#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC12	94160	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	48149472	48149472	+	Missense_Mutation	SNP	G	G	A	rs146005796		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr16:48149472G>A	ENST00000311303.3	-	13	2188	c.1843C>T	c.(1843-1845)Cgc>Tgc	p.R615C	ABCC12_ENST00000416054.1_Silent_p.P590P|ABCC12_ENST00000448542.1_Missense_Mutation_p.R615C	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	615	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.R615C(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TAGACAGCGCGGGCCAGGCTA	0.627																																																	1	Substitution - Missense(1)	kidney(1)						G	CYS/ARG	0,4402		0,0,2201	64.0	58.0	60.0		1843	4.1	0.9	16	dbSNP_134	60	2,8598	2.2+/-6.3	0,2,4298	no	missense	ABCC12	NM_033226.2	180	0,2,6499	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	615/1360	48149472	2,13000	2201	4300	6501	SO:0001583	missense	94160			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1843C>T	16.37:g.48149472G>A	ENSP00000311030:p.Arg615Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664338	0.47572	0.0	2.33E-4	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939	D;D	0.95554	-3.74;-3.74	5.09	4.13	0.48395	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98185	0.9400	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97875	1.0288	10	0.87932	D	0	.	8.1809	0.31311	0.0815:0.0:0.7637:0.1547	.	615	Q96J65	MRP9_HUMAN	C	615;615;557	ENSP00000311030:R615C;ENSP00000401855:R615C	ENSP00000311030:R615C	R	-	1	0	ABCC12	46706973	1.000000	0.71417	0.930000	0.37139	0.266000	0.26442	3.211000	0.51137	1.267000	0.44247	0.563000	0.77884	CGC		0.627	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1		NM_033226	
ABCC5	10057	hgsc.bcm.edu	37	3	183665257	183665257	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr3:183665257delA	ENST00000334444.6	-	23	3509	c.3269delT	c.(3268-3270)ttgfs	p.L1090fs	ABCC5_ENST00000265586.6_Frame_Shift_Del_p.L1047fs	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1090	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	ACACGTAAACAAAAAAAAAGG	0.532																																																	0													49.0	58.0	55.0					3																	183665257		1969	4159	6128	SO:0001589	frameshift_variant	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3269delT	3.37:g.183665257delA	ENSP00000333926:p.Leu1090fs	Somatic		WXS	Illumina HiSeq	Phase_I	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Frame_Shift_Del	DEL	ENST00000334444.6	37	CCDS43176.1																																																																																				0.532	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1		NM_005688	
ADAR	103	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	154574687	154574687	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:154574687A>T	ENST00000368474.4	-	2	630	c.431T>A	c.(430-432)tTa>tAa	p.L144*	ADAR_ENST00000292205.5_Nonsense_Mutation_p.L187*|ADAR_ENST00000471068.1_5'UTR|ADAR_ENST00000368471.3_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	144					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L144*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CAGGAACTTTAAGATCCTTTG	0.478																																																	1	Substitution - Nonsense(1)	kidney(1)											76.0	79.0	78.0					1																	154574687		2203	4300	6503	SO:0001587	stop_gained	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.431T>A	1.37:g.154574687A>T	ENSP00000357459:p.Leu144*	Somatic		WXS	Illumina HiSeq	Phase_I	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Nonsense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.394231	0.62066	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	.	.	.	4.62	4.62	0.57501	.	1.458670	0.04060	N	0.306229	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.7959	14.1338	0.65273	1.0:0.0:0.0:0.0	.	.	.	.	X	187;144;139	.	ENSP00000292205:L187X	L	-	2	0	ADAR	152841311	0.977000	0.34250	0.008000	0.14137	0.713000	0.41058	4.384000	0.59607	2.056000	0.61249	0.402000	0.26972	TTA		0.478	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2		NM_001111	
AGTR1	185	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	148459496	148459496	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr3:148459496C>G	ENST00000497524.1	+	2	1065	c.674C>G	c.(673-675)gCt>gGt	p.A225G	AGTR1_ENST00000404754.2_Missense_Mutation_p.A225G|AGTR1_ENST00000475347.1_Missense_Mutation_p.A225G|AGTR1_ENST00000461609.1_Missense_Mutation_p.A225G|AGTR1_ENST00000418473.2_Missense_Mutation_p.A225G|AGTR1_ENST00000542281.1_Missense_Mutation_p.A225G|AGTR1_ENST00000474935.1_Missense_Mutation_p.A225G|AGTR1_ENST00000402260.1_Missense_Mutation_p.A225G|AGTR1_ENST00000349243.3_Missense_Mutation_p.A225G	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	225					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)	p.A225G(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	CTAAAGAAGGCTTATGAAATT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											50.0	54.0	53.0					3																	148459496		2202	4298	6500	SO:0001583	missense	185			M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.674C>G	3.37:g.148459496C>G	ENSP00000419422:p.Ala225Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q13725|Q8TBK4	Missense_Mutation	SNP	ENST00000497524.1	37	CCDS3137.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481820	0.63849	.	.	ENSG00000144891	ENST00000497524;ENST00000349243;ENST00000542281;ENST00000418473;ENST00000404754;ENST00000475347;ENST00000474935;ENST00000461609;ENST00000402260	T;T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.117221	0.56097	D	0.000023	T	0.50086	0.1595	L	0.50993	1.605	0.53688	D	0.999978	B	0.33022	0.394	B	0.42214	0.38	T	0.51779	-0.8662	10	0.54805	T	0.06	-12.328	12.6829	0.56932	0.0:0.9252:0.0:0.0748	.	225	P30556	AGTR1_HUMAN	G	225	ENSP00000419422:A225G;ENSP00000273430:A225G;ENSP00000443186:A225G;ENSP00000398832:A225G;ENSP00000385612:A225G;ENSP00000419783:A225G;ENSP00000418084:A225G;ENSP00000418851:A225G;ENSP00000385641:A225G	ENSP00000273430:A225G	A	+	2	0	AGTR1	149942186	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.156000	0.58138	2.572000	0.86782	0.655000	0.94253	GCT		0.358	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355807.1			
ANKLE2	23141	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	133327385	133327385	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr12:133327385T>A	ENST00000357997.5	-	3	780	c.691A>T	c.(691-693)Atg>Ttg	p.M231L	ANKLE2_ENST00000337516.5_Missense_Mutation_p.M231L|ANKLE2_ENST00000539605.1_Missense_Mutation_p.M169L	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	231					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)	p.M231L(1)		NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CCTTTGATCATCTTGACAGCT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											139.0	135.0	136.0					12																	133327385		1844	4085	5929	SO:0001583	missense	23141			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.691A>T	12.37:g.133327385T>A	ENSP00000350686:p.Met231Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	ENST00000357997.5	37	CCDS41869.1	.	.	.	.	.	.	.	.	.	.	t	14.41	2.528323	0.44969	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516;ENST00000545623	T;T;T	0.29397	1.96;1.95;1.57	5.72	4.55	0.56014	Ribonuclease H1, N-terminal (1);	0.118609	0.85682	N	0.000000	T	0.23171	0.0560	L	0.35593	1.075	0.33665	D	0.610174	B;B	0.15141	0.012;0.007	B;B	0.13407	0.006;0.009	T	0.20806	-1.0264	10	0.25751	T	0.34	-27.2635	11.822	0.52245	0.1351:0.0:0.0:0.8648	.	231;231	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	L	169;231;231;1	ENSP00000446268:M169L;ENSP00000350686:M231L;ENSP00000337651:M231L	ENSP00000337651:M231L	M	-	1	0	ANKLE2	131837458	0.998000	0.40836	0.984000	0.44739	0.981000	0.71138	2.509000	0.45459	0.955000	0.37878	0.528000	0.53228	ATG		0.378	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1			
ATM	472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	108201113	108201113	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:108201113A>T	ENST00000452508.2	+	51	7669	c.7480A>T	c.(7480-7482)Aat>Tat	p.N2494Y	ATM_ENST00000278616.4_Missense_Mutation_p.N2494Y|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2494	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.N2494Y(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTGGCTTGAAAATTCTGGAGT	0.393			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	2	Substitution - Missense(2)	kidney(2)											149.0	154.0	152.0					11																	108201113		2201	4298	6499	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7480A>T	11.37:g.108201113A>T	ENSP00000388058:p.Asn2494Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554809	0.86231	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.83419	-1.72;-1.72	4.83	4.83	0.62350	PIK-related kinase (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90789	0.7108	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92006	0.5614	10	0.72032	D	0.01	.	13.8777	0.63662	1.0:0.0:0.0:0.0	.	2494	Q13315	ATM_HUMAN	Y	2494	ENSP00000278616:N2494Y;ENSP00000388058:N2494Y	ENSP00000278616:N2494Y	N	+	1	0	ATM	107706323	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.765000	0.91724	1.915000	0.55452	0.533000	0.62120	AAT		0.393	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	
ATM	472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	108203617	108203617	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:108203617delG	ENST00000452508.2	+	54	8106	c.7917delG	c.(7915-7917)aagfs	p.K2639fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.K2639fs|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2639					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTCAGTGGAAGACTCAGAGAA	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													75.0	75.0	75.0					11																	108203617		2201	4298	6499	SO:0001589	frameshift_variant	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7917delG	11.37:g.108203617delG	ENSP00000388058:p.Lys2639fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	ENST00000452508.2	37	CCDS31669.1																																																																																				0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	
ATP8B4	79895	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	50168715	50168715	+	Silent	SNP	C	C	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr15:50168715C>T	ENST00000284509.6	-	25	2928	c.2787G>A	c.(2785-2787)gtG>gtA	p.V929V	ATP8B4_ENST00000559829.1_Silent_p.V929V	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	929						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V929V(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TCTGGTCACTCACATCCTGTA	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											83.0	83.0	83.0					15																	50168715		2196	4295	6491	SO:0001819	synonymous_variant	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.2787G>A	15.37:g.50168715C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H727	Silent	SNP	ENST00000284509.6	37	CCDS32238.1																																																																																				0.413	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1		NM_024837	
BIRC6	57448	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	32693677	32693677	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:32693677A>T	ENST00000421745.2	+	29	6087	c.5953A>T	c.(5953-5955)Aat>Tat	p.N1985Y		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1985					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.N1985Y(1)|p.N1957Y(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCTTCAACTAAATTTGGCTCA	0.408																																					Pancreas(94;175 1509 16028 18060 45422)												2	Substitution - Missense(2)	kidney(2)											110.0	111.0	111.0					2																	32693677		2203	4300	6503	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5953A>T	2.37:g.32693677A>T	ENSP00000393596:p.Asn1985Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	21.6	4.171544	0.78452	.	.	ENSG00000115760	ENST00000421745	D	0.82619	-1.63	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.88544	0.6465	M	0.74467	2.265	0.80722	D	1	D	0.58970	0.984	P	0.55161	0.77	D	0.90075	0.4166	10	0.87932	D	0	.	15.7759	0.78214	1.0:0.0:0.0:0.0	.	1985	Q9NR09	BIRC6_HUMAN	Y	1985	ENSP00000393596:N1985Y	ENSP00000393596:N1985Y	N	+	1	0	BIRC6	32547181	1.000000	0.71417	0.975000	0.42487	0.958000	0.62258	9.296000	0.96104	2.116000	0.64780	0.524000	0.50904	AAT		0.408	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3		NM_016252	
CADPS	8618	broad.mit.edu;ucsc.edu	37	3	62388785	62388786	+	Nonsense_Mutation	DNP	GA	GA	AG			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr3:62388785_62388786GA>AG	ENST00000383710.4	-	29	4201_4202	c.3852_3853TC>CT	c.(3850-3855)taTCag>taCTag	p.Q1285*	CADPS_ENST00000357948.3_Nonsense_Mutation_p.Q1206*|CADPS_ENST00000283269.9_Nonsense_Mutation_p.Q1246*	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1285	Mediates targeting and association with DCVs. {ECO:0000250}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.Y1245Y(1)|p.Q1246*(1)|p.Y1284Y(1)|p.Q1285*(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GTTTTCAACTGATAAATATGAA	0.371																																																	4	Substitution - Nonsense(2)|Substitution - coding silent(2)	kidney(4)																																								SO:0001587	stop_gained	8618			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3852_3853delinsAG	3.37:g.62388785_62388786delinsAG	ENSP00000373215:p.Gln1285*	Somatic		WXS	Illumina GAIIx	Phase_I	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Nonsense_Mutation|Silent	SNP	ENST00000383710.4	37	CCDS46858.1																																																																																				0.371	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5		NM_003716, NM_183393, NM_183394	
CDKN2C	1031	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	51436156	51436156	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:51436156G>C	ENST00000262662.1	+	3	2150	c.116G>C	c.(115-117)aGg>aCg	p.R39T	CDKN2C_ENST00000371761.3_Missense_Mutation_p.R39T|CDKN2C_ENST00000396148.1_Missense_Mutation_p.R39T			P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	39					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|oligodendrocyte differentiation (GO:0048709)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0?(11)|p.R39T(1)		central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|thyroid(1)	23				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		GGATTTGGAAGGACTGCGCTG	0.463			D		"""glioma, MM"""																																Melanoma(47;50 1155 4767 22863 47597)			Rec	yes		1	1p32	1031	"""cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)"""		"""O, L"""	12	Whole gene deletion(11)|Substitution - Missense(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(4)|thyroid(1)|kidney(1)											100.0	103.0	102.0					1																	51436156		2203	4300	6503	SO:0001583	missense	1031			BC000598	CCDS555.1	1p32.3	2013-01-10			ENSG00000123080	ENSG00000123080		"""Ankyrin repeat domain containing"""	1789	protein-coding gene	gene with protein product		603369				8001816, 9636670	Standard	NM_001262		Approved	INK4C, p18	uc001csg.3	P42773	OTTHUMG00000008046	ENST00000262662.1:c.116G>C	1.37:g.51436156G>C	ENSP00000262662:p.Arg39Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TB83	Missense_Mutation	SNP	ENST00000262662.1	37	CCDS555.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.817527	0.70912	.	.	ENSG00000123080	ENST00000262662;ENST00000396148;ENST00000371761	T;T;T	0.63913	-0.07;-0.07;-0.07	5.23	5.23	0.72850	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.79417	0.4442	M	0.78285	2.405	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.75491	-0.3299	10	0.25106	T	0.35	-6.2891	18.9896	0.92786	0.0:0.0:1.0:0.0	.	39	P42773	CDN2C_HUMAN	T	39	ENSP00000262662:R39T;ENSP00000379452:R39T;ENSP00000360826:R39T	ENSP00000262662:R39T	R	+	2	0	CDKN2C	51208744	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.540000	0.73861	2.714000	0.92807	0.655000	0.94253	AGG		0.463	CDKN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022058.1		NM_001262	
