#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
A1BG	1	broad.mit.edu	37	19	58863915	58863915	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:58863915A>T	ENST00000263100.3	-	4	408	c.347T>A	c.(346-348)tTg>tAg	p.L116*	A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	116	Ig-like V-type 2.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.L116*(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		GGGAGCAGGCAAGGACTCTGT	0.592																																																	1	Substitution - Nonsense(1)	kidney(1)											79.0	84.0	82.0					19																	58863915		2198	4292	6490	SO:0001587	stop_gained	1				CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.347T>A	19.37:g.58863915A>T	ENSP00000263100:p.Leu116*	Somatic		WXS	Illumina GAIIx	Phase_I	A8K052|Q68CK0|Q8IYJ6|Q96P39	Nonsense_Mutation	SNP	ENST00000263100.3	37	CCDS12976.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985765	0.93044	.	.	ENSG00000121410	ENST00000263100	.	.	.	3.39	3.39	0.38822	.	0.000000	0.36338	N	0.002650	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5008	0.33156	1.0:0.0:0.0:0.0	.	.	.	.	X	116	.	ENSP00000263100:L116X	L	-	2	0	A1BG	63555727	0.005000	0.15991	0.739000	0.30968	0.234000	0.25298	1.614000	0.36911	1.788000	0.52465	0.460000	0.39030	TTG		0.592	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1		NM_130786	
ANXA10	11199	broad.mit.edu;ucsc.edu	37	4	169085402	169085402	+	Silent	SNP	T	T	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr4:169085402T>C	ENST00000359299.3	+	5	549	c.363T>C	c.(361-363)aaT>aaC	p.N121N		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	121						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.N121N(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		CAAGAACAAATGGAGAAATTT	0.313																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	60.0	61.0					4																	169085402		2203	4300	6503	SO:0001819	synonymous_variant	11199			AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.363T>C	4.37:g.169085402T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q96IQ5|Q9UJV4	Silent	SNP	ENST00000359299.3	37	CCDS34096.1																																																																																				0.313	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364348.2		NM_007193	
ARHGAP23	57636	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	36619105	36619105	+	Missense_Mutation	SNP	G	G	A	rs530373399	byFrequency	TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:36619105G>A	ENST00000431231.2	+	4	340	c.272G>A	c.(271-273)cGc>cAc	p.R91H	ARHGAP23_ENST00000443378.1_5'UTR|ARHGAP23_ENST00000437668.3_Missense_Mutation_p.R91H	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	91	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)	p.R416H(1)		breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CCCCGGTACCGCCTGGAGCCC	0.627													G|||	22	0.00439297	0.0	0.0	5008	,	,		17851	0.0		0.0	False		,,,				2504	0.0225																1	Substitution - Missense(1)	kidney(1)											43.0	44.0	44.0					17																	36619105		692	1591	2283	SO:0001583	missense	57636			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.272G>A	17.37:g.36619105G>A	ENSP00000393539:p.Arg91His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080941	0.55753	.	.	ENSG00000225485	ENST00000437668;ENST00000431231	T;T	0.17528	2.27;2.65	5.17	2.9	0.33743	.	.	.	.	.	T	0.18299	0.0439	L	0.43923	1.385	0.80722	D	1	.	.	.	.	.	.	T	0.04454	-1.0950	7	0.54805	T	0.06	.	3.1391	0.06450	0.1955:0.0:0.5703:0.2342	.	.	.	.	H	91	ENSP00000394153:R91H;ENSP00000393539:R91H	ENSP00000393539:R91H	R	+	2	0	ARHGAP23	33872631	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.595000	0.46197	2.410000	0.81850	0.561000	0.74099	CGC		0.627	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1		XM_290799	
