WXS	SOLID	Phase_I	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.377417	0.24944	.	.	ENSG00000132911	ENST00000255262	T	0.36878	1.23	5.44	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.431439	0.23167	N	0.051171	T	0.30759	0.0775	L	0.38175	1.15	0.22961	N	0.998501	P	0.46784	0.884	P	0.49799	0.622	T	0.08310	-1.0728	10	0.42905	T	0.14	-14.7733	4.0007	0.09579	0.2279:0.0:0.4708:0.3013	.	207	Q9GZQ4	NMUR2_HUMAN	M	207	ENSP00000255262:I207M	ENSP00000255262:I207M	I	-	3	3	NMUR2	151764247	0.993000	0.37304	0.725000	0.30721	0.163000	0.22366	0.578000	0.23773	0.259000	0.21709	0.585000	0.79938	ATC		0.542	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1		NM_020167	
NOTCH2	4853	hgsc.bcm.edu	37	1	120572547	120572547	+	Missense_Mutation	SNP	T	T	C	rs61788900		TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr1:120572547T>C	ENST00000256646.2	-	2	356	c.137A>G	c.(136-138)aAt>aGt	p.N46S	NOTCH2_ENST00000602566.1_Missense_Mutation_p.N7S	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	46	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCTGTGCCATTGTGGTAGGT	0.348			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													3.0	3.0	3.0					1																	120572547		1347	3133	4480	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.137A>G	1.37:g.120572547T>C	ENSP00000256646:p.Asn46Ser	Somatic		WXS	SOLID	Phase_I	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.198832	0.38806	.	.	ENSG00000134250	ENST00000256646;ENST00000539617;ENST00000401649;ENST00000369342	T	0.63255	-0.03	5.05	5.05	0.67936	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.36778	U	0.002411	T	0.43366	0.1244	L	0.33093	0.98	0.22873	P	0.9986204	B;P	0.40332	0.01;0.713	B;P	0.51742	0.005;0.678	T	0.42766	-0.9432	9	0.07813	T	0.8	.	11.2333	0.48925	0.0:0.0:0.0:1.0	.	46;46	Q6IQ50;Q04721	.;NOTC2_HUMAN	S	46;7;19;7	ENSP00000256646:N46S	ENSP00000256646:N46S	N	-	2	0	NOTCH2	120374070	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.968000	0.56809	1.904000	0.55121	0.477000	0.44152	AAT		0.348	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		NM_024408	
OR9G4	283189	hgsc.bcm.edu	37	11	56510711	56510711	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr11:56510711A>C	ENST00000302957.3	-	1	576	c.577T>G	c.(577-579)Ttc>Gtc	p.F193V		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GCATCACAGAAAAAGTGGTCA	0.443																																																	0													69.0	67.0	68.0					11																	56510711		2201	4296	6497	SO:0001583	missense	283189			BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.577T>G	11.37:g.56510711A>C	ENSP00000307515:p.Phe193Val	Somatic		WXS	SOLID	Phase_I	Q6IF62|Q96RA9	Missense_Mutation	SNP	ENST00000302957.3	37	CCDS31537.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.407506	0.62399	.	.	ENSG00000172457	ENST00000302957	T	0.00220	8.52	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41396	D	0.000884	T	0.00300	0.0009	M	0.82323	2.585	0.44024	D	0.996746	P	0.38617	0.64	B	0.37550	0.253	T	0.76924	-0.2779	10	0.87932	D	0	-32.3668	13.8217	0.63325	1.0:0.0:0.0:0.0	.	193	Q8NGQ1	OR9G4_HUMAN	V	193	ENSP00000307515:F193V	ENSP00000307515:F193V	F	-	1	0	OR9G4	56267287	1.000000	0.71417	0.991000	0.47740	0.944000	0.59088	5.842000	0.69417	2.131000	0.65755	0.523000	0.50628	TTC		0.443	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1		NM_001005284	
P4HA1	5033	hgsc.bcm.edu;ucsc.edu	37	10	74790028	74790028	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr10:74790028C>T	ENST00000307116.2	-	10	1365	c.1249G>A	c.(1249-1251)Gta>Ata	p.V417I	P4HA1_ENST00000263556.3_Splice_Site|P4HA1_ENST00000440381.1_Splice_Site|P4HA1_ENST00000373008.2_Missense_Mutation_p.V417I|P4HA1_ENST00000394890.2_Splice_Site|P4HA1_ENST00000412021.2_Splice_Site			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	417	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TGATTACCTACCTGTAATTCC	0.408																																					Colon(147;367 2405 2662 52127)												0													114.0	101.0	105.0					10																	74790028		2203	4300	6503	SO:0001583	missense	5033				CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.1249G>A	10.37:g.74790028C>T	ENSP00000307318:p.Val417Ile	Somatic		WXS	SOLID	Phase_I	C9JL12|Q15082|Q15083|Q5VSQ5	Splice_Site	SNP	ENST00000307116.