CENPW	387103	broad.mit.edu;ucsc.edu	37	6	126669610	126669610	+	Splice_Site	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr6:126669610A>G	ENST00000368328.4	+	3	340		c.e3-1		CENPW_ENST00000368326.1_Splice_Site|CENPW_ENST00000368325.1_Splice_Site			Q5EE01	CENPW_HUMAN	centromere protein W						CENP-A containing nucleosome assembly (GO:0034080)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|kinetochore (GO:0000776)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.?(1)		kidney(2)|large_intestine(1)|lung(3)	6						TCCCTCTTACAGGTAATTCTA	0.294																																																	1	Unknown(1)	kidney(1)											74.0	74.0	74.0					6																	126669610		2202	4290	6492	SO:0001630	splice_region_variant	387103			BC039556	CCDS34529.1, CCDS69196.1, CCDS75516.1	6q22.32	2013-11-05	2010-04-16	2010-04-16	ENSG00000203760	ENSG00000203760			21488	protein-coding gene	gene with protein product	"""cancer-upregulated gene 2"""	611264	"""chromosome 6 open reading frame 173"""	C6orf173		17610844, 19070575	Standard	NM_001286524		Approved	CUG2	uc003qao.3	Q5EE01	OTTHUMG00000015518	ENST00000368328.4:c.241-1A>G	6.37:g.126669610A>G		Somatic		WXS	Illumina GAIIx	Phase_I	A6NIR0|A6NJC2	Splice_Site	SNP	ENST00000368328.4	37	CCDS34529.1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.242189	0.58995	.	.	ENSG00000203760	ENST00000368326;ENST00000368325;ENST00000368328	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8801	0.52571	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CENPW	126711303	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	5.055000	0.64282	2.060000	0.61445	0.482000	0.46254	.		0.294	CENPW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042104.1			Intron
CHRNA9	55584	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	40337469	40337469	+	5'UTR	SNP	G	G	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr4:40337469G>C	ENST00000310169.2	+	0	124					NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)						detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	CTTTATTATAGAGGCTCAGGA	0.517																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)												0													118.0	106.0	110.0					4																	40337469		2203	4300	6503	SO:0001623	5_prime_UTR_variant	55584			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.-16G>C	4.37:g.40337469G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q14CY7|Q4W5A2|Q9NYV2	Splice_Site	SNP	ENST00000310169.2	37	CCDS3459.1																																																																																				0.517	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1			
CNOT1	23019	hgsc.bcm.edu;ucsc.edu	37	16	58555162	58555168	+	Frame_Shift_Del	DEL	AAGGTAA	AAGGTAA	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	AAGGTAA	AAGGTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr16:58555162_58555168delAAGGTAA	ENST00000317147.5	-	48	7303_7309	c.6971_6977delTTACCTT	c.(6970-6978)attaccttcfs	p.ITF2324fs	CNOT1_ENST00000569240.1_Frame_Shift_Del_p.ITF2319fs|CNOT1_ENST00000245138.4_Frame_Shift_Del_p.ITF1175fs	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2324					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAGCTCAATGAAGGTAATAAGAAGACC	0.372																																																	0																																										SO:0001589	frameshift_variant	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.6971_6977delTTACCTT	16.37:g.58555162_58555168delAAGGTAA	ENSP00000320949:p.Ile2324fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Del	DEL	ENST00000317147.5	37	CCDS10799.1																																																																																				0.372	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3		NM_016284	
CPAMD8	27151	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17115085	17115085	+	Missense_Mutation	SNP	T	T	C	rs371807162		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr19:17115085T>C	ENST00000443236.1	-	8	843	c.812A>G	c.(811-813)tAt>tGt	p.Y271C	CPAMD8_ENST00000388925.4_Missense_Mutation_p.Y224C	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	224						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Y271C(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CAACTTACCATACTTCTGAAC	0.483																																																	1	Substitution - Missense(1)	kidney(1)											85.0	80.0	81.0					19																	17115085		1903	4121	6024	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.812A>G	19.37:g.17115085T>C	ENSP00000402505:p.Tyr271Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.31|16.31	3.088534|3.088534	0.55968|0.55968	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440;ENST00000388925	.|T;T	.|0.12774	.|2.65;2.65	2.73|2.73	2.73|2.73	0.32206|0.32206	.|.	.|0.000000	.|0.64402	.|U	.|0.000020	T|T	0.38878|0.38878	0.1057|0.1057	M|M	0.87180|0.87180	2.865|2.865	0.49213|0.49213	D|D	0.999767|0.999767	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.37686|0.37686	-0.9695|-0.9695	5|10	.|0.87932	.|D	.|0	.|.	10.1391|10.1391	0.42725|0.42725	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|224	.|Q8IZJ3	.|CPMD8_HUMAN	V|C	282|271;224	.|ENSP00000291440:Y271C;ENSP00000373577:Y224C	.|ENSP00000291440:Y271C	M|Y	-|-	1|2	0|0	CPAMD8|CPAMD8	16976085|16976085	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.806000|0.806000	0.45545|0.45545	6.510000|6.510000	0.73729|0.73729	1.047000|1.047000	0.40274|0.40274	0.402000|0.402000	0.26972|0.26972	ATG|TAT		0.483	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2		NM_015692	
CPSF7	79869	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	61183665	61183665	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:61183665G>T	ENST00000394888.4	-	6	1049	c.877C>A	c.(877-879)Cca>Aca	p.P293T	CPSF7_ENST00000439958.3_Missense_Mutation_p.P284T|CPSF7_ENST00000448745.1_Missense_Mutation_p.P284T|CPSF7_ENST00000340437.4_Missense_Mutation_p.P336T	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	293	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P293T(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						AAGAAGGCTGGATTGAGGTGA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											61.0	67.0	65.0					11																	61183665		2202	4299	6501	SO:0001583	missense	79869				CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.877C>A	11.37:g.61183665G>T	ENSP00000378352:p.Pro293Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	ENST00000394888.4	37	CCDS44619.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503188	0.85176	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000544147;ENST00000539952	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	5.44	5.44	0.79542	.	0.124417	0.56097	D	0.000034	D	0.92770	0.7701	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.993;0.998;0.999;0.997	D	0.93243	0.6628	10	0.87932	D	0	-2.4393	18.8987	0.92433	0.0:0.0:1.0:0.0	.	284;293;336;284	B4DGF8;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	T	336;293;284;284;59;284	ENSP00000345412:P336T;ENSP00000378352:P293T;ENSP00000397203:P284T;ENSP00000407394:P284T	ENSP00000345412:P336T	P	-	1	0	CPSF7	60940241	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.225000	0.89784	2.546000	0.85860	0.650000	0.86243	CCA		0.567	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2		NM_024811	
CSF3R	1441	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	36931800	36931800	+	3'UTR	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:36931800G>A	ENST00000373106.1	-	0	3216				CSF3R_ENST00000373104.1_Splice_Site_p.A750V|CSF3R_ENST00000338937.5_3'UTR|CSF3R_ENST00000331941.5_Splice_Site_p.A750V|CSF3R_ENST00000487540.2_5'UTR|MRPS15_ENST00000373116.5_5'Flank|CSF3R_ENST00000418048.2_3'UTR|CSF3R_ENST00000373103.1_3'UTR|CSF3R_ENST00000361632.4_3'UTR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)						cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A750V(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGGAGGCCCAGCCTATGGAGA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											56.0	60.0	59.0					1																	36931800		2203	4300	6503	SO:0001624	3_prime_UTR_variant	1441			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.*158C>T	1.37:g.36931800G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000373106.1	37	CCDS413.1	.	.	.	.	.	.	.	.	.	.	G	0.699	-0.791358	0.02884	.	.	ENSG00000119535	ENST00000373104;ENST00000331941	T;T	0.38722	1.12;1.12	2.77	-1.87	0.07737	.	.	.	.	.	T	0.12475	0.0303	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25467	-1.0131	8	0.02654	T	1	.	0.3233	0.00306	0.2892:0.1982:0.3111:0.2015	.	750	Q99062-4	.	V	750	ENSP00000362196:A750V;ENSP00000332180:A750V	ENSP00000332180:A750V	A	-	2	0	CSF3R	36704387	0.103000	0.21917	0.000000	0.03702	0.561000	0.35649	1.459000	0.35234	-0.454000	0.07066	-0.999000	0.02512	GCT		0.532	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2		NM_156039	
CYP26B1	56603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	72362015	72362015	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:72362015C>T	ENST00000001146.2	-	4	939	c.736G>A	c.(736-738)Ggg>Agg	p.G246R	CYP26B1_ENST00000412253.1_Missense_Mutation_p.G55R|CYP26B1_ENST00000546307.1_Missense_Mutation_p.G171R	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	246					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.G246R(1)		breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TTCTCCAGCCCCTTCTGCAGG	0.617																																																	1	Substitution - Missense(1)	kidney(1)											113.0	93.0	99.0					2																	72362015		2203	4300	6503	SO:0001583	missense	56603				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.736G>A	2.37:g.72362015C>T	ENSP00000001146:p.Gly246Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.955484	0.34471	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307;ENST00000474509	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.11	4.23	0.50019	.	0.120124	0.64402	D	0.000009	T	0.36608	0.0973	N	0.02247	-0.625	0.36688	D	0.879401	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.29549	-1.0008	10	0.18710	T	0.47	-1.7859	8.9905	0.36022	0.0:0.8291:0.0:0.1709	.	171;229;246	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	R	246;55;171;171	ENSP00000001146:G246R;ENSP00000401465:G55R;ENSP00000443304:G171R;ENSP00000430888:G171R	ENSP00000001146:G246R	G	-	1	0	CYP26B1	72215523	0.172000	0.23043	1.000000	0.80357	0.999000	0.98932	0.818000	0.27295	1.289000	0.44618	0.655000	0.94253	GGG		0.617	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1		NM_019885	
DCAF17	80067	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	172291646	172291646	+	Silent	SNP	C	C	G	rs559441907		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:172291646C>G	ENST00000375255.3	+	2	507	c.180C>G	c.(178-180)gcC>gcG	p.A60A	DCAF17_ENST00000468592.1_3'UTR|METTL8_ENST00000375258.4_5'Flank|DCAF17_ENST00000539783.1_Silent_p.A60A	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	60					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.A60A(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						CACCTATAGCCTATGAGAGAG	0.353																																																	1	Substitution - coding silent(1)	kidney(1)											125.0	117.0	120.0					2																	172291646		1828	4079	5907	SO:0001819	synonymous_variant	80067			AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.180C>G	2.37:g.172291646C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RTW5|Q53TN3|Q9H908	Silent	SNP	ENST00000375255.3	37	CCDS2243.2																																																																																				0.353	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255342.2		NM_025000	
DHDH	27294	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	49439432	49439433	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr19:49439432_49439433insA	ENST00000221403.2	+	3	386_387	c.346_347insA	c.(346-348)cgafs	p.R116fs	DHDH_ENST00000523250.1_Intron|DHDH_ENST00000522614.1_Frame_Shift_Ins_p.R116fs	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	116					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GGCCCGATCCCGAGCCCTCTTC	0.619																																																	0																																										SO:0001589	frameshift_variant	27294			AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	Exception_encountered	19.37:g.49439432_49439433insA	ENSP00000221403:p.Arg116fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000221403.2	37	CCDS12741.1																																																																																				0.619	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1		NM_014475	
DHDH	27294	hgsc.bcm.edu	37	19	49439433	49439433	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr19:49439433G>A	ENST00000221403.2	+	3	387	c.347G>A	c.(346-348)cGa>cAa	p.R116Q	DHDH_ENST00000523250.1_Intron|DHDH_ENST00000522614.1_Missense_Mutation_p.R116Q	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	116					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GCCCGATCCCGAGCCCTCTTC	0.617																																																	0													17.0	19.0	18.0					19																	49439433		2200	4296	6496	SO:0001583	missense	27294			AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.347G>A	19.37:g.49439433G>A	ENSP00000221403:p.Arg116Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047354	0.36085	.	.	ENSG00000104808	ENST00000221403;ENST00000522614	T;T	0.22336	1.96;1.96	4.39	2.19	0.27852	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.383873	0.28859	N	0.013901	T	0.13372	0.0324	L	0.38531	1.155	0.09310	N	1	B	0.20052	0.041	B	0.14578	0.011	T	0.16012	-1.0417	10	0.44086	T	0.13	-0.8003	4.0693	0.09874	0.2133:0.1978:0.5889:0.0	.	116	Q9UQ10	DHDH_HUMAN	Q	116	ENSP00000221403:R116Q;ENSP00000428672:R116Q	ENSP00000221403:R116Q	R	+	2	0	DHDH	54131245	0.000000	0.05858	0.763000	0.31416	0.981000	0.71138	0.363000	0.20301	0.719000	0.32188	0.650000	0.86243	CGA		0.617	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1		NM_014475	
DHX30	22907	broad.mit.edu;ucsc.edu	37	3	47887677	47887677	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr3:47887677T>G	ENST00000445061.1	+	11	1522	c.1115T>G	c.(1114-1116)aTc>aGc	p.I372S	DHX30_ENST00000446256.2_Missense_Mutation_p.I333S|DHX30_ENST00000348968.4_Missense_Mutation_p.I344S|DHX30_ENST00000457607.1_Missense_Mutation_p.I400S	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	372						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.I372S(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		AGTTCATGGATCGCCCCAGAA	0.547																																																	1	Substitution - Missense(1)	kidney(1)											100.0	111.0	107.0					3																	47887677		2203	4300	6503	SO:0001583	missense	22907			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1115T>G	3.37:g.47887677T>G	ENSP00000405620:p.Ile372Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	T	2.048	-0.418360	0.04766	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03004	4.1;4.09;4.1;4.08	5.24	2.78	0.32641	.	0.500268	0.22446	N	0.059948	T	0.02083	0.0065	N	0.16478	0.41	0.34179	D	0.670666	B;B	0.09022	0.001;0.002	B;B	0.11329	0.001;0.006	T	0.41698	-0.9494	10	0.08179	T	0.78	.	5.8107	0.18465	0.0:0.0946:0.3476:0.5579	.	372;333	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	S	333;372;344;400	ENSP00000392601:I333S;ENSP00000405620:I372S;ENSP00000343442:I344S;ENSP00000394682:I400S	ENSP00000343442:I344S	I	+	2	0	DHX30	47862681	0.997000	0.39634	0.992000	0.48379	0.051000	0.14879	0.486000	0.22340	0.288000	0.22398	-1.220000	0.01600	ATC		0.547	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2		NM_138615	
