#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	48313955	48313955	+	Silent	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr7:48313955C>T	ENST00000435803.1	+	17	4716	c.4692C>T	c.(4690-4692)aaC>aaT	p.N1564N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1564					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N1564N(1)|p.N1509N(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTACTTTAACATCCTGGAAA	0.313																																																	2	Substitution - coding silent(2)	kidney(2)											63.0	65.0	64.0					7																	48313955		1801	4063	5864	SO:0001819	synonymous_variant	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4692C>T	7.37:g.48313955C>T		Somatic		WXS	Illumina HiSeq	Phase_I	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																				0.313	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2		NM_152701	
AHNAK2	113146	broad.mit.edu;hgsc.bcm.edu	37	14	105410662	105410662	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr14:105410662C>T	ENST00000333244.5	-	7	11245	c.11126G>A	c.(11125-11127)gGc>gAc	p.G3709D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3709						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.G3709D(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCACCTGGCCCTCCGGGAG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											102.0	111.0	108.0					14																	105410662		1869	4095	5964	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11126G>A	14.37:g.105410662C>T	ENSP00000353114:p.Gly3709Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	15.19	2.758773	0.49468	.	.	ENSG00000185567	ENST00000333244	T	0.03272	3.99	4.0	-2.96	0.05547	.	.	.	.	.	T	0.05364	0.0142	M	0.86343	2.81	0.09310	N	1	B	0.17465	0.022	B	0.21360	0.034	T	0.47824	-0.9087	9	0.18276	T	0.48	.	1.4099	0.02289	0.4179:0.284:0.1105:0.1875	.	3709	Q8IVF2	AHNK2_HUMAN	D	3709	ENSP00000353114:G3709D	ENSP00000353114:G3709D	G	-	2	0	AHNAK2	104481707	0.000000	0.05858	0.003000	0.11579	0.020000	0.10135	-0.171000	0.09883	-0.115000	0.11915	0.485000	0.47835	GGC		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1		NM_138420	
ANKRD12	23253	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	9211598	9211598	+	Silent	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr18:9211598T>C	ENST00000262126.4	+	6	708	c.468T>C	c.(466-468)caT>caC	p.H156H	ANKRD12_ENST00000383440.2_Silent_p.H133H|ANKRD12_ENST00000400020.3_Silent_p.H133H|ANKRD12_ENST00000540578.2_3'UTR	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	156						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.H156H(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CACCAAATCATCCATCACAAA	0.333																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	65.0	64.0					18																	9211598		2203	4300	6503	SO:0001819	synonymous_variant	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.468T>C	18.37:g.9211598T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	CCDS11843.1																																																																																				0.333	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2		NM_015208	
ASPH	444	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	62588827	62588827	+	Intron	SNP	A	A	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr8:62588827A>G	ENST00000379454.4	-	3	510				ASPH_ENST00000517847.2_Intron|ASPH_ENST00000518068.1_Intron|ASPH_ENST00000517903.1_Intron|ASPH_ENST00000445642.3_Intron|ASPH_ENST00000517856.1_Intron|ASPH_ENST00000541428.1_Intron|ASPH_ENST00000389204.4_Intron|ASPH_ENST00000522603.1_Intron|ASPH_ENST00000517661.1_Missense_Mutation_p.L111P|ASPH_ENST00000379449.6_Missense_Mutation_p.L140P|ASPH_ENST00000522835.1_Intron|ASPH_ENST00000356457.5_Intron	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)	p.L140P(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TAAAATATTAAGGACTTCCTC	0.348																																																	1	Substitution - Missense(1)	kidney(1)											52.0	46.0	48.0					8																	62588827		1568	3581	5149	SO:0001627	intron_variant	444			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.322+4699T>C	8.37:g.62588827A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	A	17.23	3.336881	0.60963	.	.	ENSG00000198363	ENST00000379449;ENST00000517661	T;T	0.80123	-1.34;-1.34	5.95	5.95	0.96441	.	.	.	.	.	T	0.77618	0.4157	N	0.05280	-0.08	0.80722	D	1	D	0.61697	0.99	D	0.64877	0.93	T	0.78365	-0.2232	9	0.25106	T	0.35	.	16.1057	0.81220	1.0:0.0:0.0:0.0	.	140	Q6NXR7	.	P	140;111	ENSP00000368762:L140P;ENSP00000428060:L111P	ENSP00000368762:L140P	L	-	2	0	ASPH	62751381	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.281000	0.76405	0.528000	0.53228	CTT		0.348	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3		NM_004318	
ASXL2	55252	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	25967152	25967152	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr2:25967152G>C	ENST00000435504.4	-	13	2347	c.2054C>G	c.(2053-2055)tCa>tGa	p.S685*	ASXL2_ENST00000336112.4_Nonsense_Mutation_p.S657*|ASXL2_ENST00000404843.1_Nonsense_Mutation_p.S425*|ASXL2_ENST00000272341.4_Nonsense_Mutation_p.S425*			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	685					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.S425*(1)|p.S685*(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTCCAACTGAGGCGGCTGC	0.622																																																	2	Substitution - Nonsense(2)	kidney(2)											52.0	55.0	54.0					2																	25967152		1873	4103	5976	SO:0001587	stop_gained	55252					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2054C>G	2.37:g.25967152G>C	ENSP00000391447:p.Ser685*	Somatic		WXS	Illumina HiSeq	Phase_I	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Nonsense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	G	46	12.587121	0.99680	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	.	.	.	5.94	5.94	0.96194	.	0.478549	0.17810	N	0.161223	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-7.9616	18.9232	0.92534	0.0:0.0:1.0:0.0	.	.	.	.	X	685;657;425;425	.	ENSP00000272341:S425X	S	-	2	0	ASXL2	25820656	1.000000	0.71417	0.944000	0.38274	0.966000	0.64601	4.848000	0.62874	2.816000	0.96949	0.563000	0.77884	TCA		0.622	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3		NM_018263	
BOD1L1	259282	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	13602085	13602085	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr4:13602085T>C	ENST00000040738.5	-	10	6574	c.6439A>G	c.(6439-6441)Agc>Ggc	p.S2147G		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2147						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S2147G(1)									TCCCCTATGCTTGTGGAAATC	0.502																																																	1	Substitution - Missense(1)	kidney(1)											83.0	73.0	77.0					4																	13602085		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6439A>G	4.37:g.13602085T>C	ENSP00000040738:p.Ser2147Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	20.9	4.072314	0.76415	.	.	ENSG00000038219	ENST00000040738	T	0.16457	2.34	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	T	0.43411	0.1246	M	0.78456	2.415	0.40176	D	0.977236	D	0.76494	0.999	D	0.78314	0.991	T	0.47368	-0.9123	10	0.87932	D	0	-5.3309	14.1665	0.65480	0.0:0.0:0.0:1.0	.	2147	Q8NFC6	BOD1L_HUMAN	G	2147	ENSP00000040738:S2147G	ENSP00000040738:S2147G	S	-	1	0	BOD1L	13211183	1.000000	0.71417	0.997000	0.53966	0.856000	0.48823	4.896000	0.63222	2.083000	0.62718	0.454000	0.30748	AGC		0.502	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1		NM_148894	
SIMC1	375484	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	175772242	175772242	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr5:175772242C>T	ENST00000443967.1	+	12	2820	c.2413C>T	c.(2413-2415)Ccc>Tcc	p.P805S	RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393728.2_5'Flank|SIMC1_ENST00000341199.6_Missense_Mutation_p.P390S|SIMC1_ENST00000430704.2_Missense_Mutation_p.P390S|SIMC1_ENST00000332772.4_Missense_Mutation_p.P266S			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	805							SUMO polymer binding (GO:0032184)	p.P805S(1)									AAGGATTAAGCCCAAACCCCA	0.493																																																	1	Substitution - Missense(1)	kidney(1)											109.0	106.0	107.0					5																	175772242		2203	4300	6503	SO:0001583	missense	0			BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.2413C>T	5.37:g.175772242C>T	ENSP00000406571:p.Pro805Ser	Somatic		WXS	Illumina HiSeq	Phase_I	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	ENST00000443967.1	37		.	.	.	.	.	.	.	.	.	.	C	22.9	4.350544	0.82132	.	.	ENSG00000170085	ENST00000341199;ENST00000430704;ENST00000443967;ENST00000332772	T;T;T;T	0.32753	1.87;1.87;2.13;1.44	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000009	T	0.49729	0.1574	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.68353	0.935;0.943;0.957	T	0.42068	-0.9473	10	0.52906	T	0.07	-17.097	17.1367	0.86742	0.0:1.0:0.0:0.0	.	266;390;805	Q8NDZ2-4;Q8NDZ2-3;Q8NDZ2	.;.;CE025_HUMAN	S	390;390;805;266	ENSP00000342075:P390S;ENSP00000409287:P390S;ENSP00000406571:P805S;ENSP00000331311:P266S	ENSP00000331311:P266S	P	+	1	0	C5orf25	175704848	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.202000	0.42743	2.714000	0.92807	0.650000	0.86243	CCC		0.493	SIMC1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253155.2		NM_198567	
STKLD1	169436	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	136260828	136260828	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr9:136260828A>C	ENST00000371957.3	+	9	911	c.804A>C	c.(802-804)gaA>gaC	p.E268D	C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		268	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.E268D(2)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CGGATGTGGAAACCTTCAGGA	0.542																																																	2	Substitution - Missense(2)	kidney(2)											89.0	93.0	91.0					9																	136260828		2203	4300	6503	SO:0001583	missense	169436																														ENST00000371957.3:c.804A>C	9.37:g.136260828A>C	ENSP00000361025:p.Glu268Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	37	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	A	4.787	0.146388	0.09134	.	.	ENSG00000198870	ENST00000371957	T	0.67345	-0.26	4.86	-9.71	0.00518	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.524580	0.03689	N	0.246812	T	0.36331	0.0963	N	0.11284	0.12	0.09310	N	0.999993	B	0.09022	0.002	B	0.09377	0.004	T	0.23619	-1.0183	10	0.14252	T	0.57	-0.6546	3.7366	0.08512	0.102:0.4173:0.3138:0.167	.	268	Q8NE28	SGK71_HUMAN	D	268	ENSP00000361025:E268D	ENSP00000361025:E268D	E	+	3	2	C9orf96	135250649	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.260000	0.01177	-3.021000	0.00269	-0.464000	0.05259	GAA		0.542	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1			
