#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu	37	7	48452147	48452147	+	Silent	SNP	G	G	A	rs369363967	byFrequency	TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr7:48452147G>A	ENST00000435803.1	+	41	12450	c.12426G>A	c.(12424-12426)acG>acA	p.T4142T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4142					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCACCTGACGGGCTATGGGA	0.478													G|||	4	0.000798722	0.0023	0.0014	5008	,	,		17632	0.0		0.0	False		,,,				2504	0.0																0								G		24,3846		0,24,1911	80.0	75.0	77.0		12426	-9.9	0.0	7		77	0,8308		0,0,4154	no	coding-synonymous	ABCA13	NM_152701.3		0,24,6065	AA,AG,GG		0.0,0.6202,0.1971		4142/5059	48452147	24,12154	1935	4154	6089	SO:0001819	synonymous_variant	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12426G>A	7.37:g.48452147G>A		Somatic		WXS	SOLID	Phase_I	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																				0.478	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2		NM_152701	
ACTR8	93973	hgsc.bcm.edu;ucsc.edu	37	3	53916098	53916098	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr3:53916098T>C	ENST00000335754.3	-	1	131	c.31A>G	c.(31-33)Aac>Gac	p.N11D	ACTR8_ENST00000482349.1_5'Flank|AC012467.1_ENST00000410956.1_RNA	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	11					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		tcctttccgttctccGTATCA	0.662																																																	0													56.0	53.0	54.0					3																	53916098		2023	3931	5954	SO:0001583	missense	93973				CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.31A>G	3.37:g.53916098T>C	ENSP00000336842:p.Asn11Asp	Somatic		WXS	SOLID	Phase_I	B3KSW7|Q8N566|Q9H663	Missense_Mutation	SNP	ENST00000335754.3	37	CCDS2875.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.186528	0.57909	.	.	ENSG00000113812	ENST00000335754	D	0.96334	-3.98	5.59	5.59	0.84812	.	0.111229	0.64402	D	0.000009	D	0.89815	0.6824	N	0.08118	0	0.80722	D	1	B	0.32918	0.39	B	0.26864	0.074	D	0.89751	0.3940	10	0.56958	D	0.05	1.7881	13.1361	0.59409	0.0:0.0:0.0:1.0	.	11	Q9H981	ARP8_HUMAN	D	11	ENSP00000336842:N11D	ENSP00000336842:N11D	N	-	1	0	ACTR8	53891138	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	3.198000	0.51035	2.130000	0.65690	0.533000	0.62120	AAC		0.662	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2		NM_022899	
ADAM2	2515	hgsc.bcm.edu;ucsc.edu	37	8	39666986	39666986	+	Splice_Site	SNP	C	C	T			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr8:39666986C>T	ENST00000265708.4	-	7	617		c.e7-1		ADAM2_ENST00000521880.1_Splice_Site|ADAM2_ENST00000347580.4_Intron|ADAM2_ENST00000379853.2_Intron	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2						adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CTTGCTGTGGCTGAAAAAATC	0.249																																																	0													40.0	42.0	41.0					8																	39666986		2184	4247	6431	SO:0001630	splice_region_variant	2515			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.514-1G>A	8.37:g.39666986C>T		Somatic		WXS	SOLID	Phase_I	P78326|Q9UQQ8	Splice_Site	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089839	0.36855	.	.	ENSG00000104755	ENST00000265708;ENST00000521880	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3169	0.54962	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAM2	39786143	0.969000	0.33509	0.968000	0.41197	0.099000	0.18886	2.497000	0.45354	2.629000	0.89072	0.561000	0.74099	.		0.249	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1		NM_001464	Intron
ADAP1	11033	hgsc.bcm.edu	37	7	975057	975057	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr7:975057T>A	ENST00000265846.5	-	2	386	c.167A>T	c.(166-168)aAg>aTg	p.K56M	ADAP1_ENST00000463358.1_5'UTR|ADAP1_ENST00000539900.1_Missense_Mutation_p.K67M	NM_001284308.1|NM_001284309.1|NM_001284311.1|NM_006869.2	NP_001271237.1|NP_001271238.1|NP_001271240.1|NP_006860	O75689	ADAP1_HUMAN	ArfGAP with dual PH domains 1	56	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF GTPase activity (GO:0032312)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	6						GGACTTCACCTTGCTGACCTG	0.682																																																	0													37.0	35.0	35.0					7																	975057		2185	4278	6463	SO:0001583	missense	11033			AJ006422	CCDS5318.1, CCDS64576.1, CCDS64577.1, CCDS75558.1	7p22.3	2013-01-10	2008-09-22	2008-09-22	ENSG00000105963	ENSG00000105963		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16486	protein-coding gene	gene with protein product		608114	"""centaurin, alpha 1"""	CENTA1		10333475	Standard	NM_006869		Approved	GCS1L	uc003sjo.4	O75689	OTTHUMG00000023380	ENST00000265846.5:c.167A>T	7.37:g.975057T>A	ENSP00000265846:p.Lys56Met	Somatic		WXS	SOLID	Phase_I	A4D2Q2|B3KRZ4|B4DVA6|F6XZ68|H7C2Q4	Missense_Mutation	SNP	ENST00000265846.5	37	CCDS5318.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.150622	0.78001	.	.	ENSG00000105963	ENST00000265846;ENST00000539900;ENST00000435943	T;T;T	0.51574	0.7;0.7;0.7	4.44	3.29	0.37713	.	0.155316	0.56097	D	0.000036	T	0.67505	0.2900	M	0.92026	3.265	0.80722	D	1	D	0.52996	0.957	P	0.57679	0.825	T	0.72004	-0.4421	10	0.87932	D	0	-35.039	9.5272	0.39171	0.0:0.0837:0.0:0.9163	.	56	O75689	ADAP1_HUMAN	M	56;67;43	ENSP00000265846:K56M;ENSP00000442682:K67M;ENSP00000394973:K43M	ENSP00000265846:K56M	K	-	2	0	ADAP1	941583	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.147000	0.42226	0.754000	0.32968	0.528000	0.53228	AAG		0.682	ADAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059701.2		NM_006869	
APOB	338	hgsc.bcm.edu;ucsc.edu	37	2	21224731	21224731	+	Silent	SNP	A	A	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr2:21224731A>G	ENST00000233242.1	-	29	13690	c.13563T>C	c.(13561-13563)atT>atC	p.I4521I	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4521					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGACAGGTCAATCAATCTTT	0.363																																																	0													138.0	144.0	142.0					2																	21224731		2203	4300	6503	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13563T>C	2.37:g.21224731A>G		Somatic		WXS	SOLID	Phase_I	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.363	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			