DNAJC10	54431	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	183616891	183616891	+	Silent	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:183616891A>G	ENST00000264065.7	+	16	1942	c.1527A>G	c.(1525-1527)acA>acG	p.T509T		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	509	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)	p.T509T(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TAGATTGTACAGTTCATGAGG	0.338																																					Pancreas(56;860 1183 25669 35822 48585)												1	Substitution - coding silent(1)	kidney(1)											131.0	117.0	122.0					2																	183616891		2203	4300	6503	SO:0001819	synonymous_variant	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1527A>G	2.37:g.183616891A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	37	CCDS33345.1																																																																																				0.338	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2		NM_018981	
DOCK4	9732	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	111379463	111379463	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr7:111379463G>T	ENST00000437633.1	-	47	5340	c.5084C>A	c.(5083-5085)tCg>tAg	p.S1695*	DOCK4_ENST00000428084.1_Nonsense_Mutation_p.S1704*|DOCK4_ENST00000494651.2_Nonsense_Mutation_p.S578*	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1695	Ser-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.S1695*(1)|p.S1692*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TCTGGCACTCGATGGAGCAGA	0.532																																																	2	Substitution - Nonsense(2)	kidney(2)											50.0	51.0	51.0					7																	111379463		2047	4186	6233	SO:0001587	stop_gained	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5084C>A	7.37:g.111379463G>T	ENSP00000404179:p.Ser1695*	Somatic		WXS	Illumina HiSeq	Phase_I	O14584|O94824|Q8NB45	Nonsense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	46	12.723596	0.99691	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6434	0.95767	0.0:0.0:1.0:0.0	.	.	.	.	X	1683;1704;578;1695;1692	.	ENSP00000345432:S1692X	S	-	2	0	DOCK4	111166699	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	7.674000	0.83992	2.880000	0.98712	0.655000	0.94253	TCG		0.532	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4		NM_014705	
DYNC1H1	1778	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	102446833	102446833	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr14:102446833A>G	ENST00000360184.4	+	5	1071	c.907A>G	c.(907-909)Atc>Gtc	p.I303V		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	303	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.I303V(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GACTCTGGATATCTTGAAACA	0.448																																																	1	Substitution - Missense(1)	kidney(1)											68.0	69.0	69.0					14																	102446833		2203	4300	6503	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.907A>G	14.37:g.102446833A>G	ENSP00000348965:p.Ile303Val	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789820	0.50102	.	.	ENSG00000197102	ENST00000360184	T	0.53423	0.62	5.24	5.24	0.73138	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.37046	0.0989	L	0.38733	1.17	0.80722	D	1	B	0.23854	0.092	B	0.24541	0.054	T	0.17837	-1.0356	10	0.08837	T	0.75	.	15.421	0.75011	1.0:0.0:0.0:0.0	.	303	Q14204	DYHC1_HUMAN	V	303	ENSP00000348965:I303V	ENSP00000348965:I303V	I	+	1	0	DYNC1H1	101516586	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	8.833000	0.92089	2.102000	0.63906	0.482000	0.46254	ATC		0.448	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1		NM_001376	
EPS15	2060	hgsc.bcm.edu	37	1	51869130	51869130	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:51869130delT	ENST00000371733.3	-	17	1848	c.1752delA	c.(1750-1752)aaafs	p.K584fs	EPS15_ENST00000493793.1_5'UTR|EPS15_ENST00000396122.4_Frame_Shift_Del_p.K261fs|EPS15_ENST00000371730.2_Frame_Shift_Del_p.K450fs	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	584					cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						CAGAACAAACTTTTTCAGTAA	0.373			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											112.0	110.0	111.0					1																	51869130		2203	4300	6503	SO:0001589	frameshift_variant	2060			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1752delA	1.37:g.51869130delT	ENSP00000360798:p.Lys584fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8J7|D3DPJ2|Q5SRH4	Frame_Shift_Del	DEL	ENST00000371733.3	37	CCDS557.1																																																																																				0.373	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1		NM_001981	
ESCO1	114799	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	19119910	19119910	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr18:19119910G>A	ENST00000269214.5	-	9	2951	c.2014C>T	c.(2014-2016)Cct>Tct	p.P672S		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	672					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)	p.P672S(1)		breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						GGGTCTTCAGGAAGAACCATT	0.323																																																	1	Substitution - Missense(1)	kidney(1)											89.0	93.0	92.0					18																	19119910		2203	4300	6503	SO:0001583	missense	114799			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2014C>T	18.37:g.19119910G>A	ENSP00000269214:p.Pro672Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	37	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483880	0.84854	.	.	ENSG00000141446	ENST00000269214	T	0.60548	0.18	5.56	5.56	0.83823	.	0.119065	0.64402	D	0.000019	T	0.74137	0.3677	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.70081	-0.4970	10	0.32370	T	0.25	-27.1186	19.5268	0.95210	0.0:0.0:1.0:0.0	.	672	Q5FWF5	ESCO1_HUMAN	S	672	ENSP00000269214:P672S	ENSP00000269214:P672S	P	-	1	0	ESCO1	17373908	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.624000	0.88883	0.585000	0.79938	CCT		0.323	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1		NM_052911	
F2	2147	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	46747604	46747604	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:46747604A>G	ENST00000311907.5	+	7	811	c.755A>G	c.(754-756)aAc>aGc	p.N252S	F2_ENST00000530231.1_Missense_Mutation_p.N252S	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	252	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)	p.N252S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	CAGGACTTCAACTCAGCTGTG	0.657																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												1	Substitution - Missense(1)	kidney(1)											62.0	70.0	67.0					11																	46747604		2201	4299	6500	SO:0001583	missense	2147			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.755A>G	11.37:g.46747604A>G	ENSP00000308541:p.Asn252Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	CCDS31476.1	.	.	.	.	.	.	.	.	.	.	A	0.128	-1.117272	0.01799	.	.	ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468	T;T;T	0.79554	-1.28;-1.28;-1.28	5.17	-8.45	0.00946	Kringle (4);Kringle-like fold (1);	1.007920	0.07948	N	0.980396	T	0.61527	0.2354	N	0.16016	0.355	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.52638	-0.8549	10	0.87932	D	0	.	10.7827	0.46388	0.7488:0.0:0.0952:0.1561	.	252	P00734	THRB_HUMAN	S	252;252;242	ENSP00000308541:N252S;ENSP00000433907:N252S;ENSP00000387413:N242S	ENSP00000308541:N252S	N	+	2	0	F2	46704180	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.552000	0.06020	-1.433000	0.01977	-0.313000	0.08912	AAC		0.657	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			
FAM151A	338094	broad.mit.edu;ucsc.edu	37	1	55077410	55077410	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:55077410A>C	ENST00000302250.2	-	6	969	c.809T>G	c.(808-810)cTg>cGg	p.L270R	ACOT11_ENST00000371316.3_Intron|FAM151A_ENST00000371304.2_Missense_Mutation_p.L270R	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	270						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.L270R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CCACAGCGTCAGGCTGTACCT	0.602																																																	1	Substitution - Missense(1)	kidney(1)											83.0	77.0	79.0					1																	55077410		2203	4300	6503	SO:0001583	missense	338094			AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.809T>G	1.37:g.55077410A>C	ENSP00000306888:p.Leu270Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	ENST00000302250.2	37	CCDS594.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.272835	0.80580	.	.	ENSG00000162391	ENST00000302250;ENST00000371304;ENST00000294370	T;T	0.24350	1.86;1.86	4.59	4.59	0.56863	.	0.115003	0.36591	N	0.002512	T	0.56031	0.1958	M	0.88775	2.98	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.65520	-0.6148	10	0.87932	D	0	-16.4719	13.3708	0.60711	1.0:0.0:0.0:0.0	.	270	Q8WW52	F151A_HUMAN	R	270	ENSP00000306888:L270R;ENSP00000360353:L270R	ENSP00000294370:L270R	L	-	2	0	FAM151A	54849998	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.334000	0.79224	2.039000	0.60335	0.533000	0.62120	CTG		0.602	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1		NM_176782	
FAM35A	54537	broad.mit.edu;hgsc.bcm.edu	37	10	88930275	88930275	+	Silent	SNP	G	G	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr10:88930275G>C	ENST00000298784.1	+	5	1788	c.1674G>C	c.(1672-1674)ctG>ctC	p.L558L	FAM35A_ENST00000298786.4_Silent_p.L558L	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	558								p.L558L(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						AAGACTTACTGGCATATGTGT	0.398																																					Ovarian(175;703 2004 25460 32514 43441)												1	Substitution - coding silent(1)	kidney(1)											83.0	78.0	79.0					10																	88930275		2203	4300	6503	SO:0001819	synonymous_variant	54537			BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.1674G>C	10.37:g.88930275G>C		Somatic		WXS	Illumina HiSeq	Phase_I	O95885|Q9H991	Silent	SNP	ENST00000298784.1	37	CCDS7383.1	.	.	.	.	.	.	.	.	.	.	g	8.576	0.881272	0.17467	.	.	ENSG00000122376	ENST00000342900	.	.	.	4.26	3.26	0.37387	.	.	.	.	.	T	0.57844	0.2081	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54563	-0.8275	4	.	.	.	-7.3423	8.9226	0.35621	0.1923:0.0:0.8077:0.0	.	.	.	.	R	213	.	.	G	+	1	0	FAM35A	88920255	0.988000	0.35896	0.999000	0.59377	0.989000	0.77384	1.688000	0.37690	2.201000	0.70794	0.537000	0.68136	GGC		0.398	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2		NM_019054	
FBXO34	55030	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	55817639	55817639	+	Silent	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr14:55817639T>G	ENST00000313833.4	+	2	776	c.531T>G	c.(529-531)ccT>ccG	p.P177P	FBXO34_ENST00000440021.1_Silent_p.P177P	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	177								p.P177P(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						GCTACCAACCTGAGCCTTTTG	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											98.0	83.0	88.0					14																	55817639		2203	4300	6503	SO:0001819	synonymous_variant	55030			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.531T>G	14.37:g.55817639T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q2VPB5|Q4VBP5|Q86TY4	Silent	SNP	ENST00000313833.4	37	CCDS32086.1																																																																																				0.483	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1			
GCC1	79571	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	127224747	127224747	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr7:127224747G>A	ENST00000321407.2	-	1	914	c.490C>T	c.(490-492)Cag>Tag	p.Q164*	GCC1_ENST00000497650.1_Intron	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	164					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.Q164*(1)		breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GTAGCCAACTGAGTCTTCAGC	0.522																																																	1	Substitution - Nonsense(1)	kidney(1)											108.0	111.0	110.0					7																	127224747		2203	4300	6503	SO:0001587	stop_gained	79571			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.490C>T	7.37:g.127224747G>A	ENSP00000318821:p.Gln164*	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H6N7	Nonsense_Mutation	SNP	ENST00000321407.2	37	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	G	40	8.520690	0.98848	.	.	ENSG00000179562	ENST00000321407	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-26.3394	17.9692	0.89108	0.0:0.0:1.0:0.0	.	.	.	.	X	164	.	ENSP00000318821:Q164X	Q	-	1	0	GCC1	127011983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.143000	0.77348	2.844000	0.97970	0.650000	0.86243	CAG		0.522	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3		NM_024523	
FNDC4	64838	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27719812	27719812	+	5'Flank	SNP	C	C	T	rs556404401		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:27719812C>T	ENST00000264703.3	-	0	0				GCKR_ENST00000424318.2_5'UTR|GCKR_ENST00000264717.2_Missense_Mutation_p.P14L	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P14L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					ATTGAGACCCCGGAGCCTGGC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		21486	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											121.0	117.0	119.0					2																	27719812		2203	4300	6503	SO:0001631	upstream_gene_variant	2646			AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787		2.37:g.27719812C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	D6W560	Missense_Mutation	SNP	ENST00000264703.3	37	CCDS1756.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459186	0.43634	.	.	ENSG00000084734	ENST00000264717	T	0.80738	-1.41	4.44	1.51	0.23008	.	0.225856	0.26553	N	0.023731	T	0.74801	0.3764	L	0.50333	1.59	0.27157	N	0.961263	D;D	0.60160	0.987;0.987	P;P	0.48030	0.564;0.564	T	0.68172	-0.5479	10	0.87932	D	0	-4.3168	4.8152	0.13363	0.0:0.6187:0.1781:0.2032	.	14;14	A8K731;Q14397	.;GCKR_HUMAN	L	14	ENSP00000264717:P14L	ENSP00000264717:P14L	P	+	2	0	GCKR	27573316	0.000000	0.05858	0.329000	0.25429	0.681000	0.39784	-0.171000	0.09883	0.487000	0.27698	0.655000	0.94253	CCG		0.527	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215031.1		NM_022823	
HELZ	9931	broad.mit.edu;ucsc.edu	37	17	65141857	65141857	+	Splice_Site	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:65141857A>G	ENST00000358691.5	-	21	2936		c.e21+1		HELZ_ENST00000580168.1_Splice_Site	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger							membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GAATTAAGGTACCTCTGCATT	0.323																																																	1	Unknown(1)	kidney(1)											83.0	83.0	83.0					17																	65141857		1815	4070	5885	SO:0001630	splice_region_variant	9931			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2769+1T>C	17.37:g.65141857A>G		Somatic		WXS	Illumina GAIIx	Phase_I	I6L9H4	Splice_Site	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.521356	0.85600	.	.	ENSG00000198265	ENST00000358691	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2167	0.82231	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HELZ	62572319	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	8.962000	0.93254	2.231000	0.72958	0.533000	0.62120	.		0.323	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1		NM_014877	Intron
IL27RA	9466	broad.mit.edu;ucsc.edu	37	19	14157347	14157347	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr19:14157347T>C	ENST00000263379.2	+	8	1183	c.1058T>C	c.(1057-1059)gTg>gCg	p.V353A		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	353	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.V353A(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						GAGCATGTAGTGGACTGGGCT	0.652																																					Colon(164;1849 1896 4443 37792 47834)												1	Substitution - Missense(1)	kidney(1)											97.0	102.0	100.0					19																	14157347		2203	4300	6503	SO:0001583	missense	9466			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1058T>C	19.37:g.14157347T>C	ENSP00000263379:p.Val353Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	37	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.654271	0.47467	.	.	ENSG00000104998	ENST00000263379	T	0.68624	-0.34	4.7	4.7	0.59300	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.38720	N	0.001599	T	0.80099	0.4561	M	0.79475	2.455	0.40384	D	0.979478	D	0.76494	0.999	D	0.85130	0.997	T	0.82890	-0.0233	10	0.87932	D	0	-31.5714	10.4844	0.44713	0.0:0.0:0.0:1.0	.	353	Q6UWB1	I27RA_HUMAN	A	353	ENSP00000263379:V353A	ENSP00000263379:V353A	V	+	2	0	IL27RA	14018347	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	2.189000	0.42621	1.978000	0.57642	0.454000	0.30748	GTG		0.652	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1		NM_004843	