ATRX	546	broad.mit.edu	37	X	76777788	76777788	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:76777788G>T	ENST00000373344.5	-	32	7142	c.6928C>A	c.(6928-6930)Cct>Act	p.P2310T	ATRX_ENST00000395603.3_Missense_Mutation_p.P2272T|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2310					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.P2310T(2)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAATTGAAAGGAATATAAGGA	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	2	Substitution - Missense(2)	kidney(2)											111.0	106.0	108.0					X																	76777788		2203	4295	6498	SO:0001583	missense	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6928C>A	X.37:g.76777788G>T	ENSP00000362441:p.Pro2310Thr	Somatic		WXS	Illumina GAIIx	Phase_I	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305990	0.23736	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92348	-3.02;-3.02	5.65	5.65	0.86999	.	0.230277	0.37219	U	0.002186	D	0.94377	0.8192	L	0.48642	1.525	0.80722	D	1	D;B	0.76494	0.999;0.296	D;B	0.65323	0.934;0.066	D	0.94587	0.7784	10	0.59425	D	0.04	-6.8457	18.7615	0.91853	0.0:0.0:1.0:0.0	.	2272;2310	P46100-4;P46100	.;ATRX_HUMAN	T	2310;2272	ENSP00000362441:P2310T;ENSP00000378967:P2272T	ENSP00000362441:P2310T	P	-	1	0	ATRX	76664444	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.159000	0.77483	2.376000	0.81061	0.429000	0.28392	CCT		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2		NM_000489	
BCCIP	56647	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	127520153	127520153	+	Silent	SNP	T	T	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr10:127520153T>G	ENST00000278100.6	+	5	588	c.576T>G	c.(574-576)gcT>gcG	p.A192A	BCCIP_ENST00000368759.5_Silent_p.A192A|BCCIP_ENST00000429863.2_Silent_p.A162A|BCCIP_ENST00000299130.3_Silent_p.A192A	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	192	Interaction with CDKN1A.				cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)	p.A192A(2)		breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CACAGATCGCTCTGCCCATGT	0.388																																																	2	Substitution - coding silent(2)	kidney(2)											66.0	66.0	66.0					10																	127520153		2203	4300	6503	SO:0001819	synonymous_variant	56647			AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.576T>G	10.37:g.127520153T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KP45|Q8ND15|Q96GC4|Q9P288	Silent	SNP	ENST00000278100.6	37	CCDS7651.1																																																																																				0.388	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1			
MROH9	80133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	170914714	170914714	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:170914714C>T	ENST00000367758.3	+	2	116	c.17C>T	c.(16-18)cCa>cTa	p.P6L	MROH9_ENST00000367759.4_Missense_Mutation_p.P6L	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	6								p.P6L(2)									ACAAGGAATCCAAAAACAAGT	0.358																																																	2	Substitution - Missense(2)	kidney(2)											123.0	109.0	114.0					1																	170914714		1875	4105	5980	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.17C>T	1.37:g.170914714C>T	ENSP00000356732:p.Pro6Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	C	6.822	0.520756	0.13005	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.14640	4.13;2.49	2.59	-5.19	0.02832	.	.	.	.	.	T	0.01592	0.0051	N	0.19112	0.55	0.09310	N	1	B;B	0.29552	0.103;0.248	B;B	0.16289	0.015;0.015	T	0.38373	-0.9664	9	0.62326	D	0.03	.	1.6181	0.02708	0.1991:0.3976:0.2499:0.1533	.	6;6	F5GWX6;Q5TGP6	.;CA129_HUMAN	L	6	ENSP00000356733:P6L;ENSP00000356732:P6L	ENSP00000356732:P6L	P	+	2	0	C1orf129	169181338	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.369000	0.02578	-1.623000	0.01558	-0.457000	0.05445	CCA		0.358	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1		NM_025063	