CDH11	1009	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	64984852	64984852	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr16:64984852G>A	ENST00000268603.4	-	12	2327	c.1712C>T	c.(1711-1713)cCc>cTc	p.P571L	CDH11_ENST00000394156.3_Missense_Mutation_p.P571L|CDH11_ENST00000566827.1_Missense_Mutation_p.P445L	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	571	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P571L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GATCACTATGGGCAGAAGGTA	0.617			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	1	Substitution - Missense(1)	kidney(1)											89.0	79.0	82.0					16																	64984852		2203	4300	6503	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1712C>T	16.37:g.64984852G>A	ENSP00000268603:p.Pro571Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	G	34	5.325077	0.95708	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.60171	2.18;0.21	5.55	5.55	0.83447	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.80924	0.4717	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	D	0.84349	0.0531	10	0.87932	D	0	.	18.497	0.90869	0.0:0.0:1.0:0.0	.	571;571	P55287-2;P55287	.;CAD11_HUMAN	L	571;571;554	ENSP00000268603:P571L;ENSP00000377711:P571L	ENSP00000268603:P571L	P	-	2	0	CDH11	63542353	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.751000	0.98889	2.594000	0.87642	0.655000	0.94253	CCC		0.617	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1		NM_033664	
CHGB	1114	broad.mit.edu;hgsc.bcm.edu	37	20	5903114	5903114	+	Silent	SNP	G	G	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr20:5903114G>A	ENST00000378961.4	+	4	528	c.324G>A	c.(322-324)ggG>ggA	p.G108G		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	108						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.G108G(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GAGCCCCAGGGGAGGAGGACA	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											36.0	37.0	37.0					20																	5903114		2203	4300	6503	SO:0001819	synonymous_variant	1114				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.324G>A	20.37:g.5903114G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Silent	SNP	ENST00000378961.4	37	CCDS13092.1																																																																																				0.577	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2		NM_001819	
COL4A5	1287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	107909822	107909822	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chrX:107909822C>T	ENST00000361603.2	+	39	3795	c.3551C>T	c.(3550-3552)cCa>cTa	p.P1184L	COL4A5_ENST00000328300.6_Missense_Mutation_p.P1184L	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1184	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.P1184L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AAGGGTGAACCAGGTGCTGTA	0.433									Alport syndrome with Diffuse Leiomyomatosis																																								1	Substitution - Missense(1)	kidney(1)											56.0	49.0	51.0					X																	107909822		2202	4300	6502	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3551C>T	X.37:g.107909822C>T	ENSP00000354505:p.Pro1184Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661801	0.67700	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.97731	-3.13;-4.51	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.98425	0.9476	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99878	1.1107	10	0.87932	D	0	.	18.4199	0.90587	0.0:1.0:0.0:0.0	.	1184;1184	E7EVY4;P29400	.;CO4A5_HUMAN	L	1184	ENSP00000331902:P1184L;ENSP00000354505:P1184L	ENSP00000331902:P1184L	P	+	2	0	COL4A5	107796478	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.556000	0.73932	2.290000	0.77057	0.600000	0.82982	CCA		0.433	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			
CYP4A11	1579	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	47401233	47401233	+	Silent	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr1:47401233C>T	ENST00000310638.4	-	5	628	c.597G>A	c.(595-597)aaG>aaA	p.K199K	CYP4A11_ENST00000457840.2_Silent_p.K95K|CYP4A11_ENST00000462347.1_Silent_p.K199K|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371905.1_Silent_p.K199K|CYP4A11_ENST00000371904.4_Silent_p.K199K	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	199					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.K199K(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	TGAAGGCACACTTCATGATGG	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											146.0	124.0	131.0					1																	47401233		2202	4299	6501	SO:0001819	synonymous_variant	1579			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.597G>A	1.37:g.47401233C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Silent	SNP	ENST00000310638.4	37	CCDS543.1																																																																																				0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1		NM_000778	
DOT1L	84444	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	2214517	2214517	+	Silent	SNP	G	G	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr19:2214517G>A	ENST00000398665.3	+	19	1881	c.1845G>A	c.(1843-1845)tcG>tcA	p.S615S	DOT1L_ENST00000608122.1_3'UTR|AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	615					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.S615S(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACGCTGTCGCTGGAGAAGC	0.647																																																	2	Substitution - coding silent(2)	kidney(2)											35.0	40.0	38.0					19																	2214517		2125	4243	6368	SO:0001819	synonymous_variant	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1845G>A	19.37:g.2214517G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O60379|Q96JL1	Silent	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	G	5.939	0.357241	0.11239	.	.	ENSG00000104885	ENST00000440640	.	.	.	4.69	-5.23	0.02798	.	.	.	.	.	T	0.35278	0.0926	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44128	-0.9348	4	.	.	.	-34.377	0.5912	0.00728	0.2848:0.1747:0.3038:0.2367	.	.	.	.	H	402	.	.	R	+	2	0	DOT1L	2165517	0.017000	0.18338	0.989000	0.46669	0.425000	0.31504	-0.905000	0.04075	-0.342000	0.08363	-1.103000	0.02113	CGC		0.647	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1		NM_032482	
EMR3	84658	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	14749072	14749072	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr19:14749072G>T	ENST00000253673.5	-	11	1429	c.1329C>A	c.(1327-1329)caC>caA	p.H443Q	EMR3_ENST00000443157.2_Missense_Mutation_p.H317Q|EMR3_ENST00000599900.1_Missense_Mutation_p.H228Q|EMR3_ENST00000344373.4_Missense_Mutation_p.H391Q	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	443					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.H443Q(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TGAGGAAGAGGTGCACACCCT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											146.0	110.0	122.0					19																	14749072		2203	4300	6503	SO:0001583	missense	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1329C>A	19.37:g.14749072G>T	ENSP00000253673:p.His443Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000253673.5	37	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	G	6.742	0.505719	0.12822	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.36699	1.24;1.24;1.24	4.44	1.11	0.20524	GPCR, family 2-like (1);	.	.	.	.	T	0.30978	0.0782	L	0.45352	1.415	0.25174	N	0.990254	P;P;B	0.36837	0.571;0.516;0.107	B;B;B	0.42163	0.378;0.26;0.088	T	0.20075	-1.0286	9	0.20046	T	0.44	.	7.9042	0.29752	0.2864:0.0:0.7136:0.0	.	317;391;443	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	Q	317;443;391	ENSP00000396208:H317Q;ENSP00000253673:H443Q;ENSP00000340758:H391Q	ENSP00000253673:H443Q	H	-	3	2	EMR3	14610072	0.991000	0.36638	0.651000	0.29564	0.012000	0.07955	0.044000	0.13992	0.516000	0.28340	-0.142000	0.14014	CAC		0.562	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1		NM_032571	
ERCC6	2074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	50738880	50738880	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr10:50738880A>C	ENST00000355832.5	-	3	507	c.429T>G	c.(427-429)tgT>tgG	p.C143W	PGBD3_ENST00000603152.1_Missense_Mutation_p.C143W|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.C143W|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.C143W	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	143					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)	p.C143W(1)		breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GGGATGTCGTACATGACCTGA	0.338								Direct reversal of damage;Nucleotide excision repair (NER)																																									1	Substitution - Missense(1)	kidney(1)											139.0	129.0	133.0					10																	50738880		2202	4299	6501	SO:0001583	missense	2074			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.429T>G	10.37:g.50738880A>C	ENSP00000348089:p.Cys143Trp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.023909	0.54683	.	.	ENSG00000225830;ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000462247;ENST00000515869;ENST00000447839	D;T;T;T	0.85088	-1.94;0.5;2.83;2.83	5.43	3.04	0.35103	.	.	.	.	.	D	0.89536	0.6743	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.67103	0.949;0.907	D	0.87601	0.2497	9	0.59425	D	0.04	-19.9252	8.9739	0.35924	0.7858:0.0:0.2142:0.0	.	143;143	E7EV46;Q03468	.;ERCC6_HUMAN	W	143	ENSP00000348089:C143W;ENSP00000422827:C143W;ENSP00000423550:C143W;ENSP00000387966:C143W	ENSP00000348089:C143W	C	-	3	2	ERCC6;RP11-123B3.6	50408886	1.000000	0.71417	0.977000	0.42913	0.868000	0.49771	1.260000	0.32968	0.349000	0.23975	0.455000	0.32223	TGT		0.338	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1		NM_000124	