AS3MT	57412	hgsc.bcm.edu;ucsc.edu	37	10	104632879	104632879	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr10:104632879A>C	ENST00000369880.3	+	5	424	c.347A>C	c.(346-348)gAc>gCc	p.D116A	C10orf32-ASMT_ENST00000299353.6_3'UTR	NM_020682.3	NP_065733.2	Q9HBK9	AS3MT_HUMAN	arsenite methyltransferase	116					arsonoacetate metabolic process (GO:0018872)|toxin metabolic process (GO:0009404)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	arsenite methyltransferase activity (GO:0030791)|methylarsonite methyltransferase activity (GO:0030792)			large_intestine(1)|lung(6)	7		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)		AAGTATCTTGACTATCACATG	0.338																																																	0													116.0	112.0	113.0					10																	104632879		1836	4087	5923	SO:0001583	missense	57412			AF226730	CCDS41567.1	10q24.33	2014-05-09	2014-05-09		ENSG00000214435	ENSG00000214435	2.1.1.137		17452	protein-coding gene	gene with protein product		611806	"""arsenic (+3 oxidation state) methyltransferase"""			11790780	Standard	NM_020682		Approved	CYT19	uc001kwk.3	Q9HBK9	OTTHUMG00000018972	ENST00000369880.3:c.347A>C	10.37:g.104632879A>C	ENSP00000358896:p.Asp116Ala	Somatic		WXS	SOLID	Phase_I	A6NP79|Q0VDK3|Q0VDK4|Q5PZ02	Missense_Mutation	SNP	ENST00000369880.3	37	CCDS41567.1	.	.	.	.	.	.	.	.	.	.	A	12.19	1.863083	0.32884	.	.	ENSG00000214435	ENST00000369880	T	0.22945	1.93	5.65	3.32	0.38043	Methyltransferase type 11 (1);	0.451722	0.25114	N	0.033032	T	0.17959	0.0431	L	0.36672	1.1	0.80722	D	1	B;B;B	0.18863	0.031;0.01;0.025	B;B;B	0.24394	0.053;0.021;0.035	T	0.07252	-1.0782	10	0.38643	T	0.18	-0.698	4.6584	0.12630	0.7053:0.0:0.1541:0.1406	.	116;116;116	Q0VDK3;Q9HBK9;Q0VDK4	.;AS3MT_HUMAN;.	A	116	ENSP00000358896:D116A	ENSP00000358896:D116A	D	+	2	0	AS3MT	104622869	0.415000	0.25416	0.131000	0.22000	0.994000	0.84299	1.185000	0.32065	0.421000	0.25980	0.459000	0.35465	GAC		0.338	AS3MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050107.1		NM_020682	
ASNS	440	hgsc.bcm.edu;ucsc.edu	37	7	97487606	97487606	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr7:97487606A>G	ENST00000394309.3	-	7	1358	c.887T>C	c.(886-888)tTa>tCa	p.L296S	ASNS_ENST00000437628.1_Missense_Mutation_p.L213S|ASNS_ENST00000444334.1_Missense_Mutation_p.L275S|ASNS_ENST00000455086.1_Missense_Mutation_p.L213S|ASNS_ENST00000422745.1_Missense_Mutation_p.L275S|ASNS_ENST00000394308.3_Missense_Mutation_p.L296S|ASNS_ENST00000175506.4_Missense_Mutation_p.L296S	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	296	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	AGCAGCCAGTAAATCGGGGCT	0.448																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)												0													94.0	81.0	86.0					7																	97487606		2203	4300	6503	SO:0001583	missense	440			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.887T>C	7.37:g.97487606A>G	ENSP00000377846:p.Leu296Ser	Somatic		WXS	SOLID	Phase_I	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.826265	0.71143	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	4.37	4.37	0.52481	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.261056	0.30575	N	0.009338	T	0.48295	0.1492	L	0.37897	1.145	0.58432	D	0.999992	D	0.56968	0.978	P	0.58577	0.841	T	0.51426	-0.8707	10	0.87932	D	0	-12.3318	12.1812	0.54214	1.0:0.0:0.0:0.0	.	296	P08243	ASNS_HUMAN	S	296;296;213;296;275;213;275	ENSP00000175506:L296S;ENSP00000377846:L296S;ENSP00000414379:L213S;ENSP00000377845:L296S;ENSP00000414901:L275S;ENSP00000408472:L213S;ENSP00000406994:L275S	ENSP00000175506:L296S	L	-	2	0	ASNS	97325542	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	6.298000	0.72763	1.919000	0.55581	0.455000	0.32223	TTA		0.448	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1		NM_001673, NM_183356	
BTN1A1	696	hgsc.bcm.edu;ucsc.edu	37	6	26509059	26509059	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr6:26509059T>A	ENST00000244513.6	+	7	1304	c.1238T>A	c.(1237-1239)cTc>cAc	p.L413H		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	413	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						CGGACCCCTCTCCCATTGGCA	0.502																																																	0													67.0	67.0	67.0					6																	26509059		2203	4300	6503	SO:0001583	missense	696			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1238T>A	6.37:g.26509059T>A	ENSP00000244513:p.Leu413His	Somatic		WXS	SOLID	Phase_I	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	ENST00000244513.6	37	CCDS4614.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.649968	0.47362	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.67171	-0.25	5.98	4.8	0.61643	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.52532	D	0.000066	T	0.74450	0.3718	M	0.87097	2.86	0.34550	D	0.711213	D	0.89917	1.0	D	0.97110	1.0	T	0.79371	-0.1831	10	0.87932	D	0	.	5.446	0.16535	0.1546:0.0802:0.0:0.7652	.	413	Q13410	BT1A1_HUMAN	H	413	ENSP00000244513:L413H	ENSP00000244513:L413H	L	+	2	0	BTN1A1	26617038	0.104000	0.21937	0.798000	0.32154	0.453000	0.32348	1.976000	0.40579	1.048000	0.40298	0.533000	0.62120	CTC		0.502	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043776.1		NM_001732	
HENMT1	113802	hgsc.bcm.edu;ucsc.edu	37	1	109191427	109191427	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr1:109191427C>G	ENST00000370032.5	-	8	1363	c.943G>C	c.(943-945)Gga>Cga	p.G315R	HENMT1_ENST00000493676.1_5'Flank|HENMT1_ENST00000370031.1_Missense_Mutation_p.G346R|HENMT1_ENST00000402983.1_Missense_Mutation_p.G315R	NM_144584.2	NP_653185.2	Q5T8I9	HENMT_HUMAN	HEN1 methyltransferase homolog 1 (Arabidopsis)	315					gene silencing by RNA (GO:0031047)|piRNA metabolic process (GO:0034587)|RNA methylation (GO:0001510)	P granule (GO:0043186)	metal ion binding (GO:0046872)|O-methyltransferase activity (GO:0008171)|RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	16						AAGACTGGTCCAAAGCATGGG	0.522																																																	0													108.0	100.0	102.0					1																	109191427		2203	4300	6503	SO:0001583	missense	0				CCDS787.1	1p13.3	2011-01-28	2011-01-28	2011-01-28	ENSG00000162639	ENSG00000162639			26400	protein-coding gene	gene with protein product	"""HEN1 methyltransferase homolog (Arabidopsis)"""	612178	"""chromosome 1 open reading frame 59"""	C1orf59			Standard	NM_144584		Approved	FLJ30525, HEN1	uc001dvt.4	Q5T8I9	OTTHUMG00000011123	ENST00000370032.5:c.943G>C	1.37:g.109191427C>G	ENSP00000359049:p.Gly315Arg	Somatic		WXS	SOLID	Phase_I	A8MRR6|B1AM16|B1AM17|Q96EJ7|Q96NN0	Missense_Mutation	SNP	ENST00000370032.5	37	CCDS787.