KANSL1L	151050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	210889861	210889861	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr2:210889861C>T	ENST00000281772.9	-	13	2794	c.2531G>A	c.(2530-2532)tGg>tAg	p.W844*	KANSL1L_ENST00000418791.1_Nonsense_Mutation_p.W802*	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	844						histone acetyltransferase complex (GO:0000123)		p.W844*(1)									GCTTTGCTCCCATAGTGACCA	0.398																																																	1	Substitution - Nonsense(1)	kidney(1)											137.0	134.0	135.0					2																	210889861		2203	4300	6503	SO:0001587	stop_gained	0			AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2531G>A	2.37:g.210889861C>T	ENSP00000281772:p.Trp844*	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Nonsense_Mutation	SNP	ENST00000281772.9	37	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	C	39	7.828181	0.98513	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	.	.	.	5.3	5.3	0.74995	.	0.193233	0.37530	N	0.002042	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9274	0.92550	0.0:1.0:0.0:0.0	.	.	.	.	X	844;802	.	ENSP00000281772:W844X	W	-	2	0	C2orf67	210598106	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	5.634000	0.67833	2.636000	0.89361	0.591000	0.81541	TGG		0.398	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3		NM_152519	
CEP95	90799	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	62512882	62512882	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:62512882C>A	ENST00000556440.2	+	5	919	c.409C>A	c.(409-411)Cgt>Agt	p.R137S	CEP95_ENST00000553412.1_Intron	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	137						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)		p.R137S(2)		endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						TCGAGGAGAACGTTTGGAAGA	0.343																																																	2	Substitution - Missense(2)	kidney(2)											126.0	117.0	120.0					17																	62512882		1820	4072	5892	SO:0001583	missense	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.409C>A	17.37:g.62512882C>A	ENSP00000450461:p.Arg137Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	37	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	C	0.063	-1.219178	0.01542	.	.	ENSG00000258890	ENST00000556440	T	0.29142	1.58	5.1	3.06	0.35304	.	1.293660	0.04839	N	0.440181	T	0.21227	0.0511	N	0.22421	0.69	0.09310	N	0.999998	B	0.12013	0.005	B	0.17722	0.019	T	0.24297	-1.0164	10	0.08599	T	0.76	0.1432	8.7177	0.34421	0.1707:0.6648:0.1645:0.0	.	137	Q96GE4	CEP95_HUMAN	S	137	ENSP00000450461:R137S	ENSP00000437744:R137S	R	+	1	0	CEP95	59943344	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	0.611000	0.24268	0.819000	0.34492	-0.188000	0.12872	CGT		0.343	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2		NM_138363	
CCL27	10850	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	34662409	34662409	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr9:34662409G>T	ENST00000259631.4	-	2	133	c.75C>A	c.(73-75)ttC>ttA	p.F25L	CCL27_ENST00000557161.1_5'UTR|RP11-195F19.30_ENST00000564224.1_RNA	NM_006664.2	NP_006655.1	Q9Y4X3	CCL27_HUMAN	chemokine (C-C motif) ligand 27	25					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.F25L(1)		kidney(1)|large_intestine(3)|ovary(1)	5	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GTGGCAGTAGGAATGCTAGGG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											63.0	55.0	57.0					9																	34662409		2203	4300	6503	SO:0001583	missense	10850			AJ243542	CCDS6569.1	9p13	2014-05-16	2002-08-22	2002-08-23	ENSG00000213927	ENSG00000213927		"""Chemokine ligands"", ""Endogenous ligands"""	10626	protein-coding gene	gene with protein product	"""CC chemokine ILC"", ""IL-11 Ralpha-locus chemokine"", ""cutaneous T-cell attracting chemokine"""	604833	"""small inducible cytokine subfamily A (Cys-Cys), member 27"""	SCYA27		10556532, 10588729	Standard	NM_006664		Approved	ALP, ILC, CTACK, skinkine, ESkine, PESKY, CTAK	uc003zvm.1	Q9Y4X3	OTTHUMG00000019834	ENST00000259631.4:c.75C>A	9.37:g.34662409G>T	ENSP00000259631:p.Phe25Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000259631.4	37	CCDS6569.1	.	.	.	.	.	.	.	.	.	.	G	4.377	0.069544	0.08436	.	.	ENSG00000213927	ENST00000259631	T	0.24538	1.85	5.09	-0.189	0.13260	Chemokine interleukin-8-like domain (1);	1.068640	0.07437	N	0.896656	T	0.07188	0.0182	N	0.02247	-0.625	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34279	-0.9835	10	0.02654	T	1	1.0906	2.5145	0.04665	0.1365:0.4227:0.2752:0.1656	.	25	Q9Y4X3	CCL27_HUMAN	L	25	ENSP00000259631:F25L	ENSP00000259631:F25L	F	-	3	2	CCL27	34652409	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.210000	0.09345	0.006000	0.14734	-0.265000	0.10407	TTC		0.547	CCL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052228.1		NM_006664	