ESPL1	9700	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53682952	53682952	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr12:53682952T>C	ENST00000257934.4	+	21	4878	c.4787T>C	c.(4786-4788)cTc>cCc	p.L1596P	ESPL1_ENST00000552462.1_Missense_Mutation_p.L1596P	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1596					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.L1596P(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CCTAGTGGGCTCTATGCCCAC	0.567																																					Colon(53;1069 1201 2587 5382)												1	Substitution - Missense(1)	kidney(1)											111.0	106.0	108.0					12																	53682952		2203	4300	6503	SO:0001583	missense	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.4787T>C	12.37:g.53682952T>C	ENSP00000257934:p.Leu1596Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395541	0.83011	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.25085	1.82;1.82	5.41	5.41	0.78517	.	0.059700	0.64402	D	0.000002	T	0.40040	0.1101	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.24476	-1.0159	10	0.72032	D	0.01	.	14.566	0.68176	0.0:0.0:0.0:1.0	.	1596	Q14674	ESPL1_HUMAN	P	1596;1271;1596	ENSP00000257934:L1596P;ENSP00000449831:L1596P	ENSP00000257934:L1596P	L	+	2	0	ESPL1	51969219	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.474000	0.73578	2.272000	0.75746	0.460000	0.39030	CTC		0.567	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2		NM_012291	
FAM193A	8603	hgsc.bcm.edu	37	4	2664872	2664873	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr4:2664872_2664873insA	ENST00000324666.5	+	10	1414_1415	c.1063_1064insA	c.(1063-1065)gaafs	p.E355fs	FAM193A_ENST00000502458.1_Frame_Shift_Ins_p.E377fs|FAM193A_ENST00000545951.1_Frame_Shift_Ins_p.E355fs|FAM193A_ENST00000505311.1_Frame_Shift_Ins_p.E355fs|FAM193A_ENST00000382839.3_Frame_Shift_Ins_p.E355fs	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	355										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						TAGTTCCTCAGAAGCTGATGAT	0.47																																																	0																																										SO:0001589	frameshift_variant	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1065dupA	4.37:g.2664874_2664874dupA	ENSP00000324587:p.Glu355fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Frame_Shift_Ins	INS	ENST00000324666.5	37	CCDS58875.1																																																																																				0.470	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1		NM_003704	
FLG	2312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	152285874	152285874	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr1:152285874G>T	ENST00000368799.1	-	3	1523	c.1488C>A	c.(1486-1488)caC>caA	p.H496Q	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	496	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H496Q(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCTCGTGGTGCGATCCTT	0.607									Ichthyosis																																								1	Substitution - Missense(1)	kidney(1)											285.0	267.0	273.0					1																	152285874		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1488C>A	1.37:g.152285874G>T	ENSP00000357789:p.His496Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	9.450	1.090341	0.20471	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.01629	4.72	2.79	-0.123	0.13527	.	.	.	.	.	T	0.01029	0.0034	L	0.47190	1.495	0.09310	N	1	D	0.53151	0.958	P	0.55011	0.766	T	0.43605	-0.9381	9	0.12766	T	0.61	.	5.3133	0.15843	0.3995:0.0:0.6005:0.0	.	496	P20930	FILA_HUMAN	Q	496;28	ENSP00000357789:H496Q	ENSP00000357789:H496Q	H	-	3	2	FLG	150552498	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.522000	0.00950	-0.038000	0.13624	0.505000	0.49811	CAC		0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1		NM_002016	
GADL1	339896	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	30769765	30769765	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr3:30769765T>C	ENST00000282538.5	-	15	1685	c.1535A>G	c.(1534-1536)gAt>gGt	p.D512G	GADL1_ENST00000498387.1_5'UTR	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	512					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)	p.D328G(1)|p.D512G(1)		breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						GTCTATCTCATCCAGGAGGAA	0.537																																																	2	Substitution - Missense(2)	kidney(2)											151.0	144.0	146.0					3																	30769765		2203	4300	6503	SO:0001583	missense	339896			AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1535A>G	3.37:g.30769765T>C	ENSP00000282538:p.Asp512Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	T	17.31	3.357578	0.61293	.	.	ENSG00000144644	ENST00000282538	T	0.40756	1.02	5.91	5.91	0.95273	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.288857	0.32357	N	0.006205	T	0.43831	0.1265	L	0.54323	1.7	0.80722	D	1	B	0.24823	0.112	B	0.28638	0.092	T	0.31779	-0.9931	10	0.51188	T	0.08	-3.8191	16.3378	0.83071	0.0:0.0:0.0:1.0	.	512	Q6ZQY3	GADL1_HUMAN	G	512	ENSP00000282538:D512G	ENSP00000282538:D512G	D	-	2	0	GADL1	30744769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.694000	0.84235	2.255000	0.74692	0.533000	0.62120	GAT		0.537	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2		NM_207359	
GCC2	9648	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	109103098	109103098	+	Silent	SNP	T	T	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr2:109103098T>A	ENST00000309863.6	+	16	4638	c.3924T>A	c.(3922-3924)gcT>gcA	p.A1308A		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1308					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.A1308A(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AGTGCCGTGCTGCCAAGGTGC	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											67.0	59.0	62.0					2																	109103098		2203	4300	6503	SO:0001819	synonymous_variant	9648			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3924T>A	2.37:g.109103098T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Silent	SNP	ENST00000309863.6	37	CCDS33268.1																																																																																				0.512	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3		NM_014635	
HMCN1	83872	broad.mit.edu;hgsc.bcm.edu	37	1	186017962	186017962	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr1:186017962A>C	ENST00000271588.4	+	42	6797	c.6568A>C	c.(6568-6570)Aac>Cac	p.N2190H	HMCN1_ENST00000367492.2_Missense_Mutation_p.N2190H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2190	Ig-like C2-type 19.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.N2190H(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTACAATGTCAACATTTGGGG	0.348																																																	1	Substitution - Missense(1)	kidney(1)											86.0	88.0	87.0					1																	186017962		2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6568A>C	1.37:g.186017962A>C	ENSP00000271588:p.Asn2190His	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.457005	0.63401	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67345	-0.26;-0.26	5.26	5.26	0.73747	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.041395	0.85682	D	0.000000	T	0.71592	0.3358	N	0.26042	0.785	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.70557	-0.4839	10	0.32370	T	0.25	.	15.4776	0.75497	1.0:0.0:0.0:0.0	.	2190	Q96RW7	HMCN1_HUMAN	H	2190	ENSP00000271588:N2190H;ENSP00000356462:N2190H	ENSP00000271588:N2190H	N	+	1	0	HMCN1	184284585	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.114000	0.77103	2.106000	0.64143	0.455000	0.32223	AAC		0.348	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
HRCT1	646962	hgsc.bcm.edu	37	9	35906601	35906601	+	Missense_Mutation	SNP	C	C	A	rs565823201|rs112212538		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr9:35906601C>A	ENST00000354323.2	+	1	413	c.317C>A	c.(316-318)cCc>cAc	p.P106H	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	106	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						caccaccacccccaccgccac	0.677																																																	0													6.0	6.0	6.0					9																	35906601		1795	3578	5373	SO:0001583	missense	646962				CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.317C>A	9.37:g.35906601C>A	ENSP00000346283:p.Pro106His	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBJ1	Missense_Mutation	SNP	ENST00000354323.2	37	CCDS35012.1	337	0.1543040293040293	82	0.16666666666666666	47	0.1298342541436464	45	0.07867132867132867	163	0.21503957783641162	C	1.568	-0.535019	0.04082	.	.	ENSG00000196196	ENST00000354323	.	.	.	0.571	-1.14	0.09741	.	2.262810	0.02394	N	0.080002	T	0.00012	0.0000	N	0.04508	-0.205	0.80722	P	0.0	P	0.36944	0.574	B	0.32465	0.146	T	0.09751	-1.0660	7	0.87932	D	0	-19.8215	.	.	.	.	106	Q6UXD1	HRCT1_HUMAN	H	106	.	ENSP00000346283:P106H	P	+	2	0	HRCT1	35896601	0.000000	0.05858	0.011000	0.14972	0.341000	0.28922	-0.113000	0.10774	-1.188000	0.02705	-0.718000	0.03613	CCC		0.677	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1		NM_001039792	
HSP90AA1	3320	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	102551690	102551690	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr14:102551690A>G	ENST00000216281.8	-	4	813	c.608T>C	c.(607-609)aTa>aCa	p.I203T	HSP90AA1_ENST00000441629.2_Missense_Mutation_p.I24T|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.I325T	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	203					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.I325T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	AATCTCCTTTATTCTTCGTTC	0.363																																																	1	Substitution - Missense(1)	kidney(1)											85.0	70.0	75.0					14																	102551690		2203	4300	6503	SO:0001583	missense	3320			M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.608T>C	14.37:g.102551690A>G	ENSP00000216281:p.Ile203Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	37	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	a	17.79	3.476183	0.63737	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629;ENST00000553585	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	4.29	4.29	0.51040	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.123645	0.51477	U	0.000099	T	0.58750	0.2144	H	0.99825	4.815	0.58432	D	0.999999	B;P;P	0.39181	0.139;0.613;0.663	B;P;P	0.59595	0.144;0.745;0.86	T	0.74618	-0.3605	10	0.87932	D	0	-16.8308	13.7409	0.62847	1.0:0.0:0.0:0.0	.	24;325;203	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	T	203;325;24;134	ENSP00000216281:I203T;ENSP00000335153:I325T;ENSP00000396189:I24T;ENSP00000450712:I134T	ENSP00000216281:I203T	I	-	2	0	HSP90AA1	101621443	1.000000	0.71417	0.573000	0.28510	0.998000	0.95712	9.062000	0.93920	1.723000	0.51488	0.528000	0.53228	ATA		0.363	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2		NM_005348	