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.1|24.1	4.496523|4.496523	0.85069|0.85069	.|.	.|.	ENSG00000122884|ENSG00000122884	ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381|ENST00000307116;ENST00000373008	.|T;T	.|0.79141	.|-1.24;-1.24	5.31|5.31	5.31|5.31	0.75309|0.75309	.|Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	.|.	.|.	.|.	.|.	.|D	.|0.86218	.|0.5880	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D;P	.|0.59767	.|0.986;0.857	.|P;P	.|0.59012	.|0.85;0.699	.|D	.|0.86424	.|0.1756	.|8	.|0.46703	.|T	.|0.11	.|.	18.555|18.555	0.91080|0.91080	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|417;417	.|Q5VSQ6;P13674	.|.;P4HA1_HUMAN	.|I	-1|417	.|ENSP00000307318:V417I;ENSP00000362099:V417I	.|ENSP00000307318:V417I	.|V	-|-	.|1	.|0	P4HA1|P4HA1	74460034|74460034	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	5.877000|5.877000	0.69675|0.69675	2.449000|2.449000	0.82847|0.82847	0.655000|0.655000	0.94253|0.94253	.|GTA		0.408	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1		NM_000917	
PDE1B	5153	hgsc.bcm.edu	37	12	54963142	54963142	+	Silent	SNP	C	C	T	rs151025806	byFrequency	TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr12:54963142C>T	ENST00000243052.3	+	4	838	c.402C>T	c.(400-402)ttC>ttT	p.F134F	PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Silent_p.F93F|PDE1B_ENST00000550620.1_Silent_p.F114F	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	134					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGGGATCTTCGTGGAACGGT	0.622													C|||	2	0.000399361	0.0	0.0	5008	,	,		18945	0.0		0.002	False		,,,				2504	0.0																0								C	,	2,4404	4.2+/-10.8	0,2,2201	49.0	50.0	49.0		402,342	-3.2	1.0	12	dbSNP_134	49	28,8572	21.6+/-65.8	0,28,4272	no	coding-synonymous,coding-synonymous	PDE1B	NM_000924.3,NM_001165975.2	,	0,30,6473	TT,TC,CC		0.3256,0.0454,0.2307	,	134/537,114/517	54963142	30,12976	2203	4300	6503	SO:0001819	synonymous_variant	5153			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.402C>T	12.37:g.54963142C>T		Somatic		WXS	SOLID	Phase_I	Q92825|Q96KP3	Silent	SNP	ENST00000243052.3	37	CCDS8882.1																																																																																				0.622	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			
PHTF2	57157	hgsc.bcm.edu;ucsc.edu	37	7	77552042	77552042	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr7:77552042G>A	ENST00000248550.7	+	10	1142	c.1066G>A	c.(1066-1068)Ggt>Agt	p.G356S	PHTF2_ENST00000416283.2_Missense_Mutation_p.G322S|PHTF2_ENST00000450574.1_Missense_Mutation_p.G322S|PHTF2_ENST00000415251.2_Missense_Mutation_p.G318S|PHTF2_ENST00000422959.2_Missense_Mutation_p.G322S|PHTF2_ENST00000424760.1_Missense_Mutation_p.G318S|PHTF2_ENST00000454592.1_3'UTR|PHTF2_ENST00000307305.8_Missense_Mutation_p.G318S|PHTF2_ENST00000275575.7_Missense_Mutation_p.G318S			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						GACTTCTGAAGGTGTTCTTCG	0.378																																																	0													66.0	63.0	64.0					7																	77552042		1867	4098	5965	SO:0001583	missense	57157			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.1066G>A	7.37:g.77552042G>A	ENSP00000248550:p.Gly356Ser	Somatic		WXS	SOLID	Phase_I	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	37		.	.	.	.	.	.	.	.	.	.	G	6.429	0.447322	0.12223	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000415251;ENST00000275575;ENST00000450574;ENST00000416283;ENST00000248550	.	.	.	5.72	4.57	0.56435	.	0.298547	0.40385	N	0.001102	T	0.14013	0.0339	N	0.08118	0	0.21325	N	0.999726	B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B	0.08055	0.0;0.0;0.0;0.0;0.0;0.003;0.001;0.0;0.001	T	0.31668	-0.9935	9	0.06494	T	0.89	-1.9477	4.8177	0.13374	0.6631:0.0:0.1433:0.1936	.	160;318;181;322;356;322;318;318;318	Q8WVD6;Q8N3S3-4;Q8N5I6;Q8N3S3-2;Q8N3S3;G5E9H7;Q8N3S3-3;B3KQZ2;E9PEE3	.;.;.;.;PHTF2_HUMAN;.;.;.;.	S	322;322;318;318;318;318;322;322;356	.	ENSP00000248550:G356S	G	+	1	0	PHTF2	77389978	1.000000	0.71417	0.985000	0.45067	0.858000	0.48976	2.227000	0.42972	1.007000	0.39238	-0.238000	0.12139	GGT		0.378	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2		NM_020432	