CDC7	8317	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	91978791	91978791	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:91978791C>T	ENST00000428239.1	+	7	1008	c.749C>T	c.(748-750)tCc>tTc	p.S250F	CDC7_ENST00000234626.6_Missense_Mutation_p.S250F|CDC7_ENST00000430031.2_Missense_Mutation_p.S222F	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	250	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S250F(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		GATCAGCAGTCCACCACAAAA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											87.0	90.0	89.0					1																	91978791		2203	4300	6503	SO:0001583	missense	8317			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.749C>T	1.37:g.91978791C>T	ENSP00000393139:p.Ser250Phe	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	C	6.183	0.401964	0.11696	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.52526	0.66;0.82;0.82	5.79	2.86	0.33363	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.878152	0.10226	N	0.700316	T	0.15739	0.0379	L	0.28556	0.865	0.09310	N	1	P;P	0.35383	0.498;0.498	B;B	0.32342	0.133;0.144	T	0.12167	-1.0558	10	0.44086	T	0.13	-14.3994	8.4587	0.32915	0.0:0.513:0.3555:0.1315	.	222;250	B7Z5H7;O00311	.;CDC7_HUMAN	F	222;250;250	ENSP00000407477:S222F;ENSP00000234626:S250F;ENSP00000393139:S250F	ENSP00000234626:S250F	S	+	2	0	CDC7	91751379	0.155000	0.22806	0.013000	0.15412	0.950000	0.60333	0.743000	0.26231	0.335000	0.23614	0.557000	0.71058	TCC		0.408	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1		NM_003503	
CHMP7	91782	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	23116262	23116262	+	Silent	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr8:23116262G>A	ENST00000397677.1	+	8	1626	c.978G>A	c.(976-978)caG>caA	p.Q326Q	CHMP7_ENST00000520102.1_3'UTR|CHMP7_ENST00000313219.7_Silent_p.Q326Q	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	326					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)	p.Q326Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		ACGCCTACCAGGCTGGGGTAG	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	52.0	52.0					8																	23116262		2203	4300	6503	SO:0001819	synonymous_variant	91782			BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.978G>A	8.37:g.23116262G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Silent	SNP	ENST00000397677.1	37	CCDS6040.1																																																																																				0.468	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254717.1		NM_152272	
CPEB1	64506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	83221251	83221251	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr15:83221251G>C	ENST00000562019.1	-	8	1510	c.1194C>G	c.(1192-1194)agC>agG	p.S398R	CPEB1_ENST00000423133.2_Missense_Mutation_p.S318R|CPEB1_ENST00000398592.2_Missense_Mutation_p.S167R|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000568757.1_Missense_Mutation_p.S318R|CPEB1_ENST00000261723.6_Missense_Mutation_p.S396R|CPEB1_ENST00000398591.2_Missense_Mutation_p.S323R|CPEB1_ENST00000564522.1_Missense_Mutation_p.S318R|CPEB1_ENST00000568128.1_Missense_Mutation_p.S393R|CPEB1_ENST00000450751.2_Missense_Mutation_p.S318R|RP11-152F13.10_ENST00000562833.1_Missense_Mutation_p.A128G|CPEB1_ENST00000563800.1_Missense_Mutation_p.S420R			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	398	Necessary for stress granule assembly and correct localization in dcp1 bodies.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.S323R(1)|p.S393R(1)		breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			GCATCCTTCGGCTGGACATCT	0.498																																																	2	Substitution - Missense(2)	kidney(2)											71.0	71.0	71.0					15																	83221251		2108	4241	6349	SO:0001583	missense	64506			AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.1194C>G	15.37:g.83221251G>C	ENSP00000457836:p.Ser398Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	ENST00000562019.1	37		.	.	.	.	.	.	.	.	.	.	G	21.3	4.133652	0.77662	.	