INO80B	83444	hgsc.bcm.edu	37	2	74684832	74684832	+	Silent	SNP	C	C	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr2:74684832C>G	ENST00000233331.7	+	5	1006	c.912C>G	c.(910-912)ggC>ggG	p.G304G	WBP1_ENST00000393972.3_5'Flank|WBP1_ENST00000409737.1_5'Flank|WBP1_ENST00000233615.2_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	304					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						CCCCCTCAGGCCCGCCGCCGC	0.692																																																	0													13.0	14.0	13.0					2																	74684832		2151	4237	6388	SO:0001819	synonymous_variant	83444			AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.912C>G	2.37:g.74684832C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000233331.7	37	CCDS1942.2																																																																																				0.692	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252223.2		NM_031288	
INTU	27152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	128605608	128605608	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr4:128605608A>T	ENST00000335251.6	+	7	1329	c.1226A>T	c.(1225-1227)cAa>cTa	p.Q409L		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	409					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.Q409L(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AATGTCATCCAAACCTTAAAA	0.279																																																	1	Substitution - Missense(1)	kidney(1)											100.0	98.0	99.0					4																	128605608		2202	4300	6502	SO:0001583	missense	27152			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1226A>T	4.37:g.128605608A>T	ENSP00000334003:p.Gln409Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	a	9.371	1.070387	0.20147	.	.	ENSG00000164066	ENST00000335251	T	0.29917	1.55	4.48	0.724	0.18236	.	0.358277	0.27393	N	0.019580	T	0.22322	0.0538	L	0.40543	1.245	0.58432	D	0.999999	B	0.27679	0.185	B	0.23852	0.049	T	0.05599	-1.0875	10	0.72032	D	0.01	0.0188	8.9797	0.35957	0.5106:0.0:0.4894:0.0	.	409	Q9ULD6	PDZD6_HUMAN	L	409	ENSP00000334003:Q409L	ENSP00000334003:Q409L	Q	+	2	0	INTU	128825058	0.998000	0.40836	0.824000	0.32777	0.242000	0.25591	1.016000	0.29976	-0.016000	0.14127	-0.332000	0.08345	CAA		0.279	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2		XM_371707	
KDM5A	5927	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	442728	442728	+	Silent	SNP	A	A	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr12:442728A>G	ENST00000399788.2	-	12	1940	c.1578T>C	c.(1576-1578)ttT>ttC	p.F526F	KDM5A_ENST00000382815.4_Silent_p.F526F	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	526	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.F526F(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GCTGGGATTCAAATAACTCGG	0.507			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	2	Substitution - coding silent(2)	kidney(2)											133.0	136.0	135.0					12																	442728		1985	4170	6155	SO:0001819	synonymous_variant	5927				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.1578T>C	12.37:g.442728A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MV76|Q4LE72|Q86XZ1	Silent	SNP	ENST00000399788.2	37	CCDS41736.1																																																																																				0.507	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1		NM_005056	
KIF14	9928	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	200586908	200586908	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr1:200586908T>A	ENST00000367350.4	-	2	1382	c.944A>T	c.(943-945)cAa>cTa	p.Q315L		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	315	Required for PRC1-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)	p.Q315L(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TTTTGGTCTTTGTTTAACTTG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											140.0	131.0	134.0					1																	200586908		2203	4300	6503	SO:0001583	missense	9928			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.944A>T	1.37:g.200586908T>A	ENSP00000356319:p.Gln315Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.949036	0.53186	.	.	ENSG00000118193	ENST00000367350	T	0.73575	-0.76	5.12	-2.53	0.06326	.	0.611839	0.15458	N	0.261274	T	0.47783	0.1464	N	0.14661	0.345	0.09310	N	1	P	0.34462	0.454	B	0.24394	0.053	T	0.34204	-0.9838	10	0.28530	T	0.3	.	9.6537	0.39912	0.1124:0.0:0.4707:0.4169	.	315	Q15058	KIF14_HUMAN	L	315	ENSP00000356319:Q315L	ENSP00000356319:Q315L	Q	-	2	0	KIF14	198853531	0.001000	0.12720	0.005000	0.12908	0.497000	0.33675	0.226000	0.17776	-0.343000	0.08351	0.477000	0.44152	CAA		0.403	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1		NM_014875	
KPNA4	3840	broad.mit.edu;ucsc.edu	37	3	160254590	160254590	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr3:160254590T>G	ENST00000334256.4	-	2	413	c.108A>C	c.(106-108)ttA>ttC	p.L36F		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	36	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)	p.L36F(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCACCTTCCTTAATTCAACTA	0.269																																																	1	Substitution - Missense(1)	kidney(1)											144.0	150.0	148.0					3																	160254590		2199	4282	6481	SO:0001583	missense	3840			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.108A>C	3.37:g.160254590T>G	ENSP00000334373:p.Leu36Phe	Somatic		WXS	Illumina GAIIx	Phase_I	A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	ENST00000334256.4	37	CCDS3191.1	.	.	.	.	.	.	.	.	.	.	T	12.72	2.022662	0.35701	.	.	ENSG00000186432	ENST00000334256	T	0.58210	0.35	6.07	3.65	0.41850	Importin-alpha, importin-beta-binding domain (2);Armadillo-like helical (1);Armadillo-type fold (1);	0.068471	0.64402	D	0.000019	T	0.72003	0.3407	M	0.90145	3.09	0.58432	D	0.999997	D	0.63046	0.992	D	0.70227	0.968	T	0.71307	-0.4632	10	0.87932	D	0	-2.1005	5.5826	0.17258	0.0:0.2016:0.1363:0.6621	.	36	O00629	IMA4_HUMAN	F	36	ENSP00000334373:L36F	ENSP00000334373:L36F	L	-	3	2	KPNA4	161737284	0.997000	0.39634	1.000000	0.80357	0.053000	0.15095	0.325000	0.19628	0.517000	0.28361	-0.323000	0.08544	TTA		0.269	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1		NM_002268	
MC3R	4159	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	54824097	54824097	+	Silent	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr20:54824097C>T	ENST00000243911.2	+	1	310	c.198C>T	c.(196-198)aaC>aaT	p.N66N		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	66					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.N103N(2)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			TGGTCAGGAACGGCAACCTGC	0.562																																																	2	Substitution - coding silent(2)	ovary(1)|kidney(1)											90.0	72.0	79.0					20																	54824097		2203	4300	6503	SO:0001819	synonymous_variant	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.198C>T	20.37:g.54824097C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q4KN27|Q9H517	Silent	SNP	ENST00000243911.2	37	CCDS13449.2																																																																																				0.562	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			
METTL9	51108	broad.mit.edu;hgsc.bcm.edu	37	16	21611123	21611123	+	Silent	SNP	G	G	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr16:21611123G>C	ENST00000358154.3	+	1	327	c.69G>C	c.(67-69)acG>acC	p.T23T	METTL9_ENST00000396014.4_Silent_p.T23T	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	23								p.T23T(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		GGATGTGGACGCTGCGGAGCC	0.736																																																	1	Substitution - coding silent(1)	kidney(1)											6.0	8.0	8.0					16																	21611123		1968	3965	5933	SO:0001819	synonymous_variant	51108			NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.69G>C	16.37:g.21611123G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Silent	SNP	ENST00000358154.3	37	CCDS10598.2																																																																																				0.736	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1		NM_016025	
MICA	100507436	broad.mit.edu;ucsc.edu	37	6	31379000	31379000	+	Missense_Mutation	SNP	G	G	T	rs576467210		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr6:31379000G>T	ENST00000449934.2	+	3	531	c.477G>T	c.(475-477)caG>caT	p.Q159H	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A									p.Q159H(1)		breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				CCAGAGCTCAGACCTTGGCCA	0.537																																																	1	Substitution - Missense(1)	kidney(1)											103.0	89.0	93.0					6																	31379000		692	1591	2283	SO:0001583	missense	100507436			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.477G>T	6.37:g.31379000G>T	ENSP00000413079:p.Gln159His	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000449934.2	37	CCDS56412.1	.	.	.	.	.	.	.	.	.	.	N	4.185	0.032875	0.08101	.	.	ENSG00000204520	ENST00000364810;ENST00000399172;ENST00000449934	T	0.00724	5.78	1.41	0.518	0.17030	.	0.963342	0.08453	N	0.943601	T	0.00724	0.0024	M	0.90977	3.165	0.09310	N	1	B	0.15141	0.012	B	0.12837	0.008	T	0.35301	-0.9794	10	0.87932	D	0	.	7.5396	0.27731	0.0:0.2701:0.7299:0.0	.	159	Q96QC4	.	H	159;116;159	ENSP00000413079:Q159H	ENSP00000365394:Q159H	Q	+	3	2	MICA	31486979	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.241000	0.18065	0.197000	0.20387	-0.702000	0.03669	CAG		0.537	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076101.7		NM_001177519	
MKNK1	8569	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	47028508	47028508	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr1:47028508G>C	ENST00000371946.4	-	11	939	c.776C>G	c.(775-777)tCt>tGt	p.S259C	MKNK1-AS1_ENST00000602433.1_RNA|MKNK1_ENST00000371945.4_Missense_Mutation_p.S218C|MKNK1_ENST00000428112.2_Missense_Mutation_p.S218C|MKNK1_ENST00000341183.5_Missense_Mutation_p.S218C|MKNK1_ENST00000371944.4_Missense_Mutation_p.S123C	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	259	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S259C(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					GTATTCTGCAGAGCCACACTG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											37.0	33.0	34.0					1																	47028508		2203	4300	6503	SO:0001583	missense	8569			AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.776C>G	1.37:g.47028508G>C	ENSP00000361014:p.Ser259Cys	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	37	CCDS538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.316071|4.316071	0.81469|0.81469	.|.	.|.	ENSG00000079277|ENSG00000079277	ENST00000524749|ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	.|T;T;T;T;T	.|0.69926	.|-0.44;-0.44;-0.44;-0.44;-0.44	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.055879	.|0.85682	.|D	.|0.000000	T|T	0.79598|0.79598	0.4473|0.4473	L|L	0.55834|0.55834	1.745|1.745	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.87578	.|0.998;0.997;0.998;0.997;0.996;0.997	T|T	0.80405|0.80405	-0.1396|-0.1396	5|10	.|0.87932	.|D	.|0	-28.4902|-28.4902	18.3905|18.3905	0.90481|0.90481	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|123;123;218;218;218;259	.|B4DQK5;Q7Z319;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.|.;.;.;.;.;MKNK1_HUMAN	V|C	11|259;218;123;218;218	.|ENSP00000361014:S259C;ENSP00000361013:S218C;ENSP00000361012:S123C;ENSP00000339573:S218C;ENSP00000411135:S218C	.|ENSP00000339573:S218C	L|S	-|-	1|2	2|0	MKNK1|MKNK1	46801095|46801095	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.645000|0.645000	0.38454|0.38454	9.657000|9.657000	0.98554|0.98554	2.826000|2.826000	0.97356|0.97356	0.563000|0.563000	0.77884|0.77884	CTG|TCT		0.602	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2		NM_003684	