POTEG	404785	hgsc.bcm.edu	37	14	19553436	19553436	+	Missense_Mutation	SNP	C	C	T	rs28406802	byFrequency	TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr14:19553436C>T	ENST00000409832.3	+	1	72	c.20C>T	c.(19-21)tCa>tTa	p.S7L		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	7										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GAGGCTGGTTCAATGCCGGCT	0.577													C|||	1260	0.251597	0.2678	0.2781	5008	,	,		34012	0.2371		0.2137	False		,,,				2504	0.2648																0													2.0	3.0	2.0					14																	19553436		578	1600	2178	SO:0001583	missense	404785				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.20C>T	14.37:g.19553436C>T	ENSP00000386971:p.Ser7Leu	Somatic		WXS	SOLID	Phase_I	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	c	11.05	1.524203	0.27299	.	.	ENSG00000222036	ENST00000409832	T	0.34275	1.37	0.436	0.436	0.16549	.	.	.	.	.	T	0.35770	0.0943	N	0.24115	0.695	0.09310	N	1	D	0.59767	0.986	P	0.58210	0.835	T	0.19418	-1.0306	8	0.87932	D	0	.	.	.	.	.	7	Q6S5H5	POTEG_HUMAN	L	7	ENSP00000386971:S7L	ENSP00000386971:S7L	S	+	2	0	POTEG	18623436	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.949000	0.03893	0.465000	0.27167	0.165000	0.16767	TCA		0.577	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1		NM_001005356	
RPL5	6125	hgsc.bcm.edu	37	1	93301855	93301857	+	In_Frame_Del	DEL	TAT	TAT	-	rs188046229		TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	TAT	TAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr1:93301855_93301857delTAT	ENST00000370321.3	+	5	523_525	c.433_435delTAT	c.(433-435)tatdel	p.Y145del	SNORA66_ENST00000515986.1_RNA|SNORD21_ENST00000383953.1_RNA	NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5	145					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		CTTCACCTGCTATTTGGATGCAG	0.488																																																	0																																										SO:0001651	inframe_deletion	6125			U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.433_435delTAT	1.37:g.93301855_93301857delTAT	ENSP00000359345:p.Tyr145del	Somatic		WXS	SOLID	Phase_I	Q32LZ3|Q53HH6|Q9H3F4	In_Frame_Del	DEL	ENST00000370321.3	37	CCDS741.1																																																																																				0.488	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030058.2		NM_000969	
SH3D19	152503	hgsc.bcm.edu;ucsc.edu	37	4	152048840	152048840	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr4:152048840A>T	ENST00000409252.2	-	19	2893	c.2186T>A	c.(2185-2187)gTa>gAa	p.V729E	SH3D19_ENST00000455740.1_Missense_Mutation_p.V706E|SH3D19_ENST00000304527.4_Missense_Mutation_p.V729E|SH3D19_ENST00000409598.4_Missense_Mutation_p.V706E|SH3D19_ENST00000514152.1_Missense_Mutation_p.V706E|SH3D19_ENST00000424281.1_Missense_Mutation_p.V670E|SH3D19_ENST00000427414.2_Missense_Mutation_p.V670E			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	729					cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CCCCTTCGGTACTATGGCCAA	0.358																																																	0													76.0	68.0	70.0					4																	152048840		2203	4300	6503	SO:0001583	missense	152503			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.2186T>A	4.37:g.152048840A>T	ENSP00000386848:p.Val729Glu	Somatic		WXS	SOLID	Phase_I	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	A	0.863	-0.734606	0.03111	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.84	0.76	0.18442	Src homology-3 domain (1);	2.107390	0.01930	N	0.041152	T	0.15478	0.0373	N	0.11154	0.105	0.09310	N	1	B;B;B;B	0.12630	0.0;0.006;0.0;0.001	B;B;B;B	0.15052	0.002;0.012;0.004;0.001	T	0.22977	-1.0201	10	0.02654	T	1	0.1242	6.8364	0.23939	0.2801:0.4525:0.2674:0.0	.	729;706;670;484	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	E	706;729;706;670;670;729;706	ENSP00000387030:V706E;ENSP00000302913:V729E;ENSP00000416708:V706E;ENSP00000404542:V670E;ENSP00000415694:V670E;ENSP00000386848:V729E;ENSP00000423449:V706E	ENSP00000302913:V729E	V	-	2	0	SH3D19	152268290	.	.	0.000000	0.03702	0.027000	0.11550	.	.	0.063000	0.16370	-0.462000	0.05337	GTA		0.358	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3		NM_001009555	