.	ENSG00000214575	ENST00000450751;ENST00000398593;ENST00000423133;ENST00000398591;ENST00000261723;ENST00000398592	T;T;T;T;T	0.23754	3.35;1.89;1.89;1.89;1.89	5.84	3.95	0.45737	RNA recognition motif domain (1);	0.000000	0.85682	U	0.000000	T	0.51483	0.1677	M	0.86178	2.8	0.58432	D	0.999998	D;D;P;D	0.89917	1.0;1.0;0.875;1.0	D;D;P;D	0.87578	0.997;0.998;0.8;0.998	T	0.54675	-0.8258	10	0.66056	D	0.02	-11.8158	10.3161	0.43738	0.1868:0.0:0.8132:0.0	.	396;393;398;393	B7Z237;Q9BZB8-3;Q9BZB8;E7ET70	.;.;CPEB1_HUMAN;.	R	393;393;318;323;396;167	ENSP00000414187:S393R;ENSP00000397526:S318R;ENSP00000381591:S323R;ENSP00000261723:S396R;ENSP00000381592:S167R	ENSP00000261723:S396R	S	-	3	2	CPEB1	81018306	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.334000	0.43920	2.769000	0.95229	0.563000	0.77884	AGC		0.498	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000421102.1		NM_030594	
CPXM2	119587	broad.mit.edu	37	10	125651046	125651046	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr10:125651046C>T	ENST00000241305.3	-	1	284	c.130G>A	c.(130-132)Gag>Aag	p.E44K	CPXM2_ENST00000368854.3_Intron	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	44					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.E44K(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		TAGTAGGGCTCCCGGCTCCAG	0.736																																																	1	Substitution - Missense(1)	kidney(1)											8.0	11.0	10.0					10																	125651046		1954	3800	5754	SO:0001583	missense	119587			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.130G>A	10.37:g.125651046C>T	ENSP00000241305:p.Glu44Lys	Somatic		WXS	Illumina GAIIx	Phase_I	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	37	CCDS7637.1	.	.	.	.	.	.	.	.	.	.	c	9.706	1.155850	0.21454	.	.	ENSG00000121898	ENST00000241305;ENST00000418782	D	0.96334	-3.98	3.51	3.51	0.40186	.	2.162200	0.03114	N	0.162896	D	0.91556	0.7333	N	0.08118	0	0.37877	D	0.930247	B	0.18461	0.028	B	0.17098	0.017	T	0.77422	-0.2594	10	0.39692	T	0.17	-11.532	10.4272	0.44385	0.0:1.0:0.0:0.0	.	44	Q8N436	CPXM2_HUMAN	K	44	ENSP00000241305:E44K	ENSP00000241305:E44K	E	-	1	0	CPXM2	125641036	0.928000	0.31464	0.430000	0.26722	0.188000	0.23474	1.852000	0.39348	1.795000	0.52594	0.298000	0.19748	GAG		0.736	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1		NM_198148	
CROCCP2	84809	broad.mit.edu	37	1	16944979	16944981	+	lincRNA	DEL	AAG	AAG	-	rs66601805|rs67064896|rs142983965	byFrequency	TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:16944979_16944981delAAG	ENST00000412962.1	-	0	2538_2540				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GGATGGATAAAAGAagagcctct	0.369														946	0.188898	0.2186	0.2882	5008	,	,		72022	0.0298		0.2147	False		,,,				2504	0.2157																0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16944982_16944984delAAG		Somatic		WXS	Illumina GAIIx	Phase_I	Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	ENST00000412962.1	37																																																																																					0.369	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000092784.1		NR_026752.1	
YBX3	8531	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	10865871	10865871	+	Missense_Mutation	SNP	G	G	A	rs371143914		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr12:10865871G>A	ENST00000228251.4	-	5	712	c.512C>T	c.(511-513)gCt>gTt	p.A171V	YBX3_ENST00000279550.7_Missense_Mutation_p.A171V	NM_003651.4	NP_003642.3	P16989	YBOX3_HUMAN	Y box binding protein 3	171					3'-UTR-mediated mRNA stabilization (GO:0070935)|cellular hyperosmotic response (GO:0071474)|cellular response to tumor necrosis factor (GO:0071356)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of necroptotic process (GO:0060546)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoplasmic translation (GO:2000767)|positive regulation of organ growth (GO:0046622)|response to cold (GO:0009409)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|tight junction (GO:0005923)	double-stranded DNA binding (GO:0003690)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|Rho GTPase binding (GO:0017048)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.A171V(1)									