#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADD1	118	hgsc.bcm.edu	37	4	2900254	2900254	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr4:2900254T>C	ENST00000398129.1	+	7	1000	c.980T>C	c.(979-981)aTc>aCc	p.I327T	ADD1_ENST00000503455.2_Missense_Mutation_p.I327T|ADD1_ENST00000398123.2_Missense_Mutation_p.I327T|ADD1_ENST00000264758.7_Missense_Mutation_p.I327T|ADD1_ENST00000513328.2_Missense_Mutation_p.I327T|ADD1_ENST00000398125.1_Missense_Mutation_p.I327T|ADD1_ENST00000355842.3_Missense_Mutation_p.I327T|ADD1_ENST00000446856.1_Missense_Mutation_p.I327T			P35611	ADDA_HUMAN	adducin 1 (alpha)	327					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCCTGTGAGATCCAGGTAGGG	0.468																																					Esophageal Squamous(71;505 1201 20414 34538 37449)												0													116.0	106.0	109.0					4																	2900254		2203	4300	6503	SO:0001583	missense	118			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.980T>C	4.37:g.2900254T>C	ENSP00000381197:p.Ile327Thr	Somatic		WXS	SOLID	Phase_I	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	37	CCDS43205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.1|20.1	3.937711|3.937711	0.73557|0.73557	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398125;ENST00000398124;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129|ENST00000514940	T;T;T;T;T;T;T;T|.	0.25414|.	1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Class II aldolase/adducin, N-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.48822|0.48822	0.1521|0.1521	N|N	0.16016|0.16016	0.355|0.355	0.80722|0.80722	D|D	1|1	P;P;P;D;P;B;D;B|.	0.67145|.	0.859;0.859;0.859;0.996;0.859;0.324;0.996;0.374|.	P;P;P;D;P;B;D;B|.	0.87578|.	0.585;0.759;0.585;0.998;0.585;0.076;0.99;0.124|.	T|T	0.46289|0.46289	-0.9202|-0.9202	10|5	0.18710|.	T|.	0.47|.	-29.1602|-29.1602	15.8933|15.8933	0.79318|0.79318	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	327;327;327;327;327;327;327;327|.	E7ENY0;E7EV99;B4DI79;Q86XM2;P35611;P35611-3;P35611-2;A2A3N8|.	.;.;.;.;ADDA_HUMAN;.;.;.|.	T|P	327|33	ENSP00000264758:I327T;ENSP00000399828:I327T;ENSP00000381193:I327T;ENSP00000421907:I327T;ENSP00000423024:I327T;ENSP00000348100:I327T;ENSP00000381191:I327T;ENSP00000381197:I327T|.	ENSP00000264758:I327T|.	I|S	+|+	2|1	0|0	ADD1|ADD1	2870052|2870052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.909000|0.909000	0.53808|0.53808	7.951000|7.951000	0.87819|0.87819	2.158000|2.158000	0.67659|0.67659	0.533000|0.533000	0.62120|0.62120	ATC|TCC		0.468	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1		NM_014189	
AQP7	364	hgsc.bcm.edu	37	9	33387073	33387073	+	Silent	SNP	G	G	A	rs73645276		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr9:33387073G>A	ENST00000539936.1	-	4	400	c.162C>T	c.(160-162)tcC>tcT	p.S54S	AQP7_ENST00000377425.4_5'UTR|AQP7_ENST00000541274.1_Intron|AQP7_ENST00000537089.1_Intron			O14520	AQP7_HUMAN	aquaporin 7	54					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TATGGGCCACGGAACCAAGGC	0.562													g|||	1	0.000199681	0.0	0.0	5008	,	,		18264	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001819	synonymous_variant	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000539936.1:c.162C>T	9.37:g.33387073G>A		Somatic		WXS	SOLID	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000539936.1	37																																																																																					0.562	AQP7-203	KNOWN	basic	protein_coding	protein_coding			NM_001170	
ARHGAP22	58504	hgsc.bcm.edu;ucsc.edu	37	10	49812835	49812835	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr10:49812835T>A	ENST00000249601.4	-	1	303	c.7A>T	c.(7-9)Agc>Tgc	p.S3C	ARHGAP22_ENST00000491108.1_5'UTR|ARHGAP22_ENST00000435790.2_Intron|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.S3C	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	3					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						ATCTTTGGGCTCAGCATGTTC	0.612																																																	0													125.0	96.0	106.0					10																	49812835		2203	4300	6503	SO:0001583	missense	58504			AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.7A>T	10.37:g.49812835T>A	ENSP00000249601:p.Ser3Cys	Somatic		WXS	SOLID	Phase_I	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.237258	0.79800	.	.	ENSG00000128805	ENST00000249601;ENST00000417912	T;T	0.13196	2.64;2.61	4.65	4.65	0.58169	.	.	.	.	.	T	0.26159	0.0638	L	0.36672	1.1	0.32778	N	0.502926	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.85130	0.994;0.997;0.994	T	0.22068	-1.0227	9	0.62326	D	0.03	.	10.7407	0.46152	0.0:0.0:0.0:1.0	.	3;3;3	A6NDI7;Q7Z5H3-2;Q7Z5H3	.;.;RHG22_HUMAN	C	3	ENSP00000249601:S3C;ENSP00000412461:S3C	ENSP00000249601:S3C	S	-	1	0	ARHGAP22	49482841	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.219000	0.58561	1.869000	0.54173	0.533000	0.62120	AGC		0.612	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1		NM_021226	
BARD1	580	hgsc.bcm.edu;ucsc.edu	37	2	215595187	215595187	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr2:215595187T>G	ENST00000260947.4	-	10	2083	c.1949A>C	c.(1948-1950)aAg>aCg	p.K650T	BARD1_ENST00000449967.2_Missense_Mutation_p.K506T|BARD1_ENST00000432456.1_Missense_Mutation_p.K21T	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	650	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AATTTCATACTTTTCTTCCTG	0.353									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																																								0													121.0	121.0	121.0					2																	215595187		2203	4300	6503	SO:0001583	missense	580	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.1949A>C	2.37:g.215595187T>G	ENSP00000260947:p.Lys650Thr	Somatic		WXS	SOLID	Phase_I	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Missense_Mutation	SNP	ENST00000260947.4	37	CCDS2397.1	.	.	.	.	.	.	.	.	.	.	T	10.19	1.282817	0.23392	.	.	ENSG00000138376	ENST00000260947;ENST00000432456;ENST00000449967;ENST00000421162	T;T;T;T	0.58210	0.35;1.89;0.35;0.35	5.77	0.266	0.15617	BRCT (2);	0.299003	0.36409	N	0.002615	T	0.36248	0.0960	L	0.47716	1.5	0.28778	N	0.899993	B;B	0.29862	0.032;0.259	B;B	0.21546	0.013;0.035	T	0.17410	-1.0370	10	0.42905	T	0.14	-3.9076	5.012	0.14317	0.1111:0.0674:0.4418:0.3797	.	506;650	E7EUI3;Q99728	.;BARD1_HUMAN	T	650;21;506;199	ENSP00000260947:K650T;ENSP00000405020:K21T;ENSP00000406752:K506T;ENSP00000392245:K199T	ENSP00000260947:K650T	K	-	2	0	BARD1	215303432	0.993000	0.37304	0.934000	0.37439	0.956000	0.61745	2.290000	0.43531	0.095000	0.17434	-0.321000	0.08615	AAG		0.353	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1		NM_000465	
C9orf64	84267	hgsc.bcm.edu;ucsc.edu	37	9	86570341	86570341	+	Silent	SNP	C	C	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr9:86570341C>T	ENST00000376344.3	-	2	768	c.552G>A	c.(550-552)ctG>ctA	p.L184L	C9orf64_ENST00000314700.1_Silent_p.L43L|C9orf64_ENST00000376340.2_Silent_p.L43L	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	184										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTTCAACCACCAGGTGCATTA	0.423																																																	0													60.0	55.0	57.0					9																	86570341		2203	4300	6503	SO:0001819	synonymous_variant	84267			AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.552G>A	9.37:g.86570341C>T		Somatic		WXS	SOLID	Phase_I	B2RPI6|Q8N2B1|Q9BT18	Silent	SNP	ENST00000376344.3	37	CCDS6666.2																																																																																				0.423	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1		NM_032307	
