#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ANKRD30B	374860	hgsc.bcm.edu	37	18	14851929	14851929	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr18:14851929C>A	ENST00000358984.4	+	36	3809	c.3629C>A	c.(3628-3630)cCt>cAt	p.P1210H		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1210										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GGAGATGCTCCTTTGCAAGGA	0.398																																																	0													52.0	39.0	43.0					18																	14851929		692	1590	2282	SO:0001583	missense	374860			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3629C>A	18.37:g.14851929C>A	ENSP00000351875:p.Pro1210His	Somatic		WXS	SOLID	Phase_I	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.986994	0.00443	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.12984	2.63	1.39	-2.38	0.06622	.	.	.	.	.	T	0.03263	0.0095	N	0.01668	-0.77	0.26383	N	0.976696	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39418	-0.9615	9	0.09084	T	0.74	.	4.0294	0.09701	0.4081:0.191:0.4009:0.0	.	1295;1210	Q9BXX2;F8WAG3	AN30B_HUMAN;.	H	1210;604;630	ENSP00000351875:P1210H	ENSP00000277669:P630H	P	+	2	0	ANKRD30B	14841929	0.010000	0.17322	0.039000	0.18376	0.018000	0.09664	-0.316000	0.08071	-1.417000	0.02017	-3.510000	0.00033	CCT		0.398	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1		NM_001145029	
APLF	200558	hgsc.bcm.edu;ucsc.edu	37	2	68772385	68772385	+	Silent	SNP	C	C	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:68772385C>T	ENST00000303795.4	+	8	1398	c.1227C>T	c.(1225-1227)atC>atT	p.I409I	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	409	Flexible linker.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GTGTACAAATCGTGGGCCAAG	0.418																																																	0													161.0	149.0	153.0					2																	68772385		2203	4300	6503	SO:0001819	synonymous_variant	200558			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.1227C>T	2.37:g.68772385C>T		Somatic		WXS	SOLID	Phase_I	A8K476|Q53P47|Q53PB9|Q53QU0	Silent	SNP	ENST00000303795.4	37	CCDS1888.1																																																																																				0.418	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1		NM_173545	
B4GALT4	8702	hgsc.bcm.edu	37	3	118931440	118931440	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr3:118931440G>A	ENST00000483209.1	-	8	1632	c.991C>T	c.(991-993)Cct>Tct	p.P331S	B4GALT4_ENST00000467604.1_3'UTR|B4GALT4_ENST00000471675.1_Intron|B4GALT4_ENST00000393765.2_Missense_Mutation_p.P331S|B4GALT4_ENST00000359213.3_Missense_Mutation_p.P331S			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	331					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	ATATATAAAGGATTGTGTTCC	0.373																																																	0													114.0	105.0	108.0					3																	118931440		2203	4300	6503	SO:0001583	missense	8702			AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.991C>T	3.37:g.118931440G>A	ENSP00000420161:p.Pro331Ser	Somatic		WXS	SOLID	Phase_I	Q68D68|Q9BSW3|Q9C078	Missense_Mutation	SNP	ENST00000483209.1	37	CCDS2986.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281178	0.80692	.	.	ENSG00000121578	ENST00000483209;ENST00000359213;ENST00000393765	T;T;T	0.35236	1.32;1.32;1.32	5.38	5.38	0.77491	.	0.057338	0.64402	D	0.000001	T	0.50120	0.1597	M	0.76574	2.34	0.80722	D	1	D	0.63046	0.992	P	0.49561	0.615	T	0.52675	-0.8544	10	0.49607	T	0.09	-13.458	17.8886	0.88864	0.0:0.0:1.0:0.0	.	331	O60513	B4GT4_HUMAN	S	331	ENSP00000420161:P331S;ENSP00000352144:P331S;ENSP00000377360:P331S	ENSP00000352144:P331S	P	-	1	0	B4GALT4	120414130	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	6.427000	0.73378	2.793000	0.96121	0.655000	0.94253	CCT		0.373	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354925.2		NM_003778	
ATP11B	23200	hgsc.bcm.edu	37	3	182584081	182584081	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr3:182584081A>G	ENST00000323116.5	+	14	1729	c.1469A>G	c.(1468-1470)aAa>aGa	p.K490R		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	490					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CTCTTCTTTAAAGCAGTCAGT	0.383																																																	0													79.0	74.0	76.0					3																	182584081		2203	4300	6503	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1469A>G	3.37:g.182584081A>G	ENSP00000321195:p.Lys490Arg	Somatic		WXS	SOLID	Phase_I	Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	CCDS33896.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.083|7.083	0.570596|0.570596	0.13560|0.13560	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000498086|ENST00000323116	T|T	0.63096|0.58652	-0.02|0.32	5.56|5.56	4.39|4.39	0.52855|0.52855	.|ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.104089|0.104089	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.53722|0.53722	0.1814|0.1814	N|N	0.13098|0.13098	0.295|0.295	0.80722|0.80722	D|D	1|1	.|D;B	.|0.69078	.|0.997;0.009	.|D;B	.|0.75020	.|0.985;0.03	T|T	0.48305|0.48305	-0.9047|-0.9047	8|10	0.66056|0.07813	D|T	0.02|0.8	.|.	11.5168|11.5168	0.50526|0.50526	0.9284:0.0:0.0716:0.0|0.9284:0.0:0.0716:0.0	.|.	.|64;490	.|B3KSJ2;Q9Y2G3	.|.;AT11B_HUMAN	E|R	291|490	ENSP00000418421:K291E|ENSP00000321195:K490R	ENSP00000418421:K291E|ENSP00000321195:K490R	K|K	+|+	1|2	0|0	ATP11B|ATP11B	184066775|184066775	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.790000|8.790000	0.91844|0.91844	1.024000|1.024000	0.39682|0.39682	0.528000|0.528000	0.53228|0.53228	AAG|AAA		0.383	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1		NM_014616	
BRPF3	27154	hgsc.bcm.edu	37	6	36175215	36175215	+	Silent	SNP	A	A	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr6:36175215A>T	ENST00000357641.6	+	4	1984	c.1731A>T	c.(1729-1731)cgA>cgT	p.R577R	BRPF3_ENST00000534400.1_Silent_p.R577R|BRPF3_ENST00000534694.1_Silent_p.R577R|BRPF3_ENST00000339717.7_Silent_p.R577R|BRPF3_ENST00000443324.2_Silent_p.R577R|BRPF3_ENST00000543502.1_Silent_p.R577R	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	577					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						AGCTCAAACGAGAGCAGGTAA	0.552																																																	0													42.0	41.0	41.0					6																	36175215		2203	4300	6503	SO:0001819	synonymous_variant	27154			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.1731A>T	6.37:g.36175215A>T		Somatic		WXS	SOLID	Phase_I	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Silent	SNP	ENST00000357641.6	37	CCDS34437.1																																																																																				0.552	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3		NM_015695	
C8orf31	286122	hgsc.bcm.edu;ucsc.edu	37	8	144124450	144124450	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr8:144124450A>G	ENST00000395172.1	+	2	384	c.32A>G	c.(31-33)aAt>aGt	p.N11S	C8orf31_ENST00000517653.1_Intron	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	11										breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AATTCCTGCAATTCAGTGAGG	0.597																																																	0													79.0	82.0	81.0					8																	144124450		2203	4300	6503	SO:0001583	missense	286122				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.32A>G	8.37:g.144124450A>G	ENSP00000378601:p.Asn11Ser	Somatic		WXS	SOLID	Phase_I	Q6GMU7	Missense_Mutation	SNP	ENST00000395172.1	37	CCDS6395.1	.	.	.	.	.	.	.	.	.	.	a	0.346	-0.947585	0.02304	.	.	ENSG00000177335	ENST00000395172	T	0.52983	0.64	1.03	-2.06	0.07298	.	.	.	.	.	T	0.22475	0.0542	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.14023	0.01	T	0.05115	-1.0905	9	0.40728	T	0.16	.	4.1628	0.10293	0.243:0.4057:0.3513:0.0	.	11	Q8N9H6	CH031_HUMAN	S	11	ENSP00000378601:N11S	ENSP00000378601:N11S	N	+	2	0	C8orf31	144195825	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.049000	0.11924	-2.970000	0.00286	-0.639000	0.03973	AAT		0.597	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1		NM_173687	
CCDC144CP	348254	hgsc.bcm.edu;ucsc.edu	37	17	18486814	18486815	+	IGR	INS	-	-	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:18486814_18486815insT								CTD-2303H24.2 (41580 upstream) : CCDC144B (4777 downstream)																							TTCTTTTCTCCCATTTTCTTGT	0.317																																																	0																																										SO:0001628	intergenic_variant	284047																															17.37:g.18486814_18486815insT		Somatic		WXS	SOLID	Phase_I		Frame_Shift_Ins	INS		37																																																																																				0	0.317									
CCDC47	57003	hgsc.bcm.edu	37	17	61838603	61838603	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:61838603A>T	ENST00000225726.5	-	5	1038	c.656T>A	c.(655-657)cTt>cAt	p.L219H	CCDC47_ENST00000582252.1_Missense_Mutation_p.L219H|CCDC47_ENST00000403162.3_Missense_Mutation_p.L219H	NM_020198.2	NP_064583.2	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47	219					calcium ion homeostasis (GO:0055074)|ER overload response (GO:0006983)|osteoblast differentiation (GO:0001649)|post-embryonic development (GO:0009791)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	18						CAGCTGGATAAGCATGCCCTC	0.453																																																	0													263.0	215.0	231.0					17																	61838603		2203	4300	6503	SO:0001583	missense	57003			AF226054	CCDS11643.1	17q23.3	2005-12-19				ENSG00000108588			24856	protein-coding gene	gene with protein product						12477932	Standard	NM_020198		Approved	GK001	uc002jbs.4	Q96A33		ENST00000225726.5:c.656T>A	17.37:g.61838603A>T	ENSP00000225726:p.Leu219His	Somatic		WXS	SOLID	Phase_I	B2RAS8|D3DU20|Q96D00|Q96JZ7|Q9H3E4|Q9NRG3	Missense_Mutation	SNP	ENST00000225726.5	37	CCDS11643.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481691	0.44147	.	.	ENSG00000108588	ENST00000225726;ENST00000403162	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.79209	0.4407	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77670	-0.2501	9	0.15952	T	0.53	-12.0899	14.8505	0.70292	1.0:0.0:0.0:0.0	.	219;219	Q96A33-2;Q96A33	.;CCD47_HUMAN	H	219	.	ENSP00000225726:L219H	L	-	2	0	CCDC47	59192335	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.088000	0.94132	2.163000	0.67991	0.482000	0.46254	CTT		0.453	CCDC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444016.2		NM_020198	
CELSR1	9620	hgsc.bcm.edu;ucsc.edu	37	22	46793633	46793633	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr22:46793633G>A	ENST00000262738.3	-	12	5638	c.5639C>T	c.(5638-5640)cCc>cTc	p.P1880L		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1880	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGGGGGACAGGGGCTCGAGGT	0.652																																																	0													77.0	50.0	59.0					22																	46793633		2200	4300	6500	SO:0001583	missense	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5639C>T	22.37:g.46793633G>A	ENSP00000262738:p.Pro1880Leu	Somatic		WXS	SOLID	Phase_I	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622139	0.28889	.	.	ENSG00000075275	ENST00000262738	T	0.54279	0.58	4.39	4.39	0.52855	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.270105	0.29328	U	0.012467	T	0.59959	0.2232	M	0.84511	2.7	0.80722	D	1	P;B	0.36027	0.533;0.117	B;B	0.36418	0.224;0.046	T	0.68131	-0.5490	10	0.49607	T	0.09	.	16.9223	0.86167	0.0:0.0:1.0:0.0	.	201;1880	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	L	1880	ENSP00000262738:P1880L	ENSP00000262738:P1880L	P	-	2	0	CELSR1	45172297	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	2.585000	0.46111	2.173000	0.68751	0.561000	0.74099	CCC		0.652	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1		NM_014246	
CHRFAM7A	89832	hgsc.bcm.edu	37	15	30664489	30664489	+	Silent	SNP	A	A	G	rs200611153		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr15:30664489A>G	ENST00000299847.2	-	7	837	c.384T>C	c.(382-384)ccT>ccC	p.P128P	CHRFAM7A_ENST00000567722.1_5'Flank|CHRFAM7A_ENST00000401522.3_Silent_p.P37P|CHRFAM7A_ENST00000397827.3_Silent_p.P37P	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	128						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		AGGTGACATCAGGGTAGGGCT	0.552																																																	0													94.0	91.0	92.0					15																	30664489		1674	3596	5270	SO:0001819	synonymous_variant	89832			AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.384T>C	15.37:g.30664489A>G		Somatic		WXS	SOLID	Phase_I	A8KAB9	Silent	SNP	ENST00000299847.2	37	CCDS32184.1																																																																																				0.552	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430700.1		NM_148911	