CCGATCTGCAGCGTAACGACT	0.502																																																	1	Substitution - Missense(1)	kidney(1)						G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	92.0	100.0	97.0		512,512	5.5	1.0	12		97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CSDA	NM_001145426.1,NM_003651.4	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	171/304,171/373	10865871	1,13005	2203	4300	6503	SO:0001583	missense	8531			L29064	CCDS8630.1, CCDS44831.1	12p13.1	2013-03-13	2013-03-13	2013-03-13	ENSG00000060138	ENSG00000060138			2428	protein-coding gene	gene with protein product	"""cold-shock domain containing A1"""	603437	"""cold shock domain protein A"""	CSDA		2977358, 8710501	Standard	NM_003651		Approved	dbpA, ZONAB, CSDA1	uc001qyt.3	P16989	OTTHUMG00000168409	ENST00000228251.4:c.512C>T	12.37:g.10865871G>A	ENSP00000228251:p.Ala171Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBW6|Q14121|Q969N6|Q96B76	Missense_Mutation	SNP	ENST00000228251.4	37	CCDS8630.1	.	.	.	.	.	.	.	.	.	.	G	36	5.756857	0.96898	0.0	1.16E-4	ENSG00000060138	ENST00000279550;ENST00000228251	T;T	0.35048	1.37;1.33	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000003	T	0.66366	0.2782	M	0.86573	2.825	0.58432	D	0.99999	D;D	0.89917	0.999;1.0	D;D	0.87578	0.973;0.998	T	0.72418	-0.4300	10	0.87932	D	0	.	16.8488	0.85988	0.0:0.0:1.0:0.0	.	171;171	P16989-2;P16989	.;DBPA_HUMAN	V	171	ENSP00000279550:A171V;ENSP00000228251:A171V	ENSP00000228251:A171V	A	-	2	0	CSDA	10757138	1.000000	0.71417	0.989000	0.46669	0.987000	0.75469	8.331000	0.90022	2.569000	0.86673	0.491000	0.48974	GCT		0.502	YBX3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399628.1		NM_003651	
CSNK1G3	1456	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	122923847	122923847	+	Splice_Site	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr5:122923847G>T	ENST00000361991.2	+	6	789	c.759G>T	c.(757-759)aaG>aaT	p.K253N	CSNK1G3_ENST00000511130.2_Splice_Site_p.K140N|CSNK1G3_ENST00000360683.2_Splice_Site_p.K253N|CSNK1G3_ENST00000345990.4_Splice_Site_p.K253N|CSNK1G3_ENST00000395411.1_Splice_Site_p.K253N|CSNK1G3_ENST00000521364.1_Splice_Site_p.K253N|CSNK1G3_ENST00000510842.2_Splice_Site_p.K253N|CSNK1G3_ENST00000512718.3_Splice_Site_p.K178N|CSNK1G3_ENST00000395412.1_Splice_Site_p.K253N			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K253N(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		AAGGCTTAAAGGTAATTGTTT	0.284																																					Pancreas(187;2868 2964 4353 6297)												1	Substitution - Missense(1)	kidney(1)											120.0	122.0	122.0					5																	122923847		2203	4300	6503	SO:0001630	splice_region_variant	1456			AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.759+1G>T	5.37:g.122923847G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Missense_Mutation	SNP	ENST00000361991.2	37	CCDS4135.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798780	0.90538	.	.	ENSG00000151292	ENST00000395412;ENST00000395411;ENST00000345990;ENST00000511130;ENST00000512718;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	T;T;T;T;T;T;T;T;T	0.10099	2.91;2.91;2.91;2.91;2.91;2.91;2.91;2.91;2.91	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.38374	0.1038	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D	0.71674	0.99;0.998;0.997;0.997;0.998;0.997	D;D;D;D;D;D	0.74674	0.972;0.984;0.984;0.936;0.984;0.972	T	0.29701	-1.0003	10	0.87932	D	0	.	18.9125	0.92491	0.0:0.0:1.0:0.0	.	178;253;140;253;253;253	B4DSH2;A8K040;E7EVD0;Q9Y6M4-3;Q9Y6M4;Q9Y6M4-2	.;.;.;.;KC1G3_HUMAN;.	N	253;253;253;140;178;253;253;253;253	ENSP00000378807:K253N;ENSP00000378806:K253N;ENSP00000334735:K253N;ENSP00000421385:K140N;ENSP00000421998:K178N;ENSP00000429412:K253N;ENSP00000423838:K253N;ENSP00000354942:K253N;ENSP00000353904:K253N	ENSP00000334735:K253N	K	+	3	2	CSNK1G3	122951746	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.626000	0.83164	2.723000	0.93209	0.650000	0.86243	AAG		0.284	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250900.1		NM_004384	Missense_Mutation