CNTNAP1	8506	hgsc.bcm.edu	37	17	40839832	40839832	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr17:40839832G>T	ENST00000264638.4	+	8	1356	c.1139G>T	c.(1138-1140)cGt>cTt	p.R380L	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	380					axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.R380H(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TTCCCACGCCGTGGCCGCCTG	0.637																																																	1	Substitution - Missense(1)	breast(1)											91.0	84.0	87.0					17																	40839832		2203	4300	6503	SO:0001583	missense	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1139G>T	17.37:g.40839832G>T	ENSP00000264638:p.Arg380Leu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875262	0.33162	.	.	ENSG00000108797	ENST00000264638	T	0.78595	-1.19	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.101216	0.42420	D	0.000708	T	0.65698	0.2716	L	0.40543	1.245	0.35176	D	0.772019	B	0.29232	0.238	B	0.26693	0.072	T	0.66352	-0.5945	10	0.10636	T	0.68	.	11.7866	0.52045	0.081:0.0:0.919:0.0	.	380	P78357	CNTP1_HUMAN	L	380	ENSP00000264638:R380L	ENSP00000264638:R380L	R	+	2	0	CNTNAP1	38093358	1.000000	0.71417	0.160000	0.22671	0.418000	0.31294	4.577000	0.60922	2.302000	0.77476	0.655000	0.94253	CGT		0.637	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1		NM_003632	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388429	1388429	+	Missense_Mutation	SNP	G	G	A	rs79298048	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr4:1388429G>A	ENST00000324803.4	+	1	3090	c.130G>A	c.(130-132)Gcc>Acc	p.A44T		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	44					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CGGAGTGCCCGCCTGCTCACA	0.662													N|||	944	0.188498	0.062	0.2853	5008	,	,		16920	0.0536		0.3797	False		,,,				2504	0.2331																0								G	THR/ALA	508,3898		29,450,1724	219.0	210.0	213.0		130	-1.5	0.0	4	dbSNP_131	213	3442,5158		673,2096,1531	no	missense	CRIPAK	NM_175918.3	58	702,2546,3255	AA,AG,GG		40.0233,11.5297,30.3706	benign	44/447	1388429	3950,9056	2203	4300	6503	SO:0001583	missense	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.130G>A	4.37:g.1388429G>A	ENSP00000323978:p.Ala44Thr	Somatic		WXS	SOLID	Phase_I	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	438	0.20054945054945056	28	0.056910569105691054	99	0.27348066298342544	38	0.06643356643356643	273	0.36015831134564646	-	6.138	0.393672	0.11638	0.115297	0.400233	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.24350	1.86	1.11	-1.54	0.08584	Post-SET domain (1);	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.39748	0.686	B	0.17722	0.019	T	0.47484	-0.9114	8	0.36615	T	0.2	.	3.7735	0.08650	0.1991:0.2527:0.5481:0.0	.	44	Q8N1N5	CRPAK_HUMAN	T	44;37	ENSP00000323978:A44T	ENSP00000323978:A44T	A	+	1	0	CRIPAK	1378429	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.619000	0.05572	-0.466000	0.06943	0.413000	0.27773	GCC		0.662	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2		NM_175918	
PIH1D3	139212	hgsc.bcm.edu;ucsc.edu	37	X	106462183	106462183	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chrX:106462183G>A	ENST00000372453.3	+	4	378	c.316G>A	c.(316-318)Gtt>Att	p.V106I	PIH1D3_ENST00000336387.4_Missense_Mutation_p.V106I|PIH1D3_ENST00000535523.1_Missense_Mutation_p.V106I	NM_173494.1	NP_775765.1	Q9NQM4	PIHD3_HUMAN	PIH1 domain containing 3	106																	TATGTGGGATGTTAGAGAAAT	0.373																																																	0													81.0	78.0	79.0					X																	106462183		2203	4300	6503	SO:0001583	missense	0			AL136112	CCDS14528.1	Xq22.3	2014-05-20	2012-07-18	2012-07-18	ENSG00000080572	ENSG00000080572			28570	protein-coding gene	gene with protein product	"""sarcoma antigen NY-SAR-97"""		"""chromosome X open reading frame 41"""	CXorf41		12601173, 24421334	Standard	NM_001169154		Approved	MGC35261, NYSAR97	uc004enc.3	Q9NQM4	OTTHUMG00000022160	ENST00000372453.3:c.316G>A	X.37:g.106462183G>A	ENSP00000361531:p.Val106Ile	Somatic		WXS	SOLID	Phase_I	D3DUX5|Q86WE1	Missense_Mutation	SNP	ENST00000372453.3	37	CCDS14528.1	.	.	.	.	.	.	.	.	.	.	g	3.404	-0.121664	0.06838	.	.	ENSG00000080572	ENST00000372453;ENST00000535523;ENST00000336387	.	.	.	5.79	1.89	0.25635	.	0.605495	0.17466	N	0.173271	T	0.31918	0.0812	L	0.51422	1.61	0.09310	N	1	B	0.13145	0.007	B	0.12837	0.008	T	0.21177	-1.0253	9	0.36615	T	0.2	-8.5895	5.0996	0.14753	0.3035:0.2676:0.4288:0.0	.	106	Q9NQM4	CX041_HUMAN	I	106	.	ENSP00000337757:V106I	V	+	1	0	CXorf41	106348839	0.175000	0.23083	0.185000	0.23176	0.435000	0.31806	0.728000	0.26013	0.203000	0.20529	0.597000	0.82753	GTT		0.373	PIH1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057832.1		NM_173494	
DBNDD1	79007	hgsc.bcm.edu	37	16	90075259	90075259	+	Silent	SNP	C	C	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr16:90075259C>T	ENST00000002501.6	-	3	383	c.252G>A	c.(250-252)tcG>tcA	p.S84S	DBNDD1_ENST00000568838.1_Silent_p.S204S|DBNDD1_ENST00000392973.3_Silent_p.S90S|DBNDD1_ENST00000304733.3_Silent_p.S104S	NM_001042610.1	NP_001036075.1	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 1	84						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		GCTCCTGGTCCGACATGTCGG	0.642																																																	0													35.0	40.0	39.0					16																	90075259		2031	4173	6204	SO:0001819	synonymous_variant	79007			AK090696	CCDS10991.2, CCDS42223.1, CCDS73931.1	16q24.3	2008-02-05			ENSG00000003249	ENSG00000003249			28455	protein-coding gene	gene with protein product						12477932	Standard	NM_001288708		Approved	MGC3101, FLJ12582	uc002fqe.1	Q9H9R9	OTTHUMG00000138984	ENST00000002501.6:c.252G>A	16.37:g.90075259C>T		Somatic		WXS	SOLID	Phase_I	B4DQS3|Q69YT2|Q9BW25	Silent	SNP	ENST00000002501.6	37	CCDS42223.1																																																																																				0.642	DBNDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272872.1		NM_024043	
DCHS2	54798	hgsc.bcm.edu	37	4	155410650	155410650	+	Missense_Mutation	SNP	T	T	C	rs72731014	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr4:155410650T>C	ENST00000339452.1	-	1	2218	c.1858A>G	c.(1858-1860)Act>Gct	p.T620A	DCHS2_ENST00000443500.1_Missense_Mutation_p.T620A|DCHS2_ENST00000456341.2_Missense_Mutation_p.T613A	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1747	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CGGTCTAGAGTCCGGATAGTG	0.592													T|||	866	0.172923	0.0386	0.3084	5008	,	,		18744	0.1558		0.2137	False		,,,				2504	0.2342																0								T	ALA/THR,ALA/THR	77,1307		6,65,621	46.0	48.0	48.0		1858,1858	0.7	0.1	4	dbSNP_130	48	550,2632		56,438,1097	yes	missense,missense	DCHS2	NM_001142552.1,NM_001142553.1	58,58	62,503,1718	CC,CT,TT		17.2847,5.5636,13.7319	,	620/1370,620/710	155410650	627,3939	692	1591	2283	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1858A>G	4.37:g.155410650T>C	ENSP00000345062:p.Thr620Ala	Somatic		WXS	SOLID	Phase_I	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	37	CCDS47150.1	359	0.16437728937728938	17	0.034552845528455285	96	0.26519337016574585	81	0.14160839160839161	165	0.21767810026385223	T	1.685	-0.505419	0.04261	0.055636	0.172847	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.49432	0.78;0.78;0.78	5.17	0.658	0.17855	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.004	T	0.30238	-0.9985	7	0.07644	T	0.81	.	0.3221	0.00305	0.2522:0.2199:0.1358:0.3921	.	620;620	E9PG03;E9PC11	.;.	A	620;620;613;620	ENSP00000345062:T620A;ENSP00000408543:T613A;ENSP00000395539:T620A	ENSP00000345062:T620A	T	-	1	0	DCHS2	155630100	0.000000	0.05858	0.103000	0.21229	0.887000	0.51463	-0.488000	0.06497	0.308000	0.22923	0.455000	0.32223	ACT		0.592	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1		NM_001142552	
DMGDH	29958	hgsc.bcm.edu;ucsc.edu	37	5	78322310	78322310	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr5:78322310A>T	ENST00000255189.3	-	13	2155	c.2127T>A	c.(2125-2127)aaT>aaA	p.N709K	DMGDH_ENST00000540686.1_Missense_Mutation_p.N329K|DMGDH_ENST00000380311.4_Missense_Mutation_p.N508K	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	709					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		AGGTTCCAAAATTGTCGATTC	0.463																																																	0													119.0	107.0	111.0					5																	78322310		2203	4300	6503	SO:0001583	missense	29958			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.2127T>A	5.37:g.78322310A>T	ENSP00000255189:p.Asn709Lys	Somatic		WXS	SOLID	Phase_I	B2RBN0|B4E1J9	Missense_Mutation	SNP	ENST00000255189.3	37	CCDS4044.1	.	.	.	.	.	.	.	.	.	.	A	16.79	3.221163	0.58560	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000540686;ENST00000539598	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	5.32	-1.49	0.08718	Glycine cleavage T-protein, N-terminal (1);	0.181260	0.56097	D	0.000021	T	0.80613	0.4656	M	0.80183	2.485	0.42403	D	0.99257	D;P;P;P	0.53745	0.962;0.735;0.704;0.539	P;B;B;P	0.57425	0.82;0.444;0.361;0.493	T	0.78196	-0.2298	10	0.31617	T	0.26	.	12.6753	0.56891	0.3922:0.0:0.6078:0.0	.	329;508;559;709	B4E1J9;F8W6P8;F5H1C7;Q9UI17	.;.;.;M2GD_HUMAN	K	709;548;508;329;559	ENSP00000255189:N709K;ENSP00000430972:N548K;ENSP00000369667:N508K;ENSP00000439478:N329K	ENSP00000255189:N709K	N	-	3	2	DMGDH	78358066	0.997000	0.39634	0.966000	0.40874	0.965000	0.64279	0.399000	0.20916	-0.507000	0.06549	0.459000	0.35465	AAT		0.463	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3		NM_013391	