ITCH	83737	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	33012330	33012330	+	Splice_Site	SNP	A	A	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr20:33012330A>C	ENST00000262650.6	+	8	779	c.643A>C	c.(643-645)Aga>Cga	p.R215R	ITCH_ENST00000535650.1_Splice_Site_p.R64R|ITCH_ENST00000374864.4_Splice_Site_p.R174R			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	215					apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)	p.R174R(1)		NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						GGATGAAACAAGGTAAGCATT	0.338																																																	1	Substitution - coding silent(1)	kidney(1)											142.0	133.0	136.0					20																	33012330		2203	4300	6503	SO:0001630	splice_region_variant	83737			AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.644+1A>C	20.37:g.33012330A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Silent	SNP	ENST00000262650.6	37	CCDS58768.1																																																																																				0.338	ITCH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078783.2			Silent
FOCAD	54914	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	20990252	20990253	+	Frame_Shift_Ins	INS	-	-	G	rs181929688		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr9:20990252_20990253insG	ENST00000380249.1	+	44	5499_5500	c.5135_5136insG	c.(5134-5139)gtaccafs	p.P1713fs	FOCAD_ENST00000605086.1_Frame_Shift_Ins_p.P1149fs|FOCAD_ENST00000338382.6_Frame_Shift_Ins_p.P1713fs	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1713						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GCTGGGCCAGTACCAAGCTTCC	0.594																																																	0																																										SO:0001589	frameshift_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	Exception_encountered	9.37:g.20990252_20990253insG	ENSP00000369599:p.Pro1713fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Frame_Shift_Ins	INS	ENST00000380249.1	37	CCDS34993.1																																																																																				0.594	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1		NM_017794	
KIF1B	23095	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	10394639	10394639	+	Missense_Mutation	SNP	G	G	A	rs145596547		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:10394639G>A	ENST00000377086.1	+	28	3188	c.2986G>A	c.(2986-2988)Gtc>Atc	p.V996I	KIF1B_ENST00000377081.1_Missense_Mutation_p.V996I|KIF1B_ENST00000263934.6_Missense_Mutation_p.V950I			O60333	KIF1B_HUMAN	kinesin family member 1B	996					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.V950I(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GGTGGCCATCGTCAGTGAGAA	0.512																																																	1	Substitution - Missense(1)	kidney(1)						G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	222.0	201.0	208.0		2848	5.7	1.0	1	dbSNP_134	208	0,8600		0,0,4300	no	missense	KIF1B	NM_015074.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	950/1771	10394639	1,13005	2203	4300	6503	SO:0001583	missense	23095			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2986G>A	1.37:g.10394639G>A	ENSP00000366290:p.Val996Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	36	5.643830	0.96704	2.27E-4	0.0	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.79247	-1.25;-1.25;-1.25	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.85869	0.5797	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.998;0.973	D;D;D;D;P;B	0.80764	0.994;0.963;0.99;0.99;0.771;0.415	D	0.83905	0.0292	10	0.42905	T	0.14	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	982;956;996;970;996;950	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	I	996;950;996;996	ENSP00000263934:V950I;ENSP00000366290:V996I;ENSP00000366284:V996I	ENSP00000263934:V950I	V	+	1	0	KIF1B	10317226	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	9.798000	0.99111	2.854000	0.98071	0.655000	0.94253	GTC		0.512	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			
KIF5C	3800	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	149851037	149851037	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:149851037A>G	ENST00000435030.1	+	17	2376	c.2008A>G	c.(2008-2010)Aag>Gag	p.K670E	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.K575E|KIF5C_ENST00000397413.1_Missense_Mutation_p.K438E			O60282	KIF5C_HUMAN	kinesin family member 5C	670					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.K670E(1)|p.K573E(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGAGCTGGCAAAGCTCCGAGC	0.507																																																	2	Substitution - Missense(2)	kidney(2)											30.0	32.0	31.0					2																	149851037		1936	4122	6058	SO:0001583	missense	3800			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2008A>G	2.37:g.149851037A>G	ENSP00000393379:p.Lys670Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	37		.	.	.	.	.	.	.	.	.	.	A	15.88	2.964428	0.53507	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;T;T	0.80653	-1.4;-1.4;-1.4	5.35	5.35	0.76521	.	0.267324	0.35805	N	0.002962	T	0.72162	0.3426	.	.	.	0.42286	D	0.992112	B;B	0.23058	0.003;0.079	B;B	0.24006	0.012;0.05	T	0.67488	-0.5658	8	.	.	.	.	15.5051	0.75731	1.0:0.0:0.0:0.0	.	670;236	O60282;Q3LIE3	KIF5C_HUMAN;.	E	670;575;573;438	ENSP00000393379:K670E;ENSP00000410115:K575E;ENSP00000380560:K438E	.	K	+	1	0	KIF5C	149559283	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	6.092000	0.71414	2.235000	0.73313	0.533000	0.62120	AAG		0.507	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3		NM_004522	
KNTC1	9735	hgsc.bcm.edu;ucsc.edu	37	12	123028814	123028814	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr12:123028814delG	ENST00000333479.7	+	8	844	c.667delG	c.(667-669)gggfs	p.G224fs	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	224					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGTGATAATTGGGGTAATTGT	0.294																																																	0													150.0	140.0	143.0					12																	123028814		1806	4075	5881	SO:0001589	frameshift_variant	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.667delG	12.37:g.123028814delG	ENSP00000328236:p.Gly224fs	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2C4|B3KSG2	Frame_Shift_Del	DEL	ENST00000333479.7	37	CCDS45002.1																																																																																				0.294	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			
LAMA1	284217	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	7042148	7042148	+	Silent	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr18:7042148G>A	ENST00000389658.3	-	9	1350	c.1257C>T	c.(1255-1257)caC>caT	p.H419H		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	419	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.			H -> E (in Ref. 3; CAA41418). {ECO:0000305}.	axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.H419H(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACTTACCATTGTGTAAGTCAG	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											71.0	57.0	62.0					18																	7042148		2203	4300	6503	SO:0001819	synonymous_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1257C>T	18.37:g.7042148G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.433	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1		NM_005559	
LAMA4	3910	broad.mit.edu;ucsc.edu|broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	112441542	112441543	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr6:112441542_112441543GA>TT	ENST00000230538.7	-	33	5005_5006	c.4608_4609TC>AA	c.(4606-4611)ggTCac>ggAAac	p.H1537N	LAMA4_ENST00000424408.2_Missense_Mutation_p.H1530N|LAMA4_ENST00000389463.4_Missense_Mutation_p.H1530N|LAMA4_ENST00000522006.1_Missense_Mutation_p.H1530N	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1537	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.G1529G(1)|p.H1530N(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGTTTTTTGTGACCAACATTAA	0.421																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)																																								SO:0001583	missense	3910				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.4608_4609delinsTT	6.37:g.112441542_112441543delinsTT	ENSP00000230538:p.His1537Asn	Somatic		WXS	Illumina GAIIx|Illumina HiSeq	Phase_I	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation|Silent	SNP	ENST00000230538.7	37	CCDS43491.1																																																																																				0.421	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2		NM_001105206	
CERS3	204219	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	101009686	101009686	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr15:101009686C>G	ENST00000394113.1	-	12	1432	c.742G>C	c.(742-744)Gct>Cct	p.A248P	CERS3_ENST00000284382.4_Missense_Mutation_p.A248P|CERS3_ENST00000560944.1_Intron|CERS3_ENST00000538112.2_Missense_Mutation_p.A248P			Q8IU89	CERS3_HUMAN	ceramide synthase 3	248	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.A248P(1)									AACATCTTAGCAGACTGCAAA	0.358																																																	1	Substitution - Missense(1)	kidney(1)											67.0	68.0	68.0					15																	101009686		2203	4300	6503	SO:0001583	missense	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.742G>C	15.37:g.101009686C>G	ENSP00000377672:p.Ala248Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954397	0.92726	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	D;D	0.86164	-2.08;-2.08	5.69	5.69	0.88448	TRAM/LAG1/CLN8 homology domain (3);	0.165966	0.51477	D	0.000087	D	0.94555	0.8246	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94707	0.7888	10	0.72032	D	0.01	-14.959	18.9514	0.92642	0.0:1.0:0.0:0.0	.	248	Q8IU89	CERS3_HUMAN	P	248;259;248	ENSP00000284382:A248P;ENSP00000437640:A248P	ENSP00000284382:A248P	A	-	1	0	CERS3	98827209	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.662000	0.74426	2.840000	0.97914	0.655000	0.94253	GCT		0.358	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4		NM_178842	
LRRC8A	56262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	131669449	131669449	+	Silent	SNP	T	T	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr9:131669449T>A	ENST00000259324.5	+	3	529	c.6T>A	c.(4-6)atT>atA	p.I2I	LRRC8A_ENST00000372600.4_Silent_p.I2I|LRRC8A_ENST00000372599.3_Silent_p.I2I	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	2					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.I2I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						GAACCATGATTCCGGTGACAG	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	71.0	73.0					9																	131669449		2203	4300	6503	SO:0001819	synonymous_variant	56262			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.6T>A	9.37:g.131669449T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXM2|Q8NCI0|Q9P2B1	Silent	SNP	ENST00000259324.5	37	CCDS35155.1																																																																																				0.542	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2		NM_019594	
MGAT4A	11320	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	99256416	99256416	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr2:99256416G>A	ENST00000264968.3	-	11	1540	c.1177C>T	c.(1177-1179)Cct>Tct	p.P393S	MGAT4A_ENST00000393487.1_Missense_Mutation_p.P393S|MGAT4A_ENST00000414521.2_Missense_Mutation_p.P265S|MGAT4A_ENST00000409391.1_Missense_Mutation_p.P393S			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	393					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.P393S(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						ACCTCCGCAGGTGGGTTTACA	0.398																																																	1	Substitution - Missense(1)	kidney(1)											78.0	80.0	80.0					2																	99256416		2203	4300	6503	SO:0001583	missense	11320			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.1177C>T	2.37:g.99256416G>A	ENSP00000264968:p.Pro393Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Missense_Mutation	SNP	ENST00000264968.3	37	CCDS2036.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952573	0.73787	.	.	ENSG00000071073	ENST00000393487;ENST00000414521;ENST00000264968;ENST00000409391	T;T;T;T	0.27402	1.67;1.7;1.67;1.67	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.57519	0.2059	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	0.976;1.0	P;D	0.83275	0.541;0.996	T	0.58014	-0.7711	10	0.62326	D	0.03	-4.0713	18.7017	0.91623	0.0:0.0:1.0:0.0	.	265;393	E9PEN2;Q9UM21	.;MGT4A_HUMAN	S	393;265;393;393	ENSP00000377127:P393S;ENSP00000404889:P265S;ENSP00000264968:P393S;ENSP00000386841:P393S	ENSP00000264968:P393S	P	-	1	0	MGAT4A	98622848	1.000000	0.71417	0.996000	0.52242	0.736000	0.42039	6.489000	0.73641	2.660000	0.90430	0.563000	0.77884	CCT		0.398	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252988.2		NM_012214	
MRPS33	51650	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	140710230	140710230	+	Silent	SNP	A	A	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr7:140710230A>C	ENST00000393008.3	-	2	359	c.204T>G	c.(202-204)ctT>ctG	p.L68L	MRPS33_ENST00000467334.1_Silent_p.L58L|MRPS33_ENST00000324787.5_Silent_p.L68L|MRPS33_ENST00000469351.1_Silent_p.L68L|MRPS33_ENST00000496958.1_Silent_p.L68L|MRPS33_ENST00000472343.1_5'Flank	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	68					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)	p.L68L(1)		breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					TGTAGAGTCCAAGAAATCGGA	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											133.0	129.0	130.0					7																	140710230		2203	4300	6503	SO:0001819	synonymous_variant	51650			AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.204T>G	7.37:g.140710230A>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000393008.3	37	CCDS5864.1																																																																																				0.408	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348878.1		NM_053035	
MYO1C	4641	hgsc.bcm.edu;ucsc.edu	37	17	1382903	1382903	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:1382903delG	ENST00000575158.1	-	8	1074	c.898delC	c.(898-900)ctcfs	p.L300fs	MYO1C_ENST00000573198.1_5'UTR|MYO1C_ENST00000545534.2_Frame_Shift_Del_p.L311fs|MYO1C_ENST00000438665.2_Frame_Shift_Del_p.L316fs|MYO1C_ENST00000361007.2_Frame_Shift_Del_p.L300fs|MYO1C_ENST00000359786.5_Frame_Shift_Del_p.L335fs			Q12965	MYO1E_HUMAN	myosin IC	305	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGATACTTGAGCTGGTTCTCG	0.662																																																	0													65.0	49.0	54.0					17																	1382903		2203	4300	6503	SO:0001589	frameshift_variant	4641			X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.898delC	17.37:g.1382903delG	ENSP00000459174:p.Leu300fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14778	Frame_Shift_Del	DEL	ENST00000575158.1	37	CCDS11003.1																																																																																				0.662	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2			
NHLRC2	374354	hgsc.bcm.edu;ucsc.edu	37	10	115636591	115636591	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr10:115636591delA	ENST00000369301.3	+	3	855	c.643delA	c.(643-645)aaafs	p.K215fs		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	215										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		AAAACTCTATAAAGATTCTTT	0.333																																																	0													44.0	48.0	47.0					10																	115636591		2199	4299	6498	SO:0001589	frameshift_variant	374354			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.643delA	10.37:g.115636591delA	ENSP00000358307:p.Lys215fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N1H1|Q8N5A6	Frame_Shift_Del	DEL	ENST00000369301.3	37	CCDS7585.1																																																																																				0.333	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1		NM_198514	