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.173844	0.38413	.	.	ENSG00000162639	ENST00000402983;ENST00000370031;ENST00000370032;ENST00000420055	T;T;T;T	0.33865	1.97;1.95;1.97;1.39	5.08	2.01	0.26516	.	0.823306	0.11339	N	0.574285	T	0.05273	0.0140	N	0.19112	0.55	0.09310	N	1	B	0.30281	0.275	B	0.23852	0.049	T	0.37865	-0.9687	10	0.12103	T	0.63	0.2046	2.786	0.05374	0.1384:0.5284:0.1625:0.1707	.	315	Q5T8I9	HENMT_HUMAN	R	315;346;315;315	ENSP00000385655:G315R;ENSP00000359048:G346R;ENSP00000359049:G315R;ENSP00000403953:G315R	ENSP00000359048:G346R	G	-	1	0	HENMT1	108992950	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.583000	0.23849	0.307000	0.22880	0.655000	0.94253	GGA		0.522	HENMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030592.1		NM_144584	
CCNA1	8900	hgsc.bcm.edu;ucsc.edu	37	13	37007258	37007258	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr13:37007258G>A	ENST00000255465.4	+	2	461	c.197G>A	c.(196-198)tGt>tAt	p.C66Y	CCNA1_ENST00000449823.1_Missense_Mutation_p.C22Y|CCNA1_ENST00000418263.1_Missense_Mutation_p.C65Y|CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000440264.1_Missense_Mutation_p.C22Y			P78396	CCNA1_HUMAN	cyclin A1	66					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		CCCGATGCTTGTCAGATACTC	0.607																																																	0													89.0	87.0	88.0					13																	37007258		2203	4300	6503	SO:0001583	missense	8900			U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.197G>A	13.37:g.37007258G>A	ENSP00000255465:p.Cys66Tyr	Somatic		WXS	SOLID	Phase_I	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	37	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.101973	0.37048	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.14640	2.59;2.59;2.49;2.49	4.63	1.86	0.25419	.	0.815751	0.11245	N	0.584207	T	0.07503	0.0189	L	0.31294	0.92	0.32416	N	0.550054	B;B	0.11235	0.004;0.002	B;B	0.06405	0.002;0.001	T	0.40590	-0.9555	10	0.02654	T	1	.	5.3942	0.16261	0.1881:0.1692:0.6427:0.0	.	65;66	P78396-2;P78396	.;CCNA1_HUMAN	Y	22;22;65;66	ENSP00000400666:C22Y;ENSP00000409873:C22Y;ENSP00000396479:C65Y;ENSP00000255465:C66Y	ENSP00000255465:C66Y	C	+	2	0	CCNA1	35905258	0.933000	0.31639	0.995000	0.50966	0.964000	0.63967	0.875000	0.28079	0.473000	0.27368	0.555000	0.69702	TGT		0.607	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2		NM_003914	
PRR32	100130613	hgsc.bcm.edu	37	X	125955323	125955323	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chrX:125955323T>G	ENST00000371125.3	+	2	782	c.702T>G	c.(700-702)agT>agG	p.S234R		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		234	Pro-rich.																TGTCTTCCAGTACTCCAGGTT	0.502																																																	0													211.0	147.0	166.0					X																	125955323		692	1591	2283	SO:0001583	missense	100130613																														ENST00000371125.3:c.702T>G	X.37:g.125955323T>G	ENSP00000360166:p.Ser234Arg	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000371125.3	37	CCDS48163.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.679051	0.47886	.	.	ENSG00000183631	ENST00000371125	T	0.48201	0.82	4.12	1.55	0.23275	.	0.401569	0.18424	N	0.141667	T	0.36441	0.0967	L	0.32530	0.975	0.09310	N	1	P	0.47677	0.899	P	0.45681	0.49	T	0.20075	-1.0286	10	0.72032	D	0.01	-2.7389	5.201	0.15264	0.0:0.2683:0.0:0.7317	.	234	B1ATL7	CX064_HUMAN	R	234	ENSP00000360166:S234R	ENSP00000360166:S234R	S	+	3	2	CXorf64	125783004	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.068000	0.14531	0.198000	0.20407	0.486000	0.48141	AGT		0.502	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058188.1			
DAPP1	27071	hgsc.bcm.edu;ucsc.edu	37	4	100756843	100756843	+	Silent	SNP	C	C	T	rs554960188		TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr4:100756843C>T	ENST00000512369.1	+	2	233	c.165C>T	c.(163-165)gaC>gaT	p.D55D	DAPP1_ENST00000296414.7_Silent_p.D55D	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	55	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		ATGGATGTGACGGCAGCTACC	0.547																																																	0													130.0	127.0	128.0					4																	100756843		2072	4203	6275	SO:0001819	synonymous_variant	27071			AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.165C>T	4.37:g.100756843C>T		Somatic		WXS	SOLID	Phase_I	Q8TCK5|Q9UHF2	Silent	SNP	ENST00000512369.1	37	CCDS47112.1																																																																																				0.547	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1			
DCDC1	341019	hgsc.bcm.edu;ucsc.edu	37	11	31327796	31327796	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr11:31327796C>T	ENST00000452803.1	-	5	775	c.574G>A	c.(574-576)Gta>Ata	p.V192I	DCDC1_ENST00000597505.1_Missense_Mutation_p.V192I|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	192	Doublecortin. {ECO:0000255|PROSITE- ProRule:PRU00072}.			V -> A (in Ref. 1; AAP75563). {ECO:0000305}.	intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ATGGTTGGTACAGTAACTCTG	0.323																																																	0													124.0	119.0	121.0					11																	31327796		2202	4299	6501	SO:0001583	missense	341019			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.574G>A	11.37:g.31327796C>T	ENSP00000389792:p.Val192Ile	Somatic		WXS	SOLID	Phase_I	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683877	0.68157	.	.	ENSG00000188682	ENST00000452803	D	0.93247	-3.19	5.95	4.08	0.47627	Doublecortin domain (3);	0.603708	0.14607	N	0.309295	D	0.90324	0.6973	L	0.48362	1.52	0.20926	N	0.999829	B	0.29590	0.25	B	0.30572	0.117	D	0.84106	0.0398	10	0.52906	T	0.07	.	11.3676	0.49681	0.0:0.8577:0.0:0.1423	.	192	P59894	DCDC1_HUMAN	I	192	ENSP00000389792:V192I	ENSP00000343496:V192I	V	-	1	0	DCDC1	31284372	0.998000	0.40836	0.985000	0.45067	0.990000	0.78478	1.857000	0.39399	1.518000	0.48934	0.650000	0.86243	GTA		0.323	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1		NM_181807	