CLGN	1047	hgsc.bcm.edu	37	4	141321658	141321658	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr4:141321658C>G	ENST00000325617.5	-	7	987	c.547G>C	c.(547-549)Gat>Cat	p.D183H	CLGN_ENST00000537281.1_Missense_Mutation_p.D183H|CLGN_ENST00000414773.1_Missense_Mutation_p.D183H	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	183					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					CCACATTTATCTGGTCCAAAC	0.338																																																	0													80.0	84.0	82.0					4																	141321658		2203	4298	6501	SO:0001583	missense	1047			D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.547G>C	4.37:g.141321658C>G	ENSP00000326699:p.Asp183His	Somatic		WXS	SOLID	Phase_I	B3KS90|B4DXV8|D3DNY8	Missense_Mutation	SNP	ENST00000325617.5	37	CCDS3751.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708158	0.89018	.	.	ENSG00000153132	ENST00000325617;ENST00000414773;ENST00000537281;ENST00000545667	T;T;T	0.63580	-0.05;-0.05;-0.05	5.36	5.36	0.76844	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Calreticulin/calnexin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.83376	0.5241	M	0.89785	3.06	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	D	0.86578	0.1852	10	0.87932	D	0	-28.7922	19.4559	0.94889	0.0:1.0:0.0:0.0	.	183	O14967	CLGN_HUMAN	H	183;183;183;100	ENSP00000326699:D183H;ENSP00000392782:D183H;ENSP00000439381:D183H	ENSP00000326699:D183H	D	-	1	0	CLGN	141541108	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.776000	0.85560	2.669000	0.90835	0.591000	0.81541	GAT		0.338	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257272.2		NM_004362	
CYP4F11	57834	hgsc.bcm.edu;ucsc.edu	37	19	16038275	16038275	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr19:16038275T>A	ENST00000402119.4	-	3	788	c.362A>T	c.(361-363)gAt>gTt	p.D121V	CYP4F11_ENST00000326742.8_Missense_Mutation_p.D121V|CYP4F11_ENST00000591841.1_5'UTR|CYP4F11_ENST00000248041.8_Missense_Mutation_p.D121V	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GAAAATCATATCCTTGGGTGC	0.537																																																	0													162.0	159.0	160.0					19																	16038275		2203	4300	6503	SO:0001583	missense	57834			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.362A>T	19.37:g.16038275T>A	ENSP00000384588:p.Asp121Val	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000402119.4	37	CCDS12337.1	.	.	.	.	.	.	.	.	.	.	t	13.24	2.177365	0.38413	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	T;T;T	0.79454	-1.27;-1.27;-0.38	2.61	1.5	0.22942	.	0.000000	0.56097	U	0.000028	D	0.83533	0.5275	M	0.71871	2.18	0.80722	D	1	D;D	0.58970	0.979;0.984	D;D	0.72075	0.947;0.976	T	0.80721	-0.1256	10	0.66056	D	0.02	.	6.7554	0.23510	0.0:0.0:0.241:0.759	.	121;121	F8W978;Q9HBI6	.;CP4FB_HUMAN	V	121	ENSP00000384588:D121V;ENSP00000248041:D121V;ENSP00000319859:D121V	ENSP00000248041:D121V	D	-	2	0	CYP4F11	15899275	0.993000	0.37304	0.004000	0.12327	0.027000	0.11550	3.371000	0.52379	0.199000	0.20427	0.254000	0.18369	GAT		0.537	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460385.2		NM_021187	
DHTKD1	55526	hgsc.bcm.edu	37	10	12139743	12139743	+	Silent	SNP	G	G	A	rs370218003		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr10:12139743G>A	ENST00000263035.4	+	8	1481	c.1419G>A	c.(1417-1419)acG>acA	p.T473T	DHTKD1_ENST00000465617.1_3'UTR	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	473					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GACTCATGACGCAGGAGGAGG	0.488																																																	0								G		0,4406		0,0,2203	64.0	59.0	61.0		1419	0.0	1.0	10		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DHTKD1	NM_018706.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		473/920	12139743	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55526			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1419G>A	10.37:g.12139743G>A		Somatic		WXS	SOLID	Phase_I	Q68CU5|Q9BUM8|Q9HCE2	Silent	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	G	3.163	-0.171759	0.06421	0.0	1.16E-4	ENSG00000181192	ENST00000448829	.	.	.	5.34	0.0383	0.14199	.	.	.	.	.	T	0.42245	0.1194	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20806	-1.0264	4	.	.	.	-13.2177	2.02	0.03506	0.32:0.2162:0.3239:0.1399	.	.	.	.	T	25	.	.	A	+	1	0	DHTKD1	12179749	0.033000	0.19621	0.992000	0.48379	0.374000	0.29953	-0.906000	0.04071	-0.264000	0.09365	-1.509000	0.00949	GCA		0.488	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1		NM_018706	
DMRTB1	63948	hgsc.bcm.edu	37	1	53927263	53927263	+	Missense_Mutation	SNP	C	C	G	rs146520630		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:53927263C>G	ENST00000371445.3	+	2	750	c.695C>G	c.(694-696)cCc>cGc	p.P232R	DMRTB1_ENST00000463126.1_3'UTR	NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	232	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P232L(1)		large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						CCTGGCGTCCCCCTGCAGCAG	0.672																																																	1	Substitution - Missense(1)	skin(1)											59.0	54.0	56.0					1																	53927263		2203	4300	6503	SO:0001583	missense	63948			AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.695C>G	1.37:g.53927263C>G	ENSP00000360500:p.Pro232Arg	Somatic		WXS	SOLID	Phase_I	Q96SD2	Missense_Mutation	SNP	ENST00000371445.3	37	CCDS581.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946821	0.53186	.	.	ENSG00000143006	ENST00000371445;ENST00000431335	T	0.56444	0.46	5.01	5.01	0.66863	.	0.402201	0.21295	N	0.076913	T	0.68970	0.3059	M	0.66939	2.045	0.09310	N	1	D	0.69078	0.997	D	0.68353	0.957	T	0.62077	-0.6930	10	0.87932	D	0	-12.3233	14.0092	0.64486	0.0:1.0:0.0:0.0	.	232	Q96MA1	DMRTB_HUMAN	R	232;79	ENSP00000360500:P232R	ENSP00000360500:P232R	P	+	2	0	DMRTB1	53699851	0.442000	0.25633	0.018000	0.16275	0.617000	0.37484	3.778000	0.55371	2.779000	0.95612	0.655000	0.94253	CCC		0.672	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1			
DNAH3	55567	hgsc.bcm.edu;ucsc.edu	37	16	20975125	20975125	+	Missense_Mutation	SNP	C	C	T	rs553011109	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr16:20975125C>T	ENST00000261383.3	-	53	10080	c.10081G>A	c.(10081-10083)Gtg>Atg	p.V3361M	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3361					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GAACGGCACACGTTGTTGTAG	0.478													C|||	8	0.00159744	0.0	0.0	5008	,	,		24555	0.0		0.0	False		,,,				2504	0.0082																0													153.0	118.0	130.0					16																	20975125		2201	4300	6501	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10081G>A	16.37:g.20975125C>T	ENSP00000261383:p.Val3361Met	Somatic		WXS	SOLID	Phase_I	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.632090	0.67015	.	.	ENSG00000158486	ENST00000261383	T	0.68025	-0.3	5.78	4.83	0.62350	.	0.069863	0.56097	D	0.000029	D	0.87501	0.6193	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.91654	0.5337	10	0.87932	D	0	.	14.8395	0.70212	0.0:0.931:0.0:0.069	.	3361	Q8TD57	DYH3_HUMAN	M	3361	ENSP00000261383:V3361M	ENSP00000261383:V3361M	V	-	1	0	DNAH3	20882626	0.985000	0.35326	0.831000	0.32960	0.913000	0.54294	2.698000	0.47068	1.449000	0.47699	0.563000	0.77884	GTG		0.478	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1		NM_017539	
DNAJC21	134218	hgsc.bcm.edu;ucsc.edu	37	5	34937560	34937560	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr5:34937560A>G	ENST00000342382.4	+	5	795	c.568A>G	c.(568-570)Aag>Gag	p.K190E	DNAJC21_ENST00000382021.2_Missense_Mutation_p.K190E|DNAJC21_ENST00000303525.7_Missense_Mutation_p.K190E			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	190					protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			AGAAAACAAAAAGATTCGGGA	0.418																																																	0													51.0	58.0	56.0					5																	34937560		2203	4300	6503	SO:0001583	missense	134218				CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.568A>G	5.37:g.34937560A>G	ENSP00000343728:p.Lys190Glu	Somatic		WXS	SOLID	Phase_I	Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Missense_Mutation	SNP	ENST00000342382.4	37	CCDS34144.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.011839	0.93346	.	.	ENSG00000168724	ENST00000342382;ENST00000382021;ENST00000303525	T;T;T	0.56444	0.46;0.47;0.46	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.79661	0.4484	M	0.94101	3.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.998;0.997	D	0.85324	0.1086	10	0.72032	D	0.01	-26.9276	15.6979	0.77515	1.0:0.0:0.0:0.0	.	190;190;190	Q5F1R6-3;Q5F1R6;Q5F1R6-2	.;DJC21_HUMAN;.	E	190	ENSP00000343728:K190E;ENSP00000371451:K190E;ENSP00000306289:K190E	ENSP00000306289:K190E	K	+	1	0	DNAJC21	34973317	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.870000	0.92336	2.159000	0.67721	0.528000	0.53228	AAG		0.418	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1		NM_194283	
FOXO3	2309	hgsc.bcm.edu	37	6	108985341	108985341	+	Silent	SNP	C	C	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr6:108985341C>T	ENST00000343882.6	+	3	1609	c.1305C>T	c.(1303-1305)ttC>ttT	p.F435F	FOXO3_ENST00000406360.1_Silent_p.F435F|FOXO3_ENST00000540898.1_Silent_p.F215F	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	435					antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F435F(2)		central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		GCACGGTGTTCGGACCTTCAT	0.572																																																	2	Substitution - coding silent(2)	urinary_tract(1)|central_nervous_system(1)											89.0	87.0	88.0					6																	108985341		2203	4300	6503	SO:0001819	synonymous_variant	2309			AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1305C>T	6.37:g.108985341C>T		Somatic		WXS	SOLID	Phase_I	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Silent	SNP	ENST00000343882.6	37	CCDS5068.1																																																																																				0.572	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2			
GFM2	84340	hgsc.bcm.edu	37	5	74021847	74021852	+	In_Frame_Del	DEL	ACTCAA	ACTCAA	-	rs5868753|rs76339998	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	ACTCAA	ACTCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr5:74021847_74021852delACTCAA	ENST00000296805.3	-	18	2283_2288	c.1826_1831delTTGAGT	c.(1825-1833)tttgagtat>tat	p.FE609del	GFM2_ENST00000345239.2_In_Frame_Del_p.FE562del|GFM2_ENST00000515125.1_5'UTR|RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000509430.1_In_Frame_Del_p.FE609del	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2									p.F609Y(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		CTTTCAGCATACTCAAACTCAATCAC	0.413														1915	0.382388	0.7572	0.3372	5008	,	,		20860	0.1974		0.2425	False		,,,				2504	0.2423																1	Substitution - Missense(1)	lung(1)																																								SO:0001651	inframe_deletion	84340			AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1826_1831delTTGAGT	5.37:g.74021853_74021858delACTCAA	ENSP00000296805:p.Phe609_Glu610del	Somatic		WXS	SOLID	Phase_I		In_Frame_Del	DEL	ENST00000296805.3	37	CCDS4023.1																																																																																				0.413	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2		NM_032380	
GTF2H2	2966	hgsc.bcm.edu	37	5	70351196	70351196	+	Missense_Mutation	SNP	T	T	C	rs200357275		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr5:70351196T>C	ENST00000330280.7	-	9	740	c.453A>G	c.(451-453)atA>atG	p.I151M	GTF2H2_ENST00000425596.2_Missense_Mutation_p.I94M|GTF2H2_ENST00000274400.5_Missense_Mutation_p.I151M|GTF2H2_ENST00000517900.1_Intron			Q13888	TF2H2_HUMAN	general transcription factor IIH, polypeptide 2, 44kDa	151	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.		I -> M. {ECO:0000269|PubMed:9063743}.		7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G-protein coupled receptor internalization (GO:0002031)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|translation (GO:0006412)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	nucleic acid binding (GO:0003676)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation factor activity, nucleic acid binding (GO:0008135)|zinc ion binding (GO:0008270)			endometrium(1)|lung(1)|urinary_tract(1)	3		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCTGCATAGCTATGCTTAGGG	0.333								Nucleotide excision repair (NER)																													Esophageal Squamous(64;995 1128 1466 1620 27952)												0													77.0	86.0	83.0					5																	70351196		2111	4236	6347	SO:0001583	missense	2966			Z30094	CCDS34183.1	5q13.2	2012-11-05	2002-08-29		ENSG00000145736	ENSG00000145736		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4656	protein-coding gene	gene with protein product		601748	"""general transcription factor IIH, polypeptide 2 (44kD subunit)"""			8194529	Standard	NM_001515		Approved	BTF2, TFIIH, BTF2P44, T-BTF2P44, p44	uc003kav.4	Q13888	OTTHUMG00000164542	ENST00000330280.7:c.453A>G	5.37:g.70351196T>C	ENSP00000328901:p.Ile151Met	Somatic		WXS	SOLID	Phase_I	Q15570|Q15571|Q9BS41	Missense_Mutation	SNP	ENST00000330280.7	37	CCDS34183.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.607573	0.00842	.	.	ENSG00000145736	ENST00000274400;ENST00000330280;ENST00000425596;ENST00000522323	T;T;T	0.26957	1.7;1.7;1.7	2.36	2.36	0.29203	Ssl1-like (1);von Willebrand factor, type A (2);	0.172283	0.52532	N	0.000073	T	0.04952	0.0133	N	0.00325	-1.645	0.20307	N	0.999914	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.003	T	0.37572	-0.9700	10	0.11794	T	0.64	.	4.6425	0.12556	0.2135:0.6562:0.0:0.1303	.	151;151	Q86U80;Q13888	.;TF2H2_HUMAN	M	151;151;94;151	ENSP00000274400:I151M;ENSP00000328901:I151M;ENSP00000394164:I94M	ENSP00000274400:I151M	I	-	3	3	GTF2H2	70386952	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	2.119000	0.41958	0.556000	0.29098	-0.971000	0.02607	ATA		0.333	GTF2H2-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372632.4		NM_001515	