MRPS22	56945	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	139074556	139074556	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr3:139074556A>G	ENST00000495075.1	+	9	1343	c.911A>G	c.(910-912)tAt>tGt	p.Y304C	MRPS22_ENST00000478464.1_Missense_Mutation_p.Y263C|MRPS22_ENST00000310776.4_Missense_Mutation_p.Y304C|MRPS22_ENST00000465056.1_Missense_Mutation_p.Y303C			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	304						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)	p.Y304C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						GTCCAGCTGTATCACGTGCTC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											78.0	76.0	77.0					3																	139074556		2203	4300	6503	SO:0001583	missense	56945			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.911A>G	3.37:g.139074556A>G	ENSP00000418008:p.Tyr304Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	37	CCDS3107.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.96|15.96	2.986808|2.986808	0.53934|0.53934	.|.	.|.	ENSG00000175110|ENSG00000184432	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000478464|ENST00000503326	D;D;D;D|.	0.83163|.	-1.69;-1.69;-1.69;-1.69|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.110083|0.110083	0.64402|0.64402	N|D	0.000006|0.000006	T|T	0.77994|0.77994	0.4214|0.4214	M|M	0.82630|0.82630	2.6|2.6	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.79108|.	0.987;0.987;0.992|.	T|T	0.80137|0.80137	-0.1508|-0.1508	10|6	0.87932|.	D|.	0|.	-4.181|-4.181	15.7313|15.7313	0.77807|0.77807	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	263;303;304|.	G5E9W7;G5E9V5;P82650|.	.;.;RT22_HUMAN|.	C|H	304;304;303;263|107	ENSP00000418008:Y304C;ENSP00000310785:Y304C;ENSP00000418233:Y303C;ENSP00000419303:Y263C|.	ENSP00000310785:Y304C|.	Y|Y	+|-	2|1	0|0	MRPS22|COPB2	140557246|140557246	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.454000|0.454000	0.32378|0.32378	5.706000|5.706000	0.68362|0.68362	2.118000|2.118000	0.64928|0.64928	0.533000|0.533000	0.62120|0.62120	TAT|TAC		0.413	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1		NM_020191	
MSLN	10232	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	816775	816775	+	Silent	SNP	C	C	G	rs201168564	byFrequency	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr16:816775C>G	ENST00000382862.3	+	13	1457	c.1362C>G	c.(1360-1362)ccC>ccG	p.P454P	MSLN_ENST00000545450.2_Silent_p.P446P|MSLN_ENST00000563941.1_Silent_p.P446P|MSLN_ENST00000566549.1_Silent_p.P446P	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	454					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P454P(2)		breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				CCCTCAGCCCCGAGGAGCTGA	0.647																																																	2	Substitution - coding silent(2)	kidney(2)											65.0	66.0	66.0					16																	816775		2191	4289	6480	SO:0001819	synonymous_variant	10232			U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.1362C>G	16.37:g.816775C>G		Somatic		WXS	Illumina HiSeq	Phase_I	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Silent	SNP	ENST00000382862.3	37	CCDS32356.1																																																																																				0.647	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109253.2			
MTCH2	23788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	47652589	47652589	+	Splice_Site	SNP	A	A	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr11:47652589A>G	ENST00000302503.3	-	7	635	c.478T>C	c.(478-480)Tgt>Cgt	p.C160R	MTCH2_ENST00000542981.1_Splice_Site_p.C12R|MTCH2_ENST00000534074.1_5'Flank	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	160					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)		p.C160R(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						AATACTTACCAGTACTTGGAT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											82.0	80.0	81.0					11																	47652589		2201	4298	6499	SO:0001630	splice_region_variant	23788			AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.479+1T>C	11.37:g.47652589A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R7L8	Missense_Mutation	SNP	ENST00000302503.3	37	CCDS7943.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.833514	0.50951	.	.	ENSG00000109919	ENST00000302503;ENST00000542981;ENST00000530428;ENST00000530558	T;T;T	0.77489	0.76;-1.1;0.76	5.28	5.28	0.74379	Mitochondrial carrier domain (2);	0.041854	0.85682	D	0.000000	T	0.38878	0.1057	N	0.00204	-1.855	0.58432	D	0.999996	B	0.14012	0.009	B	0.14023	0.01	T	0.46091	-0.9216	10	0.14252	T	0.57	.	8.4327	0.32769	0.7197:0.0:0.0:0.2803	.	160	Q9Y6C9	MTCH2_HUMAN	R	160;12;151;139	ENSP00000303222:C160R;ENSP00000439013:C12R;ENSP00000432043:C151R	ENSP00000303222:C160R	C	-	1	0	MTCH2	47609165	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	4.556000	0.60775	1.999000	0.58509	0.402000	0.26972	TGT		0.348	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391921.2		NM_014342	Missense_Mutation
MYH11	4629	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	15872668	15872668	+	Silent	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr16:15872668C>T	ENST00000300036.5	-	7	868	c.759G>A	c.(757-759)acG>acA	p.T253T	MYH11_ENST00000452625.2_Silent_p.T260T|MYH11_ENST00000576790.2_Silent_p.T253T|MYH11_ENST00000396324.3_Silent_p.T260T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	253	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.T260T(2)|p.T253T(2)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGATGTAACCCGTGACGTCGA	0.562			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	4	Substitution - coding silent(4)	lung(2)|kidney(2)											188.0	140.0	156.0					16																	15872668		2197	4300	6497	SO:0001819	synonymous_variant	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.759G>A	16.37:g.15872668C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																				0.562	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2		NM_001040113	
NOMO2	283820	hgsc.bcm.edu	37	16	18525759	18525759	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr16:18525759delC	ENST00000381474.3	-	25	2997	c.2932delG	c.(2932-2934)gttfs	p.V978fs	NOMO2_ENST00000543392.1_Frame_Shift_Del_p.V811fs|NOMO2_ENST00000330537.6_Frame_Shift_Del_p.V978fs	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	978						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						TCCATGGCAACCCCTTGTTCG	0.507																																																	0													1.0	1.0	1.0					16																	18525759		1	5	6	SO:0001589	frameshift_variant	283820			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.2932delG	16.37:g.18525759delC	ENSP00000370883:p.Val978fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4G177	Frame_Shift_Del	DEL	ENST00000381474.3	37	CCDS32394.1																																																																																				0.507	NOMO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435858.1		NM_001004060	
NOMO3	408050	hgsc.bcm.edu	37	16	16374089	16374089	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr16:16374089delG	ENST00000399336.4	+	25	3101	c.2929delG	c.(2929-2931)gggfs	p.G977fs	NOMO3_ENST00000572932.1_3'UTR|NOMO3_ENST00000538468.1_Frame_Shift_Del_p.G810fs|NOMO3_ENST00000263012.6_Frame_Shift_Del_p.G977fs	NM_001004067.3	NP_001004067.1	P69849	NOMO3_HUMAN	NODAL modulator 3	977						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	8				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		GCCCGAACAAGGGGTTGCCAT	0.507																																																	0													0.0	1.0	1.0					16																	16374089		0	1	1	SO:0001589	frameshift_variant	408050			AK125530	CCDS42123.1	16p13	2004-11-24				ENSG00000103226			25242	protein-coding gene	gene with protein product		609159				15257293	Standard	NM_001004067		Approved		uc002deq.3	P69849	OTTHUMG00000170525	ENST00000399336.4:c.2929delG	16.37:g.16374089delG	ENSP00000382274:p.Gly977fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000399336.4	37	CCDS42123.1																																																																																				0.507	NOMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409528.13		NM_001004067	