DECR2	26063	hgsc.bcm.edu	37	16	460352	460352	+	Nonsense_Mutation	SNP	T	T	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr16:460352T>G	ENST00000219481.5	+	5	585	c.447T>G	c.(445-447)taT>taG	p.Y149*	DECR2_ENST00000461947.1_3'UTR|DECR2_ENST00000424398.2_Nonsense_Mutation_p.Y137*|DECR2_ENST00000397710.1_Nonstop_Mutation_p.*212G	NM_020664.3	NP_065715.1	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2, peroxisomal	149					unsaturated fatty acid biosynthetic process (GO:0006636)	peroxisomal membrane (GO:0005778)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)	9		Hepatocellular(16;0.00015)				GTGTGCTCTATGAGAAGTTCT	0.587																																																	0													127.0	107.0	114.0					16																	460352		2202	4300	6502	SO:0001587	stop_gained	26063			AJ293009	CCDS10409.1	16p13.3	2011-09-14			ENSG00000242612	ENSG00000242612	1.3.1.34	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2754	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 17C, member 1"""	615839				11514237, 19027726	Standard	NM_020664		Approved	PDCR, SDR17C1	uc002chb.3	Q9NUI1	OTTHUMG00000047846	ENST00000219481.5:c.447T>G	16.37:g.460352T>G	ENSP00000219481:p.Tyr149*	Somatic		WXS	SOLID	Phase_I	Q6ZRS7|Q96ET0	Nonsense_Mutation	SNP	ENST00000219481.5	37	CCDS10409.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.194|9.194	1.026860|1.026860	0.19512|0.19512	.|.	.|.	ENSG00000242612|ENSG00000242612	ENST00000397710|ENST00000219481;ENST00000424398	.|.	.|.	.|.	5.64|5.64	-5.66|-5.66	0.02451|0.02451	.|.	.|0.157132	.|0.64402	.|D	.|0.000017	.|.	.|.	.|.	.|.	.|.	.|.	0.21386|0.21386	N|N	0.999702|0.999702	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.02654	.|T	.|1	.|.	13.7308|13.7308	0.62787|0.62787	0.0:0.3304:0.0:0.6696|0.0:0.3304:0.0:0.6696	.|.	.|.	.|.	.|.	G|X	212|149;137	.|.	.|ENSP00000219481:Y149X	X|Y	+|+	1|3	0|2	DECR2|DECR2	400353|400353	0.248000|0.248000	0.23930|0.23930	0.515000|0.515000	0.27774|0.27774	0.245000|0.245000	0.25701|0.25701	-0.451000|-0.451000	0.06795|0.06795	-1.425000|-1.425000	0.01997|0.01997	0.448000|0.448000	0.29417|0.29417	TGA|TAT		0.587	DECR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109069.4		NM_020664	
FGD1	2245	hgsc.bcm.edu;ucsc.edu	37	X	54491907	54491907	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chrX:54491907G>A	ENST00000375135.3	-	8	2346	c.1613C>T	c.(1612-1614)tCc>tTc	p.S538F		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	538	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GCTGTCCGGGGAGCCATGGGG	0.577																																																	0													45.0	42.0	43.0					X																	54491907		2203	4300	6503	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1613C>T	X.37:g.54491907G>A	ENSP00000364277:p.Ser538Phe	Somatic		WXS	SOLID	Phase_I	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860505	0.91433	.	.	ENSG00000102302	ENST00000375135	T	0.64803	-0.12	5.43	5.43	0.79202	Dbl homology (DH) domain (5);	0.000000	0.52532	D	0.000079	T	0.77955	0.4208	M	0.74647	2.275	0.54753	D	0.99998	P;P	0.45957	0.869;0.869	P;P	0.59948	0.866;0.797	T	0.80527	-0.1343	10	0.87932	D	0	-0.9915	17.0002	0.86380	0.0:0.0:1.0:0.0	.	296;538	B4DS99;P98174	.;FGD1_HUMAN	F	538	ENSP00000364277:S538F	ENSP00000364277:S538F	S	-	2	0	FGD1	54508632	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.702000	0.98712	2.277000	0.76020	0.523000	0.50628	TCC		0.577	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1		NM_004463	
FRMPD2	143162	hgsc.bcm.edu;ucsc.edu	37	10	49450292	49450292	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr10:49450292A>G	ENST00000374201.3	-	5	781	c.479T>C	c.(478-480)gTt>gCt	p.V160A	FRMPD2_ENST00000407470.4_Missense_Mutation_p.V129A|FRMPD2_ENST00000305531.3_Missense_Mutation_p.V136A	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	160	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TTTCTCATGAACCCGACAAGC	0.562																																																	0													101.0	98.0	99.0					10																	49450292		2203	4300	6503	SO:0001583	missense	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.479T>C	10.37:g.49450292A>G	ENSP00000363317:p.Val160Ala	Somatic		WXS	SOLID	Phase_I	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.555821	0.00918	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.24908	1.83;1.83;1.83	5.36	-2.54	0.06307	KIND (2);	.	.	.	.	T	0.13586	0.0329	N	0.16790	0.44	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.32955	-0.9887	9	0.22109	T	0.4	.	10.5169	0.44896	0.4624:0.0:0.5376:0.0	.	136;160;129	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	A	160;136;129	ENSP00000363317:V160A;ENSP00000307079:V136A;ENSP00000384339:V129A	ENSP00000307079:V136A	V	-	2	0	FRMPD2	49120298	0.000000	0.05858	0.000000	0.03702	0.243000	0.25628	0.012000	0.13287	-0.490000	0.06707	-0.290000	0.09829	GTT		0.562	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3		NM_152428	
GLDC	2731	hgsc.bcm.edu	37	9	6536219	6536219	+	Missense_Mutation	SNP	T	T	C	rs141152043	byFrequency	TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr9:6536219T>C	ENST00000321612.6	-	23	2833	c.2683A>G	c.(2683-2685)Atg>Gtg	p.M895V		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	895					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	GGCCAGGACATGGTAGGGGCG	0.542													T|||	9	0.00179712	0.0061	0.0	5008	,	,		20312	0.0		0.001	False		,,,				2504	0.0																0								T	VAL/MET	20,4386	26.2+/-53.5	0,20,2183	36.0	31.0	33.0		2683	5.2	1.0	9	dbSNP_134	33	3,8597	3.0+/-9.4	0,3,4297	yes	missense	GLDC	NM_000170.2	21	0,23,6480	CC,CT,TT		0.0349,0.4539,0.1768	benign	895/1021	6536219	23,12983	2203	4300	6503	SO:0001583	missense	2731			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2683A>G	9.37:g.6536219T>C	ENSP00000370737:p.Met895Val	Somatic		WXS	SOLID	Phase_I	Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	CCDS34987.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	T	13.77	2.335394	0.41398	0.004539	3.49E-4	ENSG00000178445	ENST00000321612	D	0.97959	-4.63	5.21	5.21	0.72293	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.95242	0.8457	L	0.38175	1.15	0.80722	D	1	B	0.26547	0.152	B	0.25987	0.065	D	0.93643	0.6966	10	0.41790	T	0.15	-25.9896	15.3768	0.74610	0.0:0.0:0.0:1.0	.	895	P23378	GCSP_HUMAN	V	895	ENSP00000370737:M895V	ENSP00000370737:M895V	M	-	1	0	GLDC	6526219	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.596000	0.82721	2.092000	0.63282	0.254000	0.18369	ATG		0.542	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2		NM_000170	