HAUS6	54801	hgsc.bcm.edu;ucsc.edu	37	9	19058758	19058759	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr9:19058758_19058759delAT	ENST00000380502.3	-	16	2473_2474	c.2006_2007delAT	c.(2005-2007)catfs	p.H669fs	HAUS6_ENST00000380496.1_Frame_Shift_Del_p.H533fs	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	669					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGGTCAGCACATGTTTCTGAGG	0.376																																																	0																																										SO:0001589	frameshift_variant	54801			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.2006_2007delAT	9.37:g.19058758_19058759delAT	ENSP00000369871:p.His669fs	Somatic		WXS	SOLID	Phase_I	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Frame_Shift_Del	DEL	ENST00000380502.3	37	CCDS6489.1																																																																																				0.376	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1		NM_017645	
LDHA	3939	hgsc.bcm.edu	37	11	18424451	18424451	+	Silent	SNP	C	C	T	rs5030621	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr11:18424451C>T	ENST00000422447.3	+	5	756	c.483C>T	c.(481-483)agC>agT	p.S161S	LDHA_ENST00000396222.2_Silent_p.S161S|AC084117.3_ENST00000496975.2_RNA|LDHA_ENST00000430553.2_Silent_p.S103S|LDHA_ENST00000227157.4_Silent_p.S161S|LDHA_ENST00000379412.5_Silent_p.S161S|LDHA_ENST00000542179.1_Silent_p.S161S|LDHA_ENST00000540430.1_Silent_p.S190S	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	161			S -> R (in dbSNP:rs5030621).		cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						TTATTGGAAGCGGTTGCAATC	0.458													T|||	3178	0.634585	0.4183	0.7334	5008	,	,		16176	0.6478		0.7336	False		,,,				2504	0.7413																0								T	,,,,	2105,2293	601.8+/-389.8	500,1105,594	116.0	110.0	112.0		309,570,483,483,483	5.3	1.0	11	dbSNP_113	112	6102,2480	407.7+/-349.2	2172,1758,361	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LDHA	NM_001135239.1,NM_001165414.1,NM_001165415.1,NM_001165416.1,NM_005566.3	,,,,	2672,2863,955	TT,TC,CC		28.8977,47.8627,36.772	,,,,	103/275,190/362,161/275,161/242,161/333	18424451	8207,4773	2199	4291	6490	SO:0001819	synonymous_variant	3939			X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.483C>T	11.37:g.18424451C>T		Somatic		WXS	SOLID	Phase_I	B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Silent	SNP	ENST00000422447.3	37	CCDS7839.1																																																																																				0.458	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2		NM_005566	
LRRC37B	114659	hgsc.bcm.edu;ucsc.edu	37	17	30358422	30358422	+	Missense_Mutation	SNP	A	A	G	rs201006374		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:30358422A>G	ENST00000341671.7	+	5	1926	c.1921A>G	c.(1921-1923)Aaa>Gaa	p.K641E	LRRC37B_ENST00000327564.7_Missense_Mutation_p.K668E|LRRC37B_ENST00000584368.1_Intron|LRRC37B_ENST00000394713.3_Intron|LRRC37B_ENST00000543378.2_Missense_Mutation_p.K559E	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	641				K -> E (in Ref. 1; CAC44536). {ECO:0000305}.		cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				TTTAATTACAAAACTGAGCCT	0.323																																																	0													49.0	53.0	52.0					17																	30358422		2200	4299	6499	SO:0001583	missense	114659			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.1921A>G	17.37:g.30358422A>G	ENSP00000340519:p.Lys641Glu	Somatic		WXS	SOLID	Phase_I	Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	37	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-2.942420	0.00052	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000341671	T;T;T	0.50813	0.73;0.73;0.73	2.36	1.37	0.22104	.	.	.	.	.	T	0.19366	0.0465	N	0.05487	-0.04	0.29610	N	0.847023	B	0.02656	0.0	B	0.01281	0.0	T	0.33007	-0.9885	9	0.02654	T	1	.	4.6522	0.12601	0.331:0.0:0.669:0.0	.	641	Q96QE4	LR37B_HUMAN	E	559;668;641	ENSP00000443345:K559E;ENSP00000332536:K668E;ENSP00000340519:K641E	ENSP00000332536:K668E	K	+	1	0	LRRC37B	27382535	0.001000	0.12720	0.267000	0.24556	0.060000	0.15804	0.143000	0.16115	0.111000	0.17947	-0.411000	0.06167	AAA		0.323	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1		NM_052888	
MCPH1	79648	hgsc.bcm.edu	37	8	6302121	6302122	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr8:6302121_6302122delGT	ENST00000344683.5	+	8	954_955	c.878_879delGT	c.(877-879)agtfs	p.S293fs	MCPH1_ENST00000522905.1_Frame_Shift_Del_p.S245fs|MCPH1_ENST00000519480.1_Frame_Shift_Del_p.S293fs	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	293					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		AAATTTCTGAGTAATCTTTCAA	0.371																																					Colon(95;1448 1467 8277 34473 35819)												0																																										SO:0001589	frameshift_variant	79648			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.878_879delGT	8.37:g.6302121_6302122delGT	ENSP00000342924:p.Ser293fs	Somatic		WXS	SOLID	Phase_I	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Frame_Shift_Del	DEL	ENST00000344683.5	37	CCDS43689.1																																																																																				0.371	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2		NM_024596	
MICAL2	9645	hgsc.bcm.edu	37	11	12246315	12246315	+	Missense_Mutation	SNP	C	C	T	rs190895714	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr11:12246315C>T	ENST00000256194.4	+	13	1924	c.1636C>T	c.(1636-1638)Cgc>Tgc	p.R546C	MICAL2_ENST00000342902.5_Missense_Mutation_p.R546C|MICAL2_ENST00000379612.3_Missense_Mutation_p.R546C|MICAL2_ENST00000537344.1_Missense_Mutation_p.R546C|MICAL2_ENST00000527546.1_Missense_Mutation_p.R546C	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	546	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		CACATCCTGGCGCAGTGGGTT	0.637													C|||	2	0.000399361	0.0	0.0014	5008	,	,		17659	0.001		0.0	False		,,,				2504	0.0																0								C	CYS/ARG	0,4402		0,0,2201	109.0	90.0	96.0		1636	1.8	1.0	11		96	1,8587	1.2+/-3.3	0,1,4293	no	missense	MICAL2	NM_014632.2	180	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	546/1125	12246315	1,12989	2201	4294	6495	SO:0001583	missense	9645			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1636C>T	11.37:g.12246315C>T	ENSP00000256194:p.Arg546Cys	Somatic		WXS	SOLID	Phase_I	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	CCDS7809.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	19.77	3.889212	0.72524	0.0	1.16E-4	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	D;D;D;D;D	0.95377	-3.69;-3.69;-3.69;-3.69;-3.69	5.01	1.82	0.25136	Calponin homology domain (5);	0.200485	0.39475	N	0.001357	D	0.97424	0.9157	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.998	D;D;D;D;D	0.71414	0.912;0.947;0.973;0.947;0.96	D	0.97478	1.0045	10	0.87932	D	0	.	12.6403	0.56707	0.667:0.333:0.0:0.0	.	546;546;546;546;546	G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;MICA2_HUMAN	C	546;79;546;546;546;546	ENSP00000441689:R546C;ENSP00000256194:R546C;ENSP00000433965:R546C;ENSP00000344894:R546C;ENSP00000368932:R546C	ENSP00000256194:R546C	R	+	1	0	MICAL2	12202891	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.037000	0.49775	0.683000	0.31428	-0.181000	0.13052	CGC		0.637	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1		NM_014632	
MRGPRX2	117194	hgsc.bcm.edu;ucsc.edu	37	11	19077607	19077607	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr11:19077607C>T	ENST00000329773.2	-	2	430	c.343G>A	c.(343-345)Gca>Aca	p.A115T		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	115					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						CTCAGGCCTGCAAGGTAGGCA	0.562																																					GBM(198;1966 2199 4849 37227 49954)												0													94.0	91.0	92.0					11																	19077607		2199	4293	6492	SO:0001583	missense	117194				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.343G>A	11.37:g.19077607C>T	ENSP00000333800:p.Ala115Thr	Somatic		WXS	SOLID	Phase_I	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	ENST00000329773.2	37	CCDS7847.1	.	.	.	.	.	.	.	.	.	.	.	17.07	3.293851	0.60086	.	.	ENSG00000183695	ENST00000329773	T	0.76060	-0.99	5.26	-7.24	0.01475	GPCR, rhodopsin-like superfamily (1);	1.035100	0.07607	N	0.924643	T	0.50188	0.1601	N	0.17723	0.515	0.09310	N	1	B	0.28026	0.198	B	0.28011	0.085	T	0.38308	-0.9667	10	0.19147	T	0.46	.	5.6305	0.17508	0.2899:0.2505:0.0:0.4596	.	115	Q96LB1	MRGX2_HUMAN	T	115	ENSP00000333800:A115T	ENSP00000333800:A115T	A	-	1	0	MRGPRX2	19034183	0.000000	0.05858	0.000000	0.03702	0.946000	0.59487	-0.831000	0.04405	-1.258000	0.02471	0.655000	0.94253	GCA		0.562	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1		NM_054030	
APEH	327	hgsc.bcm.edu	37	3	49721998	49721998	+	IGR	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr3:49721998A>G	ENST00000296456.5	+	0	3220				AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000449682.2_Missense_Mutation_p.W621R	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.W607R(2)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTCTCACCCCAGCCTGCAATC	0.597																																																	2	Substitution - Missense(2)	prostate(1)|lung(1)											89.0	92.0	91.0					3																	49721998		2203	4300	6503	SO:0001628	intergenic_variant	4485			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49721998A>G		Somatic		WXS	SOLID	Phase_I	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.5|20.5	4.009355|4.009355	0.75046|0.75046	.|.	.|.	ENSG00000173531|ENSG00000173531	ENST00000448220|ENST00000449682	.|D	.|0.97232	.|-4.3	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.39759	.|N	.|0.001263	D|D	0.99089|0.99089	0.9687|0.9687	H|H	0.98388|0.98388	4.22|4.22	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.99026|0.99026	1.0819|1.0819	5|10	.|0.87932	.|D	.|0	.|.	13.7446|13.7446	0.62868|0.62868	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|621	.|G3XAK1	.|.	P|R	90|621	.|ENSP00000414287:W621R	.|ENSP00000414287:W621R	L|W	-|-	2|1	0|0	MST1|MST1	49697002|49697002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.649000|8.649000	0.91067|0.91067	2.063000|2.063000	0.61619|0.61619	0.459000|0.459000	0.35465|0.35465	CTG|TGG		0.597	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2			
MTMR4	9110	hgsc.bcm.edu;ucsc.edu	37	17	56572562	56572562	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:56572562T>C	ENST00000323456.5	-	16	3065	c.2941A>G	c.(2941-2943)Atg>Gtg	p.M981V	MTMR4_ENST00000579925.1_Missense_Mutation_p.M924V	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	981					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GACAACCACATCTGGTTCTTT	0.512																																																	0													176.0	172.0	174.0					17																	56572562		2203	4300	6503	SO:0001583	missense	9110			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.2941A>G	17.37:g.56572562T>C	ENSP00000325285:p.Met981Val	Somatic		WXS	SOLID	Phase_I	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	T	5.755	0.323779	0.10900	.	.	ENSG00000108389	ENST00000323456	D	0.92299	-3.01	5.68	4.6	0.57074	.	1.420310	0.03734	N	0.254009	D	0.84234	0.5427	N	0.08118	0	0.18873	N	0.999983	B	0.02656	0.0	B	0.04013	0.001	T	0.71906	-0.4451	10	0.36615	T	0.2	.	6.7046	0.23244	0.1463:0.0:0.2936:0.5601	.	981	Q9NYA4	MTMR4_HUMAN	V	981	ENSP00000325285:M981V	ENSP00000325285:M981V	M	-	1	0	MTMR4	53927561	1.000000	0.71417	0.925000	0.36789	0.915000	0.54546	1.297000	0.33400	0.975000	0.38392	0.454000	0.30748	ATG		0.512	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1		NM_004687	
MTUS1	57509	hgsc.bcm.edu;ucsc.edu	37	8	17581247	17581247	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr8:17581247G>A	ENST00000262102.6	-	4	2607	c.2383C>T	c.(2383-2385)Cgg>Tgg	p.R795W	MTUS1_ENST00000381861.3_5'Flank|MTUS1_ENST00000519263.1_Intron|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_5'Flank	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	795					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		CCTGTCCTCCGCAGCGCAGGA	0.488																																																	0													122.0	116.0	118.0					8																	17581247		1923	4122	6045	SO:0001583	missense	57509			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2383C>T	8.37:g.17581247G>A	ENSP00000262102:p.Arg795Trp	Somatic		WXS	SOLID	Phase_I	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.755006	0.49362	.	.	ENSG00000129422	ENST00000262102	T	0.36157	1.27	3.42	0.297	0.15762	.	0.869334	0.09600	N	0.780298	T	0.34424	0.0897	N	0.24115	0.695	0.09310	N	1	D	0.71674	0.998	P	0.53861	0.736	T	0.29181	-1.0020	10	0.66056	D	0.02	0.0362	8.4454	0.32838	0.0:0.2846:0.4559:0.2595	.	795	Q9ULD2	MTUS1_HUMAN	W	795	ENSP00000262102:R795W	ENSP00000262102:R795W	R	-	1	2	MTUS1	17625527	0.000000	0.05858	0.000000	0.03702	0.970000	0.65996	-0.016000	0.12613	0.036000	0.15547	0.655000	0.94253	CGG		0.488	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1		XM_372031	