EEA1	8411	hgsc.bcm.edu	37	12	93192687	93192687	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr12:93192687T>C	ENST00000322349.8	-	21	3212	c.2948A>G	c.(2947-2949)aAa>aGa	p.K983R		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	983	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						AACAGCAATTTTAAGCTCTCC	0.308																																																	0													117.0	112.0	114.0					12																	93192687		2202	4299	6501	SO:0001583	missense	8411			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2948A>G	12.37:g.93192687T>C	ENSP00000317955:p.Lys983Arg	Somatic		WXS	SOLID	Phase_I	Q14221	Missense_Mutation	SNP	ENST00000322349.8	37	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.469259	0.26423	.	.	ENSG00000102189	ENST00000322349	T	0.65549	-0.16	5.49	4.35	0.52113	.	0.104244	0.41712	N	0.000830	T	0.62804	0.2458	L	0.27053	0.805	0.19300	N	0.999971	D	0.69078	0.997	D	0.73380	0.98	T	0.52578	-0.8557	10	0.22706	T	0.39	.	8.7856	0.34818	0.0:0.0865:0.0:0.9135	.	983	Q15075	EEA1_HUMAN	R	983	ENSP00000317955:K983R	ENSP00000317955:K983R	K	-	2	0	EEA1	91716818	0.975000	0.34042	0.019000	0.16419	0.171000	0.22731	3.045000	0.49838	0.918000	0.36919	0.482000	0.46254	AAA		0.308	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1		NM_003566	
ERMP1	79956	hgsc.bcm.edu;ucsc.edu	37	9	5801303	5801303	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr9:5801303C>T	ENST00000339450.5	-	11	2029	c.1940G>A	c.(1939-1941)aGc>aAc	p.S647N	ERMP1_ENST00000543230.1_Missense_Mutation_p.S225N|ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_3'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	647						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TTTTTTTGTGCTCTTGGCAAG	0.338																																																	0													136.0	142.0	140.0					9																	5801303		2203	4300	6503	SO:0001583	missense	79956			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.1940G>A	9.37:g.5801303C>T	ENSP00000340427:p.Ser647Asn	Somatic		WXS	SOLID	Phase_I	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.633128	0.29068	.	.	ENSG00000099219	ENST00000339450;ENST00000543230	T;T	0.22945	1.93;1.93	5.62	4.53	0.55603	.	0.106181	0.85682	D	0.000000	T	0.16514	0.0397	N	0.24115	0.695	0.80722	D	1	B	0.19200	0.034	B	0.19391	0.025	T	0.06588	-1.0818	10	0.17832	T	0.49	-9.5938	11.9233	0.52803	0.0:0.8511:0.0:0.1489	.	647	Q7Z2K6	ERMP1_HUMAN	N	647;225	ENSP00000340427:S647N;ENSP00000439368:S225N	ENSP00000340427:S647N	S	-	2	0	ERMP1	5791303	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	4.148000	0.58085	2.666000	0.90696	0.650000	0.86243	AGC		0.338	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1		NM_024896	
ESM1	11082	hgsc.bcm.edu;ucsc.edu	37	5	54277855	54277855	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr5:54277855T>G	ENST00000381405.4	-	2	566	c.421A>C	c.(421-423)Aag>Cag	p.K141Q	ESM1_ENST00000598310.1_Intron|ESM1_ENST00000381403.4_Intron	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	141					angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)			breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			TTGGAAGACTTGGTTACTGAA	0.438																																																	0													128.0	123.0	125.0					5																	54277855		2203	4300	6503	SO:0001583	missense	11082			X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.421A>C	5.37:g.54277855T>G	ENSP00000370812:p.Lys141Gln	Somatic		WXS	SOLID	Phase_I	B2R4G3|Q15330|Q3V4E3|Q96ES3	Missense_Mutation	SNP	ENST00000381405.4	37	CCDS3963.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.157137	0.38119	.	.	ENSG00000164283	ENST00000381405	.	.	.	5.9	0.745	0.18359	.	0.449748	0.23704	N	0.045382	T	0.27027	0.0662	L	0.32530	0.975	0.09310	N	0.999993	B	0.28713	0.22	B	0.27500	0.08	T	0.16512	-1.0400	9	0.52906	T	0.07	-11.6222	6.452	0.21908	0.0:0.1865:0.1214:0.6921	.	141	Q9NQ30	ESM1_HUMAN	Q	141	.	ENSP00000370812:K141Q	K	-	1	0	ESM1	54313612	0.993000	0.37304	0.024000	0.17045	0.609000	0.37215	2.204000	0.42761	0.502000	0.28037	-0.468000	0.05107	AAG		0.438	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2		NM_007036	
GPR45	11250	hgsc.bcm.edu;ucsc.edu	37	2	105859154	105859154	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr2:105859154G>A	ENST00000258456.1	+	1	955	c.839G>A	c.(838-840)tGg>tAg	p.W280*		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						TCCCTCTGCTGGCTGCCCCAC	0.607																																																	0													187.0	179.0	182.0					2																	105859154		2203	4300	6503	SO:0001587	stop_gained	11250			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.839G>A	2.37:g.105859154G>A	ENSP00000258456:p.Trp280*	Somatic		WXS	SOLID	Phase_I	Q6NWS4|Q6NXU6	Nonsense_Mutation	SNP	ENST00000258456.1	37	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	G	37	6.113469	0.97296	.	.	ENSG00000135973	ENST00000258456	.	.	.	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.5508	17.1015	0.86651	0.0:0.0:1.0:0.0	.	.	.	.	X	280	.	ENSP00000258456:W280X	W	+	2	0	GPR45	105225586	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.522000	0.60539	2.365000	0.80145	0.462000	0.41574	TGG		0.607	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1		NM_007227	
GRIN2A	2903	hgsc.bcm.edu	37	16	9857305	9857305	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr16:9857305G>A	ENST00000396573.2	-	14	4405	c.4096C>T	c.(4096-4098)Cct>Tct	p.P1366S	GRIN2A_ENST00000535259.1_Intron|GRIN2A_ENST00000330684.3_Missense_Mutation_p.P1366S|GRIN2A_ENST00000562109.1_Intron|GRIN2A_ENST00000404927.2_Intron|GRIN2A_ENST00000396575.2_Missense_Mutation_p.P1366S	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1366			P -> L (found in a cutaneous malignant melanoma sample; somatic mutation). {ECO:0000269|PubMed:21499247}.		directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGGAGGAAAGGGTTATCGGAG	0.547																																																	0													77.0	72.0	73.0					16																	9857305		2197	4300	6497	SO:0001583	missense	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.4096C>T	16.37:g.9857305G>A	ENSP00000379818:p.Pro1366Ser	Somatic		WXS	SOLID	Phase_I	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517343	0.64634	.	.	ENSG00000183454	ENST00000396573;ENST00000330684;ENST00000396575	T;T;T	0.52754	0.65;0.65;0.65	5.61	4.65	0.58169	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.047498	0.85682	N	0.000000	T	0.54759	0.1878	M	0.80746	2.51	0.80722	D	1	B	0.27700	0.186	B	0.35859	0.212	T	0.54964	-0.8214	9	.	.	.	.	14.0274	0.64594	0.0725:0.0:0.9275:0.0	.	1366	Q12879	NMDE1_HUMAN	S	1366	ENSP00000379818:P1366S;ENSP00000332549:P1366S;ENSP00000379820:P1366S	.	P	-	1	0	GRIN2A	9764806	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.302000	0.96175	1.503000	0.48686	0.655000	0.94253	CCT		0.547	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			
GRK5	2869	hgsc.bcm.edu;ucsc.edu	37	10	121190918	121190918	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr10:121190918G>A	ENST00000392870.2	+	8	946	c.617G>A	c.(616-618)cGg>cAg	p.R206Q	GRK5_ENST00000369108.3_Missense_Mutation_p.R101Q	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		TGCCAGGTTCGGGCCACGGGT	0.597																																																	0													64.0	57.0	59.0					10																	121190918		2203	4300	6503	SO:0001583	missense	2869			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.617G>A	10.37:g.121190918G>A	ENSP00000376609:p.Arg206Gln	Somatic		WXS	SOLID	Phase_I	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672722	0.88445	.	.	ENSG00000198873	ENST00000392870;ENST00000457057;ENST00000369108	T;T	0.65364	-0.15;-0.15	5.47	5.47	0.80525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000052	T	0.80138	0.4568	M	0.73753	2.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.993;0.995	T	0.81788	-0.0772	10	0.72032	D	0.01	-7.2677	19.3484	0.94374	0.0:0.0:1.0:0.0	.	206;206	B2R7K0;P34947	.;GRK5_HUMAN	Q	206;101;101	ENSP00000376609:R206Q;ENSP00000358104:R101Q	ENSP00000358104:R101Q	R	+	2	0	GRK5	121180908	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	9.827000	0.99397	2.570000	0.86706	0.655000	0.94253	CGG		0.597	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2		NM_005308	
ILVBL	10994	hgsc.bcm.edu	37	19	15229993	15229993	+	Silent	SNP	A	A	G	rs1131177	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr19:15229993A>G	ENST00000263383.3	-	9	1174	c.1035T>C	c.(1033-1035)gaT>gaC	p.D345D	ILVBL_ENST00000534378.1_Silent_p.D238D|ILVBL_ENST00000531635.1_5'Flank	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	345						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						GGACAATGACATCCGCCTTCT	0.627													A|||	1129	0.225439	0.0265	0.2752	5008	,	,		17072	0.3323		0.1968	False		,,,				2504	0.3783																0								A		237,4169	138.8+/-174.5	6,225,1972	74.0	66.0	69.0		1035	-5.4	0.1	19	dbSNP_86	69	1716,6884	313.0+/-311.1	164,1388,2748	no	coding-synonymous	ILVBL	NM_006844.3		170,1613,4720	GG,GA,AA		19.9535,5.379,15.0161		345/633	15229993	1953,11053	2203	4300	6503	SO:0001819	synonymous_variant	10994			U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1035T>C	19.37:g.15229993A>G		Somatic		WXS	SOLID	Phase_I	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Silent	SNP	ENST00000263383.3	37	CCDS12325.1																																																																																				0.627	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1		NM_006844	