HFM1	164045	hgsc.bcm.edu;ucsc.edu	37	1	91840948	91840948	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr1:91840948G>C	ENST00000370425.3	-	13	1750	c.1652C>G	c.(1651-1653)gCt>gGt	p.A551G	HFM1_ENST00000370424.3_Missense_Mutation_p.A230G|HFM1_ENST00000294696.5_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	551	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AATAAATTTAGCATCTTTCAC	0.333																																																	0													78.0	74.0	75.0					1																	91840948		1826	4077	5903	SO:0001583	missense	164045			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.1652C>G	1.37:g.91840948G>C	ENSP00000359454:p.Ala551Gly	Somatic		WXS	SOLID	Phase_I	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664593	0.47572	.	.	ENSG00000162669	ENST00000370425;ENST00000370424;ENST00000370421;ENST00000541820	T;T	0.44482	0.92;0.92	5.71	4.79	0.61399	Helicase, C-terminal (1);	0.000000	0.29355	U	0.012386	T	0.33556	0.0867	N	0.24115	0.695	0.80722	D	1	B;D	0.55605	0.166;0.972	B;P	0.55871	0.077;0.786	T	0.10989	-1.0606	10	0.52906	T	0.07	.	14.1122	0.65129	0.0717:0.0:0.9283:0.0	.	230;551	A6NGI5;A2PYH4	.;HFM1_HUMAN	G	551;230;235;584	ENSP00000359454:A551G;ENSP00000359453:A230G	ENSP00000359450:A235G	A	-	2	0	HFM1	91613536	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	4.921000	0.63397	2.711000	0.92665	0.563000	0.77884	GCT		0.333	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2		NM_001017975	
IGSF22	283284	hgsc.bcm.edu;ucsc.edu	37	11	18738274	18738274	+	Splice_Site	SNP	C	C	T			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr11:18738274C>T	ENST00000513874.1	-	10	1386		c.e10+1		RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22											NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CAACCACTCACGGTCAACAGT	0.517																																																	0													88.0	86.0	87.0					11																	18738274		1955	4146	6101	SO:0001630	splice_region_variant	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1246+1G>A	11.37:g.18738274C>T		Somatic		WXS	SOLID	Phase_I	A6NNA0|D6RGV7	Splice_Site	SNP	ENST00000513874.1	37	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553672	0.45487	.	.	ENSG00000179057	ENST00000513874	.	.	.	4.77	2.81	0.32909	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0909	0.30801	0.0:0.7192:0.0:0.2808	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF22	18694850	1.000000	0.71417	0.961000	0.40146	0.681000	0.39784	1.355000	0.34068	0.367000	0.24454	0.655000	0.94253	.		0.517	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2		NM_173588	Intron
KIF23	9493	hgsc.bcm.edu;ucsc.edu	37	15	69714040	69714040	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr15:69714040T>C	ENST00000260363.4	+	4	382	c.265T>C	c.(265-267)Ttt>Ctt	p.F89L	KIF23_ENST00000395392.2_Missense_Mutation_p.F89L|KIF23_ENST00000537891.1_5'Flank|KIF23_ENST00000558585.1_5'Flank|KIF23_ENST00000559279.1_Missense_Mutation_p.F89L|KIF23_ENST00000352331.4_Missense_Mutation_p.F89L	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	89	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						GAAGGAACTCTTTGATGTTGT	0.368																																																	0													145.0	144.0	144.0					15																	69714040		2199	4298	6497	SO:0001583	missense	9493			X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.265T>C	15.37:g.69714040T>C	ENSP00000260363:p.Phe89Leu	Somatic		WXS	SOLID	Phase_I	Q8WVP0	Missense_Mutation	SNP	ENST00000260363.4	37	CCDS32278.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.942739	0.92526	.	.	ENSG00000137807	ENST00000260363;ENST00000352331;ENST00000395392	T;T;T	0.78003	-1.14;-1.14;-1.14	5.88	5.88	0.94601	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.91915	0.7440	H	0.96943	3.91	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.72982	0.979;0.977	D	0.94364	0.7590	10	0.87932	D	0	.	15.1138	0.72384	0.0:0.0:0.0:1.0	.	89;89	Q02241-2;Q02241	.;KIF23_HUMAN	L	89	ENSP00000260363:F89L;ENSP00000304978:F89L;ENSP00000378790:F89L	ENSP00000260363:F89L	F	+	1	0	KIF23	67501094	1.000000	0.71417	0.997000	0.53966	0.633000	0.38033	7.898000	0.87363	2.250000	0.74265	0.482000	0.46254	TTT		0.368	KIF23-201	KNOWN	basic|CCDS	protein_coding	protein_coding				
LDLRAD1	388633	hgsc.bcm.edu;ucsc.edu	37	1	54477874	54477874	+	Silent	SNP	C	C	T			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr1:54477874C>T	ENST00000371360.1	-	4	299	c.282G>A	c.(280-282)ggG>ggA	p.G94G	LDLRAD1_ENST00000420619.1_Silent_p.G55G|LDLRAD1_ENST00000371362.3_Intron|LDLRAD1_ENST00000545928.1_Silent_p.G51G	NM_001010978.2	NP_001010978.2	Q5T700	LRAD1_HUMAN	low density lipoprotein receptor class A domain containing 1	94	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.					integral component of membrane (GO:0016021)				large_intestine(3)|prostate(1)|skin(3)	7						CATCACAGACCCCACTGGCTG	0.607																																																	0													137.0	108.0	118.0					1																	54477874		2203	4300	6503	SO:0001819	synonymous_variant	388633				CCDS30725.1, CCDS60145.1, CCDS60146.1, CCDS60147.1	1p32.3	2008-02-05	2005-10-07		ENSG00000203985	ENSG00000203985			32069	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 1"""				Standard	NM_001010978		Approved		uc001cwm.2	Q5T700	OTTHUMG00000008433	ENST00000371360.1:c.282G>A	1.37:g.54477874C>T		Somatic		WXS	SOLID	Phase_I	A0PJY0|B7ZME3|Q5T6Z9	Silent	SNP	ENST00000371360.1	37	CCDS30725.1																																																																																				0.607	LDLRAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023243.1		NM_001010978	
LRFN5	145581	hgsc.bcm.edu;ucsc.edu	37	14	42356392	42356392	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr14:42356392G>T	ENST00000298119.4	+	3	1753	c.564G>T	c.(562-564)aaG>aaT	p.K188N	LRFN5_ENST00000554171.1_Missense_Mutation_p.K188N|LRFN5_ENST00000554120.1_Missense_Mutation_p.K188N	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	188						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		ACATTCCTAAGGGGACCTTCT	0.423										HNSCC(30;0.082)																																							0													73.0	63.0	66.0					14																	42356392		2203	4300	6503	SO:0001583	missense	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.564G>T	14.37:g.42356392G>T	ENSP00000298119:p.Lys188Asn	Somatic		WXS	SOLID	Phase_I	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287667	0.23478	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	D;D;D	0.91237	-2.81;-2.81;-2.81	5.56	-1.24	0.09435	.	0.000000	0.56097	D	0.000023	T	0.78362	0.4271	N	0.04655	-0.195	0.45762	D	0.998659	B;B	0.21905	0.062;0.03	B;B	0.31614	0.133;0.063	T	0.64394	-0.6418	10	0.48119	T	0.1	.	10.4058	0.44256	0.5756:0.0:0.4244:0.0	.	188;188	G3V364;Q96NI6	.;LRFN5_HUMAN	N	188	ENSP00000298119:K188N;ENSP00000451897:K188N;ENSP00000451067:K188N	ENSP00000298119:K188N	K	+	3	2	LRFN5	41426142	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	0.652000	0.24888	-0.148000	0.11234	0.650000	0.86243	AAG		0.423	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1		NM_152447	