SIK2	23235	hgsc.bcm.edu;ucsc.edu	37	11	111558776	111558776	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr11:111558776T>A	ENST00000304987.3	+	4	541	c.368T>A	c.(367-369)tTc>tAc	p.F123Y		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	123	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AGGCGAAAATTCTGGCAAATC	0.398																																																	0													115.0	108.0	110.0					11																	111558776		2201	4297	6498	SO:0001583	missense	23235			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.368T>A	11.37:g.111558776T>A	ENSP00000305976:p.Phe123Tyr	Somatic		WXS	SOLID	Phase_I	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	T	35	5.420707	0.96111	.	.	ENSG00000170145	ENST00000304987	T	0.67345	-0.26	6.07	6.07	0.98685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86619	0.5976	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89918	0.4057	10	0.87932	D	0	.	16.3141	0.82909	0.0:0.0:0.0:1.0	.	123	Q9H0K1	SIK2_HUMAN	Y	123	ENSP00000305976:F123Y	ENSP00000305976:F123Y	F	+	2	0	SIK2	111063986	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.622000	0.83099	2.326000	0.78906	0.533000	0.62120	TTC		0.398	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3		NM_015191	
SLC20A1	6574	hgsc.bcm.edu;ucsc.edu	37	2	113420443	113420443	+	Silent	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr2:113420443G>T	ENST00000272542.3	+	11	2420	c.1881G>T	c.(1879-1881)gtG>gtT	p.V627V		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	627					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						TCTTCTAGGTGGGCTCTGTTG	0.507																																																	0													158.0	139.0	145.0					2																	113420443		2203	4300	6503	SO:0001819	synonymous_variant	6574				CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1881G>T	2.37:g.113420443G>T		Somatic		WXS	SOLID	Phase_I	Q08344|Q6DHX8|Q9UQ82	Silent	SNP	ENST00000272542.3	37	CCDS2099.1																																																																																				0.507	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2		NM_005415	
SLC8A2	6543	hgsc.bcm.edu;ucsc.edu	37	19	47940782	47940782	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr19:47940782C>T	ENST00000236877.6	-	8	2442	c.2047G>A	c.(2047-2049)Gcc>Acc	p.A683T	SLC8A2_ENST00000539381.1_Missense_Mutation_p.A146T|SLC8A2_ENST00000542837.1_Missense_Mutation_p.A439T|SLC8A2_ENST00000601757.1_5'UTR	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	683					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		ATTACCAAGGCCAAGTTCGTT	0.532																																																	0													172.0	148.0	156.0					19																	47940782		2203	4300	6503	SO:0001583	missense	6543			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.2047G>A	19.37:g.47940782C>T	ENSP00000236877:p.Ala683Thr	Somatic		WXS	SOLID	Phase_I	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	37	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457538	0.84317	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000539381;ENST00000542837	T;T;T	0.64803	1.37;-0.12;1.23	2.77	2.77	0.32553	.	0.000000	0.64402	D	0.000003	T	0.77294	0.4109	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.80549	-0.1333	10	0.56958	D	0.05	.	13.4529	0.61182	0.0:1.0:0.0:0.0	.	511;683	E9PGS7;Q9UPR5	.;NAC2_HUMAN	T	511;683;146;439	ENSP00000236877:A683T;ENSP00000440588:A146T;ENSP00000437536:A439T	ENSP00000236877:A683T	A	-	1	0	SLC8A2	52632594	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	7.543000	0.82106	1.867000	0.54127	0.502000	0.49764	GCC		0.532	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1			
SPAST	6683	hgsc.bcm.edu;ucsc.edu	37	2	32362024	32362025	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr2:32362024_32362025insC	ENST00000315285.3	+	11	1525_1526	c.1400_1401insC	c.(1399-1404)atagaafs	p.E468fs	SPAST_ENST00000345662.1_Frame_Shift_Ins_p.E436fs	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GAATTTCTAATAGAATTTGATG	0.317																																																	0																																										SO:0001589	frameshift_variant	6683			AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	Exception_encountered	2.37:g.32362024_32362025insC	ENSP00000320885:p.Glu468fs	Somatic		WXS	SOLID	Phase_I		Frame_Shift_Ins	INS	ENST00000315285.3	37	CCDS1778.1																																																																																				0.317	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1		NM_199436	