MUC4	4585	hgsc.bcm.edu	37	3	195510766	195510766	+	Missense_Mutation	SNP	G	G	T	rs79949955	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr3:195510766G>T	ENST00000463781.3	-	2	8144	c.7685C>A	c.(7684-7686)cCt>cAt	p.P2562H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2562H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.577													.|||	400	0.0798722	0.1029	0.1138	5008	,	,		11044	0.0208		0.0517	False		,,,				2504	0.1145																0													54.0	46.0	48.0					3																	195510766		679	1590	2269	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7685C>A	3.37:g.195510766G>T	ENSP00000417498:p.Pro2562His	Somatic		WXS	SOLID	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	7.342	0.621188	0.14193	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.47;1.46	1.05	1.05	0.20165	.	.	.	.	.	T	0.15998	0.0385	N	0.19112	0.55	0.09310	N	1	B	0.26876	0.162	B	0.09377	0.004	T	0.21314	-1.0249	8	.	.	.	.	7.9236	0.29861	0.0:0.0:1.0:0.0	.	2562	E7ESK3	.	H	2562	ENSP00000417498:P2562H;ENSP00000420243:P2562H	.	P	-	2	0	MUC4	196995161	0.027000	0.19231	0.003000	0.11579	0.000000	0.00434	1.793000	0.38764	0.619000	0.30197	0.000000	0.15137	CCT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MYT1	4661	hgsc.bcm.edu	37	20	62863561	62863561	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr20:62863561A>T	ENST00000328439.1	+	19	3084	c.2720A>T	c.(2719-2721)aAa>aTa	p.K907I	MYT1_ENST00000536311.1_Missense_Mutation_p.K934I	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ATCAGCGGGAAATACGCCTCT	0.637																																					GBM(59;481 1041 20555 21139 33705)												0													54.0	56.0	55.0					20																	62863561		2203	4300	6503	SO:0001583	missense	4661			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2720A>T	20.37:g.62863561A>T	ENSP00000327465:p.Lys907Ile	Somatic		WXS	SOLID	Phase_I	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.314036	0.60414	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.60797	0.21;0.16	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.82546	-0.0403	10	0.87932	D	0	-21.2471	14.7002	0.69150	1.0:0.0:0.0:0.0	.	934;907	F5H7M8;Q01538	.;MYT1_HUMAN	I	907;934	ENSP00000327465:K907I;ENSP00000442412:K934I	ENSP00000327465:K907I	K	+	2	0	MYT1	62334005	1.000000	0.71417	0.955000	0.39395	0.553000	0.35397	9.077000	0.94016	1.877000	0.54381	0.460000	0.39030	AAA		0.637	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1		NM_004535	
NBPF4	148545	hgsc.bcm.edu	37	1	108777900	108777900	+	Missense_Mutation	SNP	C	C	T	rs61799407	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:108777900C>T	ENST00000415641.3	-	9	1189	c.986G>A	c.(985-987)aGt>aAt	p.S329N		NM_001143989.2	NP_001137461.1	Q96M43	NBPF4_HUMAN	neuroblastoma breakpoint family, member 4	329	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				endometrium(2)|lung(1)|skin(1)	4						TTCAAGATCACTTTGCTTTTC	0.413																																																	0																																										SO:0001583	missense	148545			AK057395	CCDS44182.1	1p13.3	2013-01-17			ENSG00000196427	ENSG00000196427		"""neuroblastoma breakpoint family"""	26550	protein-coding gene	gene with protein product		613994				16079250	Standard	NM_001143989		Approved	FLJ32833	uc009weo.2	Q96M43	OTTHUMG00000011318	ENST00000415641.3:c.986G>A	1.37:g.108777900C>T	ENSP00000389237:p.Ser329Asn	Somatic		WXS	SOLID	Phase_I	Q5T483	Missense_Mutation	SNP	ENST00000415641.3	37	CCDS44182.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.611392	0.00007	.	.	ENSG00000196427	ENST00000415641;ENST00000428601;ENST00000370038	T	0.02472	4.28	1.26	-2.52	0.06346	.	.	.	.	.	T	0.00210	0.0006	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36480	-0.9746	9	0.09843	T	0.71	.	1.0905	0.01662	0.1683:0.2793:0.3384:0.2139	.	329	Q5T483	.	N	329;358;329	ENSP00000389237:S329N	ENSP00000359055:S329N	S	-	2	0	NBPF4	108579423	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.495000	0.02294	-4.408000	0.00051	-3.379000	0.00040	AGT		0.413	NBPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031255.5		NM_152488	
NOTCH2	4853	hgsc.bcm.edu	37	1	120548025	120548025	+	Silent	SNP	G	G	A	rs140551270		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:120548025G>A	ENST00000256646.2	-	3	561	c.342C>T	c.(340-342)ccC>ccT	p.P114P	NOTCH2_ENST00000602566.1_Silent_p.P75P	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	114	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATTCAGGCAGGGTCGAGACA	0.547			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													183.0	139.0	154.0					1																	120548025		2203	4300	6503	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.342C>T	1.37:g.120548025G>A		Somatic		WXS	SOLID	Phase_I	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																				0.547	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		NM_024408	
NLRP3	114548	hgsc.bcm.edu	37	1	247587937	247587937	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:247587937C>G	ENST00000336119.3	+	3	1938	c.1192C>G	c.(1192-1194)Ctg>Gtg	p.L398V	NLRP3_ENST00000348069.2_Missense_Mutation_p.L398V|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.L398V|NLRP3_ENST00000366496.2_Missense_Mutation_p.L398V|NLRP3_ENST00000391828.3_Missense_Mutation_p.L398V|NLRP3_ENST00000366497.2_Missense_Mutation_p.L398V	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	398	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGCCTTCAGTCTGATTCAGGA	0.537																																																	0													89.0	71.0	77.0					1																	247587937		2203	4300	6503	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1192C>G	1.37:g.247587937C>G	ENSP00000337383:p.Leu398Val	Somatic		WXS	SOLID	Phase_I	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	5.296	0.240044	0.10023	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	4.17	1.94	0.25998	NACHT nucleoside triphosphatase (1);	0.000000	0.41194	D	0.000930	T	0.73931	0.3650	L	0.41415	1.275	0.29531	N	0.852783	B;P;P;B;B	0.46578	0.323;0.88;0.544;0.357;0.125	B;P;B;B;B	0.46275	0.099;0.51;0.236;0.236;0.186	T	0.65825	-0.6074	10	0.19147	T	0.46	.	5.0246	0.14378	0.0:0.6347:0.0:0.3653	.	398;398;398;398;398	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	V	398	ENSP00000375704:L398V;ENSP00000355453:L398V;ENSP00000337383:L398V;ENSP00000294752:L398V;ENSP00000355452:L398V;ENSP00000375703:L398V	ENSP00000337383:L398V	L	+	1	2	NLRP3	245654560	0.265000	0.24102	0.682000	0.30024	0.186000	0.23388	1.229000	0.32600	0.489000	0.27749	0.655000	0.94253	CTG		0.537	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1		NM_004895	
NPEPPS	9520	hgsc.bcm.edu;ucsc.edu	37	17	45656826	45656826	+	Silent	SNP	A	A	G	rs2661174		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:45656826A>G	ENST00000322157.4	+	4	726	c.489A>G	c.(487-489)aaA>aaG	p.K163K	NPEPPS_ENST00000544660.1_Silent_p.K119K|NPEPPS_ENST00000525037.1_3'UTR|NPEPPS_ENST00000530173.1_Silent_p.K159K	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	163					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						ATAGAAGTAAATATACTACCC	0.338																																																	0													46.0	44.0	44.0					17																	45656826		1815	4073	5888	SO:0001819	synonymous_variant	9520			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.489A>G	17.37:g.45656826A>G		Somatic		WXS	SOLID	Phase_I	B7Z463|Q6P145|Q9NP16|Q9UEM2	Silent	SNP	ENST00000322157.4	37	CCDS45721.1																																																																																				0.338	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1		NM_006310	
NPEPPS	9520	hgsc.bcm.edu	37	17	45669359	45669359	+	Missense_Mutation	SNP	T	T	G	rs200616431		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:45669359T>G	ENST00000322157.4	+	11	1535	c.1298T>G	c.(1297-1299)tTt>tGt	p.F433C	NPEPPS_ENST00000544660.1_Missense_Mutation_p.F353C|NPEPPS_ENST00000525037.1_3'UTR|NPEPPS_ENST00000530173.1_Missense_Mutation_p.F429C	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	433					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.F433C(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GATGAGATATTTGATGCTATA	0.383																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											123.0	78.0	93.0					17																	45669359		2020	4149	6169	SO:0001583	missense	9520			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1298T>G	17.37:g.45669359T>G	ENSP00000320324:p.Phe433Cys	Somatic		WXS	SOLID	Phase_I	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.519381	0.85495	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660;ENST00000527964;ENST00000527360	T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93	5.51	5.51	0.81932	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	H	0.99435	4.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76427	-0.2963	10	0.87932	D	0	.	15.6257	0.76855	0.0:0.0:0.0:1.0	.	433;429;433	A6NEC2;E9PLK3;P55786	PSAL_HUMAN;.;PSA_HUMAN	C	429;433;420;353;116;130	ENSP00000433287:F429C;ENSP00000320324:F433C;ENSP00000442461:F353C;ENSP00000435639:F116C;ENSP00000435966:F130C	ENSP00000320324:F433C	F	+	2	0	NPEPPS	43024358	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.850000	0.86915	2.099000	0.63709	0.528000	0.53228	TTT		0.383	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1		NM_006310	
PLEKHB2	55041	hgsc.bcm.edu;ucsc.edu	37	2	131883458	131883458	+	Missense_Mutation	SNP	G	G	A	rs377415954		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:131883458G>A	ENST00000403716.1	+	3	730	c.170G>A	c.(169-171)cGc>cAc	p.R57H	PLEKHB2_ENST00000404460.1_Missense_Mutation_p.R57H|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.R57H|PLEKHB2_ENST00000439822.2_Missense_Mutation_p.R57H|PLEKHB2_ENST00000303908.3_Missense_Mutation_p.R57H|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.R9H|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.R57H|PLEKHB2_ENST00000438882.2_Missense_Mutation_p.R57H|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.R57H|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.R57H	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	57	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		ATCAACATCCGCACGGGGCAG	0.527																																																	0													112.0	100.0	104.0					2																	131883458		2203	4300	6503	SO:0001583	missense	55041				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.170G>A	2.37:g.131883458G>A	ENSP00000385892:p.Arg57His	Somatic		WXS	SOLID	Phase_I	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	ENST00000403716.1	37	CCDS46413.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042490	0.93685	.	.	ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000439822;ENST00000438882;ENST00000538982;ENST00000404460;ENST00000409612;ENST00000409279;ENST00000303908	T;T;T;T;T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;1.47;-0.97;-0.97;-0.97;-0.97	4.93	4.93	0.64822	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.067173	0.64402	U	0.000018	D	0.85978	0.5823	M	0.77820	2.39	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999;0.998;0.999	D	0.87157	0.2212	10	0.56958	D	0.05	-0.1004	15.9847	0.80142	0.0:0.0:1.0:0.0	.	57;57;57;57;57;57;57	B4DZ66;B4DF08;Q53FF1;Q96CS7-3;B7WPA5;Q96CS7;B8ZZN1	.;.;.;.;.;PKHB2_HUMAN;.	H	57;57;57;57;57;9;57;57;57;57	ENSP00000386410:R57H;ENSP00000385892:R57H;ENSP00000234115:R57H;ENSP00000389629:R57H;ENSP00000401193:R57H;ENSP00000444389:R9H;ENSP00000385609:R57H;ENSP00000386662:R57H;ENSP00000386666:R57H;ENSP00000306852:R57H	ENSP00000234115:R57H	R	+	2	0	PLEKHB2	131599928	1.000000	0.71417	0.971000	0.41717	0.899000	0.52679	5.718000	0.68455	2.443000	0.82685	0.462000	0.41574	CGC		0.527	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2		NM_017958	