DENND2A	27147	broad.mit.edu	37	7	140301430	140301430	+	Silent	SNP	A	A	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr7:140301430A>C	ENST00000275884.6	-	2	1185	c.768T>G	c.(766-768)ggT>ggG	p.G256G	DENND2A_ENST00000537639.1_Silent_p.G256G|DENND2A_ENST00000496613.1_Silent_p.G256G|DENND2A_ENST00000492720.1_Silent_p.G256G			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	256					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.G256G(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TTGTGGGGGAACCCTCCGAGC	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											114.0	120.0	118.0					7																	140301430		1896	4112	6008	SO:0001819	synonymous_variant	27147			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.768T>G	7.37:g.140301430A>C		Somatic		WXS	Illumina GAIIx	Phase_I	C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	37	CCDS43659.1																																																																																				0.587	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1		NM_015689	
DNAH9	1770	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	11583161	11583161	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:11583161G>T	ENST00000262442.4	+	18	3509	c.3441G>T	c.(3439-3441)gaG>gaT	p.E1147D	DNAH9_ENST00000454412.2_Missense_Mutation_p.E1147D	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1147	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E1147D(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCTTGGTTGAGATCATGGGAC	0.423																																																	1	Substitution - Missense(1)	kidney(1)											155.0	150.0	152.0					17																	11583161		2203	4300	6503	SO:0001583	missense	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3441G>T	17.37:g.11583161G>T	ENSP00000262442:p.Glu1147Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	6.598	0.478621	0.12521	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.23348	1.91;1.91	5.55	-1.74	0.08056	.	0.318723	0.31199	N	0.008078	T	0.14442	0.0349	L	0.48218	1.51	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.13202	-1.0518	10	0.15066	T	0.55	.	3.2653	0.06863	0.3115:0.1027:0.4809:0.105	.	1147	Q9NYC9	DYH9_HUMAN	D	1147	ENSP00000262442:E1147D;ENSP00000414874:E1147D	ENSP00000262442:E1147D	E	+	3	2	DNAH9	11523886	1.000000	0.71417	0.976000	0.42696	0.235000	0.25334	1.235000	0.32671	0.033000	0.15463	0.555000	0.69702	GAG		0.423	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2		NM_001372	
EPM2A	7957	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	145948647	145948647	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr6:145948647G>T	ENST00000367519.3	-	4	1426	c.901C>A	c.(901-903)Ccg>Acg	p.P301T		NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	301	Tyrosine-protein phosphatase.		P -> L (in EPM2; loss of phosphatase activity; affects glycogen binding; disrupts the interaction with PPP1R3C). {ECO:0000269|PubMed:11175283}.		autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)	p.P301T(1)		kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		TAGACAGCCGGCCTCTTGGCC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											68.0	72.0	70.0					6																	145948647		2203	4300	6503	SO:0001583	missense	7957			AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.901C>A	6.37:g.145948647G>T	ENSP00000356489:p.Pro301Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Missense_Mutation	SNP	ENST00000367519.3	37	CCDS5206.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030958	0.54790	.	.	ENSG00000112425	ENST00000367519;ENST00000392304;ENST00000324857	T	0.65178	-0.14	6.04	4.27	0.50696	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (1);	0.092556	0.85682	N	0.000000	T	0.72755	0.3500	M	0.88241	2.94	0.48571	D	0.999675	D;D;D	0.76494	0.999;0.999;0.983	D;D;D	0.72075	0.976;0.959;0.946	T	0.76767	-0.2838	10	0.72032	D	0.01	-24.6988	7.8044	0.29193	0.0643:0.1196:0.6919:0.1242	.	301;301;163	O95278;O95278-2;E1P599	EPM2A_HUMAN;.;.	T	301	ENSP00000356489:P301T	ENSP00000320279:P301T	P	-	1	0	EPM2A	145990340	1.000000	0.71417	0.699000	0.30290	0.449000	0.32228	4.160000	0.58164	0.888000	0.36160	0.563000	0.77884	CCG		0.567	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042564.1			