ITGA11	22801	hgsc.bcm.edu;ucsc.edu	37	15	68661592	68661592	+	Silent	SNP	A	A	G			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr15:68661592A>G	ENST00000315757.7	-	3	281	c.195T>C	c.(193-195)aaT>aaC	p.N65N	ITGA11_ENST00000423218.2_Silent_p.N65N	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	65					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TCTGGTAGCCATTGGTTTCCA	0.562																																																	0													109.0	110.0	109.0					15																	68661592		1996	4176	6172	SO:0001819	synonymous_variant	22801			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.195T>C	15.37:g.68661592A>G		Somatic		WXS	SOLID	Phase_I	J3KQM2|Q8WYI8|Q9UKQ1	Silent	SNP	ENST00000315757.7	37	CCDS45291.1																																																																																				0.562	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			NM_012211	
LRRC7	57554	hgsc.bcm.edu;ucsc.edu	37	1	70555438	70555438	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:70555438G>A	ENST00000035383.5	+	23	4397	c.4367G>A	c.(4366-4368)gGc>gAc	p.G1456D	LRRC7_ENST00000415775.2_Missense_Mutation_p.G740D|LRRC7_ENST00000310961.5_Missense_Mutation_p.G1414D	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1456	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AAGAATCCTGGCCTTGGATTT	0.294																																																	0													96.0	99.0	98.0					1																	70555438		2202	4299	6501	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4367G>A	1.37:g.70555438G>A	ENSP00000035383:p.Gly1456Asp	Somatic		WXS	SOLID	Phase_I	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328816	0.81690	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.30981	1.51;1.51;1.51	5.48	5.48	0.80851	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.45296	0.1335	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.97110	0.959;0.999;1.0	T	0.23868	-1.0176	10	0.44086	T	0.13	.	17.9073	0.88923	0.0:0.0:1.0:0.0	.	740;1409;1456	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	D	1414;1456;740;1232	ENSP00000309245:G1414D;ENSP00000035383:G1456D;ENSP00000394867:G740D	ENSP00000035383:G1456D	G	+	2	0	LRRC7	70328026	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.075000	0.94004	2.569000	0.86673	0.591000	0.81541	GGC		0.294	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1		NM_020794	
MLLT6	4302	hgsc.bcm.edu	37	17	36875827	36875827	+	Missense_Mutation	SNP	T	T	C	rs62620198	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr17:36875827T>C	ENST00000325718.7	+	13	2091	c.2000T>C	c.(1999-2001)cTg>cCg	p.L667P	CTB-58E17.9_ENST00000579499.1_RNA|MIR4726_ENST00000577947.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	667					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					CAGGAGAGTCTGTCTTCCATG	0.667			T	MLL	AL								T|||	7	0.00139776	0.0008	0.0	5008	,	,		14886	0.0		0.006	False		,,,				2504	0.0							Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	0								T	PRO/LEU	8,4394	11.4+/-27.6	0,8,2193	24.0	24.0	24.0		2000	4.7	1.0	17	dbSNP_129	24	92,8506	47.6+/-106.9	0,92,4207	yes	missense	MLLT6	NM_005937.3	98	0,100,6400	CC,CT,TT		1.07,0.1817,0.7692	probably-damaging	667/1094	36875827	100,12900	2201	4299	6500	SO:0001583	missense	4302				CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.2000T>C	17.37:g.36875827T>C	ENSP00000316426:p.Leu667Pro	Somatic		WXS	SOLID	Phase_I	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	ENST00000325718.7	37	CCDS11327.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	T	22.9	4.354093	0.82243	0.001817	0.0107	ENSG00000108292	ENST00000325718	T	0.11169	2.8	4.73	4.73	0.59995	.	0.151343	0.39341	N	0.001385	T	0.16854	0.0405	L	0.40543	1.245	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.995	T	0.00677	-1.1614	10	0.39692	T	0.17	.	13.3355	0.60515	0.0:0.0:0.0:1.0	rs62620198	121;667	Q96I32;P55198	.;AF17_HUMAN	P	667	ENSP00000316426:L667P	ENSP00000316426:L667P	L	+	2	0	MLLT6	34129353	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.116000	0.71571	1.895000	0.54865	0.418000	0.28097	CTG		0.667	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1		NM_005937	
MPHOSPH6	10200	hgsc.bcm.edu	37	16	82203742	82203742	+	Silent	SNP	T	T	C	rs1134847	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr16:82203742T>C	ENST00000258169.4	-	1	89	c.39A>G	c.(37-39)ctA>ctG	p.L13L	MPHOSPH6_ENST00000563504.1_5'UTR|CTD-2588J6.2_ENST00000563841.1_lincRNA|MPHOSPH6_ENST00000569021.1_Silent_p.L13L|MPHOSPH6_ENST00000567729.1_5'UTR	NM_005792.2	NP_005783.2	Q99547	MPH6_HUMAN	M-phase phosphoprotein 6	13					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(3)	5						TCATGCGCAGTAGATTCTTGG	0.711													C|||	3218	0.642572	0.4054	0.8127	5008	,	,		13310	0.7649		0.7465	False		,,,				2504	0.6094																0								C		2116,2282		524,1068,607	32.0	24.0	27.0		39	2.6	1.0	16	dbSNP_86	27	6335,2261		2348,1639,311	no	coding-synonymous	MPHOSPH6	NM_005792.2		2872,2707,918	CC,CT,TT		26.3029,48.1128,34.9623		13/161	82203742	8451,4543	2199	4298	6497	SO:0001819	synonymous_variant	10200			X98263	CCDS10937.1	16q23.3	2008-03-03			ENSG00000135698	ENSG00000135698			7214	protein-coding gene	gene with protein product		605500				8885239	Standard	NM_005792		Approved	MPP6	uc002fgw.3	Q99547	OTTHUMG00000137632	ENST00000258169.4:c.39A>G	16.37:g.82203742T>C		Somatic		WXS	SOLID	Phase_I	B2RAF0	Silent	SNP	ENST00000258169.4	37	CCDS10937.1																																																																																				0.711	MPHOSPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269058.1		NM_005792	
MTCH2	23788	hgsc.bcm.edu	37	11	47663986	47663986	+	Missense_Mutation	SNP	C	C	T	rs72909898		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr11:47663986C>T	ENST00000302503.3	-	1	189	c.32G>A	c.(31-33)gGc>gAc	p.G11D	MTCH2_ENST00000542981.1_5'UTR	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	11					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						GAGACCGGAGCCCAGGAGCAC	0.692																																																	0													27.0	24.0	25.0					11																	47663986		2192	4283	6475	SO:0001583	missense	23788			AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.32G>A	11.37:g.47663986C>T	ENSP00000303222:p.Gly11Asp	Somatic		WXS	SOLID	Phase_I	B2R7L8	Missense_Mutation	SNP	ENST00000302503.3	37	CCDS7943.1	261	0.11950549450549451	90	0.18292682926829268	28	0.07734806629834254	52	0.09090909090909091	91	0.12005277044854881	c	33	5.245186	0.95272	.	.	ENSG00000109919	ENST00000302503;ENST00000530428	D;D	0.82711	-1.64;-1.64	4.21	4.21	0.49690	Mitochondrial carrier domain (1);	0.158380	0.56097	D	0.000031	T	0.00815	0.0027	M	0.83012	2.62	0.80722	D	1	B	0.33238	0.403	B	0.35899	0.213	T	0.34403	-0.9830	10	0.87932	D	0	-0.9377	15.9047	0.79419	0.0:1.0:0.0:0.0	.	11	Q9Y6C9	MTCH2_HUMAN	D	11	ENSP00000303222:G11D;ENSP00000432043:G11D	ENSP00000303222:G11D	G	-	2	0	MTCH2	47620562	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.066000	0.57520	2.344000	0.79699	0.550000	0.68814	GGC		0.692	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391921.2		NM_014342	
MTF1	4520	hgsc.bcm.edu;ucsc.edu	37	1	38300849	38300849	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:38300849T>C	ENST00000373036.4	-	6	1032	c.892A>G	c.(892-894)Aaa>Gaa	p.K298E		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	298					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTGAATGTTTTCTCACAGCCA	0.383																																																	0													251.0	219.0	230.0					1																	38300849		2203	4300	6503	SO:0001583	missense	4520			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.892A>G	1.37:g.38300849T>C	ENSP00000362127:p.Lys298Glu	Somatic		WXS	SOLID	Phase_I	B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	37	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241773	0.79912	.	.	ENSG00000188786	ENST00000373036;ENST00000543396	T	0.27104	1.69	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.048684	0.85682	D	0.000000	T	0.31009	0.0783	M	0.69185	2.1	0.53688	D	0.999978	P	0.39717	0.684	B	0.38378	0.272	T	0.19418	-1.0306	10	0.72032	D	0.01	.	14.7119	0.69238	0.0:0.0:0.0:1.0	.	298	Q14872	MTF1_HUMAN	E	298;166	ENSP00000362127:K298E	ENSP00000362127:K298E	K	-	1	0	MTF1	38073436	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.883000	0.87264	1.878000	0.54408	0.528000	0.53228	AAA		0.383	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2		NM_005955	