PLCD4	84812	hgsc.bcm.edu;ucsc.edu	37	2	219501273	219501273	+	Silent	SNP	G	G	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:219501273G>A	ENST00000450993.2	+	16	2601	c.2262G>A	c.(2260-2262)caG>caA	p.Q754Q	PLCD4_ENST00000417849.1_Silent_p.Q754Q|RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000432688.1_Silent_p.Q786Q	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	754					acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TCTGCATCCAGGAAGGCCTGG	0.567																																																	0													54.0	53.0	53.0					2																	219501273		1935	4141	6076	SO:0001819	synonymous_variant	84812			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.2262G>A	2.37:g.219501273G>A		Somatic		WXS	SOLID	Phase_I	Q53FS8	Silent	SNP	ENST00000450993.2	37	CCDS46516.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.578550	0.00879	.	.	ENSG00000115556	ENST00000457773	.	.	.	5.17	2.4	0.29515	.	.	.	.	.	T	0.45357	0.1338	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.27571	-1.0070	4	.	.	.	.	2.6561	0.05013	0.2197:0.1242:0.5284:0.1277	.	.	.	.	R	103	.	.	G	+	1	0	PLCD4	219209517	0.874000	0.30092	0.333000	0.25482	0.045000	0.14185	1.052000	0.30429	0.341000	0.23771	-0.140000	0.14226	GGA		0.567	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1			
PLIN4	729359	hgsc.bcm.edu	37	19	4510615	4510615	+	Silent	SNP	G	G	A	rs140509702	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr19:4510615G>A	ENST00000301286.3	-	3	3314	c.3315C>T	c.(3313-3315)gaC>gaT	p.D1105D		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	1105						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						ACGTCGCCACGTCAGTCGCAA	0.682													g|||	43	0.00858626	0.0	0.0014	5008	,	,		15852	0.0387		0.0	False		,,,				2504	0.0031																0										0,4328		0,0,2164	25.0	29.0	28.0		3315	-3.1	0.0	19	dbSNP_134	28	5,8509		0,5,4252	no	coding-synonymous	PLIN4	NM_001080400.1		0,5,6416	AA,AG,GG		0.0587,0.0,0.0389		1105/1358	4510615	5,12837	2164	4257	6421	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.3315C>T	19.37:g.4510615G>A		Somatic		WXS	SOLID	Phase_I	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																				0.682	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1		XM_170901	
POTED	317754	hgsc.bcm.edu	37	21	14987721	14987721	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr21:14987721A>G	ENST00000299443.5	+	3	692	c.640A>G	c.(640-642)Ata>Gta	p.I214V		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	214						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						CTGACAGGCCATACAATGCCA	0.368																																																	0													0.0	0.0	0.0					21																	14987721		0	0	0	SO:0001583	missense	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.640A>G	21.37:g.14987721A>G	ENSP00000299443:p.Ile214Val	Somatic		WXS	SOLID	Phase_I	C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	a	0.007	-1.941151	0.00479	.	.	ENSG00000166351	ENST00000299443	T	0.61980	0.06	1.4	-0.257	0.12979	Ankyrin repeat-containing domain (4);	0.710225	0.12028	N	0.506284	T	0.25901	0.0631	N	0.02379	-0.575	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.24835	-1.0149	10	0.02654	T	1	.	4.8079	0.13329	0.5201:0.0:0.4799:0.0	rs2606005;rs4816795	214	Q86YR6	POTED_HUMAN	V	214	ENSP00000299443:I214V	ENSP00000299443:I214V	I	+	1	0	POTED	13909592	0.070000	0.21116	0.053000	0.19242	0.176000	0.22953	0.073000	0.14640	-0.544000	0.06232	-1.160000	0.01791	ATA		0.368	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1		NM_174981	
POTEG	404785	hgsc.bcm.edu	37	14	19574243	19574243	+	Missense_Mutation	SNP	C	C	A	rs200779890		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr14:19574243C>A	ENST00000409832.3	+	9	1352	c.1300C>A	c.(1300-1302)Cct>Act	p.P434T		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	434				P -> T (in Ref. 1; AAS58871 and 3; AAI27624). {ECO:0000305}.						cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AGAAAACCTGCCTAACGGTGC	0.408																																																	0													1.0	1.0	1.0					14																	19574243		283	662	945	SO:0001583	missense	404785				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1300C>A	14.37:g.19574243C>A	ENSP00000386971:p.Pro434Thr	Somatic		WXS	SOLID	Phase_I	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	431	0.19734432234432234	111	0.22560975609756098	61	0.1685082872928177	79	0.1381118881118881	180	0.23746701846965698	A	0.001	-2.939128	0.00052	.	.	ENSG00000222036	ENST00000409832	T	0.25250	1.81	1.47	-2.94	0.05581	.	.	.	.	.	T	0.00012	0.0000	N	0.02247	-0.625	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13872	-1.0493	8	0.02654	T	1	.	0.5559	0.00671	0.2081:0.3317:0.2012:0.259	.	434	Q6S5H5	POTEG_HUMAN	T	434	ENSP00000386971:P434T	ENSP00000386971:P434T	P	+	1	0	POTEG	18644243	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-2.265000	0.01172	-2.568000	0.00469	-1.447000	0.01057	CCT		0.408	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1		NM_001005356	
PRAMEF1	65121	hgsc.bcm.edu	37	1	12854414	12854414	+	Missense_Mutation	SNP	G	G	A	rs1063769	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:12854414G>A	ENST00000332296.7	+	3	741	c.638G>A	c.(637-639)cGc>cAc	p.R213H	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	213			R -> H (in dbSNP:rs1063769).		negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGAAATTCGCAACATGTCC	0.403																																																	0													332.0	303.0	313.0					1																	12854414		2203	4300	6503	SO:0001583	missense	65121			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.638G>A	1.37:g.12854414G>A	ENSP00000332134:p.Arg213His	Somatic		WXS	SOLID	Phase_I	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	2.614	-0.290146	0.05568	.	.	ENSG00000116721	ENST00000332296	T	0.01025	5.43	1.61	-3.22	0.05125	.	0.000000	0.49916	U	0.000135	T	0.00666	0.0022	L	0.34521	1.04	0.80722	P	0.0	B	0.09022	0.002	B	0.06405	0.002	T	0.48514	-0.9029	9	0.16420	T	0.52	.	3.4737	0.07577	0.1852:0.0:0.2519:0.5629	rs1063769	213	O95521	PRAM1_HUMAN	H	213	ENSP00000332134:R213H	ENSP00000332134:R213H	R	+	2	0	PRAMEF1	12777001	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.869000	0.01643	-1.558000	0.01690	-0.446000	0.05623	CGC		0.403	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1		NM_023013	
PRAMEF7	441871	hgsc.bcm.edu	37	1	12977626	12977626	+	Silent	SNP	A	A	G	rs61778319	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:12977626A>G	ENST00000361079.2	+	2	197	c.114A>G	c.(112-114)acA>acG	p.T38T				Q5VXH5	PRAM7_HUMAN	PRAME family member 7	38					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(2)|kidney(5)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	18	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCTTCCCCACACTGTTCATGG	0.617																																																	0																																										SO:0001819	synonymous_variant	441871				CCDS30593.1	1p36.21	2013-01-17			ENSG00000204510	ENSG00000204510		"""-"""	28415	protein-coding gene	gene with protein product							Standard	NM_001012277		Approved			Q5VXH5	OTTHUMG00000001982	ENST00000361079.2:c.114A>G	1.37:g.12977626A>G		Somatic		WXS	SOLID	Phase_I	B9EIP0	Silent	SNP	ENST00000361079.2	37	CCDS30593.1																																																																																				0.617	PRAMEF7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_001012277	
PRAMEF7	441871	hgsc.bcm.edu	37	1	12977766	12977766	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:12977766T>G	ENST00000361079.2	+	2	337	c.254T>G	c.(253-255)gTt>gGt	p.V85G				Q5VXH5	PRAM7_HUMAN	PRAME family member 7	85					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(2)|kidney(5)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	18	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGAAGGGGTTGATGTGCTG	0.572																																																	0													0.0	1.0	1.0					1																	12977766		0	3	3	SO:0001583	missense	441871				CCDS30593.1	1p36.21	2013-01-17			ENSG00000204510	ENSG00000204510		"""-"""	28415	protein-coding gene	gene with protein product							Standard	NM_001012277		Approved			Q5VXH5	OTTHUMG00000001982	ENST00000361079.2:c.254T>G	1.37:g.12977766T>G	ENSP00000354371:p.Val85Gly	Somatic		WXS	SOLID	Phase_I	B9EIP0	Missense_Mutation	SNP	ENST00000361079.2	37	CCDS30593.1	.	.	.	.	.	.	.	.	.	.	.	8.773	0.926369	0.18056	.	.	ENSG00000204510	ENST00000361079;ENST00000330881	T;T	0.05139	3.49;3.49	1.51	1.51	0.23008	.	0.482456	0.19404	N	0.115087	T	0.08492	0.0211	L	0.52905	1.665	0.09310	N	0.999998	P	0.40266	0.71	P	0.44447	0.45	T	0.14008	-1.0488	10	0.87932	D	0	.	5.1468	0.14989	0.0:0.0:0.0:1.0	.	85	Q5VXH5	PRAM7_HUMAN	G	85	ENSP00000354371:V85G;ENSP00000328915:V85G	ENSP00000328915:V85G	V	+	2	0	PRAMEF7	12900353	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.729000	0.26028	0.940000	0.37473	0.163000	0.16589	GTT		0.572	PRAMEF7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_001012277	
PRSS38	339501	hgsc.bcm.edu;ucsc.edu	37	1	228033865	228033866	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:228033865_228033866insT	ENST00000366757.3	+	5	961_962	c.937_938insT	c.(937-939)ctcfs	p.L313fs		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	313						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						GGGGCCCACTCTCAGCGTCCTA	0.559																																																	0																																										SO:0001589	frameshift_variant	339501				CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.938dupT	1.37:g.228033866_228033866dupT	ENSP00000355719:p.Leu313fs	Somatic		WXS	SOLID	Phase_I	Q7RTY6	Frame_Shift_Ins	INS	ENST00000366757.3	37	CCDS1563.1																																																																																				0.559	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1		NM_183062	
RAD21L1	642636	hgsc.bcm.edu	37	20	1212254	1212254	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr20:1212254A>C	ENST00000409241.1	+	4	452	c.359A>C	c.(358-360)cAa>cCa	p.Q120P	RAD21L1_ENST00000477283.1_3'UTR|RAD21L1_ENST00000402452.1_Missense_Mutation_p.Q120P|RAD21L1_ENST00000381882.2_Missense_Mutation_p.Q120P	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	120					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						TTTGACACCCAAAATATGAAG	0.269																																																	0													47.0	37.0	40.0					20																	1212254		692	1588	2280	SO:0001583	missense	642636			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.359A>C	20.37:g.1212254A>C	ENSP00000386414:p.Gln120Pro	Somatic		WXS	SOLID	Phase_I	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	ENST00000409241.1	37	CCDS46568.1	.	.	.	.	.	.	.	.	.	.	A	0.235	-1.017899	0.02078	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	T;T;T	0.49432	1.0;0.78;1.0	4.78	4.78	0.61160	.	0.674550	0.13575	N	0.377725	T	0.20088	0.0483	N	0.02751	-0.505	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.12553	-1.0543	10	0.02654	T	1	.	10.086	0.42419	0.8321:0.1679:0.0:0.0	.	120	Q9H4I0	RD21L_HUMAN	P	120	ENSP00000385925:Q120P;ENSP00000386414:Q120P;ENSP00000371306:Q120P	ENSP00000371306:Q120P	Q	+	2	0	RAD21L1	1160254	0.002000	0.14202	0.019000	0.16419	0.562000	0.35680	0.538000	0.23160	2.126000	0.65437	0.533000	0.62120	CAA		0.269	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334022.1			
RAET1L	154064	hgsc.bcm.edu	37	6	150343148	150343148	+	Missense_Mutation	SNP	A	A	C	rs78563624		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr6:150343148A>C	ENST00000367341.1	-	2	316	c.317T>G	c.(316-318)cTt>cGt	p.L106R	RAET1L_ENST00000286380.2_Missense_Mutation_p.L106R			Q5VY80	RET1L_HUMAN	retinoic acid early transcript 1L	106	MHC class I alpha-1 like. {ECO:0000250}.		L -> R (in dbSNP:rs1555696).		antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.4e-12)		CTGAATGTCAAGCAGTTGCTC	0.488																																																	0								A	ARG/LEU	162,4214		30,102,2056	118.0	91.0	100.0		317	-3.8	0.0	6	dbSNP_131	100	931,7549		176,579,3485	no	missense	RAET1L	NM_130900.2	102	206,681,5541	CC,CA,AA		10.9788,3.702,8.5019	probably-damaging	106/247	150343148	1093,11763	2188	4240	6428	SO:0001583	missense	154064			AY039682	CCDS5224.1	6q24.1-25.1	2008-02-05			ENSG00000155918	ENSG00000155918			16798	protein-coding gene	gene with protein product		611047				11827464	Standard	NM_130900		Approved		uc011eei.2	Q5VY80	OTTHUMG00000015809	ENST00000367341.1:c.317T>G	6.37:g.150343148A>C	ENSP00000356310:p.Leu106Arg	Somatic		WXS	SOLID	Phase_I	A3KME4|Q8TE74	Missense_Mutation	SNP	ENST00000367341.1	37	CCDS5224.1	568	0.2600732600732601	74	0.15040650406504066	102	0.281767955801105	99	0.17307692307692307	293	0.3865435356200528	a	0.978	-0.698139	0.03279	0.03702	0.109788	ENSG00000155918	ENST00000367341;ENST00000286380	T;T	0.00638	6.04;6.04	1.91	-3.81	0.04294	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00210	0.0006	L	0.40543	1.245	0.80722	P	0.0	B	0.32382	0.368	B	0.35114	0.196	T	0.28459	-1.0043	8	0.33940	T	0.23	.	3.8488	0.08946	0.218:0.4486:0.0:0.3334	.	106	Q5VY80	RET1L_HUMAN	R	106	ENSP00000356310:L106R;ENSP00000286380:L106R	ENSP00000286380:L106R	L	-	2	0	RAET1L	150384841	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.702000	0.00823	-2.111000	0.00836	0.402000	0.26972	CTT		0.488	RAET1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042676.1		NM_130900	