ONECUT2	9480	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	55143848	55143848	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr18:55143848G>A	ENST00000491143.2	+	2	1440	c.1408G>A	c.(1408-1410)Gtc>Atc	p.V470I		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	470					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.V470I(2)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GCTCACAACCGTCAGCAACTT	0.587																																																	2	Substitution - Missense(2)	kidney(1)|central_nervous_system(1)											57.0	64.0	62.0					18																	55143848		2109	4254	6363	SO:0001583	missense	9480			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1408G>A	18.37:g.55143848G>A	ENSP00000419185:p.Val470Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000491143.2	37	CCDS42440.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.007453|5.007453	0.93287|0.93287	.|.	.|.	ENSG00000119547|ENSG00000119547	ENST00000481727|ENST00000491143;ENST00000262095	.|.	.|.	.|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.|0.159557	.|0.39909	.|N	.|0.001234	D|D	0.82540|0.82540	0.5059|0.5059	M|M	0.70903|0.70903	2.155|2.155	0.80722|0.80722	D|D	1|1	.|D	.|0.54601	.|0.967	.|D	.|0.77004	.|0.989	T|T	0.82610|0.82610	-0.0372|-0.0372	5|9	.|0.87932	.|D	.|0	-21.6632|-21.6632	20.1323|20.1323	0.98003|0.98003	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|470	.|O95948	.|ONEC2_HUMAN	H|I	98|451;470	.|.	.|ENSP00000262095:V470I	R|V	+|+	2|1	0|0	ONECUT2|ONECUT2	53294846|53294846	1.000000|1.000000	0.71417|0.71417	0.973000|0.973000	0.42090|0.42090	0.995000|0.995000	0.86356|0.86356	9.476000|9.476000	0.97823|0.97823	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	CGT|GTC		0.587	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3			
OR52J3	119679	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	5068347	5068347	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:5068347G>A	ENST00000380370.1	+	1	592	c.592G>A	c.(592-594)Ggt>Agt	p.G198S		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G198S(1)		NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCGTATCAATGGTATCTATGG	0.448																																																	1	Substitution - Missense(1)	kidney(1)											270.0	244.0	253.0					11																	5068347		2201	4298	6499	SO:0001583	missense	119679			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.592G>A	11.37:g.5068347G>A	ENSP00000369728:p.Gly198Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	37	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	G	5.296	0.239919	0.10023	.	.	ENSG00000205495	ENST00000380370	T	0.00069	8.77	4.19	2.31	0.28768	GPCR, rhodopsin-like superfamily (1);	0.665861	0.12995	N	0.422112	T	0.00073	0.0002	N	0.00355	-1.605	0.09310	N	1	B	0.14438	0.01	B	0.29176	0.099	T	0.07385	-1.0775	10	0.40728	T	0.16	.	9.0504	0.36372	0.1833:0.0:0.8167:0.0	.	198	Q8NH60	O52J3_HUMAN	S	198	ENSP00000369728:G198S	ENSP00000369728:G198S	G	+	1	0	OR52J3	5024923	0.000000	0.05858	0.037000	0.18230	0.095000	0.18619	-0.016000	0.12613	0.409000	0.25649	0.655000	0.94253	GGT		0.448	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1		NM_001001916	
OR6C68	403284	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	55886972	55886972	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr12:55886972G>C	ENST00000548615.1	+	1	811	c.811G>C	c.(811-813)Ggt>Cgt	p.G271R	RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|OR6C68_ENST00000379662.1_Missense_Mutation_p.G276R	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G276R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						CATTAATAAAGGTGTGTCAGT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											68.0	70.0	69.0					12																	55886972		2203	4300	6503	SO:0001583	missense	403284				CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.811G>C	12.37:g.55886972G>C	ENSP00000448811:p.Gly271Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000548615.1	37	CCDS31826.2	.	.	.	.	.	.	.	.	.	.	G	19.25	3.790745	0.70452	.	.	ENSG00000205327	ENST00000379662;ENST00000548615	T;T	0.00091	8.74;8.74	5.24	3.39	0.38822	GPCR, rhodopsin-like superfamily (1);	0.139564	0.32120	N	0.006556	T	0.00328	0.0010	M	0.69823	2.125	0.09310	N	1	D	0.59357	0.985	D	0.69142	0.962	T	0.43360	-0.9396	10	0.56958	D	0.05	.	3.2051	0.06663	0.2768:0.0:0.5284:0.1948	.	271	A6NDL8	O6C68_HUMAN	R	276;271	ENSP00000368983:G276R;ENSP00000448811:G271R	ENSP00000368983:G276R	G	+	1	0	OR6C68	54173239	0.000000	0.05858	0.011000	0.14972	0.897000	0.52465	-0.937000	0.03942	1.373000	0.46208	0.596000	0.82720	GGT		0.358	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406677.1			
OR6C4	341418	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	55945508	55945508	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr12:55945508C>G	ENST00000394256.2	+	1	526	c.498C>G	c.(496-498)ttC>ttG	p.F166L	RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_001005494.1	NP_001005494.1	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C, member 4	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F166L(1)|p.F166F(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	11						AGGTAGATTTCTGTGTCTCCA	0.478																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|kidney(1)											132.0	131.0	132.0					12																	55945508		2203	4300	6503	SO:0001583	missense	341418			BK004261	CCDS31827.1	12q14.2	2012-08-09				ENSG00000179626		"""GPCR / Class A : Olfactory receptors"""	19632	protein-coding gene	gene with protein product							Standard	NM_001005494		Approved		uc010spp.2	Q8NGE1	OTTHUMG00000169959	ENST00000394256.2:c.498C>G	12.37:g.55945508C>G	ENSP00000377799:p.Phe166Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MZG7|B2RNN2|Q6IFK1	Missense_Mutation	SNP	ENST00000394256.2	37	CCDS31827.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725446	0.48833	.	.	ENSG00000179626	ENST00000394256	T	0.00018	9.07	4.98	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000064	T	0.00384	0.0012	M	0.84948	2.725	0.21064	N	0.999799	D	0.89917	1.0	D	0.91635	0.999	T	0.27739	-1.0065	10	0.87932	D	0	.	8.6417	0.33981	0.0:0.7619:0.0:0.2381	.	166	Q8NGE1	OR6C4_HUMAN	L	166	ENSP00000377799:F166L	ENSP00000377799:F166L	F	+	3	2	OR6C4	54231775	0.772000	0.28567	0.997000	0.53966	0.515000	0.34225	-0.069000	0.11542	0.802000	0.34089	-0.136000	0.14681	TTC		0.478	OR6C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406678.1			
PCDHGA12	26025	hgsc.bcm.edu	37	5	140812776	140812776	+	Intron	DEL	T	T	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr5:140812776delT	ENST00000252085.3	+	1	2566				PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB7_ENST00000398594.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCttctttcttttttttttt	0.413																																																	0									,,,,,,,,,,,,,,,,,,,,	139,219,3894		0,0,139,2,215,1770	27.0	30.0	29.0		,,,,,,,,,,,,,,,,,,,,	-0.3	0.0	5		30	252,363,7627		2,1,247,1,360,3510	no	codingComplex,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron	PCDHGB4,PCDHGA8,PCDHGA12,PCDHGB7,PCDHGB6,PCDHGB5,PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA11,PCDHGA10,PCDHGA9,PCDHGA7,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_032094.1,NM_032092.1,NM_032088.1,NM_018927.3,NM_018926.2,NM_018925.2,NM_018924.2,NM_018923.2,NM_018922.2,NM_018921.2,NM_018920.2,NM_018919.2,NM_018918.2,NM_018917.2,NM_018916.3,NM_018915.2,NM_018914.2,NM_018913.2,NM_018912.2,NM_003736.2,NM_003735.2	,,,,,,,,,,,,,,,,,,,,	2,1,386,3,575,5280	A1A1,A1A2,A1R,A2A2,A2R,RR		7.4618,8.4196,7.7877	,,,,,,,,,,,,,,,,,,,,	,,,,,,,,,,,,,,,,,,,,	140812776	391,582,11521	2201	4298	6499	SO:0001627	intron_variant	26025			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2424+26T>-	5.37:g.140812776delT		Somatic		WXS	Illumina HiSeq	Phase_I	O15100|Q6UW70|Q9Y5D7	Frame_Shift_Del	DEL	ENST00000252085.3	37	CCDS4260.1																																																																																				0.413	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2		NM_003735	
PCSK2	5126	broad.mit.edu;hgsc.bcm.edu	37	20	17417410	17417410	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr20:17417410G>T	ENST00000262545.2	+	8	1082	c.767G>T	c.(766-768)aGt>aTt	p.S256I	PCSK2_ENST00000377899.1_Missense_Mutation_p.S237I|PCSK2_ENST00000536609.1_Missense_Mutation_p.S221I	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	256	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.S256I(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCCTCCATCAGTCATATGCCA	0.592																																																	1	Substitution - Missense(1)	kidney(1)											80.0	68.0	72.0					20																	17417410		2203	4300	6503	SO:0001583	missense	5126			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.767G>T	20.37:g.17417410G>T	ENSP00000262545:p.Ser256Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924548	0.92319	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	D;D;D	0.87334	-2.24;-2.24;-2.24	5.38	5.38	0.77491	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.91250	0.7242	L	0.45581	1.43	0.80722	D	1	D;D	0.57257	0.979;0.979	D;D	0.68943	0.913;0.961	D	0.92046	0.5644	10	0.87932	D	0	-36.2924	17.6879	0.88261	0.0:0.0:1.0:0.0	.	221;256	B4DFQ3;P16519	.;NEC2_HUMAN	I	237;256;221	ENSP00000367131:S237I;ENSP00000262545:S256I;ENSP00000437458:S221I	ENSP00000262545:S256I	S	+	2	0	PCSK2	17365410	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.413000	0.97351	2.519000	0.84933	0.655000	0.94253	AGT		0.592	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2		NM_002594	
PDGFD	80310	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	103797665	103797665	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:103797665C>A	ENST00000393158.2	-	6	1141	c.962G>T	c.(961-963)gGg>gTg	p.G321V	PDGFD_ENST00000302251.5_Missense_Mutation_p.G315V			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	321					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.G321V(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		CACGGTTTTCCCTGAATTGCA	0.458																																																	2	Substitution - Missense(2)	kidney(2)											96.0	79.0	84.0					11																	103797665		2202	4299	6501	SO:0001583	missense	80310			AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.962G>T	11.37:g.103797665C>A	ENSP00000376865:p.Gly321Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285474	0.80803	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.25749	1.78;1.78	5.88	5.88	0.94601	Platelet-derived growth factor (PDGF) (3);	0.106935	0.64402	D	0.000005	T	0.48040	0.1478	L	0.60455	1.87	0.80722	D	1	D;D	0.60575	0.98;0.988	P;P	0.61800	0.894;0.83	T	0.34875	-0.9811	10	0.66056	D	0.02	-28.3581	20.2279	0.98344	0.0:1.0:0.0:0.0	.	321;315	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	V	321;315	ENSP00000376865:G321V;ENSP00000302193:G315V	ENSP00000302193:G315V	G	-	2	0	PDGFD	103302875	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.732000	0.55021	2.778000	0.95560	0.655000	0.94253	GGG		0.458	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2		NM_025208	
PDSS2	57107	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	107655484	107655484	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr6:107655484G>A	ENST00000369037.4	-	2	626	c.349C>T	c.(349-351)Ctc>Ttc	p.L117F	PDSS2_ENST00000369031.4_Missense_Mutation_p.L117F|PDSS2_ENST00000453874.2_Missense_Mutation_p.L117F	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	117					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)	p.L117F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		GAGATAAGGAGCACCACCAAG	0.483																																																	1	Substitution - Missense(1)	kidney(1)											94.0	84.0	87.0					6																	107655484		2203	4300	6503	SO:0001583	missense	57107			AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.349C>T	6.37:g.107655484G>A	ENSP00000358033:p.Leu117Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Missense_Mutation	SNP	ENST00000369037.4	37	CCDS5059.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554823	0.65425	.	.	ENSG00000164494	ENST00000369037;ENST00000453874;ENST00000369031	T;T;T	0.67171	-0.25;-0.25;-0.25	5.56	2.8	0.32819	Terpenoid synthase (2);	0.000000	0.85682	D	0.000000	T	0.75961	0.3921	M	0.87180	2.865	0.54753	D	0.999989	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	T	0.77664	-0.2503	10	0.51188	T	0.08	.	9.7518	0.40481	0.3285:0.0:0.6715:0.0	.	117;117;117;117	B4DKU5;Q86YH6-2;B2RE48;Q86YH6	.;.;.;DLP1_HUMAN	F	117	ENSP00000358033:L117F;ENSP00000399691:L117F;ENSP00000358027:L117F	ENSP00000358027:L117F	L	-	1	0	PDSS2	107762177	0.926000	0.31397	0.998000	0.56505	0.851000	0.48451	1.373000	0.34272	0.843000	0.35070	0.561000	0.74099	CTC		0.483	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131954.1		NM_020381	
PNN	5411	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	39645318	39645318	+	Silent	SNP	T	T	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr14:39645318T>C	ENST00000216832.4	+	2	217	c.150T>C	c.(148-150)ccT>ccC	p.P50P	RP11-407N17.4_ENST00000556537.1_lincRNA|PNN_ENST00000553331.1_Silent_p.P50P|PNN_ENST00000556530.1_Silent_p.P50P	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	50	Necessary for interaction with RNPS1.|Necessary for interactions with KRT8, KRT18 and KRT19.|Necessary for mediating alternative 5' splicing.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.P50P(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		TTTCTGGTCCTGGTGGAGGTA	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											120.0	115.0	116.0					14																	39645318		2203	4300	6503	SO:0001819	synonymous_variant	5411			U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.150T>C	14.37:g.39645318T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Silent	SNP	ENST00000216832.4	37	CCDS9671.1																																																																																				0.418	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2		NM_002687	
PREX2	80243	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	69009342	69009342	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr8:69009342G>C	ENST00000288368.4	+	22	2736	c.2459G>C	c.(2458-2460)gGt>gCt	p.G820A	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	820					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.G820A(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CTGGAATATGGTGTCGTGTAT	0.453																																																	2	Substitution - Missense(2)	kidney(2)											186.0	158.0	168.0					8																	69009342		2203	4300	6503	SO:0001583	missense	80243			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2459G>C	8.37:g.69009342G>C	ENSP00000288368:p.Gly820Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334287	0.81801	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.66460	-0.21	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.82774	0.5110	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.82476	-0.0438	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	820;820;820	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	A	820	ENSP00000288368:G820A	ENSP00000288368:G820A	G	+	2	0	PREX2	69171896	1.000000	0.71417	0.300000	0.25030	0.388000	0.30384	9.823000	0.99369	2.937000	0.99478	0.650000	0.86243	GGT		0.453	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1		NM_025170	