SPTB	6710	hgsc.bcm.edu	37	14	65237810	65237810	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr14:65237810G>A	ENST00000389721.5	-	26	5623	c.5591C>T	c.(5590-5592)aCa>aTa	p.T1864I	SPTB_ENST00000556626.1_Missense_Mutation_p.T1864I|SPTB_ENST00000542895.1_Missense_Mutation_p.T1864I|SPTB_ENST00000389720.3_Missense_Mutation_p.T1864I|SPTB_ENST00000389722.3_Missense_Mutation_p.T1864I	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1864					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGCATATGCTGTCTGCAGACG	0.627																																																	0													118.0	112.0	114.0					14																	65237810		2203	4300	6503	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5591C>T	14.37:g.65237810G>A	ENSP00000374371:p.Thr1864Ile	Somatic		WXS	SOLID	Phase_I	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397846	0.42512	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.31	5.14	2.26	0.28386	.	0.225350	0.46145	D	0.000316	T	0.30727	0.0774	L	0.57536	1.79	0.28172	N	0.928511	B;B;P	0.35272	0.365;0.119;0.493	B;B;B	0.34180	0.12;0.134;0.177	T	0.18178	-1.0345	10	0.52906	T	0.07	.	7.083	0.25241	0.153:0.0:0.7074:0.1396	.	648;1864;1868	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	I	1868;1864;648;529;1864;1864;1864;1864	ENSP00000374372:T1864I;ENSP00000451324:T529I;ENSP00000451752:T1864I;ENSP00000374371:T1864I;ENSP00000443882:T1864I;ENSP00000374370:T1864I	ENSP00000334218:T648I	T	-	2	0	SPTB	64307563	0.775000	0.28604	0.296000	0.24974	0.922000	0.55478	3.426000	0.52778	0.254000	0.21573	0.462000	0.41574	ACA		0.627	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			
SULF2	55959	hgsc.bcm.edu	37	20	46365452	46365452	+	Missense_Mutation	SNP	C	C	A	rs562017382	byFrequency	TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr20:46365452C>A	ENST00000359930.4	-	3	1261	c.410G>T	c.(409-411)cGg>cTg	p.R137L	SULF2_ENST00000361612.4_Missense_Mutation_p.R137L|SULF2_ENST00000484875.1_Missense_Mutation_p.R137L|SULF2_ENST00000467815.1_Missense_Mutation_p.R137L|SULF2_ENST00000478766.1_5'UTR	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	137					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						CTCACCTGTCCGGTAGCCAGT	0.617																																																	0													92.0	69.0	77.0					20																	46365452		2203	4300	6503	SO:0001583	missense	55959			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.410G>T	20.37:g.46365452C>A	ENSP00000353007:p.Arg137Leu	Somatic		WXS	SOLID	Phase_I	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	C	31	5.092375	0.94149	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815;ENST00000437955	D;D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06;-5.06	5.24	5.24	0.73138	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99096	0.9689	M	0.78344	2.41	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.942;0.999;0.999	D	0.99863	1.1085	10	0.87932	D	0	-17.1006	18.8085	0.92048	0.0:1.0:0.0:0.0	.	137;137;137	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	L	137	ENSP00000353007:R137L;ENSP00000418290:R137L;ENSP00000354662:R137L;ENSP00000418442:R137L;ENSP00000410026:R137L	ENSP00000353007:R137L	R	-	2	0	SULF2	45798859	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	7.814000	0.86154	2.444000	0.82710	0.561000	0.74099	CGG		0.617	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1		NM_018837	