MTRR	4552	hgsc.bcm.edu;ucsc.edu	37	5	7897260	7897260	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr5:7897260G>T	ENST00000264668.2	+	14	1963	c.1933G>T	c.(1933-1935)Gag>Tag	p.E645*	MTRR_ENST00000440940.2_Nonsense_Mutation_p.E618*	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	645					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TGTTGGGGAGGAGGAAGCCCC	0.453																																																	0													88.0	87.0	87.0					5																	7897260		2203	4300	6503	SO:0001587	stop_gained	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1933G>T	5.37:g.7897260G>T	ENSP00000264668:p.Glu645*	Somatic		WXS	SOLID	Phase_I	O60471|Q32MA9|Q7Z4M8	Nonsense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	G	35	5.588505	0.96590	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	.	.	.	5.4	5.4	0.78164	.	0.348339	0.33610	N	0.004722	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-12.6306	14.253	0.66033	0.0:0.1502:0.8498:0.0	.	.	.	.	X	645;618	.	ENSP00000264668:E645X	E	+	1	0	MTRR	7950260	0.936000	0.31750	0.021000	0.16686	0.640000	0.38277	2.254000	0.43214	2.508000	0.84585	0.655000	0.94253	GAG		0.453	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			
NBPF3	84224	hgsc.bcm.edu	37	1	21806631	21806631	+	Silent	SNP	G	G	T	rs200384063		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:21806631G>T	ENST00000318249.5	+	11	1646	c.1296G>T	c.(1294-1296)ctG>ctT	p.L432L	NBPF3_ENST00000454000.2_Silent_p.L362L|NBPF3_ENST00000342104.5_Silent_p.L420L|NBPF3_ENST00000318220.6_Silent_p.L376L	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	432	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTGAGTACCTGGAACTGCCTG	0.473																																																	0													84.0	52.0	64.0					1																	21806631		2145	3610	5755	SO:0001819	synonymous_variant	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1296G>T	1.37:g.21806631G>T		Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	37	CCDS216.1																																																																																				0.473	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NBPF3	84224	hgsc.bcm.edu	37	1	21806710	21806710	+	Missense_Mutation	SNP	T	T	A	rs12034222		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:21806710T>A	ENST00000318249.5	+	11	1725	c.1375T>A	c.(1375-1377)Ttg>Atg	p.L459M	NBPF3_ENST00000454000.2_Missense_Mutation_p.L389M|NBPF3_ENST00000342104.5_Missense_Mutation_p.L447M|NBPF3_ENST00000318220.6_Missense_Mutation_p.L403M	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	459	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.		L -> V (in dbSNP:rs12034222). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCTCTTGACTTGGACAGTGA	0.473																																																	0													59.0	33.0	42.0					1																	21806710		2179	4004	6183	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1375T>A	1.37:g.21806710T>A	ENSP00000316782:p.Leu459Met	Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.022	-1.412298	0.01145	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21	0.658	-1.32	0.09201	DUF1220 (2);	.	.	.	.	T	0.01627	0.0052	N	0.00436	-1.5	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.33189	-0.9878	8	0.17832	T	0.49	.	.	.	.	.	447;459	Q9H094-3;Q9H094	.;NBPF3_HUMAN	M	389;403;459;447;403	ENSP00000415711:L389M;ENSP00000316739:L403M;ENSP00000316782:L459M;ENSP00000340336:L447M;ENSP00000391865:L403M	ENSP00000316739:L403M	L	+	1	2	NBPF3	21679297	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.156000	0.03160	-3.568000	0.00140	-3.751000	0.00022	TTG		0.473	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NBPF3	84224	hgsc.bcm.edu	37	1	21808250	21808250	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:21808250C>G	ENST00000318249.5	+	13	1944	c.1594C>G	c.(1594-1596)Ctt>Gtt	p.L532V	NBPF3_ENST00000454000.2_Missense_Mutation_p.L462V|NBPF3_ENST00000342104.5_Missense_Mutation_p.L520V|NBPF3_ENST00000318220.6_Missense_Mutation_p.L476V	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	532	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGGCTTTTCTCTTGACGTGGA	0.458																																																	0													41.0	28.0	33.0					1																	21808250		2176	4279	6455	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1594C>G	1.37:g.21808250C>G	ENSP00000316782:p.Leu532Val	Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	2.544	-0.305587	0.05495	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.13307	2.6;2.6;2.6;2.6;2.6	0.583	0.583	0.17417	DUF1220 (2);	.	.	.	.	T	0.24586	0.0596	M	0.63428	1.95	0.09310	N	1	P;P;B	0.49696	0.763;0.927;0.072	P;P;B	0.56563	0.507;0.801;0.055	T	0.08166	-1.0735	8	0.49607	T	0.09	.	.	.	.	.	462;520;532	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	V	462;476;532;520;476	ENSP00000415711:L462V;ENSP00000316739:L476V;ENSP00000316782:L532V;ENSP00000340336:L520V;ENSP00000391865:L476V	ENSP00000316739:L476V	L	+	1	0	NBPF3	21680837	0.008000	0.16893	0.003000	0.11579	0.003000	0.03518	1.005000	0.29834	0.579000	0.29504	0.398000	0.26397	CTT		0.458	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NBPF3	84224	hgsc.bcm.edu	37	1	21809709	21809709	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:21809709A>C	ENST00000318249.5	+	15	2082	c.1732A>C	c.(1732-1734)Act>Cct	p.T578P	NBPF3_ENST00000454000.2_Missense_Mutation_p.T508P|NBPF3_ENST00000342104.5_Missense_Mutation_p.T566P|NBPF3_ENST00000318220.6_Missense_Mutation_p.T522P	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	578	NBPF 5. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTATTCGACTACTTCAACTTA	0.453																																																	0													69.0	49.0	56.0					1																	21809709		2169	4214	6383	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1732A>C	1.37:g.21809709A>C	ENSP00000316782:p.Thr578Pro	Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-4.188991	0.00001	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.04360	3.64;3.64;3.64;3.64;3.64	1.03	-2.07	0.07276	DUF1220 (2);	.	.	.	.	T	0.00695	0.0023	N	0.00041	-2.485	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.30090	-0.9990	9	0.02654	T	1	.	1.4336	0.02339	0.181:0.3038:0.356:0.1592	.	508;566;578	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	P	508;522;578;566;522	ENSP00000415711:T508P;ENSP00000316739:T522P;ENSP00000316782:T578P;ENSP00000340336:T566P;ENSP00000391865:T522P	ENSP00000316739:T522P	T	+	1	0	NBPF3	21682296	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.360000	0.00246	-3.832000	0.00101	-3.169000	0.00057	ACT		0.453	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NBPF14	25832	hgsc.bcm.edu	37	1	148004722	148004722	+	Silent	SNP	C	C	T	rs138813155	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:148004722C>T	ENST00000369219.1	-	22	2608	c.2592G>A	c.(2590-2592)tcG>tcA	p.S864S				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	864	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					TTGACGGAGTCGAATAACATA	0.448													-|||	5	0.000998403	0.0015	0.0	5008	,	,		24446	0.0		0.0	False		,,,				2504	0.0031																0								C		26,4174		7,12,2081	125.0	194.0	171.0		2592	0.4	0.0	1	dbSNP_134	171	0,8502		0,0,4251	no	coding-synonymous	NBPF14	NM_015383.1		7,12,6332	TT,TC,CC		0.0,0.619,0.2047		864/922	148004722	26,12676	2100	4251	6351	SO:0001819	synonymous_variant	25832			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2592G>A	1.37:g.148004722C>T		Somatic		WXS	SOLID	Phase_I	Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	c	1.455	-0.563923	0.03939	0.00619	0.0	ENSG00000122497	ENST00000310701	.	.	.	0.445	0.445	0.16597	.	.	.	.	.	T	0.14874	0.0359	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.26395	-1.0104	3	.	.	.	.	.	.	.	.	.	.	.	Q	870	.	.	R	-	2	0	NBPF14	146471346	0.128000	0.22383	0.004000	0.12327	0.009000	0.06853	-1.487000	0.02310	0.537000	0.28751	0.372000	0.22366	CGA		0.448	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_015383	