MAP3K5	4217	hgsc.bcm.edu;ucsc.edu	37	6	136879991	136879991	+	Silent	SNP	T	T	C	rs370967982		TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr6:136879991T>C	ENST00000359015.4	-	29	4371	c.4011A>G	c.(4009-4011)ctA>ctG	p.L1337L	MAP3K5_ENST00000355845.4_Silent_p.L584L	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1337					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GAACATCCAATAGTGTATAAT	0.323																																																	0								T		0,4406		0,0,2203	115.0	119.0	118.0		4011	-2.9	0.2	6		118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MAP3K5	NM_005923.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		1337/1375	136879991	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.4011A>G	6.37:g.136879991T>C		Somatic		WXS	SOLID	Phase_I	A6NIA0|B4DGB2|Q5THN3|Q99461	Silent	SNP	ENST00000359015.4	37	CCDS5179.1																																																																																				0.323	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			
OR10A6	390093	hgsc.bcm.edu;ucsc.edu	37	11	7949711	7949711	+	Missense_Mutation	SNP	G	G	A	rs267603212		TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr11:7949711G>A	ENST00000309838.2	-	1	498	c.499C>T	c.(499-501)Ccc>Tcc	p.P167S		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P167S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCACAAAAGGGAAAACTAGAT	0.323																																																	1	Substitution - Missense(1)	breast(1)											41.0	45.0	43.0					11																	7949711		2201	4295	6496	SO:0001583	missense	390093			AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.499C>T	11.37:g.7949711G>A	ENSP00000312470:p.Pro167Ser	Somatic		WXS	SOLID	Phase_I	Q6IF59	Missense_Mutation	SNP	ENST00000309838.2	37	CCDS31420.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.291663	0.23564	.	.	ENSG00000175393	ENST00000309838	T	0.00164	8.64	4.41	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000583	T	0.00210	0.0006	L	0.28458	0.855	0.22305	N	0.99922	D	0.53745	0.962	P	0.60286	0.872	T	0.52873	-0.8517	10	0.45353	T	0.12	.	5.4197	0.16394	0.3177:0.0:0.6823:0.0	.	167	Q8NH74	O10A6_HUMAN	S	167	ENSP00000312470:P167S	ENSP00000312470:P167S	P	-	1	0	OR10A6	7906287	0.114000	0.22134	1.000000	0.80357	0.137000	0.21094	0.377000	0.20552	1.209000	0.43321	0.655000	0.94253	CCC		0.323	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1		NM_001004461	
PARVG	64098	hgsc.bcm.edu;ucsc.edu	37	22	44592248	44592248	+	Missense_Mutation	SNP	C	C	A	rs375369681		TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr22:44592248C>A	ENST00000444313.3	+	11	1148	c.664C>A	c.(664-666)Cag>Aag	p.Q222K	PARVG_ENST00000422871.1_Missense_Mutation_p.Q222K|PARVG_ENST00000415224.1_Missense_Mutation_p.Q222K	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	222	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				CTTTGTCAACCAGAAGCTGGA	0.622																																																	0													109.0	98.0	102.0					22																	44592248		2203	4300	6503	SO:0001583	missense	64098			AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.664C>A	22.37:g.44592248C>A	ENSP00000391583:p.Gln222Lys	Somatic		WXS	SOLID	Phase_I	B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Missense_Mutation	SNP	ENST00000444313.3	37	CCDS14057.1	.	.	.	.	.	.	.	.	.	.	C	2.900	-0.227768	0.06022	.	.	ENSG00000138964	ENST00000422871;ENST00000444313;ENST00000415224	D;D;D	0.94280	-3.39;-3.39;-3.39	4.87	2.5	0.30297	Calponin homology domain (5);	0.209095	0.42172	D	0.000750	T	0.78304	0.4262	N	0.02775	-0.495	0.37570	D	0.91941	B	0.14012	0.009	B	0.17098	0.017	T	0.71619	-0.4538	10	0.02654	T	1	-10.7853	8.3466	0.32277	0.2535:0.613:0.1334:0.0	.	222	Q9HBI0	PARVG_HUMAN	K	222	ENSP00000391453:Q222K;ENSP00000391583:Q222K;ENSP00000416761:Q222K	ENSP00000416761:Q222K	Q	+	1	0	PARVG	42923581	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.357000	0.20199	1.002000	0.39104	0.650000	0.86243	CAG		0.622	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318238.4		NM_022141	
PCLO	27445	hgsc.bcm.edu;ucsc.edu	37	7	82585659	82585659	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr7:82585659C>T	ENST00000333891.9	-	5	4947	c.4610G>A	c.(4609-4611)aGc>aAc	p.S1537N	PCLO_ENST00000423517.2_Missense_Mutation_p.S1537N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTCATCACTGCTTGATGAGCC	0.408																																																	0													139.0	126.0	130.0					7																	82585659		1915	4155	6070	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4610G>A	7.37:g.82585659C>T	ENSP00000334319:p.Ser1537Asn	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.051771	0.55218	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.22743	1.94;1.95	5.47	5.47	0.80525	.	.	.	.	.	T	0.45175	0.1329	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.34601	-0.9822	9	0.87932	D	0	.	19.3222	0.94246	0.0:1.0:0.0:0.0	.	1537;1537	Q9Y6V0-5;Q9Y6V0-6	.;.	N	1468;1537;1537	ENSP00000334319:S1537N;ENSP00000388393:S1537N	ENSP00000334319:S1537N	S	-	2	0	PCLO	82423595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.656000	0.67988	2.569000	0.86673	0.655000	0.94253	AGC		0.408	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5		NM_014510	