P2RX2	22953	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	133198270	133198270	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr12:133198270G>T	ENST00000389110.3	+	11	1165	c.1128G>T	c.(1126-1128)aaG>aaT	p.K376N	P2RX2_ENST00000343948.4_Missense_Mutation_p.K402N|P2RX2_ENST00000352418.4_Missense_Mutation_p.K304N|P2RX2_ENST00000348800.5_Missense_Mutation_p.K376N|P2RX2_ENST00000351222.4_Missense_Mutation_p.K284N|P2RX2_ENST00000350048.5_Missense_Mutation_p.K352N|P2RX2_ENST00000449132.2_Missense_Mutation_p.K342N	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	376					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.K402N(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACAGCCATAAGAAATTTGACA	0.587																																																	1	Substitution - Missense(1)	kidney(1)											69.0	70.0	70.0					12																	133198270		2203	4300	6503	SO:0001583	missense	22953			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.1128G>T	12.37:g.133198270G>T	ENSP00000373762:p.Lys376Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	ENST00000389110.3	37	CCDS31931.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452766	0.63290	.	.	ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800	T;T;T;T;T;T;T	0.10573	3.49;3.49;2.86;3.49;3.49;3.49;3.49	4.67	3.7	0.42460	.	0.102365	0.64402	D	0.000005	T	0.28200	0.0696	M	0.79475	2.455	0.39070	D	0.960692	D;D;D;D;D;D;P	0.76494	0.971;0.999;0.999;0.995;0.984;0.98;0.95	P;D;D;P;P;P;P	0.65573	0.856;0.933;0.936;0.903;0.818;0.816;0.72	T	0.02698	-1.1122	10	0.56958	D	0.05	-18.4703	9.401	0.38433	0.093:0.1522:0.7547:0.0	.	342;284;304;352;402;376;376	Q9UBL9-7;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2	.;.;.;.;.;P2RX2_HUMAN;.	N	376;342;402;304;352;284;376	ENSP00000373762:K376N;ENSP00000405531:K342N;ENSP00000343339:K402N;ENSP00000341419:K304N;ENSP00000343904:K352N;ENSP00000344502:K284N;ENSP00000345095:K376N	ENSP00000343339:K402N	K	+	3	2	P2RX2	131708343	0.994000	0.37717	1.000000	0.80357	0.968000	0.65278	1.062000	0.30555	2.434000	0.82447	0.561000	0.74099	AAG		0.587	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52662911	52662911	+	Splice_Site	DEL	T	T	-			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr3:52662911delT	ENST00000296302.7	-	12	1443	c.1442delA	c.(1441-1443)cag>cg	p.Q481fs	PBRM1_ENST00000409767.1_Splice_Site_p.Q481fs|PBRM1_ENST00000410007.1_Splice_Site_p.Q481fs|PBRM1_ENST00000356770.4_Splice_Site_p.Q449fs|PBRM1_ENST00000409114.3_Splice_Site_p.Q481fs|PBRM1_ENST00000394830.3_Splice_Site_p.Q481fs|PBRM1_ENST00000337303.4_Splice_Site_p.Q481fs|PBRM1_ENST00000409057.1_Splice_Site_p.Q481fs			Q86U86	PB1_HUMAN	polybromo 1	481					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAATCACACCTGCATAACTTG	0.363			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													86.0	82.0	84.0					3																	52662911		2203	4300	6503	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1443+1A>-	3.37:g.52662911delT		Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.363	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Frame_Shift_Del
PCDHA12	56137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140255597	140255597	+	Silent	SNP	T	T	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr5:140255597T>G	ENST00000398631.2	+	1	540	c.540T>G	c.(538-540)ctT>ctG	p.L180L	PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	180	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L180L(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTTGAGCTTAAAATAAAAA	0.373																																					Pancreas(113;759 1672 13322 24104 50104)												1	Substitution - coding silent(1)	kidney(1)											45.0	50.0	48.0					5																	140255597		1935	4168	6103	SO:0001819	synonymous_variant	56137			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.540T>G	5.37:g.140255597T>G		Somatic		WXS	Illumina HiSeq	Phase_I	O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	CCDS47285.1																																																																																				0.373	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2		NM_018903	
PCID2	55795	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	113854792	113854792	+	Silent	SNP	A	A	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr13:113854792A>G	ENST00000337344.4	-	2	151	c.75T>C	c.(73-75)tgT>tgC	p.C25C	PCID2_ENST00000375457.2_Silent_p.C23C|PCID2_ENST00000246505.5_Silent_p.C25C|PCID2_ENST00000375459.1_Silent_p.C23C|PCID2_ENST00000375479.2_Silent_p.C25C|PCID2_ENST00000375477.1_Silent_p.C25C	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	25					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)			p.C25C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			CCAACTCTGCACAAGATGCTC	0.423																																																	1	Substitution - coding silent(1)	kidney(1)											126.0	126.0	126.0					13																	113854792		2203	4300	6503	SO:0001819	synonymous_variant	55795			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.75T>C	13.37:g.113854792A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Silent	SNP	ENST00000337344.4	37	CCDS9532.2																																																																																				0.423	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1		NM_018386	
PHF20	51230	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	34487450	34487450	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr20:34487450A>T	ENST00000374012.3	+	10	1570	c.1441A>T	c.(1441-1443)Aag>Tag	p.K481*	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	481					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K481*(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					TGGAATGGAGAAGTCACTGGA	0.493																																																	1	Substitution - Nonsense(1)	kidney(1)											63.0	62.0	62.0					20																	34487450		2203	4300	6503	SO:0001587	stop_gained	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1441A>T	20.37:g.34487450A>T	ENSP00000363124:p.Lys481*	Somatic		WXS	Illumina HiSeq	Phase_I	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Nonsense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	A	37	6.307182	0.97462	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	.	.	.	6.02	6.02	0.97574	.	0.298040	0.40469	N	0.001096	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	.	.	.	X	481	.	ENSP00000341900:K481X	K	+	1	0	PHF20	33950864	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	6.402000	0.73260	2.311000	0.77944	0.533000	0.62120	AAG		0.493	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2		NM_016436	
PKP2	5318	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	32949147	32949147	+	Silent	SNP	G	G	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr12:32949147G>A	ENST00000070846.6	-	12	2409	c.2385C>T	c.(2383-2385)gcC>gcT	p.A795A	PKP2_ENST00000340811.4_Silent_p.A751A	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	795					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.A795A(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ATGTGTAACAGGCAGAGGCTG	0.443																																																	1	Substitution - coding silent(1)	kidney(1)											144.0	123.0	130.0					12																	32949147		2203	4300	6503	SO:0001819	synonymous_variant	5318			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.2385C>T	12.37:g.32949147G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	ENST00000070846.6	37	CCDS8731.1																																																																																				0.443	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1		NM_004572	
RDH16	8608	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57346629	57346629	+	Missense_Mutation	SNP	C	C	T	rs368973096		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr12:57346629C>T	ENST00000398138.3	-	3	1574	c.718G>A	c.(718-720)Gag>Aag	p.E240K	RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	240					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)	p.E240K(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						ACAAACTTCTCGCCATAGGCC	0.502																																					GBM(179;741 2921 43105 45298)												1	Substitution - Missense(1)	kidney(1)						C	LYS/GLU	0,4036		0,0,2018	101.0	104.0	103.0		718	-2.2	0.3	12		103	1,8313		0,1,4156	no	missense	RDH16	NM_003708.3	56	0,1,6174	TT,TC,CC		0.012,0.0,0.0081	benign	240/318	57346629	1,12349	2018	4157	6175	SO:0001583	missense	8608				CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.718G>A	12.37:g.57346629C>T	ENSP00000381206:p.Glu240Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UNV2	Missense_Mutation	SNP	ENST00000398138.3	37	CCDS41797.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871574	0.33069	0.0	1.2E-4	ENSG00000139547	ENST00000398138	D	0.92911	-3.13	5.17	-2.23	0.06930	NAD(P)-binding domain (1);	0.514499	0.18590	N	0.136761	D	0.85155	0.5632	L	0.50333	1.59	0.09310	N	1	P;B	0.44006	0.824;0.128	B;B	0.36989	0.238;0.033	T	0.77923	-0.2406	10	0.56958	D	0.05	.	7.1005	0.25333	0.0:0.2748:0.4631:0.2622	.	116;240	Q59FX7;O75452	.;RDH16_HUMAN	K	240	ENSP00000381206:E240K	ENSP00000353980:E116K	E	-	1	0	RDH16	55632896	0.000000	0.05858	0.313000	0.25210	0.002000	0.02628	-0.690000	0.05138	-0.225000	0.09913	-0.885000	0.02943	GAG		0.502	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410898.1		NM_003708	
SIGLEC11	114132	broad.mit.edu;hgsc.bcm.edu	37	19	50461806	50461806	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr19:50461806G>A	ENST00000447370.2	-	8	1475	c.1385C>T	c.(1384-1386)cCc>cTc	p.P462L	SIGLEC11_ENST00000426971.2_Intron|CTC-326K19.6_ENST00000451973.1_5'Flank	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	462					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.P450L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		GGAGCAGGAGGGGCCCAGCAG	0.697																																																	1	Substitution - Missense(1)	kidney(1)											16.0	19.0	18.0					19																	50461806		2195	4295	6490	SO:0001583	missense	114132			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1385C>T	19.37:g.50461806G>A	ENSP00000412361:p.Pro462Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231639	0.58777	.	.	ENSG00000161640	ENST00000447370	D	0.85955	-2.05	2.86	2.86	0.33363	.	0.111688	0.41001	N	0.000962	D	0.90219	0.6942	M	0.83012	2.62	0.80722	D	1	D	0.56746	0.977	P	0.61722	0.893	D	0.90045	0.4145	9	.	.	.	.	9.8694	0.41164	0.0:0.0:1.0:0.0	.	462	Q96RL6	SIG11_HUMAN	L	462	ENSP00000412361:P462L	.	P	-	2	0	SIGLEC11	55153618	0.985000	0.35326	0.988000	0.46212	0.955000	0.61496	3.010000	0.49559	1.548000	0.49413	0.556000	0.70494	CCC		0.697	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1		NM_052884	
APBB1	322	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6415569	6415569	+	IGR	SNP	A	A	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr11:6415569A>T	ENST00000609360.1	-	0	2642				SMPD1_ENST00000527275.1_Missense_Mutation_p.E542V|SMPD1_ENST00000356761.2_Missense_Mutation_p.E487V|SMPD1_ENST00000299397.3_Missense_Mutation_p.E499V|APBB1_ENST00000526240.1_5'Flank|SMPD1_ENST00000342245.4_Missense_Mutation_p.E543V	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)						apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)	p.E543V(1)|p.E499V(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AGGGCTCGAGAAACCTATGGG	0.557																																					GBM(147;1810 2556 5672 39622)												2	Substitution - Missense(2)	kidney(2)											92.0	84.0	87.0					11																	6415569		2201	4296	6497	SO:0001628	intergenic_variant	6609			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213			11.37:g.6415569A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	ENST00000609360.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.39|16.39	3.108861|3.108861	0.56398|0.56398	.|.	.|.	ENSG00000166311|ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275|ENST00000526280	D;D;D;D|.	0.90844|.	-2.74;-2.74;-2.74;-2.74|.	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.75982|.	0.3924|.	M|M	0.84219|0.84219	2.685|2.685	0.58432|0.58432	D|D	0.999999|0.999999	D;D;P|.	0.54772|.	0.968;0.958;0.881|.	P;P;P|.	0.51487|.	0.656;0.671;0.471|.	T|.	0.78620|.	-0.2133|.	10|.	0.66056|.	D|.	0.02|.	-14.1781|-14.1781	12.4918|12.4918	0.55905|0.55905	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	542;499;541|.	E9PKS3;G3XAB5;P17405|.	.;.;ASM_HUMAN|.	V|X	499;487;543;542|229	ENSP00000299397:E499V;ENSP00000349203:E487V;ENSP00000340409:E543V;ENSP00000435350:E542V|.	ENSP00000299397:E499V|.	E|K	+|+	2|1	0|0	SMPD1|SMPD1	6372145|6372145	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.164000|0.164000	0.22412|0.22412	6.772000|6.772000	0.75001|0.75001	2.052000|2.052000	0.61016|0.61016	0.379000|0.379000	0.24179|0.24179	GAA|AAA		0.557	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1		NM_001164	