NPR2	4882	hgsc.bcm.edu	37	9	35794073	35794073	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr9:35794073G>C	ENST00000342694.2	+	2	1101	c.846G>C	c.(844-846)caG>caC	p.Q282H		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	282					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CCCGGgaacaggcccaggccc	0.562																																																	0													35.0	38.0	37.0					9																	35794073		2203	4300	6503	SO:0001583	missense	4882			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.846G>C	9.37:g.35794073G>C	ENSP00000341083:p.Gln282His	Somatic		WXS	SOLID	Phase_I	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903433	0.52333	.	.	ENSG00000159899	ENST00000342694	D	0.82344	-1.6	4.11	2.22	0.28083	Extracellular ligand-binding receptor (1);	0.000000	0.38897	N	0.001524	T	0.66356	0.2781	N	0.14661	0.345	0.29846	N	0.828865	B;B	0.21225	0.053;0.002	B;B	0.24269	0.052;0.027	T	0.56463	-0.7975	10	0.25106	T	0.35	.	8.2393	0.31650	0.1835:0.0:0.8165:0.0	.	282;282	P20594-2;P20594	.;ANPRB_HUMAN	H	282	ENSP00000341083:Q282H	ENSP00000341083:Q282H	Q	+	3	2	NPR2	35784073	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.280000	0.33202	0.464000	0.27142	0.655000	0.94253	CAG		0.562	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1			
OR10G7	390265	hgsc.bcm.edu	37	11	123909234	123909234	+	Missense_Mutation	SNP	T	T	C	rs201972627	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr11:123909234T>C	ENST00000330487.5	-	1	483	c.475A>G	c.(475-477)Acc>Gcc	p.T159A		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T159A(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GTCAATATGGTCTGGACAGCA	0.577													T|||	4	0.000798722	0.0	0.0	5008	,	,		20775	0.004		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	ovary(1)						T	ALA/THR	0,4400		0,0,2200	146.0	141.0	143.0		475	2.1	0.8	11		143	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR10G7	NM_001004463.1	58	0,1,6494	CC,CT,TT		0.0116,0.0,0.0077	benign	159/312	123909234	1,12989	2200	4295	6495	SO:0001583	missense	390265			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.475A>G	11.37:g.123909234T>C	ENSP00000329689:p.Thr159Ala	Somatic		WXS	SOLID	Phase_I	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	11	0.005036630036630037	0	0.0	3	0.008287292817679558	6	0.01048951048951049	2	0.002638522427440633	T	8.660	0.900292	0.17686	0.0	1.16E-4	ENSG00000182634	ENST00000330487	T	0.00256	8.42	3.24	2.11	0.27256	GPCR, rhodopsin-like superfamily (1);	0.139097	0.33075	N	0.005307	T	0.00144	0.0004	L	0.49126	1.545	0.30208	N	0.79798	B	0.19073	0.033	B	0.34385	0.181	T	0.03761	-1.1006	10	0.46703	T	0.11	.	7.9741	0.30145	0.0:0.1027:0.0:0.8973	.	159	Q8NGN6	O10G7_HUMAN	A	159	ENSP00000329689:T159A	ENSP00000329689:T159A	T	-	1	0	OR10G7	123414444	0.000000	0.05858	0.840000	0.33206	0.416000	0.31233	0.059000	0.14322	0.466000	0.27193	0.374000	0.22700	ACC		0.577	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1		NM_001004463	
OR2T35	403244	hgsc.bcm.edu	37	1	248801602	248801603	+	Frame_Shift_Ins	INS	-	-	CA	rs370874670|rs375058001		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:248801602_248801603insCA	ENST00000317450.3	-	1	956_957	c.957_958insTG	c.(955-960)gtgatcfs	p.I320fs		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	320						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I320fs*1(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTTCCTGATCACAGTCGCCA	0.545																																																	1	Insertion - Frameshift(1)	prostate(1)																																								SO:0001589	frameshift_variant	403244			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.956_957dupTG	1.37:g.248801605_248801606dupCA	ENSP00000324369:p.Ile320fs	Somatic		WXS	SOLID	Phase_I	Q6IEY7	Frame_Shift_Ins	INS	ENST00000317450.3	37	CCDS31123.1																																																																																				0.545	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097130.1		NM_001001827	
PDCL	5082	hgsc.bcm.edu;ucsc.edu	37	9	125582825	125582825	+	Missense_Mutation	SNP	G	G	A	rs147830688	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr9:125582825G>A	ENST00000259467.4	-	4	610	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	149					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						AGCTGCTGCCGCATCTCTTCC	0.468																																																	0								G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	85.0	84.0	85.0		445	4.6	1.0	9	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	missense	PDCL	NM_005388.4	101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	149/302	125582825	2,13004	2203	4300	6503	SO:0001583	missense	5082			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.445C>T	9.37:g.125582825G>A	ENSP00000259467:p.Arg149Trp	Somatic		WXS	SOLID	Phase_I	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	ENST00000259467.4	37	CCDS6845.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959654	0.74016	2.27E-4	1.16E-4	ENSG00000136940	ENST00000259467	T	0.50813	0.73	5.58	4.61	0.57282	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.049218	0.85682	D	0.000000	T	0.63129	0.2485	M	0.68593	2.085	0.54753	D	0.999984	D	0.89917	1.0	D	0.70716	0.97	T	0.64622	-0.6364	10	0.62326	D	0.03	-15.127	10.8087	0.46533	0.0:0.0:0.6325:0.3675	.	149	Q13371	PHLP_HUMAN	W	149	ENSP00000259467:R149W	ENSP00000259467:R149W	R	-	1	2	PDCL	124622646	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.110000	0.50352	2.636000	0.89361	0.655000	0.94253	CGG		0.468	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1		NM_005388	
PELP1	27043	hgsc.bcm.edu	37	17	4576620	4576620	+	Silent	SNP	C	C	T	rs55677157	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr17:4576620C>T	ENST00000574876.1	-	15	1787	c.1770G>A	c.(1768-1770)ccG>ccA	p.P590P	PELP1_ENST00000269230.7_Intron|PELP1_ENST00000572293.1_Silent_p.P640P|PELP1_ENST00000436683.2_Silent_p.P443P|PELP1_ENST00000301396.4_Silent_p.P734P|AC091153.4_ENST00000441700.2_RNA			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	590					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						AGCGAGGAGACGGGGCCAGCA	0.652													C|||	425	0.0848642	0.0484	0.1282	5008	,	,		16334	0.003		0.2117	False		,,,				2504	0.0573																0								C		292,4018		12,268,1875	19.0	30.0	27.0		1770	-3.2	0.9	17	dbSNP_129	27	1899,6647		204,1491,2578	no	coding-synonymous	PELP1	NM_014389.2		216,1759,4453	TT,TC,CC		22.2209,6.7749,17.0426		590/1131	4576620	2191,10665	2155	4273	6428	SO:0001819	synonymous_variant	27043				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.1770G>A	17.37:g.4576620C>T		Somatic		WXS	SOLID	Phase_I	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	37	CCDS58503.1																																																																																				0.652	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2		NM_014389	
PKNOX2	63876	hgsc.bcm.edu	37	11	125300008	125300008	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr11:125300008A>C	ENST00000298282.9	+	12	1434	c.1163A>C	c.(1162-1164)cAg>cCg	p.Q388P	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Missense_Mutation_p.Q324P	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	388					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CTGCAGCAGCAGGGCGGTGCC	0.622																																																	0													46.0	51.0	49.0					11																	125300008		1930	4132	6062	SO:0001583	missense	63876			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.1163A>C	11.37:g.125300008A>C	ENSP00000298282:p.Gln388Pro	Somatic		WXS	SOLID	Phase_I	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	A	17.38	3.374751	0.61735	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.89	4.82	4.82	0.62117	.	0.072062	0.56097	D	0.000033	T	0.80127	0.4566	N	0.24115	0.695	0.58432	D	0.999993	P;P;B	0.52316	0.952;0.596;0.396	P;B;B	0.47075	0.536;0.133;0.099	T	0.80688	-0.1271	10	0.38643	T	0.18	-8.998	14.6685	0.68926	1.0:0.0:0.0:0.0	.	324;359;388	F5GZ15;B7Z3G7;Q96KN3	.;.;PKNX2_HUMAN	P	359;359;388;324	ENSP00000434732:Q359P;ENSP00000433971:Q359P;ENSP00000298282:Q388P;ENSP00000441470:Q324P	ENSP00000298282:Q388P	Q	+	2	0	PKNOX2	124805218	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.289000	0.59013	1.943000	0.56356	0.379000	0.24179	CAG		0.622	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3			
PLEKHH1	57475	hgsc.bcm.edu;ucsc.edu	37	14	68045252	68045252	+	Splice_Site	SNP	G	G	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr14:68045252G>T	ENST00000329153.5	+	20	2885	c.2753G>T	c.(2752-2754)tGc>tTc	p.C918F	PLEKHH1_ENST00000417684.2_5'Flank	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	918	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCCTGGCAGTGCTGGCAGCTC	0.582																																																	0													47.0	53.0	51.0					14																	68045252		2185	4288	6473	SO:0001630	splice_region_variant	57475			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2752-1G>T	14.37:g.68045252G>T		Somatic		WXS	SOLID	Phase_I	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732381	0.69189	.	.	ENSG00000054690	ENST00000329153	D	0.91631	-2.88	5.54	5.54	0.83059	MyTH4 domain (3);	0.092623	0.85682	D	0.000000	D	0.91676	0.7369	L	0.59436	1.845	0.80722	D	1	B	0.26902	0.163	B	0.31337	0.128	D	0.89231	0.3577	10	0.66056	D	0.02	.	19.2866	0.94077	0.0:0.0:1.0:0.0	.	918	Q9ULM0	PKHH1_HUMAN	F	918	ENSP00000330278:C918F	ENSP00000330278:C918F	C	+	2	0	PLEKHH1	67115005	1.000000	0.71417	1.000000	0.80357	0.463000	0.32649	7.307000	0.78920	2.884000	0.98904	0.655000	0.94253	TGC		0.582	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3		XM_031054	Missense_Mutation