THBS4	7060	hgsc.bcm.edu;ucsc.edu	37	5	79351852	79351852	+	Silent	SNP	A	A	T	rs71594659|rs438042	byFrequency	TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr5:79351852A>T	ENST00000350881.2	+	3	727	c.537A>T	c.(535-537)ccA>ccT	p.P179P	CTD-2201I18.1_ENST00000503007.1_RNA|THBS4_ENST00000511733.1_Silent_p.P88P	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	179	Laminin G-like.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.P179P(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		AGAGGAAGCCACAGGTAGGAA	0.537													A|||	2852	0.569489	0.6536	0.5476	5008	,	,		17271	0.5139		0.5527	False		,,,				2504	0.546																1	Substitution - coding silent(1)	stomach(1)						A		2744,1660		894,956,352	20.0	24.0	23.0		537	-3.2	1.0	5	dbSNP_80	23	4236,4362		1063,2110,1126	no	coding-synonymous	THBS4	NM_003248.4		1957,3066,1478	TT,TA,AA		49.2673,37.693,46.316		179/962	79351852	6980,6022	2202	4299	6501	SO:0001819	synonymous_variant	7060				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.537A>T	5.37:g.79351852A>T		Somatic		WXS	SOLID	Phase_I	B2R909|Q86TG2	Silent	SNP	ENST00000350881.2	37	CCDS4049.1																																																																																				0.537	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1			
THNSL2	55258	hgsc.bcm.edu	37	2	88472689	88472689	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr2:88472689G>T	ENST00000324166.5	+	1	1711	c.20G>T	c.(19-21)aGg>aTg	p.R7M	THNSL2_ENST00000377254.3_Missense_Mutation_p.R7M|THNSL2_ENST00000449349.1_Intron|THNSL2_ENST00000343544.4_Missense_Mutation_p.R7M|THNSL2_ENST00000358591.2_Missense_Mutation_p.R7M|THNSL2_ENST00000402102.1_Missense_Mutation_p.R7M	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	7					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						GTCAGCACCAGGGGCGTAGCC	0.607																																																	0													55.0	63.0	61.0					2																	88472689		2203	4300	6503	SO:0001583	missense	55258				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.20G>T	2.37:g.88472689G>T	ENSP00000327323:p.Arg7Met	Somatic		WXS	SOLID	Phase_I	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	ENST00000324166.5	37	CCDS2002.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791094	0.90367	.	.	ENSG00000144115	ENST00000358591;ENST00000377254;ENST00000402102;ENST00000419759;ENST00000343544;ENST00000324166	T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45	5.36	5.36	0.76844	Pyridoxal phosphate-dependent enzyme, beta subunit (1);	0.000000	0.64402	U	0.000003	D	0.83317	0.5228	H	0.97783	4.075	0.51012	D	0.999906	D;D	0.89917	1.0;1.0	D;D	0.78314	0.99;0.991	D	0.89770	0.3953	10	0.87932	D	0	.	18.0741	0.89422	0.0:0.0:1.0:0.0	.	7;7	Q86YJ6;Q86YJ6-2	THNS2_HUMAN;.	M	7	ENSP00000351402:R7M;ENSP00000366464:R7M;ENSP00000384475:R7M;ENSP00000391300:R7M;ENSP00000339563:R7M;ENSP00000327323:R7M	ENSP00000327323:R7M	R	+	2	0	THNSL2	88253804	1.000000	0.71417	0.989000	0.46669	0.944000	0.59088	9.144000	0.94629	2.496000	0.84212	0.561000	0.74099	AGG		0.607	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252662.1		NM_018271	
TRAF4	9618	hgsc.bcm.edu;ucsc.edu	37	17	27075315	27075315	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr17:27075315C>A	ENST00000262395.5	+	5	627	c.498C>A	c.(496-498)taC>taA	p.Y166*	TRAF4_ENST00000444415.3_Nonsense_Mutation_p.Y166*|AC010761.10_ENST00000579468.1_RNA|AC010761.9_ENST00000577325.1_RNA|TRAF4_ENST00000262396.6_Intron	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	166					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			AGAGTGTCTACTGTGAGAATA	0.582																																																	0													50.0	48.0	49.0					17																	27075315		2203	4300	6503	SO:0001587	stop_gained	9618			X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.498C>A	17.37:g.27075315C>A	ENSP00000262395:p.Tyr166*	Somatic		WXS	SOLID	Phase_I	O75615|Q14848|Q2KJU4|Q2PJN8	Nonsense_Mutation	SNP	ENST00000262395.5	37	CCDS11243.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851402	0.71719	.	.	ENSG00000076604	ENST00000262395;ENST00000422344;ENST00000444415	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.2477	0.87032	0.0:1.0:0.0:0.0	.	.	.	.	X	166;173;166	.	ENSP00000262395:Y166X	Y	+	3	2	TRAF4	24099442	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.161000	0.77505	2.668000	0.90789	0.561000	0.74099	TAC		0.582	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255944.2		NM_145751	