THEG	51298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	375870	375870	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr19:375870C>T	ENST00000342640.4	-	1	143	c.101G>A	c.(100-102)aGc>aAc	p.S34N	THEG_ENST00000346878.2_Missense_Mutation_p.S34N	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	34					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)		p.S34N(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTACACAGAGCTCTGGAGGCC	0.667																																																	1	Substitution - Missense(1)	kidney(1)											40.0	43.0	42.0					19																	375870		2203	4299	6502	SO:0001583	missense	51298			AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.101G>A	19.37:g.375870C>T	ENSP00000340088:p.Ser34Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	37	CCDS12025.1	.	.	.	.	.	.	.	.	.	.	C	2.988	-0.208838	0.06140	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.23348	2.05;1.91	3.16	0.883	0.19177	.	2.194380	0.02012	N	0.047081	T	0.17066	0.0410	N	0.19112	0.55	0.09310	N	1	B;B	0.32829	0.386;0.386	B;B	0.28139	0.086;0.086	T	0.21690	-1.0238	10	0.56958	D	0.05	-10.6092	5.3196	0.15874	0.202:0.6788:0.0:0.1191	.	34;34	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	N	34	ENSP00000340088:S34N;ENSP00000264820:S34N	ENSP00000340088:S34N	S	-	2	0	THEG	326870	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.561000	0.05957	0.321000	0.23259	0.561000	0.74099	AGC		0.667	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2			
TINAG	27283	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	54212217	54212217	+	Silent	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr6:54212217T>C	ENST00000259782.4	+	6	897	c.801T>C	c.(799-801)aaT>aaC	p.N267N		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	267					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.N267N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			ACACGGCCAATCTATCCCCTC	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											111.0	103.0	106.0					6																	54212217		2203	4300	6503	SO:0001819	synonymous_variant	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.801T>C	6.37:g.54212217T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T467|Q9UJW1|Q9ULZ4	Silent	SNP	ENST00000259782.4	37	CCDS4955.1																																																																																				0.433	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1		NM_014464	
VMP1	81671	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	57915760	57915760	+	Splice_Site	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr17:57915760T>C	ENST00000262291.4	+	11	1387		c.e11+2		VMP1_ENST00000539763.1_Splice_Site|VMP1_ENST00000588617.1_Splice_Site|MIR21_ENST00000362134.1_RNA|VMP1_ENST00000536180.1_Splice_Site|VMP1_ENST00000537567.1_Splice_Site|VMP1_ENST00000545362.1_Splice_Site	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1						autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)		p.?(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						ACACCACAGGTAAGACTTTAA	0.483																																																	1	Unknown(1)	kidney(1)											74.0	67.0	69.0					17																	57915760		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.1077+2T>C	17.37:g.57915760T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DVV9|Q9H0P4|Q9P089	Splice_Site	SNP	ENST00000262291.4	37	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.377999	0.82682	.	.	ENSG00000062716	ENST00000262291;ENST00000537567;ENST00000539763;ENST00000536180;ENST00000545362	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2539	0.82501	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	VMP1	55270542	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.841000	0.86834	2.244000	0.73946	0.528000	0.53228	.		0.483	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1		NM_030938	Intron
TNS3	64759	broad.mit.edu;ucsc.edu	37	7	47384579	47384579	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr7:47384579T>C	ENST00000398879.1	-	19	2875	c.2509A>G	c.(2509-2511)Agc>Ggc	p.S837G	TNS3_ENST00000311160.9_Missense_Mutation_p.S837G|TNS3_ENST00000355730.3_Missense_Mutation_p.S597G			Q68CZ2	TENS3_HUMAN	tensin 3	837					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S837G(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GACTCCTTGCTACTTAAAATT	0.483																																																	1	Substitution - Missense(1)	kidney(1)											103.0	99.0	101.0					7																	47384579		1997	4174	6171	SO:0001583	missense	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2509A>G	7.37:g.47384579T>C	ENSP00000381854:p.Ser837Gly	Somatic		WXS	Illumina GAIIx	Phase_I	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.784339	0.00628	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.93488	-2.8;-2.8;-3.23;-2.86	5.68	-3.91	0.04168	.	1.386370	0.04102	N	0.313117	D	0.86318	0.5904	N	0.19112	0.55	0.27364	N	0.955899	B	0.02656	0.0	B	0.01281	0.0	T	0.74067	-0.3784	10	0.08837	T	0.75	-2.3439	14.0763	0.64891	0.0:0.7645:0.0:0.2355	.	837	Q68CZ2	TENS3_HUMAN	G	837;947;837;597;293;940	ENSP00000312143:S837G;ENSP00000381854:S837G;ENSP00000347968:S597G;ENSP00000414358:S940G	ENSP00000312143:S837G	S	-	1	0	TNS3	47351104	0.000000	0.05858	0.003000	0.11579	0.147000	0.21601	0.204000	0.17335	-0.803000	0.04415	-1.098000	0.02139	AGC		0.483	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1		NM_022748	
UCK1	83549	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	134405914	134405914	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr9:134405914T>G	ENST00000372215.4	-	2	320	c.227A>C	c.(226-228)aAg>aCg	p.K76T	UCK1_ENST00000459858.1_5'UTR|UCK1_ENST00000372210.3_Missense_Mutation_p.K67T|UCK1_ENST00000372208.3_Missense_Mutation_p.K76T|UCK1_ENST00000372211.3_Missense_Mutation_p.K81T	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1	76					CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)	p.K76T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		GGCCTTGGCCTTCTGCTCTGC	0.577																																					Melanoma(42;523 1129 28385 43975 48113)												1	Substitution - Missense(1)	kidney(1)											224.0	185.0	198.0					9																	134405914		2203	4300	6503	SO:0001583	missense	83549			AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.227A>C	9.37:g.134405914T>G	ENSP00000361289:p.Lys76Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	Missense_Mutation	SNP	ENST00000372215.4	37	CCDS6944.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.095464	0.56075	.	.	ENSG00000130717	ENST00000372215;ENST00000372208;ENST00000372211;ENST00000372210	.	.	.	4.2	4.2	0.49525	Phosphoribulokinase/uridine kinase (1);	0.052940	0.64402	D	0.000001	T	0.62011	0.2393	M	0.70595	2.14	0.80722	D	1	B;B;B	0.24721	0.097;0.11;0.097	B;B;B	0.30495	0.116;0.075;0.116	T	0.61302	-0.7090	9	0.33940	T	0.23	-36.7497	12.6214	0.56605	0.0:0.0:0.0:1.0	.	67;76;76	Q5JT10;Q9HA47-2;Q9HA47	.;.;UCK1_HUMAN	T	76;76;81;67	.	ENSP00000361282:K76T	K	-	2	0	UCK1	133395735	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.010000	0.70753	1.768000	0.52137	0.459000	0.35465	AAG		0.577	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054726.1		NM_031432	
UTP3	57050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	71555786	71555786	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr4:71555786A>C	ENST00000254803.2	+	1	1591	c.1392A>C	c.(1390-1392)gaA>gaC	p.E464D		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	464					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E464D(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ATAGTGGTGAATTATCTGGCA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											138.0	143.0	141.0					4																	71555786		2203	4300	6503	SO:0001583	missense	57050			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.1392A>C	4.37:g.71555786A>C	ENSP00000254803:p.Glu464Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6FI82	Missense_Mutation	SNP	ENST00000254803.2	37	CCDS3546.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584682	0.65992	.	.	ENSG00000132467	ENST00000254803	T	0.66995	-0.24	5.46	3.03	0.35002	Something about silencing protein 10 (Sas10), C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85044	0.5607	H	0.96142	3.775	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86128	0.1573	10	0.72032	D	0.01	-17.3904	8.7849	0.34814	0.7462:0.0:0.2538:0.0	.	464	Q9NQZ2	SAS10_HUMAN	D	464	ENSP00000254803:E464D	ENSP00000254803:E464D	E	+	3	2	UTP3	71774650	0.985000	0.35326	0.995000	0.50966	0.986000	0.74619	1.715000	0.37971	1.004000	0.39156	0.533000	0.62120	GAA		0.373	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252163.2		NM_020368	
VAV1	7409	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6828883	6828883	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr19:6828883T>C	ENST00000602142.1	+	13	1319	c.1237T>C	c.(1237-1239)Tcg>Ccg	p.S413P	VAV1_ENST00000539284.1_Missense_Mutation_p.S316P|VAV1_ENST00000596764.1_Missense_Mutation_p.S381P|VAV1_ENST00000304076.2_Missense_Mutation_p.S413P|VAV1_ENST00000599806.1_Missense_Mutation_p.S358P	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	413	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S413P(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CAAGATCACCTCGGTGGAACG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											60.0	49.0	53.0					19																	6828883		2203	4300	6503	SO:0001583	missense	7409				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1237T>C	19.37:g.6828883T>C	ENSP00000472929:p.Ser413Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617029	0.66672	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.78707	-1.2;-1.2	5.25	0.252	0.15545	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.452960	0.18935	N	0.127102	T	0.80670	0.4667	L	0.47190	1.495	0.29683	N	0.841583	P;D;D;D	0.59357	0.937;0.96;0.973;0.985	P;P;D;P	0.64321	0.543;0.741;0.924;0.89	T	0.76366	-0.2985	10	0.66056	D	0.02	.	10.8408	0.46715	0.7258:0.0:0.0:0.2742	.	316;413;358;413	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	P	413;316	ENSP00000302269:S413P;ENSP00000443242:S316P	ENSP00000302269:S413P	S	+	1	0	VAV1	6779883	0.000000	0.05858	0.428000	0.26697	0.915000	0.54546	0.523000	0.22925	-0.008000	0.14320	-0.480000	0.04831	TCG		0.602	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1			