RIF1	55183	hgsc.bcm.edu	37	2	152319431	152319431	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr2:152319431C>A	ENST00000243326.5	+	29	3880	c.3397C>A	c.(3397-3399)Caa>Aaa	p.Q1133K	RIF1_ENST00000453091.2_Missense_Mutation_p.Q1133K|RIF1_ENST00000444746.2_Missense_Mutation_p.Q1133K|RIF1_ENST00000428287.2_Missense_Mutation_p.Q1133K|RIF1_ENST00000430328.2_Missense_Mutation_p.Q1133K			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TGTCATTCCTCAAGATGTCAC	0.398																																																	0													64.0	58.0	60.0					2																	152319431		2203	4300	6503	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.3397C>A	2.37:g.152319431C>A	ENSP00000243326:p.Gln1133Lys	Somatic		WXS	SOLID	Phase_I	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	6.070	0.381256	0.11466	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.09911	2.94;2.93;2.93;2.94;2.93	3.92	1.91	0.25777	.	0.761160	0.12675	N	0.448474	T	0.07773	0.0195	M	0.63428	1.95	0.09310	N	0.999998	P;P	0.39696	0.555;0.683	B;B	0.34385	0.138;0.181	T	0.16364	-1.0405	10	0.07644	T	0.81	-3.8268	2.5576	0.04764	0.1712:0.454:0.2679:0.1069	.	1133;1133	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	K	1133	ENSP00000390181:Q1133K;ENSP00000414615:Q1133K;ENSP00000415691:Q1133K;ENSP00000243326:Q1133K;ENSP00000416123:Q1133K	ENSP00000243326:Q1133K	Q	+	1	0	RIF1	152027677	0.119000	0.22226	0.518000	0.27811	0.102000	0.19082	1.438000	0.35002	0.981000	0.38548	0.467000	0.42956	CAA		0.398	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			
RREB1	6239	hgsc.bcm.edu;ucsc.edu	37	6	7189542	7189542	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr6:7189542G>T	ENST00000349384.6	+	6	726	c.412G>T	c.(412-414)Ggg>Tgg	p.G138W	RREB1_ENST00000334984.6_Missense_Mutation_p.G138W|RREB1_ENST00000379938.2_Missense_Mutation_p.G138W|Y_RNA_ENST00000364613.1_RNA|RREB1_ENST00000379933.3_Missense_Mutation_p.G138W	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	138					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				TACCACCAATGGGAACATGCA	0.597																																																	0													65.0	51.0	56.0					6																	7189542		2203	4299	6502	SO:0001583	missense	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.412G>T	6.37:g.7189542G>T	ENSP00000305560:p.Gly138Trp	Somatic		WXS	SOLID	Phase_I	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024633	0.93518	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000471433;ENST00000349384;ENST00000334984;ENST00000483150	T;T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82;2.82	5.65	5.65	0.86999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000015	T	0.27027	0.0662	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.01102	-1.1451	10	0.72032	D	0.01	-52.896	19.7284	0.96174	0.0:0.0:1.0:0.0	.	138;138;138	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	W	138	ENSP00000369265:G138W;ENSP00000369270:G138W;ENSP00000420299:G138W;ENSP00000305560:G138W;ENSP00000335574:G138W;ENSP00000419511:G138W	ENSP00000335574:G138W	G	+	1	0	RREB1	7134541	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.162000	0.94745	2.668000	0.90789	0.591000	0.81541	GGG		0.597	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			
SCARA5	286133	hgsc.bcm.edu	37	8	27779093	27779093	+	Missense_Mutation	SNP	G	G	A	rs118119884	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr8:27779093G>A	ENST00000354914.3	-	4	1396	c.911C>T	c.(910-912)gCg>gTg	p.A304V	SCARA5_ENST00000380385.2_Intron|SCARA5_ENST00000301906.4_Missense_Mutation_p.A261V|SCARA5_ENST00000518030.1_Missense_Mutation_p.A261V|SCARA5_ENST00000524352.1_Missense_Mutation_p.A304V	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	304					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GGTACCTTTCGCGAGGGAGAT	0.662													G|||	139	0.0277556	0.003	0.0187	5008	,	,		14218	0.0417		0.0447	False		,,,				2504	0.0358																0								G	VAL/ALA	35,4371	40.0+/-72.8	0,35,2168	72.0	57.0	62.0		911	2.0	1.0	8	dbSNP_132	62	309,8291	110.2+/-170.6	5,299,3996	yes	missense	SCARA5	NM_173833.5	64	5,334,6164	AA,AG,GG		3.593,0.7944,2.6449	benign	304/496	27779093	344,12662	2203	4300	6503	SO:0001583	missense	286133			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.911C>T	8.37:g.27779093G>A	ENSP00000346990:p.Ala304Val	Somatic		WXS	SOLID	Phase_I	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	66	0.03021978021978022	3	0.006097560975609756	9	0.024861878453038673	14	0.024475524475524476	40	0.052770448548812667	G	8.646	0.897169	0.17686	0.007944	0.03593	ENSG00000168079	ENST00000354914;ENST00000517320;ENST00000524352;ENST00000518030;ENST00000301906	D;D;D;D	0.93247	-2.39;-2.78;-3.19;-3.19	4.22	1.95	0.26073	.	0.698537	0.14228	N	0.332917	T	0.52645	0.1747	N	0.21282	0.65	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.002	T	0.59332	-0.7474	10	0.16420	T	0.52	.	4.669	0.12680	0.4251:0.0:0.5749:0.0	.	304;261;304	Q6ZMJ2-2;Q6ZMJ2-3;Q6ZMJ2	.;.;SCAR5_HUMAN	V	304;104;304;261;261	ENSP00000346990:A304V;ENSP00000428663:A304V;ENSP00000430713:A261V;ENSP00000301906:A261V	ENSP00000301906:A261V	A	-	2	0	SCARA5	27835012	0.633000	0.27181	0.951000	0.38953	0.696000	0.40369	3.803000	0.55560	0.913000	0.36797	0.456000	0.33151	GCG		0.662	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2		NM_173833	
SPATC1	375686	hgsc.bcm.edu	37	8	145086876	145086876	+	Missense_Mutation	SNP	T	T	C	rs60050811	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr8:145086876T>C	ENST00000377470.3	+	1	295	c.193T>C	c.(193-195)Tcc>Ccc	p.S65P	SPATC1_ENST00000447830.2_Missense_Mutation_p.S65P	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	65	Necessary for targeting centrosomes. {ECO:0000250}.			S -> P (in Ref. 1; BAD08232 and 4; AAH50390). {ECO:0000305}.		centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGCAGGCCTTTCCTCACGCCA	0.592													.|||	717	0.143171	0.4342	0.0519	5008	,	,		19317	0.0218		0.0408	False		,,,				2504	0.045																0													44.0	45.0	45.0					8																	145086876		692	1591	2283	SO:0001583	missense	375686			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.193T>C	8.37:g.145086876T>C	ENSP00000366690:p.Ser65Pro	Somatic		WXS	SOLID	Phase_I	B4DWW9|Q5U5I8|Q7Z6L7	Missense_Mutation	SNP	ENST00000377470.3	37	CCDS6413.2	281	0.12866300366300365	209	0.4247967479674797	27	0.07458563535911603	14	0.024475524475524476	31	0.040897097625329816	c	3.178	-0.168543	0.06461	.	.	ENSG00000186583	ENST00000377470;ENST00000447830	T;T	0.47528	0.84;0.84	4.0	-8.0	0.01126	.	1.415030	0.05210	N	0.506626	T	0.00012	0.0000	N	0.20685	0.6	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.14615	-1.0466	9	0.22109	T	0.4	-1.1144	2.0347	0.03537	0.1505:0.3546:0.2444:0.2505	rs60050811	65;65	B4DWW9;Q76KD6	.;SPERI_HUMAN	P	65	ENSP00000366690:S65P;ENSP00000387613:S65P	ENSP00000366690:S65P	S	+	1	0	SPATC1	145158864	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.937000	0.00330	-3.513000	0.00149	-1.008000	0.02478	TCC		0.592	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1		NM_198572	
STK32C	282974	hgsc.bcm.edu	37	10	134036270	134036270	+	Missense_Mutation	SNP	G	G	A	rs570752291		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr10:134036270G>A	ENST00000368622.1	-	10	1156	c.775C>T	c.(775-777)Cgt>Tgt	p.R259C	STK32C_ENST00000368625.4_Missense_Mutation_p.R389C					serine/threonine kinase 32C									p.R376C(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CAGTGCAGACGGCCTTTCTAC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		15701	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	breast(1)											53.0	52.0	53.0					10																	134036270		2201	4298	6499	SO:0001583	missense	282974			AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.775C>T	10.37:g.134036270G>A	ENSP00000357611:p.Arg259Cys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000368622.1	37		.	.	.	.	.	.	.	.	.	.	G	21.7	4.188816	0.78789	.	.	ENSG00000165752	ENST00000368622;ENST00000298630;ENST00000368625	T;T;T	0.25250	1.81;1.81;1.81	3.53	3.53	0.40419	Protein kinase-like domain (1);	0.000000	0.64402	U	0.000006	T	0.50582	0.1624	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.996;0.917;0.997	T	0.58340	-0.7653	10	0.62326	D	0.03	.	15.3065	0.73995	0.0:0.0:1.0:0.0	.	389;376;259	B7Z7J1;Q86UX6;Q86UX6-2	.;ST32C_HUMAN;.	C	259;376;389	ENSP00000357611:R259C;ENSP00000298630:R376C;ENSP00000357614:R389C	ENSP00000298630:R376C	R	-	1	0	STK32C	133886260	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	5.391000	0.66266	1.825000	0.53177	0.479000	0.44913	CGT		0.642	STK32C-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051068.2		NM_173575	