PTPRC	5788	broad.mit.edu;hgsc.bcm.edu	37	1	198687258	198687258	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:198687258A>T	ENST00000367376.2	+	14	1651	c.1480A>T	c.(1480-1482)Aca>Tca	p.T494S	PTPRC_ENST00000442510.2_Missense_Mutation_p.T496S|PTPRC_ENST00000594404.1_Missense_Mutation_p.T333S|PTPRC_ENST00000352140.3_Missense_Mutation_p.T446S|PTPRC_ENST00000348564.6_Missense_Mutation_p.T335S	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	494	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T494S(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TGTCTCCATGACATCAGATAA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											74.0	70.0	72.0					1																	198687258		2203	4300	6503	SO:0001583	missense	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1480A>T	1.37:g.198687258A>T	ENSP00000356346:p.Thr494Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	A	7.245	0.602105	0.13939	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.57273	0.41	4.3	-3.72	0.04411	Fibronectin, type III (4);Immunoglobulin-like fold (1);	2.595140	0.01447	N	0.015335	T	0.46795	0.1411	M	0.67953	2.075	0.09310	N	1	B;B;B;B;B	0.29232	0.228;0.156;0.238;0.238;0.238	B;B;B;B;B	0.33960	0.138;0.173;0.124;0.124;0.124	T	0.19976	-1.0289	10	0.07813	T	0.8	.	5.5237	0.16947	0.2762:0.3258:0.398:0.0	.	430;430;335;446;494	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	S	496;430;446;446;380;494;428;333	ENSP00000193532:T446S	ENSP00000306782:T333S	T	+	1	0	PTPRC	196953881	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.746000	0.04829	-0.579000	0.05952	0.477000	0.44152	ACA		0.393	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				
PWP1	11137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	108082496	108082496	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr12:108082496G>A	ENST00000412830.3	+	3	404	c.236G>A	c.(235-237)gGt>gAt	p.G79D	PWP1_ENST00000541166.1_Missense_Mutation_p.G17D	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	79					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.G79D(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						CTGGAGGATGGTGACCCAGAG	0.532																																																	1	Substitution - Missense(1)	kidney(1)											140.0	129.0	133.0					12																	108082496		2203	4300	6503	SO:0001583	missense	11137			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.236G>A	12.37:g.108082496G>A	ENSP00000387365:p.Gly79Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	37	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	.	13.73	2.325231	0.41197	.	.	ENSG00000136045	ENST00000412830;ENST00000547995;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.70631	-0.5;-0.48	5.82	4.93	0.64822	.	0.386956	0.31772	N	0.007082	T	0.58323	0.2114	L	0.38175	1.15	0.35878	D	0.828705	B	0.02656	0.0	B	0.01281	0.0	T	0.58831	-0.7567	10	0.15066	T	0.55	.	12.4485	0.55666	0.081:0.0:0.919:0.0	.	79	Q13610	PWP1_HUMAN	D	79;17;79;79;79;17	ENSP00000387365:G79D;ENSP00000445249:G17D	ENSP00000258531:G79D	G	+	2	0	PWP1	106606626	0.993000	0.37304	0.959000	0.39883	0.949000	0.60115	2.407000	0.44565	1.448000	0.47680	0.579000	0.79373	GGT		0.532	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1		NM_007062	
PYGM	5837	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	64514199	64514199	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr11:64514199A>G	ENST00000164139.3	-	20	2859	c.2461T>C	c.(2461-2463)Tat>Cat	p.Y821H	PYGM_ENST00000377432.3_Missense_Mutation_p.Y733H|RASGRP2_ENST00000377497.3_5'Flank|RASGRP2_ENST00000377487.1_5'Flank|RASGRP2_ENST00000394430.1_5'Flank|RASGRP2_ENST00000377494.1_5'Flank|RASGRP2_ENST00000394432.3_5'Flank|RASGRP2_ENST00000377486.3_5'Flank|RASGRP2_ENST00000377489.1_5'Flank|RASGRP2_ENST00000354024.3_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	821					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)	p.Y821H(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCCCGGGCATACTGGGCAATG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											99.0	97.0	98.0					11																	64514199		2201	4297	6498	SO:0001583	missense	5837				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.2461T>C	11.37:g.64514199A>G	ENSP00000164139:p.Tyr821His	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.583202	0.86748	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.96587	-3.95;-4.06	4.39	4.39	0.52855	.	0.000000	0.42294	D	0.000737	D	0.98836	0.9607	H	0.98996	4.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98784	1.0733	10	0.87932	D	0	-12.3378	11.6045	0.51024	1.0:0.0:0.0:0.0	.	733;821	A6NDY6;P11217	.;PYGM_HUMAN	H	733;821;802	ENSP00000366650:Y733H;ENSP00000164139:Y821H	ENSP00000164139:Y821H	Y	-	1	0	PYGM	64270775	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.065000	0.93941	1.858000	0.53909	0.379000	0.24179	TAT		0.622	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2		NM_005609	
RAB3GAP2	25782	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	220346067	220346067	+	Silent	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:220346067A>G	ENST00000358951.2	-	22	2444	c.2328T>C	c.(2326-2328)gtT>gtC	p.V776V		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	776					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.V776V(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TTGAAAGCCAAACACTCAGGA	0.358																																																	1	Substitution - coding silent(1)	kidney(1)											99.0	90.0	93.0					1																	220346067		2203	4300	6503	SO:0001819	synonymous_variant	25782			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2328T>C	1.37:g.220346067A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	37	CCDS31028.1																																																																																				0.358	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2		NM_012414	
RARA	5914	broad.mit.edu;ucsc.edu	37	17	38508320	38508320	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:38508320A>G	ENST00000254066.5	+	5	1083	c.628A>G	c.(628-630)Acg>Gcg	p.T210A	RARA_ENST00000425707.3_Missense_Mutation_p.T113A|RARA_ENST00000420042.1_3'UTR|RARA_ENST00000394089.2_Missense_Mutation_p.T210A|RARA_ENST00000394086.3_Missense_Mutation_p.T226A|RARA_ENST00000394081.3_Missense_Mutation_p.T205A	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	210	Ligand-binding.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)	p.T210A(1)		breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CAAATACACTACGGTATGGCT	0.632			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																			Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	1	Substitution - Missense(1)	kidney(1)											26.0	24.0	25.0					17																	38508320		2203	4299	6502	SO:0001583	missense	5914			X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.628A>G	17.37:g.38508320A>G	ENSP00000254066:p.Thr210Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Missense_Mutation	SNP	ENST00000254066.5	37	CCDS11366.1	.	.	.	.	.	.	.	.	.	.	A	13.17	2.158043	0.38119	.	.	ENSG00000131759	ENST00000254066;ENST00000425707;ENST00000394089;ENST00000394086;ENST00000394081;ENST00000420042	T;D;T;T;T	0.92752	1.3;-3.1;1.3;1.3;1.3	4.54	4.54	0.55810	Nuclear hormone receptor, ligand-binding (2);	.	.	.	.	D	0.93674	0.7979	L	0.51422	1.61	0.80722	D	1	D;B;P	0.55172	0.97;0.012;0.707	D;B;B	0.65323	0.934;0.031;0.345	D	0.93388	0.6749	9	0.48119	T	0.1	.	12.8681	0.57951	1.0:0.0:0.0:0.0	.	113;205;210	B8Y636;F1D8N9;P10276	.;.;RARA_HUMAN	A	210;113;210;226;205;97	ENSP00000254066:T210A;ENSP00000389993:T113A;ENSP00000377649:T210A;ENSP00000377648:T226A;ENSP00000377643:T205A	ENSP00000254066:T210A	T	+	1	0	RARA	35761846	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	9.262000	0.95591	1.682000	0.51000	0.383000	0.25322	ACG		0.632	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257136.2			
RASGEF1C	255426	broad.mit.edu;ucsc.edu	37	5	179546418	179546418	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr5:179546418T>G	ENST00000393371.2	-	7	1131	c.835A>C	c.(835-837)Att>Ctt	p.I279L	RASGEF1C_ENST00000519883.1_5'UTR|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.I279L|RASGEF1C_ENST00000522500.1_Missense_Mutation_p.I128L			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	279	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.I279L(2)		breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGAACTCAATCACCTGGGCC	0.637																																																	2	Substitution - Missense(2)	kidney(2)											139.0	107.0	118.0					5																	179546418		2203	4300	6503	SO:0001583	missense	255426			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.835A>C	5.37:g.179546418T>G	ENSP00000377037:p.Ile279Leu	Somatic		WXS	Illumina GAIIx	Phase_I	D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	ENST00000393371.2	37	CCDS4452.1	.	.	.	.	.	.	.	.	.	.	T	8.929	0.962905	0.18583	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.27557	1.66;1.66;1.66	4.38	0.569	0.17340	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.276309	0.33959	N	0.004390	T	0.17066	0.0410	N	0.25332	0.735	0.44579	D	0.997549	B	0.06786	0.001	B	0.16289	0.015	T	0.08973	-1.0696	10	0.21014	T	0.42	.	7.5066	0.27549	0.0:0.2908:0.0:0.7092	.	279	Q8N431	RGF1C_HUMAN	L	279;279;128	ENSP00000354963:I279L;ENSP00000377037:I279L;ENSP00000429114:I128L	ENSP00000354963:I279L	I	-	1	0	RASGEF1C	179479024	1.000000	0.71417	0.916000	0.36221	0.070000	0.16714	4.521000	0.60532	0.179000	0.19938	-0.441000	0.05720	ATT		0.637	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2		NM_175062	
TATDN1	83940	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	125498660	125498660	+	IGR	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr8:125498660T>G	ENST00000276692.6	-	0	1018				RP11-158K1.3_ENST00000518639.1_RNA|RNF139_ENST00000303545.3_Nonsense_Mutation_p.L257*	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.L257*(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ATGTACATCTTAAGGATGGCA	0.393																																																	1	Substitution - Nonsense(1)	kidney(1)											157.0	143.0	147.0					8																	125498660		2203	4300	6503	SO:0001628	intergenic_variant	11236			AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125498660T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R5J0|Q8TD02|Q9BY40	Nonsense_Mutation	SNP	ENST00000276692.6	37	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505615	0.85282	.	.	ENSG00000170881	ENST00000303545	.	.	.	5.24	5.24	0.73138	.	0.148257	0.42420	D	0.000702	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-10.4682	15.4351	0.75140	0.0:0.0:0.0:1.0	.	.	.	.	X	257	.	ENSP00000304051:L257X	L	+	2	0	RNF139	125567841	1.000000	0.71417	1.000000	0.80357	0.284000	0.27059	7.188000	0.77739	2.090000	0.63153	0.528000	0.53228	TTA		0.393	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1		NM_032026	
ROCK1	6093	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	18546995	18546995	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr18:18546995G>A	ENST00000399799.2	-	27	4175	c.3235C>T	c.(3235-3237)Cag>Tag	p.Q1079*		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1079					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q1079*(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					CTGGCCAACTGCATCTGAAGC	0.368																																																	1	Substitution - Nonsense(1)	kidney(1)											171.0	153.0	159.0					18																	18546995		2203	4300	6503	SO:0001587	stop_gained	6093				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3235C>T	18.37:g.18546995G>A	ENSP00000382697:p.Gln1079*	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ91|Q2KHM4|Q59GZ4	Nonsense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	G	48	14.925336	0.99815	.	.	ENSG00000067900	ENST00000399799	.	.	.	5.61	4.72	0.59763	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	15.7818	0.78267	0.0:0.0:0.8625:0.1375	.	.	.	.	X	1079	.	ENSP00000382697:Q1079X	Q	-	1	0	ROCK1	16800993	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	6.518000	0.73764	1.347000	0.45714	0.585000	0.79938	CAG		0.368	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2		NM_005406	
SCARB2	950	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	77100845	77100845	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr4:77100845C>A	ENST00000264896.2	-	4	786	c.437G>T	c.(436-438)tGg>tTg	p.W146L	SCARB2_ENST00000452464.2_Intron	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	146					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)	p.W146L(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			CACCTGGGACCACTCTATGAC	0.527											OREG0016231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											157.0	147.0	150.0					4																	77100845		2203	4300	6503	SO:0001583	missense	950			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.437G>T	4.37:g.77100845C>A	ENSP00000264896:p.Trp146Leu	Somatic	1173	WXS	Illumina HiSeq	Phase_I	B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	ENST00000264896.2	37	CCDS3577.1	.	.	.	.	.	.	.	.	.	.	C	1.318	-0.600194	0.03744	.	.	ENSG00000138760	ENST00000264896	T	0.69806	-0.43	5.95	2.1	0.27182	.	0.854169	0.10924	N	0.619155	T	0.43233	0.1238	N	0.05078	-0.115	0.35547	D	0.80357	B	0.02656	0.0	B	0.06405	0.002	T	0.32268	-0.9913	10	0.10377	T	0.69	.	13.0376	0.58881	0.578:0.422:0.0:0.0	.	146	Q14108	SCRB2_HUMAN	L	146	ENSP00000264896:W146L	ENSP00000264896:W146L	W	-	2	0	SCARB2	77319869	0.044000	0.20184	0.002000	0.10522	0.113000	0.19764	0.152000	0.16302	0.059000	0.16252	0.655000	0.94253	TGG		0.527	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252403.1		NM_005506	
SERPINB8	5271	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	61650927	61650927	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr18:61650927delC	ENST00000397985.2	+	5	795	c.539delC	c.(538-540)acafs	p.T180fs	SERPINB8_ENST00000397988.3_Frame_Shift_Del_p.T180fs|SERPINB8_ENST00000542677.1_5'UTR|SERPINB8_ENST00000353706.2_Frame_Shift_Del_p.T180fs	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	180					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				AGAAAGTACACAAGGGGAATG	0.388																																																	0													119.0	113.0	115.0					18																	61650927		2203	4300	6503	SO:0001589	frameshift_variant	5271			L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.539delC	18.37:g.61650927delC	ENSP00000381072:p.Thr180fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTW2|Q7Z2V6|Q8N178	Frame_Shift_Del	DEL	ENST00000397985.2	37	CCDS11991.1																																																																																				0.388	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134014.1		NM_001031848	
SF3A3	10946	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	38455225	38455226	+	Nonsense_Mutation	DNP	GC	GC	AT			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:38455225_38455226GC>AT	ENST00000373019.4	-	2	1093_1094	c.138_139GC>AT	c.(136-141)atGCaa>atATaa	p.46_47MQ>I*	SF3A3_ENST00000448721.2_Nonsense_Mutation_p.46_47MQ>I*|SF3A3_ENST00000489537.1_5'UTR|RNU6-510P_ENST00000391239.1_RNA	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	46					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.M46I(1)|p.Q47*(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTCACATCTTGCATGGCCCGAG	0.55																																																	2	Substitution - Nonsense(1)|Substitution - Missense(1)	kidney(2)																																								SO:0001587	stop_gained	10946			U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.138_139delinsAT	1.37:g.38455225_38455226delinsAT	ENSP00000362110:p.M46_Q47delinsI*	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPT5|Q15460|Q5VT87	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000373019.4	37	CCDS428.1																																																																																				0.550	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012976.1		NM_006802	