RGPD5	84220	hgsc.bcm.edu	37	2	110585652	110585652	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:110585652A>G	ENST00000016946.3	+	17	2551	c.2393A>G	c.(2392-2394)gAa>gGa	p.E798G	RGPD5_ENST00000272454.6_Missense_Mutation_p.E798G|RGPD5_ENST00000393283.1_Missense_Mutation_p.E798G	NM_005054.2	NP_005045.2	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5	798					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)				central_nervous_system(1)	1						TATTCTCCCGAAACACCACCT	0.328																																																	0													1.0	1.0	1.0					2																	110585652		1	2	3	SO:0001583	missense	84220			U64675	CCDS2082.1, CCDS2083.1	2q13	2013-01-10			ENSG00000015568	ENSG00000015568		"""Tetratricopeptide (TTC) repeat domain containing"""	32418	protein-coding gene	gene with protein product		612708				15710750, 15815621	Standard	NM_032260		Approved	RGP5, BS-63, DKFZp686I1842		Q99666	OTTHUMG00000130985	ENST00000016946.3:c.2393A>G	2.37:g.110585652A>G	ENSP00000016946:p.Glu798Gly	Somatic		WXS	SOLID	Phase_I	Q53QN2|Q53T03|Q59GM7|Q9H0B2	Missense_Mutation	SNP	ENST00000016946.3	37	CCDS2082.1	.	.	.	.	.	.	.	.	.	.	a	3.399	-0.122707	0.06795	.	.	ENSG00000015568	ENST00000393283;ENST00000272454;ENST00000016946	T;T;T	0.22743	1.94;1.94;1.94	1.79	0.592	0.17471	.	.	.	.	.	T	0.09992	0.0245	N	0.14661	0.345	0.54753	P	1.0999999999983245E-5	B;B	0.32526	0.017;0.374	B;B	0.29267	0.009;0.1	T	0.22312	-1.0220	8	0.40728	T	0.16	-12.6019	5.0209	0.14361	0.8224:0.0:0.1776:0.0	.	798;798	Q99666;Q99666-2	RGPD5_HUMAN;.	G	798	ENSP00000376962:E798G;ENSP00000272454:E798G;ENSP00000016946:E798G	ENSP00000016946:E798G	E	+	2	0	RGPD5	109942941	1.000000	0.71417	0.996000	0.52242	0.053000	0.15095	4.111000	0.57838	0.162000	0.19483	0.156000	0.16432	GAA		0.328	RGPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253599.3		NM_005054	
RGPD5	84220	hgsc.bcm.edu	37	2	110593536	110593536	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:110593536C>A	ENST00000016946.3	+	20	2996	c.2838C>A	c.(2836-2838)ttC>ttA	p.F946L		NM_005054.2	NP_005045.2	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5	946				F -> L (in Ref. 1; AAB41848). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)				central_nervous_system(1)	1						ATACTGGCTTCCAGGCTCAGG	0.423																																																	0													0.0	1.0	1.0					2																	110593536		0	4	4	SO:0001583	missense	84220			U64675	CCDS2082.1, CCDS2083.1	2q13	2013-01-10			ENSG00000015568	ENSG00000015568		"""Tetratricopeptide (TTC) repeat domain containing"""	32418	protein-coding gene	gene with protein product		612708				15710750, 15815621	Standard	NM_032260		Approved	RGP5, BS-63, DKFZp686I1842		Q99666	OTTHUMG00000130985	ENST00000016946.3:c.2838C>A	2.37:g.110593536C>A	ENSP00000016946:p.Phe946Leu	Somatic		WXS	SOLID	Phase_I	Q53QN2|Q53T03|Q59GM7|Q9H0B2	Missense_Mutation	SNP	ENST00000016946.3	37	CCDS2082.1	.	.	.	.	.	.	.	.	.	.	c	0.016	-1.528123	0.00959	.	.	ENSG00000015568	ENST00000016946	T	0.36520	1.25	.	.	.	.	.	.	.	.	T	0.19087	0.0458	N	0.25647	0.755	0.43913	P	0.003441999999999945	B	0.16802	0.019	B	0.12156	0.007	T	0.26883	-1.0090	7	0.20046	T	0.44	1.6924	2.6652	0.05046	0.0:0.5:0.0:0.5	.	946	Q99666	RGPD5_HUMAN	L	946	ENSP00000016946:F946L	ENSP00000016946:F946L	F	+	3	2	RGPD5	109950825	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.316000	0.19469	-0.000000	0.14550	0.000000	0.15137	TTC		0.423	RGPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253599.3		NM_005054	
RNF17	56163	hgsc.bcm.edu;ucsc.edu	37	13	25419107	25419107	+	Silent	SNP	G	G	C			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr13:25419107G>C	ENST00000255324.5	+	22	3043	c.2991G>C	c.(2989-2991)ctG>ctC	p.L997L	RNF17_ENST00000339524.3_Silent_p.L49L|RNF17_ENST00000381921.1_Silent_p.L997L	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	997	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AGGTCTTGCTGTATGATGTGG	0.318																																																	0													125.0	129.0	128.0					13																	25419107		2203	4300	6503	SO:0001819	synonymous_variant	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2991G>C	13.37:g.25419107G>C		Somatic		WXS	SOLID	Phase_I	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	37	CCDS9308.2																																																																																				0.318	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1		NM_031994	
SAP130	79595	hgsc.bcm.edu	37	2	128744480	128744480	+	Missense_Mutation	SNP	T	T	C	rs72841716	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:128744480T>C	ENST00000259235.3	-	14	2044	c.1915A>G	c.(1915-1917)Agt>Ggt	p.S639G	SAP130_ENST00000259234.6_Missense_Mutation_p.S612G|SAP130_ENST00000357702.5_Missense_Mutation_p.S639G	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	639					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		GGAGCAGCACTGAATGGATTG	0.562													T|||	3	0.000599042	0.0008	0.0	5008	,	,		20245	0.0		0.002	False		,,,				2504	0.0																0								T	GLY/SER,GLY/SER	8,4398	14.3+/-33.2	0,8,2195	107.0	93.0	98.0		1915,1915	6.2	1.0	2	dbSNP_130	98	114,8486	61.3+/-123.2	0,114,4186	yes	missense,missense	SAP130	NM_001145928.1,NM_024545.3	56,56	0,122,6381	CC,CT,TT		1.3256,0.1816,0.938	possibly-damaging,possibly-damaging	639/1084,639/1049	128744480	122,12884	2203	4300	6503	SO:0001583	missense	79595			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1915A>G	2.37:g.128744480T>C	ENSP00000259235:p.Ser639Gly	Somatic		WXS	SOLID	Phase_I	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	CCDS2153.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	18.93	3.728472	0.69074	0.001816	0.013256	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	6.17	6.17	0.99709	.	0.122517	0.85682	D	0.000000	T	0.50803	0.1637	L	0.27053	0.805	0.53005	D	0.999966	P;B;B;D;B	0.56746	0.89;0.001;0.001;0.977;0.001	B;B;B;P;B	0.54026	0.337;0.002;0.003;0.74;0.005	T	0.56938	-0.7896	9	0.45353	T	0.12	-15.6489	16.8222	0.85835	0.0:0.0:0.0:1.0	.	639;612;639;169;276	B7ZLM3;Q96DP1;Q9H0E3;Q9H0E3-2;B3KRT9	.;.;SP130_HUMAN;.;.	G	639;639;612	.	ENSP00000259234:S612G	S	-	1	0	SAP130	128460950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.452000	0.60054	2.371000	0.80710	0.533000	0.62120	AGT		0.562	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3		NM_024545	
SDCCAG3	10807	hgsc.bcm.edu	37	9	139297266	139297266	+	Missense_Mutation	SNP	C	C	T	rs17855450	byFrequency	TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr9:139297266C>T	ENST00000357365.3	-	10	1411	c.1282G>A	c.(1282-1284)Gtt>Att	p.V428I	SDCCAG3_ENST00000461693.1_5'UTR|SDCCAG3_ENST00000371725.3_Missense_Mutation_p.V355I|SDCCAG3_ENST00000298537.7_Missense_Mutation_p.V405I	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	428			V -> I (in dbSNP:rs17855450). {ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		TCGTCTTTAACTTCAGAAATT	0.468													T|||	80	0.0159744	0.0197	0.0346	5008	,	,		15404	0.0		0.0288	False		,,,				2504	0.001																0								T	ILE/VAL,ILE/VAL,ILE/VAL	112,3632		3,106,1763	45.0	45.0	45.0		1282,1063,1213	-0.1	0.1	9	dbSNP_123	45	260,7928		4,252,3838	no	missense,missense,missense	SDCCAG3	NM_001039707.1,NM_001039708.1,NM_006643.3	29,29,29	7,358,5601	TT,TC,CC		3.1754,2.9915,3.1177	benign,benign,benign	428/436,355/363,405/413	139297266	372,11560	1872	4094	5966	SO:0001583	missense	10807			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.1282G>A	9.37:g.139297266C>T	ENSP00000349929:p.Val428Ile	Somatic		WXS	SOLID	Phase_I	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	ENST00000357365.3	37	CCDS43904.1	43	0.019688644688644688	12	0.024390243902439025	16	0.04419889502762431	0	0.0	15	0.01978891820580475	t	0.008	-1.870053	0.00542	0.029915	0.031754	ENSG00000165689	ENST00000357365;ENST00000298537;ENST00000371725	T;T;T	0.14640	2.49;2.49;2.49	4.87	-0.113	0.13568	.	0.413716	0.25307	N	0.031603	T	0.00936	0.0031	N	0.04880	-0.145	0.09310	N	0.999994	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.41502	-0.9505	10	0.09590	T	0.72	-32.2999	5.4297	0.16446	0.0:0.3545:0.1494:0.496	rs17855450	355;405;428	Q96C92-4;Q96C92-2;Q96C92	.;.;SDCG3_HUMAN	I	428;405;355	ENSP00000349929:V428I;ENSP00000298537:V405I;ENSP00000360790:V355I	ENSP00000298537:V405I	V	-	1	0	SDCCAG3	138417087	0.080000	0.21391	0.089000	0.20774	0.041000	0.13682	-0.247000	0.08866	-0.225000	0.09913	-1.311000	0.01308	GTT		0.468	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2		NM_006643	
SLC17A1	6568	hgsc.bcm.edu	37	6	25801166	25801166	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr6:25801166C>A	ENST00000244527.4	-	11	1336	c.1221G>T	c.(1219-1221)atG>atT	p.M407I	SLC17A1_ENST00000427328.1_Missense_Mutation_p.M353I|SLC17A1_ENST00000468082.1_Missense_Mutation_p.M353I|SLC17A1_ENST00000476801.1_Missense_Mutation_p.M407I	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	407					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						GTCCTCCTATCATTCCAGTTA	0.308																																																	0													100.0	101.0	101.0					6																	25801166		2203	4297	6500	SO:0001583	missense	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.1221G>T	6.37:g.25801166C>A	ENSP00000244527:p.Met407Ile	Somatic		WXS	SOLID	Phase_I	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	C	2.747	-0.260991	0.05791	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.58506	0.53;0.33;0.53;0.33	3.67	-2.04	0.07343	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.991864	0.08187	N	0.984499	T	0.25457	0.0619	L	0.44542	1.39	0.09310	N	1	B;B	0.14012	0.008;0.009	B;B	0.14023	0.006;0.01	T	0.38693	-0.9649	10	0.46703	T	0.11	.	8.2326	0.31608	0.0:0.3966:0.0:0.6034	.	353;407	Q14916-2;Q14916	.;NPT1_HUMAN	I	407;353;407;353	ENSP00000244527:M407I;ENSP00000410549:M353I;ENSP00000420614:M407I;ENSP00000420546:M353I	ENSP00000244527:M407I	M	-	3	0	SLC17A1	25909145	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.579000	0.05834	-0.467000	0.06932	-0.345000	0.07892	ATG		0.308	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			
SLC8A1	6546	hgsc.bcm.edu	37	2	40392062	40392062	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:40392062delT	ENST00000403092.1	-	8	2134	c.2101delA	c.(2101-2103)atgfs	p.M701fs	SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1_ENST00000405901.3_Frame_Shift_Del_p.M696fs|SLC8A1_ENST00000542024.1_Frame_Shift_Del_p.M665fs|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000406391.2_Frame_Shift_Del_p.M665fs|SLC8A1_ENST00000405269.1_Frame_Shift_Del_p.M665fs|SLC8A1_ENST00000408028.2_Frame_Shift_Del_p.M693fs|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000406785.2_Frame_Shift_Del_p.M665fs|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1_ENST00000332839.4_Frame_Shift_Del_p.M701fs|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000402441.1_Frame_Shift_Del_p.M665fs|SLC8A1_ENST00000542756.1_Frame_Shift_Del_p.M696fs			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	701					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GGGCGCCCCATTTCTGCAATG	0.507																																																	0													189.0	180.0	183.0					2																	40392062		2203	4300	6503	SO:0001589	frameshift_variant	6546				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2101delA	2.37:g.40392062delT	ENSP00000384763:p.Met701fs	Somatic		WXS	SOLID	Phase_I	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Frame_Shift_Del	DEL	ENST00000403092.1	37	CCDS1806.1																																																																																				0.507	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1		NM_021097	
SP140	11262	hgsc.bcm.edu;ucsc.edu	37	2	231102997	231102997	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:231102997G>A	ENST00000392045.3	+	3	421	c.307G>A	c.(307-309)Gag>Aag	p.E103K	SP140_ENST00000544128.1_3'UTR|SP140_ENST00000417495.3_Missense_Mutation_p.E103K|SP140_ENST00000420434.3_Missense_Mutation_p.E103K|SP140_ENST00000343805.6_Missense_Mutation_p.E103K|SP140_ENST00000350136.5_Missense_Mutation_p.E83K|SP140_ENST00000486687.2_Missense_Mutation_p.E103K|SP140_ENST00000373645.3_Missense_Mutation_p.E103K	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	103	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CAGTGAACTGGAGAAGACATT	0.393																																																	0													127.0	116.0	120.0					2																	231102997		2203	4300	6503	SO:0001583	missense	11262			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.307G>A	2.37:g.231102997G>A	ENSP00000375899:p.Glu103Lys	Somatic		WXS	SOLID	Phase_I	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604966	0.66445	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	D;D;D;D;D;D	0.95238	-3.65;-3.65;-3.65;-3.65;-3.65;-3.65	3.49	2.58	0.30949	Sp100 (2);	.	.	.	.	D	0.96414	0.8830	M	0.78456	2.415	0.26302	N	0.977955	D;D;D;D;D;D	0.69078	0.997;0.99;0.987;0.995;0.995;0.99	D;D;P;D;D;D	0.77557	0.989;0.917;0.792;0.99;0.97;0.917	D	0.89629	0.3854	9	0.87932	D	0	-27.1049	8.5506	0.33449	0.0:0.2521:0.7479:0.0	.	103;103;103;103;103;103	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75;Q6NSG4	.;.;.;LY10_HUMAN;.;.	K	103;103;103;83;103;103;103;103;103	ENSP00000440107:E103K;ENSP00000345846:E83K;ENSP00000375899:E103K;ENSP00000342096:E103K;ENSP00000398210:E103K;ENSP00000362749:E103K	ENSP00000342096:E103K	E	+	1	0	SP140	230811241	1.000000	0.71417	0.992000	0.48379	0.745000	0.42441	1.540000	0.36115	0.985000	0.38656	0.655000	0.94253	GAG		0.393	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1		NM_007237	