RBBP6	5930	hgsc.bcm.edu;ucsc.edu	37	16	24573318	24573318	+	Silent	SNP	T	T	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr16:24573318T>G	ENST00000319715.4	+	10	1557	c.1125T>G	c.(1123-1125)tcT>tcG	p.S375S	RBBP6_ENST00000348022.2_Silent_p.S375S|RBBP6_ENST00000381039.3_Silent_p.S375S	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	375					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CAGTGACATCTTCATCAACTC	0.468																																																	0													192.0	176.0	181.0					16																	24573318		2197	4300	6497	SO:0001819	synonymous_variant	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.1125T>G	16.37:g.24573318T>G		Somatic		WXS	SOLID	Phase_I	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	ENST00000319715.4	37	CCDS10621.1																																																																																				0.468	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2		NM_006910	
RHBDD1	84236	hgsc.bcm.edu;ucsc.edu	37	2	227771560	227771560	+	Silent	SNP	T	T	C			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr2:227771560T>C	ENST00000341329.3	+	4	860	c.618T>C	c.(616-618)acT>acC	p.T206T	RHBDD1_ENST00000392062.2_Silent_p.T206T|RHBDD1_ENST00000409053.1_Silent_p.T40T	NM_032276.3	NP_115652.2	Q8TEB9	RHBL4_HUMAN	rhomboid domain containing 1	206					apoptotic process (GO:0006915)|cellular response to unfolded protein (GO:0034620)|cellular response to UV (GO:0034644)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|membrane protein intracellular domain proteolysis (GO:0031293)|membrane protein proteolysis (GO:0033619)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein processing (GO:0010954)|positive regulation of secretion (GO:0051047)|post-translational protein modification (GO:0043687)|spermatid differentiation (GO:0048515)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		TAATGTACACTCAAGGGCCTC	0.443																																																	0													140.0	146.0	144.0					2																	227771560		2203	4300	6503	SO:0001819	synonymous_variant	84236			AK074258	CCDS2464.1	2q36.3	2012-07-09			ENSG00000144468	ENSG00000144468			23081	protein-coding gene	gene with protein product						12838346	Standard	NM_032276		Approved	DKFZp547E052	uc002voi.3	Q8TEB9	OTTHUMG00000133178	ENST00000341329.3:c.618T>C	2.37:g.227771560T>C		Somatic		WXS	SOLID	Phase_I	Q495B9|Q53S43|Q5EBM8|Q6P5V8|Q8IV60|Q9H057	Silent	SNP	ENST00000341329.3	37	CCDS2464.1																																																																																				0.443	RHBDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256885.2			
SLC16A7	9194	hgsc.bcm.edu;ucsc.edu	37	12	60169209	60169209	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr12:60169209T>G	ENST00000261187.4	+	4	1297	c.1133T>G	c.(1132-1134)gTc>gGc	p.V378G	SLC16A7_ENST00000552024.1_Missense_Mutation_p.V378G|SLC16A7_ENST00000552432.1_Missense_Mutation_p.V378G|SLC16A7_ENST00000543448.1_Missense_Mutation_p.V279G|SLC16A7_ENST00000547379.1_Missense_Mutation_p.V378G	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	378					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	GTCGGACTTGTCACAATTGTG	0.433																																																	0													101.0	93.0	96.0					12																	60169209		2203	4300	6503	SO:0001583	missense	9194			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.1133T>G	12.37:g.60169209T>G	ENSP00000261187:p.Val378Gly	Somatic		WXS	SOLID	Phase_I	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	T	11.10	1.538698	0.27475	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448	T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29	5.77	-1.01	0.10169	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.665589	0.16064	N	0.231348	T	0.71117	0.3302	M	0.82823	2.61	0.36108	D	0.844599	D	0.56746	0.977	P	0.62560	0.904	T	0.74976	-0.3480	9	.	.	.	.	10.8476	0.46751	0.0:0.4126:0.0:0.5874	.	378	O60669	MOT2_HUMAN	G	378;378;378;378;378;279	ENSP00000449547:V378G;ENSP00000448071:V378G;ENSP00000448742:V378G;ENSP00000446722:V378G;ENSP00000261187:V378G;ENSP00000443731:V279G	.	V	+	2	0	SLC16A7	58455476	0.999000	0.42202	0.010000	0.14722	0.007000	0.05969	1.304000	0.33482	-0.317000	0.08677	-0.408000	0.06270	GTC		0.433	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1		NM_004731	
TAS2R1	50834	hgsc.bcm.edu;ucsc.edu	37	5	9629743	9629743	+	Silent	SNP	C	C	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr5:9629743C>G	ENST00000382492.2	-	1	720	c.402G>C	c.(400-402)ctG>ctC	p.L134L	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	134					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						ATACATATAGCAGAGACCCCA	0.428																																																	0													51.0	55.0	53.0					5																	9629743		2203	4300	6503	SO:0001819	synonymous_variant	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.402G>C	5.37:g.9629743C>G		Somatic		WXS	SOLID	Phase_I	Q646G8	Silent	SNP	ENST00000382492.2	37	CCDS3876.1																																																																																				0.428	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			
TRIM3	10612	hgsc.bcm.edu	37	11	6477381	6477381	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr11:6477381T>C	ENST00000525074.1	-	7	1848	c.1454A>G	c.(1453-1455)gAa>gGa	p.E485G	TRIM3_ENST00000529058.1_5'UTR|TRIM3_ENST00000536344.1_Missense_Mutation_p.E366G|TRIM3_ENST00000359518.3_Missense_Mutation_p.E485G|TRIM3_ENST00000345851.3_Missense_Mutation_p.E485G|TRIM3_ENST00000537602.1_Missense_Mutation_p.E407G	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	485					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATTGGTGAATTCACCTTTCTC	0.522																																					Melanoma(6;5 510 1540 25169 29084)												0													127.0	113.0	118.0					11																	6477381		2201	4296	6497	SO:0001583	missense	10612			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1454A>G	11.37:g.6477381T>C	ENSP00000433102:p.Glu485Gly	Somatic		WXS	SOLID	Phase_I	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	T	31	5.087133	0.94100	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	5.56	5.56	0.83823	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.91171	0.7219	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.987	D	0.92218	0.5782	10	0.72032	D	0.01	-16.0271	14.5421	0.68002	0.0:0.0:0.0:1.0	.	366;485	F5H2Q8;O75382	.;TRIM3_HUMAN	G	485;485;485;485;474;407;485;366	ENSP00000433102:E485G;ENSP00000340797:E485G;ENSP00000441091:E407G;ENSP00000352508:E485G;ENSP00000445460:E366G	ENSP00000337094:E474G	E	-	2	0	TRIM3	6433957	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.967000	0.87967	2.109000	0.64355	0.460000	0.39030	GAA		0.522	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2		NM_006458	