VMP1	81671	hgsc.bcm.edu;ucsc.edu	37	17	57886217	57886217	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr17:57886217G>A	ENST00000262291.4	+	8	1085	c.775G>A	c.(775-777)Gga>Aga	p.G259R	VMP1_ENST00000545362.1_Missense_Mutation_p.G203R|VMP1_ENST00000536180.1_Missense_Mutation_p.G162R|VMP1_ENST00000539763.1_Missense_Mutation_p.G67R|VMP1_ENST00000537567.1_Missense_Mutation_p.G125R	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	259					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						TGGATTTTTTGGAATTTTGGC	0.343																																																	0													82.0	82.0	82.0					17																	57886217		2203	4300	6503	SO:0001583	missense	0				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.775G>A	17.37:g.57886217G>A	ENSP00000262291:p.Gly259Arg	Somatic		WXS	SOLID	Phase_I	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	37	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997721	0.74818	.	.	ENSG00000062716	ENST00000262291;ENST00000537567;ENST00000539763;ENST00000536180;ENST00000545362	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.91406	3.205	0.80722	D	1	P;P;P;P	0.50528	0.903;0.923;0.881;0.936	P;B;P;P	0.60886	0.7;0.397;0.649;0.88	D	0.88281	0.2936	9	0.87932	D	0	-10.7567	18.4701	0.90771	0.0:0.0:1.0:0.0	.	125;162;203;259	B4DED7;B4DGZ7;F5H2J3;Q96GC9	.;.;.;VMP1_HUMAN	R	259;125;67;162;203	.	ENSP00000262291:G259R	G	+	1	0	VMP1	55240999	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.318000	0.96334	2.439000	0.82584	0.313000	0.20887	GGA		0.343	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1		NM_030938	
TRPV6	55503	hgsc.bcm.edu;ucsc.edu	37	7	142575416	142575416	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr7:142575416C>G	ENST00000359396.3	-	3	582	c.337G>C	c.(337-339)Gag>Cag	p.E113Q	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	113					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TCATAGAGCTCAGATGTCATG	0.557																																																	0													83.0	88.0	86.0					7																	142575416		2203	4300	6503	SO:0001583	missense	55503			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.337G>C	7.37:g.142575416C>G	ENSP00000352358:p.Glu113Gln	Somatic		WXS	SOLID	Phase_I	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385612	0.61956	.	.	ENSG00000165125	ENST00000359396;ENST00000431833	T;T	0.51574	0.71;0.7	4.86	4.86	0.63082	Ankyrin repeat-containing domain (4);	0.101299	0.64402	D	0.000003	T	0.36853	0.0982	N	0.10707	0.03	0.52099	D	0.999944	P	0.50819	0.939	P	0.53593	0.73	T	0.24476	-1.0159	10	0.44086	T	0.13	-27.037	8.3967	0.32561	0.0:0.7579:0.1567:0.0854	.	113	Q9H1D0	TRPV6_HUMAN	Q	113;40	ENSP00000352358:E113Q;ENSP00000415917:E40Q	ENSP00000352358:E113Q	E	-	1	0	TRPV6	142285538	0.997000	0.39634	0.383000	0.26132	0.865000	0.49528	3.700000	0.54786	2.240000	0.73641	0.655000	0.94253	GAG		0.557	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1		NM_014274	
TSPAN19	144448	hgsc.bcm.edu;ucsc.edu	37	12	85421765	85421765	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr12:85421765A>T	ENST00000532498.2	-	4	256	c.176T>A	c.(175-177)aTt>aAt	p.I59N	TSPAN19_ENST00000547403.2_Intron	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	59						integral component of membrane (GO:0016021)				ovary(1)	1						TCCAATCAAAATTTGAGAAAT	0.289																																																	0													59.0	55.0	56.0					12																	85421765		1806	4063	5869	SO:0001583	missense	144448				CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.176T>A	12.37:g.85421765A>T	ENSP00000433816:p.Ile59Asn	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000532498.2	37	CCDS44949.1	.	.	.	.	.	.	.	.	.	.	A	9.697	1.153511	0.21371	.	.	ENSG00000231738	ENST00000532498;ENST00000547836	T;T	0.81163	-1.46;-1.46	4.4	3.2	0.36748	.	.	.	.	.	T	0.68210	0.2976	L	0.27053	0.805	0.09310	N	1	B	0.25351	0.124	B	0.21917	0.037	T	0.60398	-0.7271	9	0.87932	D	0	.	7.2607	0.26201	0.7941:0.0:0.0:0.2059	.	59	P0C672	TSN19_HUMAN	N	59	ENSP00000433816:I59N;ENSP00000446898:I59N	ENSP00000433816:I59N	I	-	2	0	TSPAN19	83945896	0.148000	0.22702	0.004000	0.12327	0.115000	0.19883	2.631000	0.46502	0.750000	0.32877	0.533000	0.62120	ATT		0.289	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388240.2		NM_001100917	