SPANXD	64648	hgsc.bcm.edu	37	X	140785696	140785696	+	Missense_Mutation	SNP	T	T	C	rs2983592		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chrX:140785696T>C	ENST00000370515.3	-	2	553	c.220A>G	c.(220-222)Aag>Gag	p.K74E		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	74						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					ATTCTGTTCTTTCGGGCGTGG	0.438																																																	0													214.0	187.0	196.0					X																	140785696		2199	4270	6469	SO:0001583	missense	64648			AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.220A>G	X.37:g.140785696T>C	ENSP00000359546:p.Lys74Glu	Somatic		WXS	SOLID	Phase_I	Q5JWI1	Missense_Mutation	SNP	ENST00000370515.3	37	CCDS14675.1	.	.	.	.	.	.	.	.	.	.	N	0	-2.710851	0.00094	.	.	ENSG00000196406	ENST00000370515	T	0.03889	3.77	.	.	.	.	.	.	.	.	T	0.01387	0.0045	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42515	-0.9447	5	0.02654	T	1	.	.	.	.	rs2983592;rs5954409;rs17855379;rs17855768	74	Q9BXN6	SPNXD_HUMAN	E	74	ENSP00000359546:K74E	ENSP00000359546:K74E	K	-	1	0	SPANXD	140613362	0.011000	0.17503	0.004000	0.12327	0.004000	0.04260	-2.049000	0.01405	-2.041000	0.00915	-2.024000	0.00429	AAG		0.438	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058598.1			
TFDP2	7029	hgsc.bcm.edu;ucsc.edu	37	3	141678681	141678681	+	Splice_Site	SNP	A	A	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr3:141678681A>G	ENST00000489671.1	-	11	1316	c.886T>C	c.(886-888)Ttt>Ctt	p.F296L	TFDP2_ENST00000499676.2_Splice_Site_p.F236L|TFDP2_ENST00000486111.1_Splice_Site_p.F236L|TFDP2_ENST00000467072.1_Splice_Site_p.F236L|TFDP2_ENST00000310282.6_Splice_Site_p.F236L|TFDP2_ENST00000397991.4_Splice_Site_p.F268L|TFDP2_ENST00000479040.1_Splice_Site_p.F235L|TFDP2_ENST00000317104.7_Splice_Site_p.F220L|TFDP2_ENST00000495310.1_Splice_Site_p.F199L|TFDP2_ENST00000477292.1_Splice_Site_p.F160L			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	296	DCB2.				gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						AGATACTCAAACCTGCATCAG	0.408																																																	0													87.0	82.0	83.0					3																	141678681		1921	4153	6074	SO:0001630	splice_region_variant	7029			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.885-1T>C	3.37:g.141678681A>G		Somatic		WXS	SOLID	Phase_I	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Missense_Mutation	SNP	ENST00000489671.1	37	CCDS54650.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.32|17.32	3.360093|3.360093	0.61403|0.61403	.|.	.|.	ENSG00000114126|ENSG00000114126	ENST00000499676;ENST00000489671;ENST00000486111;ENST00000477292;ENST00000495310;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991;ENST00000467667|ENST00000474279	T;T;T;T;T;T;T;T;T;T;T|.	0.44083|.	1.93;1.91;1.93;0.94;0.93;1.93;1.93;1.93;1.93;1.91;1.58|.	5.59|5.59	5.59|5.59	0.84812|0.84812	Transcription factor DP, C-terminal (1);|.	0.064498|.	0.64402|.	D|.	0.000006|.	T|T	0.64294|0.64294	0.2585|0.2585	L|L	0.48986|0.48986	1.54|1.54	0.80722|0.80722	D|D	1|1	B;P;P|.	0.45428|.	0.004;0.78;0.858|.	B;B;B|.	0.39465|.	0.009;0.3;0.256|.	T|T	0.61628|0.61628	-0.7024|-0.7024	10|5	0.23891|.	T|.	0.37|.	-5.9357|-5.9357	15.7656|15.7656	0.78123|0.78123	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	199;296;236|.	B7Z8L5;Q14188;Q14188-5|.	.;TFDP2_HUMAN;.|.	L|A	236;296;236;160;199;236;220;236;235;268;236|9	ENSP00000439782:F236L;ENSP00000420616:F296L;ENSP00000420599:F236L;ENSP00000418971:F160L;ENSP00000419036:F199L;ENSP00000418590:F236L;ENSP00000315668:F220L;ENSP00000309622:F236L;ENSP00000417585:F235L;ENSP00000381078:F268L;ENSP00000417726:F236L|.	ENSP00000309622:F236L|.	F|V	-|-	1|2	0|0	TFDP2|TFDP2	143161371|143161371	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	8.773000|8.773000	0.91762|0.91762	2.133000|2.133000	0.65898|0.65898	0.379000|0.379000	0.24179|0.24179	TTT|GTT		0.408	TFDP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353294.4		NM_006286	Missense_Mutation
TK2	7084	hgsc.bcm.edu;ucsc.edu	37	16	66582905	66582905	+	Missense_Mutation	SNP	T	T	A	rs281865500		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr16:66582905T>A	ENST00000451102.2	-	2	482	c.132A>T	c.(130-132)gaA>gaT	p.E44D	TK2_ENST00000417693.3_Missense_Mutation_p.E44D|TK2_ENST00000527284.1_Missense_Mutation_p.E13D|TK2_ENST00000527800.1_5'UTR|Y_RNA_ENST00000563151.1_lincRNA|TK2_ENST00000525974.1_5'UTR|TK2_ENST00000564917.1_Missense_Mutation_p.E44D|TK2_ENST00000545043.2_Missense_Mutation_p.E44D|TK2_ENST00000299697.7_Missense_Mutation_p.E86D|TK2_ENST00000563369.2_5'UTR|TK2_ENST00000544898.1_5'UTR			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial	44					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		CTTTTTCCTGTTCTTTATCTA	0.318																																																	0			GRCh37	CD084235	TK2	D							135.0	149.0	144.0					16																	66582905		2200	4300	6500	SO:0001583	missense	7084				CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.132A>T	16.37:g.66582905T>A	ENSP00000414334:p.Glu44Asp	Somatic		WXS	SOLID	Phase_I	B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	Missense_Mutation	SNP	ENST00000451102.2	37	CCDS10805.2	.	.	.	.	.	.	.	.	.	.	T	12.91	2.080891	0.36758	.	.	ENSG00000166548	ENST00000299697;ENST00000417693;ENST00000545043;ENST00000451102;ENST00000527284	D;D;D;D;D	0.98762	-5.11;-4.78;-4.62;-5.07;-5.12	4.44	3.34	0.38264	.	0.728684	0.13466	N	0.385761	D	0.90851	0.7126	N	0.00621	-1.32	0.80722	D	1	B;B;B;B;B	0.29766	0.039;0.011;0.256;0.039;0.25	B;B;B;B;B	0.30105	0.014;0.01;0.052;0.014;0.111	D	0.86530	0.1821	10	0.20046	T	0.44	-8.1341	6.6408	0.22909	0.0:0.108:0.0:0.892	.	86;44;8;86;13	Q8IZR3;O00142;A4IF54;E5KNQ5;O00142-2	.;KITM_HUMAN;.;.;.	D	86;44;44;44;13	ENSP00000299697:E86D;ENSP00000407469:E44D;ENSP00000438143:E44D;ENSP00000414334:E44D;ENSP00000435312:E13D	ENSP00000299697:E86D	E	-	3	2	TK2	65140406	1.000000	0.71417	0.985000	0.45067	0.893000	0.52053	3.242000	0.51384	0.847000	0.35167	0.496000	0.49642	GAA		0.318	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268806.4			
TLR5	7100	hgsc.bcm.edu;ucsc.edu	37	1	223284112	223284112	+	Silent	SNP	G	G	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr1:223284112G>T	ENST00000540964.1	-	4	2723	c.2262C>A	c.(2260-2262)atC>atA	p.I754I	TLR5_ENST00000342210.6_Silent_p.I754I			O60602	TLR5_HUMAN	toll-like receptor 5	754	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.		Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1). {ECO:0000269|PubMed:14623910}.		cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		CAAGACAAACGATCTTTCTAC	0.468																																																	0													93.0	84.0	87.0					1																	223284112		2203	4300	6503	SO:0001819	synonymous_variant	7100				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.2262C>A	1.37:g.223284112G>T		Somatic		WXS	SOLID	Phase_I	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Silent	SNP	ENST00000540964.1	37	CCDS31033.1																																																																																				0.468	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_003268	
TNFSF9	8744	hgsc.bcm.edu;ucsc.edu	37	19	6534712	6534712	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr19:6534712G>A	ENST00000245817.3	+	3	438	c.400G>A	c.(400-402)Gtg>Atg	p.V134M		NM_003811.3	NP_003802.1	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily, member 9	134					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	5						GAAGGAGCTGGTGGTGGCCAA	0.627																																																	0													61.0	62.0	61.0					19																	6534712		2188	4297	6485	SO:0001583	missense	8744			U03398	CCDS12169.1	19p13.3	2008-07-22				ENSG00000125657		"""Tumor necrosis factor (ligand) superfamily"""	11939	protein-coding gene	gene with protein product	"""receptor 4-1BB ligand"", ""homolog of mouse 4-1BB-L"""	606182				8405064, 8088337	Standard	NM_003811		Approved	4-1BB-L	uc002mfh.2	P41273		ENST00000245817.3:c.400G>A	19.37:g.6534712G>A	ENSP00000245817:p.Val134Met	Somatic		WXS	SOLID	Phase_I	Q2M3S2	Missense_Mutation	SNP	ENST00000245817.3	37	CCDS12169.1	.	.	.	.	.	.	.	.	.	.	g	8.771	0.926001	0.18056	.	.	ENSG00000125657	ENST00000245817	D	0.95656	-3.77	4.13	1.91	0.25777	Tumour necrosis factor (3);Tumour necrosis factor-like (2);Tumour necrosis factor, conserved site (1);	0.580192	0.14030	N	0.346209	D	0.90628	0.7061	L	0.35723	1.085	0.30330	N	0.786739	P	0.49358	0.923	B	0.40636	0.335	D	0.86901	0.2054	10	0.54805	T	0.06	-25.8663	7.0743	0.25195	0.2355:0.0:0.7645:0.0	.	134	P41273	TNFL9_HUMAN	M	134	ENSP00000245817:V134M	ENSP00000245817:V134M	V	+	1	0	TNFSF9	6485712	1.000000	0.71417	0.994000	0.49952	0.082000	0.17680	0.685000	0.25378	0.866000	0.35629	0.466000	0.42574	GTG		0.627	TNFSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457856.1		NM_003811	
TSPYL1	7259	hgsc.bcm.edu;ucsc.edu	37	6	116600312	116600312	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr6:116600312G>T	ENST00000368608.3	-	1	754	c.682C>A	c.(682-684)Cgc>Agc	p.R228S	DSE_ENST00000452085.3_5'Flank|DSE_ENST00000540275.1_Intron|RP1-93H18.1_ENST00000449314.1_lincRNA	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	228					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		GGGTCCATGCGGAGAGCCTCA	0.602																																																	0													56.0	53.0	54.0					6																	116600312		2203	4300	6503	SO:0001583	missense	7259			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.682C>A	6.37:g.116600312G>T	ENSP00000357597:p.Arg228Ser	Somatic		WXS	SOLID	Phase_I	O75885|Q5TFE6	Missense_Mutation	SNP	ENST00000368608.3	37	CCDS34518.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.587794	0.28268	.	.	ENSG00000189241	ENST00000368608	T	0.28895	1.59	4.4	3.52	0.40303	.	0.000000	0.35495	N	0.003174	T	0.03827	0.0108	N	0.02830	-0.485	0.29271	N	0.870693	B	0.24092	0.097	B	0.27715	0.082	T	0.41088	-0.9528	10	0.08599	T	0.76	-6.4395	10.6155	0.45447	0.0:0.1938:0.8062:0.0	.	228	Q9H0U9	TSYL1_HUMAN	S	228	ENSP00000357597:R228S	ENSP00000357597:R228S	R	-	1	0	TSPYL1	116707005	0.701000	0.27806	0.871000	0.34182	0.983000	0.72400	1.604000	0.36804	1.439000	0.47511	0.561000	0.74099	CGC		0.602	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1			
TTN	7273	hgsc.bcm.edu	37	2	179407913	179407913	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:179407913T>G	ENST00000591111.1	-	297	92088	c.91864A>C	c.(91864-91866)Act>Cct	p.T30622P	TTN-AS1_ENST00000456053.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T23390P|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T32263P|TTN_ENST00000342992.6_Missense_Mutation_p.T29695P|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T23323P|TTN_ENST00000460472.2_Missense_Mutation_p.T23198P|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30622	Fibronectin type-III 123. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAGTAACAGTGTGCTCTAGG	0.458																																																	0													231.0	221.0	225.0					2																	179407913		1931	4148	6079	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.91864A>C	2.37:g.179407913T>G	ENSP00000465570:p.Thr30622Pro	Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.16	2.451614	0.43531	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	5.61	5.61	0.85477	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75072	0.3800	M	0.72479	2.2	0.58432	D	0.999994	D;D;D;D	0.67145	0.992;0.992;0.992;0.996	D;D;D;D	0.74023	0.967;0.967;0.967;0.982	T	0.78155	-0.2314	9	0.87932	D	0	.	16.1025	0.81194	0.0:0.0:0.0:1.0	.	23198;23323;23390;30622	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	29695;23198;23390;23323;23195	ENSP00000343764:T29695P;ENSP00000434586:T23198P;ENSP00000340554:T23390P;ENSP00000352154:T23323P	ENSP00000340554:T23390P	T	-	1	0	TTN	179116159	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	7.997000	0.88414	2.254000	0.74563	0.533000	0.62120	ACT		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
TTN	7273	hgsc.bcm.edu;ucsc.edu	37	2	179614382	179614382	+	Intron	SNP	C	C	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr2:179614382C>T	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E4249K|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGACAGGCTCCACTGTTAGA	0.338																																																	0													55.0	60.0	59.0					2																	179614382		2199	4297	6496	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3468G>A	2.37:g.179614382C>T		Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.77	2.037876	0.35989	.	.	ENSG00000155657	ENST00000360870	T	0.39997	1.05	6.06	6.06	0.98353	.	.	.	.	.	T	0.28300	0.0699	N	0.24115	0.695	0.80722	D	1	P	0.42296	0.775	B	0.39660	0.306	T	0.08330	-1.0727	9	0.05525	T	0.97	.	16.3127	0.82898	0.0:0.8328:0.1672:0.0	.	4249	Q8WZ42-6	.	K	4249	ENSP00000354117:E4249K	ENSP00000354117:E4249K	E	-	1	0	TTN	179322627	0.774000	0.28592	0.957000	0.39632	0.436000	0.31835	1.498000	0.35660	2.882000	0.98803	0.655000	0.94253	GAG		0.338	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