TXN2	25828	hgsc.bcm.edu;ucsc.edu	37	22	36872895	36872895	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr22:36872895C>G	ENST00000216185.2	-	3	738	c.272G>C	c.(271-273)gGa>gCa	p.G91A	TXN2_ENST00000416967.1_5'UTR|TXN2_ENST00000487725.1_5'UTR|TXN2_ENST00000403313.1_Missense_Mutation_p.G91A			Q99757	THIOM_HUMAN	thioredoxin 2	91	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.	Contributes to redox potential value. {ECO:0000250}.			cell redox homeostasis (GO:0045454)|cellular response to nutrient levels (GO:0031669)|glycerol ether metabolic process (GO:0006662)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)	dendrite (GO:0030425)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)	protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|lung(1)|prostate(1)	3						CTTGCAGGGTCCACACCACCT	0.547																																																	0													153.0	123.0	133.0					22																	36872895		2203	4300	6503	SO:0001583	missense	25828			U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348			17772	protein-coding gene	gene with protein product		609063				9006939, 17220299	Standard	NM_012473		Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.272G>C	22.37:g.36872895C>G	ENSP00000216185:p.Gly91Ala	Somatic		WXS	SOLID	Phase_I	Q5JZA0|Q6FH60|Q9UH29	Missense_Mutation	SNP	ENST00000216185.2	37	CCDS13928.1	.	.	.	.	.	.	.	.	.	.	c	22.6	4.306606	0.81247	.	.	ENSG00000100348	ENST00000216185;ENST00000403313	T;T	0.09163	3.01;3.01	5.17	5.17	0.71159	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.21307	0.0513	M	0.64630	1.985	0.80722	D	1	P	0.51653	0.947	P	0.48030	0.564	T	0.00992	-1.1488	10	0.87932	D	0	-7.9483	18.7023	0.91625	0.0:1.0:0.0:0.0	.	91	Q99757	THIOM_HUMAN	A	91	ENSP00000216185:G91A;ENSP00000385393:G91A	ENSP00000216185:G91A	G	-	2	0	TXN2	35202841	1.000000	0.71417	0.998000	0.56505	0.657000	0.38888	7.579000	0.82511	2.426000	0.82243	0.450000	0.29827	GGA		0.547	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319016.1		NM_012473	
USP36	57602	hgsc.bcm.edu	37	17	76810621	76810621	+	Missense_Mutation	SNP	G	G	A	rs568739495		TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr17:76810621G>A	ENST00000542802.3	-	11	1480	c.1037C>T	c.(1036-1038)cCg>cTg	p.P346L	USP36_ENST00000588467.1_5'UTR|USP36_ENST00000312010.6_Missense_Mutation_p.P346L|USP36_ENST00000449938.2_Missense_Mutation_p.P46L			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	346	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GAGGAATTCCGGATAGCCTAC	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		20378	0.001		0.0	False		,,,				2504	0.0																0													100.0	82.0	88.0					17																	76810621		2203	4300	6503	SO:0001583	missense	57602			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.1037C>T	17.37:g.76810621G>A	ENSP00000441214:p.Pro346Leu	Somatic		WXS	SOLID	Phase_I	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	37	CCDS32755.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350446	0.82132	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802;ENST00000432878	T;T;T	0.11495	2.77;2.77;2.77	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	H	0.96175	3.78	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	T	0.66077	-0.6013	10	0.72032	D	0.01	-28.3893	18.2102	0.89867	0.0:0.0:1.0:0.0	.	346	Q9P275-2	.	L	346;46;346;346	ENSP00000310590:P346L;ENSP00000401119:P46L;ENSP00000441214:P346L	ENSP00000310590:P346L	P	-	2	0	USP36	74322216	1.000000	0.71417	0.404000	0.26397	0.583000	0.36354	9.691000	0.98679	2.392000	0.81423	0.561000	0.74099	CCG		0.418	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3		NM_025090	
ZDBF2	57683	hgsc.bcm.edu	37	2	207170013	207170013	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr2:207170013A>G	ENST00000374423.3	+	5	1147	c.761A>G	c.(760-762)cAt>cGt	p.H254R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	254							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TATCAGAAACATAAAGAATCA	0.363																																																	0													31.0	30.0	30.0					2																	207170013		1829	4087	5916	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.761A>G	2.37:g.207170013A>G	ENSP00000363545:p.His254Arg	Somatic		WXS	SOLID	Phase_I	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	A	1.886	-0.456663	0.04540	.	.	ENSG00000204186	ENST00000374423	T	0.16196	2.36	4.71	2.87	0.33458	.	0.465919	0.16082	N	0.230457	T	0.09247	0.0228	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.14578	0.011	T	0.31024	-0.9958	10	0.31617	T	0.26	.	11.8282	0.52280	0.3222:0.6778:0.0:0.0	.	254	Q9HCK1	ZDBF2_HUMAN	R	254	ENSP00000363545:H254R	ENSP00000363545:H254R	H	+	2	0	ZDBF2	206878258	0.005000	0.15991	0.219000	0.23793	0.057000	0.15508	0.432000	0.21461	0.386000	0.24997	-0.148000	0.13756	CAT		0.363	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1		NM_020923	
ZNF717	100131827	hgsc.bcm.edu	37	3	75786555	75786556	+	Frame_Shift_Ins	INS	-	-	TG	rs149684363|rs201868740|rs141276988	byFrequency	TCGA-CJ-4878-01A-01D-1373-10	TCGA-CJ-4878-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19049209-7ee5-4198-8a2c-036bce104f89	b62cf3a9-0b6e-42a4-9e72-5751abb2c017	g.chr3:75786555_75786556insTG	ENST00000478296.1	-	4	2344_2345	c.2068_2069insCA	c.(2068-2070)tgtfs	p.C690fs	ZNF717_ENST00000400845.3_Frame_Shift_Ins_p.C733fs|ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000422325.1_Frame_Shift_Ins_p.C740fs|ZNF717_ENST00000477374.1_Intron|MIR4273_ENST00000582824.1_RNA			Q9BY31	ZN717_HUMAN	zinc finger protein 717	730					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TGACTTCTGACAAGGTTTTTCC	0.411																																																	0										57,6,1887		6,0,45,2,2,920						-1.5	0.0		dbSNP_134	3	174,15,3751		24,0,126,3,9,1808	no	codingComplex	ZNF717	NM_001128223.1		30,0,171,5,11,2728	A1A1,A1A2,A1R,A2A2,A2R,RR		4.797,3.2308,4.2784				231,21,5638				SO:0001589	frameshift_variant	100131827			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.2068_2069insCA	3.37:g.75786555_75786556insTG	ENSP00000419377:p.Cys690fs	Somatic		WXS	SOLID	Phase_I		Frame_Shift_Ins	INS	ENST00000478296.1	37																																																																																					0.411	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2		NM_001128223	