VCL	7414	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	75860838	75860838	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr10:75860838C>G	ENST00000211998.4	+	14	2099	c.2005C>G	c.(2005-2007)Cga>Gga	p.R669G	VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.R669G|VCL_ENST00000478896.2_3'UTR	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	669	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R669G(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GAAGACGGCCCGAGAACTCAC	0.458																																																	1	Substitution - Missense(1)	kidney(1)											51.0	48.0	49.0					10																	75860838		2203	4300	6503	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2005C>G	10.37:g.75860838C>G	ENSP00000211998:p.Arg669Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199427	0.79015	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.38722	1.12;1.12;1.12	5.44	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	L	0.54323	1.7	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.994	D;D;D	0.79108	0.992;0.929;0.988	T	0.56505	-0.7968	10	0.62326	D	0.03	.	11.2684	0.49124	0.3882:0.6118:0.0:0.0	.	596;669;669	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	G	669;669;576;596;341	ENSP00000361841:R669G;ENSP00000211998:R669G;ENSP00000415489:R341G	ENSP00000211998:R669G	R	+	1	2	VCL	75530844	1.000000	0.71417	0.888000	0.34837	0.960000	0.62799	6.257000	0.72480	2.715000	0.92844	0.655000	0.94253	CGA		0.458	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_003373, NM_014000	
ZNF148	7707	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	125032327	125032327	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr3:125032327G>T	ENST00000360647.4	-	4	643	c.158C>A	c.(157-159)cCt>cAt	p.P53H	ZNF148_ENST00000485866.1_Missense_Mutation_p.P53H|ZNF148_ENST00000468369.1_Intron|ZNF148_ENST00000492394.1_Missense_Mutation_p.P53H|ZNF148_ENST00000544464.1_Intron|ZNF148_ENST00000484491.1_Missense_Mutation_p.P53H	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	53					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.P53H(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						CTCCTGGTGAGGCATACTTCG	0.453																																																	1	Substitution - Missense(1)	kidney(1)											279.0	240.0	253.0					3																	125032327		2203	4300	6503	SO:0001583	missense	7707			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.158C>A	3.37:g.125032327G>T	ENSP00000353863:p.Pro53His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	37	CCDS3031.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299713	0.40694	.	.	ENSG00000163848	ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866;ENST00000543574;ENST00000465763;ENST00000495019	T;T;T;T	0.08193	3.12;3.12;3.12;3.12	5.0	5.0	0.66597	.	0.246709	0.40064	N	0.001200	T	0.08846	0.0219	N	0.14661	0.345	0.80722	D	1	P	0.44478	0.836	P	0.44518	0.452	T	0.21177	-1.0253	10	0.72032	D	0.01	-13.2603	18.5026	0.90887	0.0:0.0:1.0:0.0	.	53	Q9UQR1	ZN148_HUMAN	H	53	ENSP00000353863:P53H;ENSP00000420335:P53H;ENSP00000419322:P53H;ENSP00000420448:P53H	ENSP00000353863:P53H	P	-	2	0	ZNF148	126515017	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.873000	0.75541	2.582000	0.87167	0.650000	0.86243	CCT		0.453	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4		NM_021964	
FLJ36000	284124	broad.mit.edu	37	17	21904197	21904197	+	lincRNA	SNP	C	C	T	rs9904223	byFrequency	TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr17:21904197C>T	ENST00000581223.2	+	0	0					NR_027084.1																						ctcaggcctgccaggacggtg	0.672													C|||	1497	0.298922	0.3132	0.3084	5008	,	,		238763	0.4008		0.2266	False		,,,				2504	0.2423																0																																												284124																															17.37:g.21904197C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581223.2	37																																																																																					0.672	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000451067.1			
HNRNPDL	9987	broad.mit.edu	37	4	83350567	83350567	+	Missense_Mutation	SNP	T	T	C	rs368295854		TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr4:83350567T>C	ENST00000295470.5	-	1	452	c.277A>G	c.(277-279)Agc>Ggc	p.S93G	ENOPH1_ENST00000509635.1_5'Flank|ENOPH1_ENST00000273920.3_5'Flank|HNRNPDL_ENST00000502762.1_Missense_Mutation_p.S93G|HNRNPDL_ENST00000602300.1_5'UTR|HNRNPDL_ENST00000514511.1_5'UTR|HNRNPDL_ENST00000349655.4_5'UTR	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	93					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)	p.S93G(1)									TGTATGGAGCTGGATTTAAAA	0.677																																																	1	Substitution - Missense(1)	kidney(1)						T	GLY/SER,GLY/SER	0,4398		0,0,2199	28.0	35.0	33.0		277,277	-1.9	1.0	4		33	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	HNRPDL	NM_031372.3,NM_001207000.1	56,56	0,1,6496	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	93/421,93/364	83350567	1,12993	2199	4298	6497	SO:0001583	missense	9987			D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.277A>G	4.37:g.83350567T>C	ENSP00000295470:p.Ser93Gly	Somatic		WXS	Illumina GAIIx	Phase_I	Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Missense_Mutation	SNP	ENST00000295470.5	37	CCDS3593.1	.	.	.	.	.	.	.	.	.	.	t	10.07	1.250232	0.22880	0.0	1.16E-4	ENSG00000152795	ENST00000295470;ENST00000502762	T;T	0.68903	-0.36;-0.36	5.44	-1.9	0.07665	.	0.870256	0.10045	N	0.722954	T	0.37046	0.0989	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16541	-1.0399	10	0.31617	T	0.26	.	1.8192	0.03107	0.157:0.3314:0.1162:0.3953	.	93	O14979	HNRDL_HUMAN	G	93	ENSP00000295470:S93G;ENSP00000422040:S93G	ENSP00000295470:S93G	S	-	1	0	HNRPDL	83569591	0.713000	0.27926	0.968000	0.41197	0.593000	0.36681	-0.186000	0.09670	-0.190000	0.10465	-1.055000	0.02315	AGC		0.677	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252644.1		NM_005463	
PLSCR5	389158	broad.mit.edu	37	3	146311927	146311927	+	Splice_Site	SNP	A	A	C			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr3:146311927A>C	ENST00000443512.1	-	4	1236	c.233T>G	c.(232-234)aTg>aGg	p.M78R	PLSCR5_ENST00000482567.1_Splice_Site_p.M66R|PLSCR5_ENST00000492200.1_Splice_Site_p.M78R	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	78								p.M78R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						ACCAAGTATCACTAATGGAAC	0.308																																																	1	Substitution - Missense(1)	kidney(1)											83.0	79.0	80.0					3																	146311927		1799	4067	5866	SO:0001630	splice_region_variant	389158			AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.233-1T>G	3.37:g.146311927A>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RXK5	Missense_Mutation	SNP	ENST00000443512.1	37	CCDS46931.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.990038	0.35131	.	.	ENSG00000231213	ENST00000492200;ENST00000482567;ENST00000443512	T;T;T	0.22945	1.93;1.93;1.93	5.45	5.45	0.79879	.	.	.	.	.	T	0.22205	0.0535	L	0.33485	1.01	0.36900	D	0.890336	B;B	0.27316	0.175;0.166	B;B	0.31337	0.077;0.128	T	0.17198	-1.0377	9	0.66056	D	0.02	.	10.3057	0.43678	0.9171:0.0:0.0829:0.0	.	66;78	B2RXK5;A0PG75	.;PLS5_HUMAN	R	78;66;78	ENSP00000417184:M78R;ENSP00000418626:M66R;ENSP00000390111:M78R	ENSP00000390111:M78R	M	-	2	0	PLSCR5	147794617	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.425000	0.66470	2.077000	0.62373	0.524000	0.50904	ATG		0.308	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1		XM_371670	Missense_Mutation
PRKCH	5583	broad.mit.edu	37	14	61789073	61789073	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr14:61789073C>T	ENST00000332981.5	+	1	639	c.254C>T	c.(253-255)gCc>gTc	p.A85V	PRKCH_ENST00000555082.1_5'Flank|RP11-902B17.1_ENST00000500036.2_RNA	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	85	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.A85V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTCGAGTTGGCCGTCTTCCAC	0.642																																					Melanoma(135;863 1779 8064 14443 26348)												2	Substitution - Missense(2)	kidney(2)											59.0	51.0	54.0					14																	61789073		2202	4299	6501	SO:0001583	missense	5583			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.254C>T	14.37:g.61789073C>T	ENSP00000329127:p.Ala85Val	Somatic		WXS	Illumina GAIIx	Phase_I	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.841361	0.91197	.	.	ENSG00000027075	ENST00000557294;ENST00000332981	T;T	0.69175	-0.38;-0.38	4.85	4.85	0.62838	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.108001	0.38436	N	0.001681	T	0.66096	0.2755	L	0.56396	1.775	0.80722	D	1	P	0.39809	0.689	P	0.45167	0.472	T	0.63265	-0.6676	10	0.05351	T	0.99	.	18.1711	0.89745	0.0:1.0:0.0:0.0	.	85	P24723	KPCL_HUMAN	V	85	ENSP00000452129:A85V;ENSP00000329127:A85V	ENSP00000329127:A85V	A	+	2	0	PRKCH	60858826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.606000	0.82863	2.518000	0.84900	0.655000	0.94253	GCC		0.642	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2		NM_006255	
RAPGEF1	2889	broad.mit.edu	37	9	134612882	134612882	+	De_novo_Start_InFrame	SNP	C	C	T			TCGA-BP-4981-01A-01D-1462-08	TCGA-BP-4981-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	64a1f085-50cc-4129-a617-e0f691a58039	9e6bf5b2-d784-40eb-a221-80f2bf7894dd	g.chr9:134612882C>T	ENST00000372189.3	-	0	43				RAPGEF1_ENST00000372195.1_Intron	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1						activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GGAGCAGGCACTTTCATCTAC	0.542																																																	0													47.0	44.0	45.0					9																	134612882		692	1591	2283			2889			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829		9.37:g.134612882C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5JUE4|Q8IV73	Translation_Start_Site	SNP	ENST00000372189.3	37	CCDS48047.1																																																																																				0.542	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2		NM_005312	