SH2B2	10603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	101952119	101952119	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr7:101952119T>G	ENST00000536178.1	+	4	1028	c.983T>G	c.(982-984)aTc>aGc	p.I328S	SH2B2_ENST00000306803.8_Missense_Mutation_p.I285S			O14492	SH2B2_HUMAN	SH2B adaptor protein 2	285					actin cytoskeleton organization (GO:0030036)|antigen receptor-mediated signaling pathway (GO:0050851)|B-1 B cell homeostasis (GO:0001922)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cytokine-mediated signaling pathway (GO:0019221)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|regulation of JAK-STAT cascade (GO:0046425)|regulation of metabolic process (GO:0019222)|regulation of Ras protein signal transduction (GO:0046578)|signal transduction (GO:0007165)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stress fiber (GO:0001725)	JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.I328S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9						GCCGAATACATCTTGGAGACC	0.602																																																	1	Substitution - Missense(1)	kidney(1)											135.0	144.0	141.0					7																	101952119		2127	4239	6366	SO:0001583	missense	10603			AB000520		7q22.1	2013-02-14			ENSG00000160999	ENSG00000160999		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	17381	protein-coding gene	gene with protein product	"""adaptor protein with pleckstrin homology and src"""	605300				9233773	Standard	XM_005276976		Approved	APS	uc011kko.2	O14492	OTTHUMG00000150652	ENST00000536178.1:c.983T>G	7.37:g.101952119T>G	ENSP00000440273:p.Ile328Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND74	Missense_Mutation	SNP	ENST00000536178.1	37		.	.	.	.	.	.	.	.	.	.	.	21.7	4.191965	0.78902	.	.	ENSG00000160999	ENST00000536178;ENST00000444095;ENST00000306803	T;T;T	0.34859	1.34;1.34;1.34	4.33	4.33	0.51752	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.055638	0.64402	D	0.000001	T	0.54481	0.1861	M	0.73217	2.22	0.42093	D	0.991301	D	0.53312	0.959	P	0.59487	0.858	T	0.68842	-0.5302	9	0.87932	D	0	-16.5743	13.6687	0.62412	0.0:0.0:0.0:1.0	.	285	O14492	SH2B2_HUMAN	S	328;285;285	ENSP00000440273:I328S;ENSP00000401883:I285S;ENSP00000304701:I285S	ENSP00000304701:I285S	I	+	2	0	SH2B2	101738839	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.400000	0.79949	1.819000	0.53055	0.459000	0.35465	ATC		0.602	SH2B2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_020979	
SLC5A10	125206	broad.mit.edu;ucsc.edu	37	17	18874338	18874338	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:18874338T>C	ENST00000395645.3	+	8	671	c.653T>C	c.(652-654)aTc>aCc	p.I218T	FAM83G_ENST00000388995.6_3'UTR|SLC5A10_ENST00000395647.2_Missense_Mutation_p.I218T|SLC5A10_ENST00000417251.2_Missense_Mutation_p.I218T|SLC5A10_ENST00000317977.6_Missense_Mutation_p.I135T|SLC5A10_ENST00000395643.2_Missense_Mutation_p.I191T|SLC5A10_ENST00000395642.1_Missense_Mutation_p.I135T	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	218					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.I218T(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						TTTGACCAGATCGGTGGTTAC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											76.0	58.0	64.0					17																	18874338		2203	4300	6503	SO:0001583	missense	125206				CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.653T>C	17.37:g.18874338T>C	ENSP00000379007:p.Ile218Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	ENST00000395645.3	37	CCDS42275.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.210279	0.58343	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.93782	0.8012	M	0.77712	2.385	0.80722	D	1	D;D;D;D;D	0.58268	0.975;0.969;0.975;0.969;0.982	D;P;D;P;D	0.63793	0.911;0.856;0.911;0.856;0.918	D	0.94196	0.7445	10	0.59425	D	0.04	.	15.8121	0.78573	0.0:0.0:0.0:1.0	.	218;191;218;218;135	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	T	135;218;135;218;218;191	ENSP00000324346:I135T;ENSP00000379008:I218T;ENSP00000379004:I135T;ENSP00000401875:I218T;ENSP00000379007:I218T;ENSP00000379005:I191T	ENSP00000324346:I135T	I	+	2	0	SLC5A10	18815063	1.000000	0.71417	0.654000	0.29608	0.174000	0.22865	5.153000	0.64888	2.139000	0.66308	0.533000	0.62120	ATC		0.622	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2		NM_152351	
SLC47A2	146802	broad.mit.edu;ucsc.edu	37	17	19619790	19619790	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:19619790A>G	ENST00000325411.5	-	1	129	c.79T>C	c.(79-81)Ttt>Ctt	p.F27L	SLC47A2_ENST00000350657.5_Missense_Mutation_p.F27L|RP11-311F12.1_ENST00000577087.2_lincRNA|SLC47A2_ENST00000463318.1_Intron	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	27					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)	p.F27L(2)		endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	TCAGTCCCAAAGCCTCTGGGA	0.642																																																	2	Substitution - Missense(2)	kidney(2)											48.0	40.0	43.0					17																	19619790		2203	4300	6503	SO:0001583	missense	146802			AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.79T>C	17.37:g.19619790A>G	ENSP00000326671:p.Phe27Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Missense_Mutation	SNP	ENST00000325411.5	37	CCDS11211.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862622	0.71949	.	.	ENSG00000180638	ENST00000350657;ENST00000325411;ENST00000433844	T;T;T	0.42513	1.5;1.53;0.97	3.72	3.72	0.42706	.	0.068220	0.64402	U	0.000015	T	0.24736	0.0600	N	0.08118	0	0.33489	D	0.588476	P;P;B	0.35011	0.48;0.48;0.349	B;B;B	0.38562	0.276;0.276;0.168	T	0.39313	-0.9620	10	0.51188	T	0.08	-10.1274	9.0999	0.36662	1.0:0.0:0.0:0.0	.	27;27;27	Q86VL8-3;Q86VL8-4;Q86VL8	.;.;S47A2_HUMAN	L	27	ENSP00000338084:F27L;ENSP00000326671:F27L;ENSP00000391848:F27L	ENSP00000326671:F27L	F	-	1	0	SLC47A2	19560382	1.000000	0.71417	0.730000	0.30809	0.752000	0.42762	3.649000	0.54417	1.476000	0.48215	0.254000	0.18369	TTT		0.642	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132242.2		NM_152908	
SPOCD1	90853	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	32259422	32259422	+	Silent	SNP	G	G	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:32259422G>T	ENST00000360482.2	-	12	2589	c.2460C>A	c.(2458-2460)gcC>gcA	p.A820A	SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000257100.3_Silent_p.A313A|RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000533231.1_Silent_p.A820A	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	820					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.A820A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TTTGGCTTAGGGCTTTCTGGA	0.582																																																	1	Substitution - coding silent(1)	kidney(1)											176.0	179.0	178.0					1																	32259422		2203	4300	6503	SO:0001819	synonymous_variant	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2460C>A	1.37:g.32259422G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	ENST00000360482.2	37	CCDS347.1	.	.	.	.	.	.	.	.	.	.	G	0.900	-0.722601	0.03158	.	.	ENSG00000134668	ENST00000528579	.	.	.	4.95	3.07	0.35406	.	.	.	.	.	T	0.35307	0.0927	.	.	.	0.21147	N	0.999772	.	.	.	.	.	.	T	0.20505	-1.0273	4	.	.	.	-0.6593	7.9663	0.30100	0.1941:0.0:0.8059:0.0	.	.	.	.	H	194	.	.	P	-	2	0	SPOCD1	32032009	0.068000	0.21057	0.081000	0.20488	0.185000	0.23345	-0.093000	0.11111	0.764000	0.33197	0.563000	0.77884	CCC		0.582	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1		NM_144569	
THSD7A	221981	broad.mit.edu;ucsc.edu	37	7	11446611	11446611	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr7:11446611C>G	ENST00000423059.4	-	21	4239	c.3988G>C	c.(3988-3990)Gac>Cac	p.D1330H	AC004160.4_ENST00000425837.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1330	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D1330H(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTGGACTGGTCCATCAGGGAA	0.493										HNSCC(18;0.044)																																							1	Substitution - Missense(1)	kidney(1)											97.0	98.0	98.0					7																	11446611		1978	4159	6137	SO:0001583	missense	221981				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3988G>C	7.37:g.11446611C>G	ENSP00000406482:p.Asp1330His	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.726752	0.69074	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.54071	0.59	6.14	6.14	0.99180	.	0.140343	0.64402	D	0.000005	T	0.33000	0.0848	N	0.02192	-0.645	0.44627	D	0.997605	B	0.02656	0.0	B	0.04013	0.001	T	0.15407	-1.0438	10	0.35671	T	0.21	.	20.8597	0.99761	0.0:1.0:0.0:0.0	.	1330	Q9UPZ6	THS7A_HUMAN	H	1330	ENSP00000406482:D1330H	ENSP00000262042:D1330H	D	-	1	0	THSD7A	11413136	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.975000	0.56859	2.937000	0.99478	0.650000	0.86243	GAC		0.493	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4		XM_928187.2	
TNFRSF1A	7132	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6439822	6439822	+	Silent	SNP	G	G	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr12:6439822G>T	ENST00000162749.2	-	7	980	c.681C>A	c.(679-681)ctC>ctA	p.L227L	TNFRSF1A_ENST00000437813.3_5'Flank|TNFRSF1A_ENST00000540022.1_Silent_p.L184L	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	227					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)	p.L227L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						CAATGAAGAGGAGGGATAAAA	0.557																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	64.0	66.0					12																	6439822		2203	4300	6503	SO:0001819	synonymous_variant	7132			M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.681C>A	12.37:g.6439822G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Silent	SNP	ENST00000162749.2	37	CCDS8542.1																																																																																				0.557	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399038.1		NM_001065	
MC1R	4157	broad.mit.edu;ucsc.edu	37	16	89986049	89986049	+	Missense_Mutation	SNP	T	T	C	rs374235260		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr16:89986049T>C	ENST00000555147.1	+	1	1763	c.383T>C	c.(382-384)aTg>aCg	p.M128T	RP11-566K11.7_ENST00000570217.1_RNA|TUBB3_ENST00000556922.1_Missense_Mutation_p.M128T|RP11-566K11.4_ENST00000554623.1_RNA|MC1R_ENST00000555427.1_Missense_Mutation_p.M128T|TUBB3_ENST00000554444.1_5'Flank	NM_002386.3	NP_002377.4	Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)	128			M -> T (in CMM5; complete absence of functional coupling to the cAMP pathway; trafficked to the cell surface but unable to bind agonist efficiently). {ECO:0000269|PubMed:17434924}.		G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)	p.M128T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		TGCAGCTCCATGCTGTCCAGC	0.652									Melanoma, Familial Clustering of																																								1	Substitution - Missense(1)	kidney(1)	GRCh37	CM074336	MC1R	M		T	THR/MET	0,4392		0,0,2196	66.0	75.0	72.0		383	4.8	1.0	16		72	1,8597	1.2+/-3.3	0,1,4298	no	missense	MC1R	NM_002386.3	81	0,1,6494	CC,CT,TT		0.0116,0.0,0.0077		128/318	89986049	1,12989	2196	4299	6495	SO:0001583	missense	10381	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555147.1:c.383T>C	16.37:g.89986049T>C	ENSP00000451605:p.Met128Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	Missense_Mutation	SNP	ENST00000555147.1	37	CCDS56011.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041246	0.75732	0.0	1.16E-4	ENSG00000258947;ENSG00000258947;ENSG00000258839	ENST00000555427;ENST00000556922;ENST00000555147	T;T;T	0.18810	2.19;2.19;2.19	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.172626	0.28236	U	0.016098	T	0.22551	0.0544	L	0.49640	1.575	0.44142	D	0.996934	B	0.29162	0.235	B	0.33121	0.158	T	0.03463	-1.1034	9	.	.	.	.	13.5341	0.61638	0.0:0.0:0.0:1.0	.	128	Q01726	MSHR_HUMAN	T	128	ENSP00000451760:M128T;ENSP00000451560:M128T;ENSP00000451605:M128T	.	M	+	2	0	MC1R;RP11-566K11.2	88513550	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.956000	0.63645	1.812000	0.52913	0.374000	0.22700	ATG		0.652	MC1R-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412014.1		NM_002386	
TUSC5	286753	broad.mit.edu;ucsc.edu	37	17	1198861	1198861	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:1198861C>G	ENST00000333813.3	+	2	803	c.464C>G	c.(463-465)aCc>aGc	p.T155S		NM_172367.2	NP_758955.2	Q8IXB3	TUSC5_HUMAN	tumor suppressor candidate 5	155					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)		p.T155S(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|prostate(4)|skin(2)	15				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CTCAGCATTACCCTCATCATC	0.612																																																	1	Substitution - Missense(1)	kidney(1)											91.0	106.0	101.0					17																	1198861		2137	4242	6379	SO:0001583	missense	286753			AB090231	CCDS42225.1	17p13.3	2009-10-16			ENSG00000184811	ENSG00000184811			29592	protein-coding gene	gene with protein product	"""located at seventeen p thirteen point three 1"", ""interferon induced transmembrane protein domain containing 3"""	612211				12660825	Standard	NM_172367		Approved	LOST1, IFITMD3	uc002fsi.1	Q8IXB3	OTTHUMG00000132196	ENST00000333813.3:c.464C>G	17.37:g.1198861C>G	ENSP00000329548:p.Thr155Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A6NMK4	Missense_Mutation	SNP	ENST00000333813.3	37	CCDS42225.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543497	0.45280	.	.	ENSG00000184811	ENST00000333813	D	0.85861	-2.04	5.56	2.09	0.27110	.	0.580762	0.14766	U	0.299696	T	0.71804	0.3383	N	0.24115	0.695	0.28690	N	0.904656	B	0.17667	0.023	B	0.17433	0.018	T	0.63963	-0.6518	10	0.72032	D	0.01	-16.3901	3.1109	0.06357	0.0:0.48:0.2286:0.2915	.	155	Q8IXB3	TUSC5_HUMAN	S	155	ENSP00000329548:T155S	ENSP00000329548:T155S	T	+	2	0	TUSC5	1145611	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	2.028000	0.41088	0.690000	0.31570	0.609000	0.83330	ACC		0.612	TUSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255249.1		NM_172367	
USP24	23358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55619805	55619805	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:55619805T>G	ENST00000294383.6	-	15	1798	c.1799A>C	c.(1798-1800)gAa>gCa	p.E600A	USP24_ENST00000407756.1_Missense_Mutation_p.E456A	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	600					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.E600A(1)|p.E569A(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CTTAATATCTTCTATGCACTT	0.403																																																	2	Substitution - Missense(2)	kidney(2)											120.0	116.0	117.0					1																	55619805		1899	4132	6031	SO:0001583	missense	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.1799A>C	1.37:g.55619805T>G	ENSP00000294383:p.Glu600Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379620	0.61845	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	D;T	0.84730	-1.89;4.04	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.89511	0.6736	L	0.48642	1.525	0.54753	D	0.999982	P	0.52842	0.956	D	0.65010	0.931	D	0.89728	0.3924	10	0.54805	T	0.06	.	16.4696	0.84102	0.0:0.0:0.0:1.0	.	456	B7WPF4	.	A	600;456	ENSP00000294383:E600A;ENSP00000385700:E456A	ENSP00000294383:E600A	E	-	2	0	USP24	55392393	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.040000	0.89188	2.289000	0.77006	0.482000	0.46254	GAA		0.403	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			
VASP	7408	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	46024608	46024608	+	Silent	SNP	T	T	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr19:46024608T>G	ENST00000245932.6	+	4	728	c.372T>G	c.(370-372)ctT>ctG	p.L124L	VASP_ENST00000586619.1_Intron	NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	124	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)	p.L124L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		CCCCAGCACTTCCCACCTGGT	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											43.0	33.0	36.0					19																	46024608		2192	4289	6481	SO:0001819	synonymous_variant	7408				CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552		ENST00000245932.6:c.372T>G	19.37:g.46024608T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RBT9|Q6PIZ1|Q93035	Silent	SNP	ENST00000245932.6	37	CCDS33051.1																																																																																				0.652	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459589.1			