TUBGCP5	114791	hgsc.bcm.edu	37	15	22836163	22836163	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr15:22836163G>A	ENST00000283645.4	+	3	431	c.301G>A	c.(301-303)Gaa>Aaa	p.E101K	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.E101K	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	101					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		CAGTATAAAGGAAATAAAGGT	0.323																																																	0													106.0	117.0	113.0					15																	22836163		2179	4252	6431	SO:0001583	missense	114791			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.301G>A	15.37:g.22836163G>A	ENSP00000283645:p.Glu101Lys	Somatic		WXS	SOLID	Phase_I	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	ENST00000283645.4	37	CCDS10008.1	.	.	.	.	.	.	.	.	.	.	.	11.40	1.627678	0.28978	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.22539	1.95;1.95	5.51	1.42	0.22433	.	0.437819	0.26571	N	0.023625	T	0.12902	0.0313	L	0.31294	0.92	0.29452	N	0.858417	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.14200	-1.0481	10	0.33940	T	0.23	-8.5694	7.1182	0.25429	0.204:0.1253:0.6706:0.0	.	101;101	Q96RT8;E9PB12	GCP5_HUMAN;.	K	101	ENSP00000283645:E101K;ENSP00000409217:E101K	ENSP00000283645:E101K	E	+	1	0	TUBGCP5	20387604	1.000000	0.71417	0.023000	0.16930	0.608000	0.37181	3.236000	0.51336	0.071000	0.16664	0.655000	0.94253	GAA		0.323	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2		NM_052903	
UPF3A	65110	hgsc.bcm.edu	37	13	115067470	115067470	+	Silent	SNP	A	A	G			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr13:115067470A>G	ENST00000375299.3	+	9	1328	c.1272A>G	c.(1270-1272)ccA>ccG	p.P424P	UPF3A_ENST00000351487.5_Silent_p.P391P|UPF3A_ENST00000475218.2_3'UTR	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	424	Required for association with EIF4A3 and ECJ core components CASC3, MAGOH and RBM8A.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		ACGACAGTCCAGCACCCAGAA	0.552																																																	0													22.0	29.0	27.0					13																	115067470		2170	4277	6447	SO:0001819	synonymous_variant	65110			AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.1272A>G	13.37:g.115067470A>G		Somatic		WXS	SOLID	Phase_I	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	A	4.566	0.105144	0.08731	.	.	ENSG00000169062	ENST00000543577	.	.	.	5.05	-1.55	0.08558	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.2513	0.20848	0.2534:0.2232:0.5235:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UPF3A	114085572	0.082000	0.21442	0.000000	0.03702	0.013000	0.08279	0.589000	0.23939	-0.587000	0.05890	-1.930000	0.00511	.		0.552	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2			
ZMYM4	9202	hgsc.bcm.edu;ucsc.edu	37	1	35859252	35859252	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4331-01A-01D-1366-10	TCGA-BP-4331-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	143b6360-f9b9-456a-b409-0afaac1704be	20024ca1-456b-49e1-b984-6cf81ee6e8e9	g.chr1:35859252G>T	ENST00000314607.6	+	18	2903	c.2823G>T	c.(2821-2823)ttG>ttT	p.L941F	ZMYM4_ENST00000373297.2_Missense_Mutation_p.L852F	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	941					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CAAGGCTTTTGAAGAACAAAG	0.388																																																	0													97.0	91.0	93.0					1																	35859252		2203	4300	6503	SO:0001583	missense	9202			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2823G>T	1.37:g.35859252G>T	ENSP00000322915:p.Leu941Phe	Somatic		WXS	SOLID	Phase_I	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.86|17.86	3.491747|3.491747	0.64074|0.64074	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.26957	.|1.7;1.73	5.28|5.28	4.13|4.13	0.48395|0.48395	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	.|T	.|0.39911	.|0.1096	M|M	0.66939|0.66939	2.045|2.045	0.50039|0.50039	D|D	0.999844|0.999844	.|D	.|0.69078	.|0.997	.|D	.|0.68765	.|0.96	.|T	.|0.37220	.|-0.9715	.|10	.|0.59425	.|D	.|0.04	-6.27|-6.27	3.0197|3.0197	0.06071|0.06071	0.1414:0.1606:0.533:0.165|0.1414:0.1606:0.533:0.165	.|.	.|941	.|Q5VZL5	.|ZMYM4_HUMAN	X|F	601|941;852	.|ENSP00000322915:L941F;ENSP00000362394:L852F	.|ENSP00000322915:L941F	E|L	+|+	1|3	0|2	ZMYM4|ZMYM4	35631839|35631839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.128000|1.128000	0.31369|0.31369	2.651000|2.651000	0.90000|0.90000	0.585000|0.585000	0.79938|0.79938	GAA|TTG		0.388	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3		NM_005095	