TRO	7216	hgsc.bcm.edu	37	X	54957276	54957276	+	Silent	SNP	T	T	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chrX:54957276T>A	ENST00000173898.7	+	12	4231	c.4119T>A	c.(4117-4119)acT>acA	p.T1373T	TRO_ENST00000375022.4_Intron|TRO_ENST00000319167.8_Intron|TRO_ENST00000375041.2_Silent_p.T976T|TRO_ENST00000399736.1_Intron|TRO_ENST00000420798.2_Silent_p.T904T	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1373	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GACCAAGCACTGGTGTTGGCT	0.592																																																	0													82.0	84.0	83.0					X																	54957276		2056	4174	6230	SO:0001819	synonymous_variant	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.4119T>A	X.37:g.54957276T>A		Somatic		WXS	SOLID	Phase_I	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	37	CCDS43959.1																																																																																				0.592	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3		NM_016157	
TRPV6	55503	hgsc.bcm.edu	37	7	142583152	142583152	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr7:142583152T>C	ENST00000359396.3	-	1	355	c.110A>G	c.(109-111)aAc>aGc	p.N37S	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	37				N -> D (in Ref. 1; AAG41951). {ECO:0000305}.	calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTGCAGCAGGTTCTGCTCATC	0.607																																																	0													110.0	111.0	111.0					7																	142583152		2203	4300	6503	SO:0001583	missense	55503			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.110A>G	7.37:g.142583152T>C	ENSP00000352358:p.Asn37Ser	Somatic		WXS	SOLID	Phase_I	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	T	1.828	-0.470636	0.04445	.	.	ENSG00000165125	ENST00000359396	T	0.51817	0.69	3.82	3.82	0.43975	.	0.538685	0.19780	N	0.106246	T	0.37265	0.0997	L	0.43152	1.355	0.22866	N	0.998639	B	0.13594	0.008	B	0.12837	0.008	T	0.17806	-1.0357	10	0.33141	T	0.24	-12.5826	9.1984	0.37242	0.0:0.0:0.0:1.0	.	37	Q9H1D0	TRPV6_HUMAN	S	37	ENSP00000352358:N37S	ENSP00000352358:N37S	N	-	2	0	TRPV6	142293274	1.000000	0.71417	0.810000	0.32431	0.061000	0.15899	2.218000	0.42889	1.753000	0.51906	0.403000	0.27427	AAC		0.607	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1		NM_014274	
TTN	7273	hgsc.bcm.edu;ucsc.edu	37	2	179405009	179405009	+	Silent	SNP	T	T	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr2:179405009T>A	ENST00000591111.1	-	301	93185	c.92961A>T	c.(92959-92961)ggA>ggT	p.G30987G	TTN_ENST00000359218.5_Silent_p.G23688G|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Silent_p.G23755G|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000342992.6_Silent_p.G30060G|TTN_ENST00000589042.1_Silent_p.G32628G|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000460472.2_Silent_p.G23563G|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30987	Fibronectin type-III 126. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTAGATCCTCCTTCATCTT	0.438																																																	0													273.0	263.0	266.0					2																	179405009		1945	4149	6094	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92961A>T	2.37:g.179405009T>A		Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
USH2A	7399	hgsc.bcm.edu;ucsc.edu	37	1	216373233	216373233	+	Missense_Mutation	SNP	T	T	C	rs397518013		TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr1:216373233T>C	ENST00000307340.3	-	17	3933	c.3547A>G	c.(3547-3549)Att>Gtt	p.I1183V	RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.I1183V|USH2A_ENST00000366942.3_Missense_Mutation_p.I1183V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1183	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGGACAAAATATATTTCTCT	0.438										HNSCC(13;0.011)																																							0													103.0	109.0	107.0					1																	216373233		2203	4300	6503	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3547A>G	1.37:g.216373233T>C	ENSP00000305941:p.Ile1183Val	Somatic		WXS	SOLID	Phase_I	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	1.670	-0.509175	0.04231	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.56444	0.46;0.46;0.46	6.02	1.07	0.20283	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.151199	0.30210	N	0.010155	T	0.29223	0.0727	N	0.14661	0.345	0.21527	N	0.999654	B;B	0.11235	0.004;0.002	B;B	0.14023	0.01;0.008	T	0.11991	-1.0565	10	0.38643	T	0.18	.	5.4764	0.16697	0.0:0.1982:0.2542:0.5476	.	1183;1183	O75445-2;O75445	.;USH2A_HUMAN	V	1183	ENSP00000305941:I1183V;ENSP00000355910:I1183V;ENSP00000355909:I1183V	ENSP00000305941:I1183V	I	-	1	0	USH2A	214439856	0.528000	0.26314	0.096000	0.21009	0.878000	0.50629	0.184000	0.16939	0.144000	0.18951	0.533000	0.62120	ATT		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1		NM_007123	
VCL	7414	hgsc.bcm.edu	37	10	75854046	75854046	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr10:75854046C>A	ENST00000211998.4	+	11	1464	c.1370C>A	c.(1369-1371)cCa>cAa	p.P457Q	VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.P457Q	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	457	3 X 112 AA tandem repeats.|N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GGAGATTCTCCAGAGGCTCGA	0.512																																																	0													36.0	41.0	39.0					10																	75854046		2203	4300	6503	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1370C>A	10.37:g.75854046C>A	ENSP00000211998:p.Pro457Gln	Somatic		WXS	SOLID	Phase_I	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078497	0.76528	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.62105	0.05;0.05;0.05	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.69079	0.3071	M	0.84326	2.69	0.80722	D	1	P;B;P	0.42456	0.673;0.129;0.78	B;B;B	0.43123	0.326;0.103;0.409	T	0.74581	-0.3618	10	0.62326	D	0.03	.	14.429	0.67236	0.1474:0.8526:0.0:0.0	.	384;457;457	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	Q	457;457;364;384;129	ENSP00000361841:P457Q;ENSP00000211998:P457Q;ENSP00000415489:P129Q	ENSP00000211998:P457Q	P	+	2	0	VCL	75524052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.621000	0.67743	2.630000	0.89119	0.650000	0.86243	CCA		0.512	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_003373, NM_014000	
WRNIP1	56897	hgsc.bcm.edu;ucsc.edu	37	6	2768965	2768965	+	Missense_Mutation	SNP	A	A	G	rs77289107	byFrequency	TCGA-BP-4766-01A-01D-1366-10	TCGA-BP-4766-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	246a22b2-db14-489d-9bd3-3a5e91a5c715	131b822f-4ad9-4645-bab7-665d8fd54a2c	g.chr6:2768965A>G	ENST00000380773.4	+	2	1072	c.863A>G	c.(862-864)cAt>cGt	p.H288R	WRNIP1_ENST00000380769.4_Missense_Mutation_p.H68R|WRNIP1_ENST00000380771.4_Missense_Mutation_p.H288R|WRNIP1_ENST00000380764.1_5'Flank	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1											breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				AGCAAGAAACATAGCATAAGG	0.403													A|||	18	0.00359425	0.0015	0.0058	5008	,	,		20596	0.0		0.0119	False		,,,				2504	0.0																0								A	ARG/HIS,ARG/HIS	6,4400	11.4+/-27.6	0,6,2197	91.0	84.0	86.0		863,863	5.4	1.0	6	dbSNP_131	86	62,8538	39.3+/-95.6	0,62,4238	yes	missense,missense	WRNIP1	NM_020135.2,NM_130395.1	29,29	0,68,6435	GG,GA,AA		0.7209,0.1362,0.5228	benign,benign	288/666,288/641	2768965	68,12938	2203	4300	6503	SO:0001583	missense	56897			AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.863A>G	6.37:g.2768965A>G	ENSP00000370150:p.His288Arg	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000380773.4	37	CCDS4475.1	14	0.00641025641025641	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	10	0.013192612137203167	A	10.90	1.481103	0.26598	0.001362	0.007209	ENSG00000124535	ENST00000380773;ENST00000380771;ENST00000380769	T;T;T	0.41065	1.01;1.01;1.01	5.37	5.37	0.77165	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.249208	0.45606	D	0.000358	T	0.12092	0.0294	N	0.04655	-0.195	0.80722	D	1	B;B	0.28584	0.216;0.006	B;B	0.27170	0.077;0.005	T	0.08722	-1.0708	10	0.38643	T	0.18	-21.7902	14.8437	0.70243	1.0:0.0:0.0:0.0	.	288;288	Q96S55-2;Q96S55	.;WRIP1_HUMAN	R	288;288;68	ENSP00000370150:H288R;ENSP00000370148:H288R;ENSP00000370146:H68R	ENSP00000370146:H68R	H	+	2	0	WRNIP1	2713964	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	4.270000	0.58896	2.155000	0.67459	0.459000	0.35465	CAT		0.403	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039641.1		NM_130395	