USP6	9098	hgsc.bcm.edu	37	17	5036784	5036784	+	Missense_Mutation	SNP	C	C	T	rs78476887		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:5036784C>T	ENST00000574788.1	+	14	2553	c.323C>T	c.(322-324)cCg>cTg	p.P108L	USP6_ENST00000332776.4_Missense_Mutation_p.P108L|USP6_ENST00000304328.5_5'UTR|USP6_ENST00000250066.6_Missense_Mutation_p.P108L|USP6_ENST00000572429.1_3'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	108	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ATCCGGGGCCCGGTGTGGTCA	0.532			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													90.0	105.0	100.0					17																	5036784		2203	4300	6503	SO:0001583	missense	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.323C>T	17.37:g.5036784C>T	ENSP00000460380:p.Pro108Leu	Somatic		WXS	SOLID	Phase_I	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	C	1.818	-0.473059	0.04445	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.35048	1.33;1.33	0.862	-1.72	0.08107	Rab-GAP/TBC domain (4);	0.095810	0.64402	D	0.000001	T	0.12561	0.0305	N	0.04508	-0.205	0.80722	D	1	B;B	0.10296	0.001;0.003	B;B	0.04013	0.0;0.001	T	0.12426	-1.0548	10	0.87932	D	0	.	1.466	0.02406	0.333:0.3387:0.0:0.3283	.	108;108	B9A6N0;P35125	.;UBP6_HUMAN	L	108	ENSP00000328010:P108L;ENSP00000250066:P108L	ENSP00000250066:P108L	P	+	2	0	USP6	4977508	0.988000	0.35896	0.017000	0.16124	0.017000	0.09413	-0.026000	0.12392	-1.410000	0.02035	-1.404000	0.01136	CCG		0.532	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1		NM_004505	
VPS13B	157680	hgsc.bcm.edu;ucsc.edu	37	8	100871685	100871685	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr8:100871685C>A	ENST00000358544.2	+	57	11207	c.11096C>A	c.(11095-11097)tCg>tAg	p.S3699*	VPS13B_ENST00000357162.2_Nonsense_Mutation_p.S3674*|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3699					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GGGACCACATCGTTTGTAAAG	0.507																																					Colon(161;2205 2542 7338 31318)												0													54.0	59.0	57.0					8																	100871685		2203	4300	6503	SO:0001587	stop_gained	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.11096C>A	8.37:g.100871685C>A	ENSP00000351346:p.Ser3699*	Somatic		WXS	SOLID	Phase_I	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	53	20.419327	0.99930	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	.	.	.	5.93	5.93	0.95920	.	0.127489	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3363	0.98740	0.0:1.0:0.0:0.0	.	.	.	.	X	3674;3699	.	ENSP00000349685:S3674X	S	+	2	0	VPS13B	100940861	1.000000	0.71417	0.111000	0.21465	0.667000	0.39255	7.487000	0.81328	2.814000	0.96858	0.563000	0.77884	TCG		0.507	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	
ZFAT	57623	hgsc.bcm.edu	37	8	135621044	135621044	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr8:135621044A>T	ENST00000377838.3	-	5	887	c.713T>A	c.(712-714)cTg>cAg	p.L238Q	ZFAT_ENST00000523399.1_Missense_Mutation_p.L176Q|ZFAT_ENST00000520727.1_Missense_Mutation_p.L226Q|ZFAT_ENST00000520356.1_Missense_Mutation_p.L226Q|ZFAT_ENST00000429442.2_Missense_Mutation_p.L226Q|ZFAT_ENST00000520214.1_Missense_Mutation_p.L226Q	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	238					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCGAGGCACCAGGTCTGCTGA	0.493																																																	0													101.0	100.0	100.0					8																	135621044		1932	4125	6057	SO:0001583	missense	57623			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.713T>A	8.37:g.135621044A>T	ENSP00000367069:p.Leu238Gln	Somatic		WXS	SOLID	Phase_I	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.373595	0.42105	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946;ENST00000522257	T;T;T;T;T;T;T	0.44881	2.9;2.83;2.87;2.85;2.83;2.9;0.91	5.94	4.8	0.61643	.	0.415345	0.22937	N	0.053836	T	0.17280	0.0415	N	0.08118	0	0.27963	N	0.936717	B;B;B;B	0.28850	0.205;0.144;0.225;0.055	B;B;B;B	0.23574	0.02;0.014;0.047;0.01	T	0.07597	-1.0764	10	0.19590	T	0.45	-15.0079	3.3842	0.07265	0.6769:0.0:0.1388:0.1843	.	176;226;226;238	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	Q	226;226;226;238;226;226;176;226;176	ENSP00000427879:L226Q;ENSP00000427831:L226Q;ENSP00000394501:L226Q;ENSP00000367069:L238Q;ENSP00000428483:L226Q;ENSP00000429091:L176Q;ENSP00000429983:L176Q	ENSP00000326997:L226Q	L	-	2	0	ZFAT	135690226	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	3.038000	0.49783	2.279000	0.76181	0.459000	0.35465	CTG		0.493	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1		NM_001029939	
ZNF19	7567	hgsc.bcm.edu;ucsc.edu	37	16	71512809	71512809	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr16:71512809C>A	ENST00000288177.5	-	4	388	c.133G>T	c.(133-135)Gag>Tag	p.E45*	ZNF19_ENST00000564230.1_Nonsense_Mutation_p.E45*|ZNF19_ENST00000565637.1_Nonsense_Mutation_p.E3*|ZNF19_ENST00000567225.1_Nonsense_Mutation_p.E45*|ZNF19_ENST00000565100.2_Intron|AC010547.9_ENST00000561908.1_Nonsense_Mutation_p.E45*	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		CCAAAATTCTCCAACATCACA	0.512																																																	0													160.0	161.0	161.0					16																	71512809		2198	4300	6498	SO:0001587	stop_gained	7567			X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.133G>T	16.37:g.71512809C>A	ENSP00000288177:p.Glu45*	Somatic		WXS	SOLID	Phase_I	A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Nonsense_Mutation	SNP	ENST00000288177.5	37	CCDS10901.1	.	.	.	.	.	.	.	.	.	.	C	37	6.524517	0.97637	.	.	ENSG00000157429	ENST00000288177	.	.	.	3.0	3.0	0.34707	.	0.000000	0.34879	N	0.003617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.243	0.54553	0.0:1.0:0.0:0.0	.	.	.	.	X	45	.	ENSP00000288177:E45X	E	-	1	0	ZNF19	70070310	0.139000	0.22563	1.000000	0.80357	0.893000	0.52053	0.221000	0.17680	1.977000	0.57605	0.563000	0.77884	GAG		0.512	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268993.2		NM_006961	
ZNF286A	57335	hgsc.bcm.edu;ucsc.edu	37	17	15620445	15620445	+	Silent	SNP	C	C	T	rs375693547		TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr17:15620445C>T	ENST00000464847.2	+	5	1960	c.1407C>T	c.(1405-1407)agC>agT	p.S469S	ZNF286A_ENST00000421016.1_Silent_p.S469S|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000583566.1_Silent_p.S469S|ZNF286A_ENST00000413242.2_Silent_p.S469S|ZNF286A_ENST00000593105.1_Silent_p.S459S|ZNF286A_ENST00000395894.2_3'UTR			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		ACAAATGTAGCGAGTGTGGAA	0.403																																																	0								T	,	1,4405		0,1,2202	67.0	71.0	70.0		1407,1407	0.2	0.6	17	dbSNP_134	70	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	ZNF286A	NM_001130842.1,NM_020652.2	,	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	,	469/522,469/522	15620445	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	57335			AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.1407C>T	17.37:g.15620445C>T		Somatic		WXS	SOLID	Phase_I	B4DKF9|Q96JF3	Silent	SNP	ENST00000464847.2	37	CCDS11172.1																																																																																				0.403	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4		NM_020652	
ZBTB21	49854	hgsc.bcm.edu	37	21	43412479	43412479	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr21:43412479C>G	ENST00000310826.5	-	3	1909	c.1726G>C	c.(1726-1728)Gct>Cct	p.A576P	ZBTB21_ENST00000398511.3_Missense_Mutation_p.A576P|ZBTB21_ENST00000465968.1_Intron|ZBTB21_ENST00000398499.1_Missense_Mutation_p.A576P|ZBTB21_ENST00000398505.3_Intron	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	576					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										ATGTCACAAGCGTAGGGCTTT	0.428																																																	0													158.0	153.0	155.0					21																	43412479		2203	4300	6503	SO:0001583	missense	0			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.1726G>C	21.37:g.43412479C>G	ENSP00000308759:p.Ala576Pro	Somatic		WXS	SOLID	Phase_I	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620131	0.87460	.	.	ENSG00000173276	ENST00000310826;ENST00000398499;ENST00000398511	T;T;T	0.15372	2.43;2.43;2.43	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.29620	0.0739	N	0.16266	0.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.09443	-1.0674	10	0.52906	T	0.07	-12.9037	19.7842	0.96430	0.0:1.0:0.0:0.0	.	576	Q9ULJ3	ZN295_HUMAN	P	576	ENSP00000308759:A576P;ENSP00000381512:A576P;ENSP00000381523:A576P	ENSP00000308759:A576P	A	-	1	0	ZNF295	42285548	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.277000	0.58939	2.676000	0.91093	0.591000	0.81541	GCT		0.428	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1		NM_020727	
ZNF641	121274	hgsc.bcm.edu;ucsc.edu	37	12	48739161	48739161	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr12:48739161T>A	ENST00000544117.2	-	4	1123	c.415A>T	c.(415-417)Atg>Ttg	p.M139L	ZNF641_ENST00000547026.1_Missense_Mutation_p.M125L|ZNF641_ENST00000301042.3_Missense_Mutation_p.M139L|ZNF641_ENST00000448928.3_Intron			Q96N77	ZN641_HUMAN	zinc finger protein 641	139	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	12						TTTTCCTGCATGACATATTCT	0.522																																																	0													95.0	90.0	92.0					12																	48739161		2203	4300	6503	SO:0001583	missense	121274			BC018090	CCDS8763.1, CCDS53787.1, CCDS53788.1	12q13.11	2013-01-08				ENSG00000167528		"""Zinc fingers, C2H2-type"", ""-"""	31834	protein-coding gene	gene with protein product		613906					Standard	NM_152320		Approved	FLJ31295	uc001rro.2	Q96N77		ENST00000544117.2:c.415A>T	12.37:g.48739161T>A	ENSP00000437832:p.Met139Leu	Somatic		WXS	SOLID	Phase_I	B3KS43|B4DNU5|Q8TCQ7|Q8WVE1	Missense_Mutation	SNP	ENST00000544117.2	37	CCDS8763.1	.	.	.	.	.	.	.	.	.	.	T	8.317	0.823436	0.16678	.	.	ENSG00000167528	ENST00000301042;ENST00000544117;ENST00000547026	T;T;T	0.03181	4.02;4.02;4.02	5.54	5.54	0.83059	Krueppel-associated box (4);	0.000000	0.85682	D	0.000000	T	0.11750	0.0286	L	0.48877	1.53	0.38262	D	0.9419	P	0.44309	0.832	P	0.61275	0.886	T	0.11518	-1.0584	10	0.34782	T	0.22	.	13.9163	0.63899	0.0:0.0:0.0:1.0	.	139	Q96N77	ZN641_HUMAN	L	139;139;125	ENSP00000301042:M139L;ENSP00000437832:M139L;ENSP00000449974:M125L	ENSP00000301042:M139L	M	-	1	0	ZNF641	47025428	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.352000	0.52239	2.243000	0.73865	0.533000	0.62120	ATG		0.522	ZNF641-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406518.1		NM_152320	
ZNF641	121274	hgsc.bcm.edu;ucsc.edu	37	12	48739179	48739179	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4338-01A-01D-1806-10	TCGA-BP-4338-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88266e1d-89b9-41e6-b662-08d144ab0f46	74c2011d-6135-4074-a0de-fedf3b6caa64	g.chr12:48739179A>T	ENST00000544117.2	-	4	1105	c.397T>A	c.(397-399)Ttt>Att	p.F133I	ZNF641_ENST00000547026.1_Missense_Mutation_p.F119I|ZNF641_ENST00000301042.3_Missense_Mutation_p.F133I|ZNF641_ENST00000448928.3_Intron			Q96N77	ZN641_HUMAN	zinc finger protein 641	133	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	12						TCTCCATAAAAGTCTGTCTGA	0.493																																																	0													86.0	84.0	85.0					12																	48739179		2203	4300	6503	SO:0001583	missense	121274			BC018090	CCDS8763.1, CCDS53787.1, CCDS53788.1	12q13.11	2013-01-08				ENSG00000167528		"""Zinc fingers, C2H2-type"", ""-"""	31834	protein-coding gene	gene with protein product		613906					Standard	NM_152320		Approved	FLJ31295	uc001rro.2	Q96N77		ENST00000544117.2:c.397T>A	12.37:g.48739179A>T	ENSP00000437832:p.Phe133Ile	Somatic		WXS	SOLID	Phase_I	B3KS43|B4DNU5|Q8TCQ7|Q8WVE1	Missense_Mutation	SNP	ENST00000544117.2	37	CCDS8763.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442969	0.63067	.	.	ENSG00000167528	ENST00000301042;ENST00000544117;ENST00000547026;ENST00000548932	T;T;T;T	0.01902	4.57;4.57;4.57;4.57	5.54	5.54	0.83059	Krueppel-associated box (4);	0.091491	0.48767	D	0.000171	T	0.07143	0.0181	L	0.61218	1.895	0.38260	D	0.941853	D	0.55605	0.972	P	0.57204	0.815	T	0.04153	-1.0973	10	0.72032	D	0.01	.	8.4684	0.32971	0.9134:0.0:0.0866:0.0	.	133	Q96N77	ZN641_HUMAN	I	133;133;119;133	ENSP00000301042:F133I;ENSP00000437832:F133I;ENSP00000449974:F119I;ENSP00000448810:F133I	ENSP00000301042:F133I	F	-	1	0	ZNF641	47025446	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.945000	0.56637	2.243000	0.73865	0.533000	0.62120	TTT		0.493	ZNF641-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406518.1		NM_152320	