WFIKKN2	124857	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	48916926	48916926	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:48916926T>A	ENST00000311378.4	+	2	805	c.277T>A	c.(277-279)Tac>Aac	p.Y93N	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_5'UTR	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	93					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Y93N(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GGCGGCCCGCTACATGGACGT	0.582																																																	1	Substitution - Missense(1)	kidney(1)											50.0	51.0	51.0					17																	48916926		2203	4300	6503	SO:0001583	missense	124857			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.277T>A	17.37:g.48916926T>A	ENSP00000311184:p.Tyr93Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	37	CCDS11575.1	.	.	.	.	.	.	.	.	.	.	T	18.65	3.670186	0.67814	.	.	ENSG00000173714	ENST00000311378	T	0.81415	-1.49	5.53	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.82728	0.5100	L	0.54323	1.7	0.54753	D	0.999989	D	0.55605	0.972	P	0.55667	0.781	T	0.83351	-0.0003	10	0.52906	T	0.07	.	10.8818	0.46944	0.0:0.0734:0.0:0.9266	.	93	Q8TEU8	WFKN2_HUMAN	N	93	ENSP00000311184:Y93N	ENSP00000311184:Y93N	Y	+	1	0	WFIKKN2	46271925	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.217000	0.58547	2.096000	0.63516	0.524000	0.50904	TAC		0.582	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1		NM_175575	
Unknown	0	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	28244851	28244851	+	IGR	SNP	A	A	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr6:28244851A>C								NKAPL (16115 upstream) : PGBD1 (4462 downstream)																							CAGAGATATCACCACAAAGAC	0.428																																																	0													89.0	83.0	85.0					6																	28244851		1952	4180	6132	SO:0001628	intergenic_variant	0																															6.37:g.28244851A>C		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.428									
BAHCC1	57597	broad.mit.edu	37	17	79423404	79423404	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr17:79423404delA	ENST00000307745.7	+	20	4651	c.4651delA	c.(4651-4653)aagfs	p.K1551fs																								GCTGAAACCCAAGGTCAAGAG	0.657																																																	0													14.0	17.0	16.0					17																	79423404		1846	4048	5894	SO:0001589	frameshift_variant	57597																														ENST00000307745.7:c.4651delA	17.37:g.79423404delA	ENSP00000303486:p.Lys1551fs	Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000307745.7	37																																																																																					0.657	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				
C16orf89	146556	broad.mit.edu	37	16	5115948	5115948	+	5'UTR	SNP	C	C	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr16:5115948C>G	ENST00000315997.5	-	0	163				C16orf89_ENST00000472572.3_5'UTR|C16orf89_ENST00000350219.4_Missense_Mutation_p.G26R|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Missense_Mutation_p.G26R|C16orf89_ENST00000474471.3_5'UTR	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89							cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)	p.G26R(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						CGCTCAGCACCCTGAGCTCTG	0.667																																																	2	Substitution - Missense(2)	kidney(2)											19.0	23.0	22.0					16																	5115948		2068	4209	6277	SO:0001623	5_prime_UTR_variant	146556				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.-39G>C	16.37:g.5115948C>G		Somatic		WXS	Illumina GAIIx	Phase_I	B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	ENST00000315997.5	37	CCDS42116.2	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029982	0.35797	.	.	ENSG00000153446	ENST00000422873;ENST00000350219	T;T	0.37058	1.22;1.68	4.09	-8.18	0.01053	.	1.432200	0.05148	N	0.495444	T	0.20536	0.0494	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.21381	-1.0247	9	0.87932	D	0	-19.5325	0.6773	0.00869	0.3569:0.1355:0.266:0.2416	.	26	G3V0F0	.	R	26	ENSP00000390402:G26R;ENSP00000283478:G26R	ENSP00000283478:G26R	G	-	1	0	C16orf89	5055949	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.353000	0.00501	-3.119000	0.00239	0.650000	0.86243	GGT		0.667	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1		NM_152459	
DSPP	1834	broad.mit.edu	37	4	88537258	88537258	+	Silent	SNP	T	T	C	rs199966097		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr4:88537258T>C	ENST00000282478.7	+	4	3477	c.3444T>C	c.(3442-3444)agT>agC	p.S1148S	DSPP_ENST00000399271.1_Silent_p.S1148S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1148	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S1148S(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagtgaaagcagcg	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	63.0	57.0					4																	88537258		1566	2841	4407	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3444T>C	4.37:g.88537258T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																				0.562	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3		NM_014208	
KCNMA1	3778	broad.mit.edu	37	10	78709126	78709126	+	Splice_Site	SNP	T	T	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr10:78709126T>C	ENST00000286628.8	-	22	2484		c.e22-2		KCNMA1_ENST00000372440.1_Splice_Site|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000286627.5_Splice_Site|KCNMA1_ENST00000372443.1_Splice_Site|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000404857.1_Splice_Site|KCNMA1_ENST00000354353.5_Splice_Site|KCNMA1_ENST00000406533.3_Splice_Site|RP11-443A13.5_ENST00000600782.1_RNA|RP11-443A13.5_ENST00000608791.1_RNA|RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000404771.3_Splice_Site	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1						blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.?(2)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ACTTCGAGTCTACAACAGGGA	0.502																																																	2	Unknown(2)	kidney(2)											38.0	35.0	36.0					10																	78709126		2203	4300	6503	SO:0001630	splice_region_variant	3778			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2485-2A>G	10.37:g.78709126T>C		Somatic		WXS	Illumina GAIIx	Phase_I	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Splice_Site	SNP	ENST00000286628.8	37		.	.	.	.	.	.	.	.	.	.	T	18.57	3.653105	0.67472	.	.	ENSG00000156113	ENST00000372421;ENST00000372440;ENST00000372403;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000434208;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8337	0.78782	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNMA1	78379132	1.000000	0.71417	0.977000	0.42913	0.686000	0.39977	7.997000	0.88414	2.206000	0.71126	0.533000	0.62120	.		0.502	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3		NM_002247	Intron
LINC00928	283761	broad.mit.edu	37	15	90048926	90048927	+	lincRNA	INS	-	-	C	rs370464270		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr15:90048926_90048927insC	ENST00000561201.1	-	0	703_704					NR_027075.1				long intergenic non-protein coding RNA 928																		caggaagggatttttttttttt	0.47																																																	0																																												283761					15q26.1	2013-05-24			ENSG00000259218	ENSG00000259218		"""Long non-coding RNAs"""	27535	non-coding RNA	RNA, long non-coding							Standard	NR_027074		Approved				OTTHUMG00000172014		15.37:g.90048926_90048927insC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS	ENST00000561201.1	37																																																																																					0.470	LINC00928-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000416410.1			
Unknown	0	broad.mit.edu	37	9	69192740	69192740	+	IGR	SNP	A	A	G	rs62551649		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr9:69192740A>G								BX255923.3 (13282 upstream) : FOXD4L6 (6739 downstream)																							tcctaataccatgggctgatc	0.567																																																	0																																										SO:0001628	intergenic_variant	440896																															9.37:g.69192740A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.567									
PDE4B	5142	broad.mit.edu	37	1	66827366	66827366	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr1:66827366C>A	ENST00000329654.4	+	10	1097	c.910C>A	c.(910-912)Ctc>Atc	p.L304I	PDE4B_ENST00000480109.2_Missense_Mutation_p.L71I|PDE4B_ENST00000371045.5_Missense_Mutation_p.L132I|PDE4B_ENST00000423207.2_Missense_Mutation_p.L289I|PDE4B_ENST00000371049.3_Missense_Mutation_p.L304I	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	304					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.L304I(1)|p.L132I(1)|p.L289I(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	AAAGCAGCAGCTCATGACCCA	0.408																																																	3	Substitution - Missense(3)	kidney(3)											154.0	139.0	144.0					1																	66827366		2203	4300	6503	SO:0001583	missense	5142			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.910C>A	1.37:g.66827366C>A	ENSP00000332116:p.Leu304Ile	Somatic		WXS	Illumina GAIIx	Phase_I	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	CCDS632.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002196	0.35320	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000528771;ENST00000371045;ENST00000531025;ENST00000526197;ENST00000480109	T;T;T;T;T;T;T;T;T	0.69561	-0.4;-0.4;-0.4;-0.41;0.99;-0.12;0.99;0.99;-0.09	5.96	5.02	0.67125	.	0.206986	0.41823	D	0.000809	T	0.46034	0.1372	L	0.44542	1.39	0.50813	D	0.999892	B;B;B;B;B	0.25563	0.0;0.005;0.129;0.011;0.003	B;B;B;B;B	0.23018	0.001;0.02;0.043;0.009;0.009	T	0.38200	-0.9672	10	0.22706	T	0.39	.	17.2993	0.87177	0.0:0.8753:0.1247:0.0	.	71;289;174;294;304	A5YW33;Q07343-3;Q13945;Q59GM8;Q07343	.;.;.;.;PDE4B_HUMAN	I	304;304;304;289;85;132;85;85;71	ENSP00000332116:L304I;ENSP00000342637:L304I;ENSP00000360088:L304I;ENSP00000392947:L289I;ENSP00000431909:L85I;ENSP00000360084:L132I;ENSP00000437249:L85I;ENSP00000436104:L85I;ENSP00000432592:L71I	ENSP00000332116:L304I	L	+	1	0	PDE4B	66599954	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.925000	0.63425	2.827000	0.97445	0.655000	0.94253	CTC		0.408	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3		NM_002600	
SCAP	22937	broad.mit.edu	37	3	47461081	47461099	+	Frame_Shift_Del	DEL	AGCCAGGGCTCCCTCACCC	AGCCAGGGCTCCCTCACCC	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	AGCCAGGGCTCCCTCACCC	AGCCAGGGCTCCCTCACCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr3:47461081_47461099delAGCCAGGGCTCCCTCACCC	ENST00000265565.5	-	13	2071_2089	c.1659_1677delGGGTGAGGGAGCCCTGGCT	c.(1657-1677)ttgggtgagggagccctggctfs	p.LGEGALA553fs	SCAP_ENST00000545718.1_Frame_Shift_Del_p.LGEGALA161fs|SCAP_ENST00000441517.2_Frame_Shift_Del_p.LGEGALA298fs|SCAP_ENST00000465628.1_5'Flank	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	553					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CGGGCATGGGAGCCAGGGCTCCCTCACCCAATGGGCTCT	0.63																																					Pancreas(149;978 1908 29304 37806 46700)												0																																										SO:0001589	frameshift_variant	22937			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.1659_1677delGGGTGAGGGAGCCCTGGCT	3.37:g.47461081_47461099delAGCCAGGGCTCCCTCACCC	ENSP00000265565:p.Leu553fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N2E0|Q8WUA1	Frame_Shift_Del	DEL	ENST00000265565.5	37	CCDS2755.2																																																																																				0.630	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2		NM_012235	
SRGAP3	9901	broad.mit.edu	37	3	9068661	9068661	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr3:9068661G>A	ENST00000383836.3	-	13	1985	c.1558C>T	c.(1558-1560)Ccg>Tcg	p.P520S	SRGAP3_ENST00000360413.3_Missense_Mutation_p.P496S|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	520	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.P520S(1)	SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ACTACAAGCGGTATAGCTTGT	0.433			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	1	Substitution - Missense(1)	kidney(1)											129.0	126.0	127.0					3																	9068661		2203	4300	6503	SO:0001583	missense	9901			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1558C>T	3.37:g.9068661G>A	ENSP00000373347:p.Pro520Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807914	0.90623	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	D;T	0.82803	-1.65;-0.53	5.17	5.17	0.71159	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	D	0.94029	0.8087	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95724	0.8769	10	0.87932	D	0	.	18.2773	0.90087	0.0:0.0:1.0:0.0	.	496;520	O43295-2;O43295	.;SRGP2_HUMAN	S	520;496	ENSP00000373347:P520S;ENSP00000353587:P496S	ENSP00000353587:P496S	P	-	1	0	SRGAP3	9043661	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	9.553000	0.98118	2.413000	0.81919	0.655000	0.94253	CCG		0.433	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3			
MC1R	4157	broad.mit.edu	37	16	89986131	89986131	+	Missense_Mutation	SNP	C	C	G	rs374878766		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr16:89986131C>G	ENST00000555147.1	+	1	1845	c.465C>G	c.(463-465)atC>atG	p.I155M	RP11-566K11.7_ENST00000570217.1_RNA|TUBB3_ENST00000556922.1_Missense_Mutation_p.I155M|RP11-566K11.4_ENST00000554623.1_RNA|MC1R_ENST00000555427.1_Missense_Mutation_p.I155M|TUBB3_ENST00000554444.1_5'Flank	NM_002386.3	NP_002377.4	Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)	155			I -> T (associated with a risk for developing melanoma; dbSNP:rs1110400). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17434924, ECO:0000269|Ref.12}.		G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)	p.I155M(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		ACCACAGCATCGTGACCCTGC	0.647									Melanoma, Familial Clustering of																																								1	Substitution - Missense(1)	kidney(1)											59.0	64.0	62.0					16																	89986131		2197	4300	6497	SO:0001583	missense	10381	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555147.1:c.465C>G	16.37:g.89986131C>G	ENSP00000451605:p.Ile155Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	Missense_Mutation	SNP	ENST00000555147.1	37	CCDS56011.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695453	0.48202	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258839	ENST00000555427;ENST00000556922;ENST00000555147	T;T;T	0.20738	2.05;2.05;2.05	4.81	-4.36	0.03645	GPCR, rhodopsin-like superfamily (1);	0.547805	0.14789	U	0.298355	T	0.41419	0.1158	M	0.87547	2.89	0.37694	D	0.923941	D	0.64830	0.994	D	0.71870	0.975	T	0.51156	-0.8741	9	.	.	.	.	7.3114	0.26477	0.0:0.3996:0.1121:0.4883	.	155	Q01726	MSHR_HUMAN	M	155	ENSP00000451760:I155M;ENSP00000451560:I155M;ENSP00000451605:I155M	.	I	+	3	3	MC1R;RP11-566K11.2	88513632	0.627000	0.27129	0.516000	0.27786	0.256000	0.26092	-0.116000	0.10724	-0.794000	0.04468	-0.380000	0.06706	ATC		0.647	MC1R-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412014.1		NM_002386	
MIR7162	102466227	broad.mit.edu	37	15	62534753	62534753	+	RNA	DEL	T	T	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr15:62534753delT	ENST00000408214.1	-	0	83																											TTCCCATAACTTTTTTTTTTT	0.323																																																	0																																												0																															15.37:g.62534753delT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000408214.1	37																																																																																					0.323	AC126323.1-201	NOVEL	basic	miRNA	miRNA				
Unknown	0	broad.mit.edu	37	21	9769171	9769172	+	IGR	INS	-	-	TT	rs372482128|rs374740133		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b1923d68-1d1e-4b59-b643-09e2c5969efd	9929ec38-d099-46f7-bcb4-7f6262394788	g.chr21:9769171_9769172insTT								CR381670.1 (85899 upstream) : MIR3648 (56659 downstream)																							GAAATTGAATCATCAGTCTAGA	0.381																																																	0																																										SO:0001628	intergenic_variant	0																															21.37:g.9769171_9769172insTT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS		37																																																																																				0	0.381									