ERCC3	2071	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	128036918	128036918	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr2:128036918C>A	ENST00000285398.2	-	10	1655	c.1561G>T	c.(1561-1563)Gaa>Taa	p.E521*	ERCC3_ENST00000493187.2_Nonsense_Mutation_p.E457*	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	521					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)	p.E521*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		GCCACATATTCCCGGTAAAAT	0.388			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	1	Substitution - Nonsense(1)	kidney(1)											104.0	93.0	97.0					2																	128036918		2203	4300	6503	SO:0001587	stop_gained	2071	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.1561G>T	2.37:g.128036918C>A	ENSP00000285398:p.Glu521*	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QM0	Nonsense_Mutation	SNP	ENST00000285398.2	37	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	C	43	9.870662	0.99284	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-32.2829	18.6656	0.91489	0.0:1.0:0.0:0.0	.	.	.	.	X	521;457	.	ENSP00000285398:E521X	E	-	1	0	ERCC3	127753388	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.560000	0.82277	2.643000	0.89663	0.591000	0.81541	GAA		0.388	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1		NM_000122	
ERCC6L	54821	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	71426172	71426172	+	Silent	SNP	T	T	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:71426172T>A	ENST00000334463.3	-	2	2580	c.2445A>T	c.(2443-2445)ccA>ccT	p.P815P	ERCC6L_ENST00000373657.1_Silent_p.P692P|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	815					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.P815P(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					CAAACCCCTTTGGTAAAGTAG	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											95.0	87.0	90.0					X																	71426172		2203	4300	6503	SO:0001819	synonymous_variant	54821			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2445A>T	X.37:g.71426172T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	37	CCDS35329.1																																																																																				0.383	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2		NM_017669	
EXOC7	23265	broad.mit.edu	37	17	74093949	74093949	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:74093949G>A	ENST00000335146.7	-	5	621	c.568C>T	c.(568-570)Cac>Tac	p.H190Y	EXOC7_ENST00000467929.2_Missense_Mutation_p.H149Y|EXOC7_ENST00000607838.1_Missense_Mutation_p.H190Y|EXOC7_ENST00000411744.2_Missense_Mutation_p.H190Y|EXOC7_ENST00000405575.4_Missense_Mutation_p.H190Y|EXOC7_ENST00000332065.5_Missense_Mutation_p.H190Y|EXOC7_ENST00000589210.1_Missense_Mutation_p.H190Y			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	190					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)		p.H190Y(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			TCGGGCAGGTGCTCCAGGGTC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											103.0	86.0	92.0					17																	74093949		2203	4300	6503	SO:0001583	missense	23265			BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.568C>T	17.37:g.74093949G>A	ENSP00000334100:p.His190Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	37	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849538	0.91277	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744;ENST00000405068;ENST00000420116	.	.	.	4.99	4.99	0.66335	Cullin repeat-like-containing domain (1);	0.155915	0.56097	D	0.000022	T	0.60090	0.2242	L	0.46157	1.445	0.80722	D	1	P;P;P;P;P;P;P;P	0.52170	0.94;0.928;0.682;0.816;0.922;0.93;0.951;0.928	P;P;B;B;B;P;B;P	0.48770	0.568;0.589;0.187;0.444;0.413;0.486;0.409;0.465	T	0.63554	-0.6611	9	0.56958	D	0.05	-24.3945	16.636	0.85060	0.0:0.0:1.0:0.0	.	190;190;149;149;190;190;190;190	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5-4;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;.;EXOC7_HUMAN;.;.	Y	190;110;190;190;190;149;190;190;75	.	ENSP00000333806:H190Y	H	-	1	0	EXOC7	71605544	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.167000	0.94773	2.598000	0.87819	0.563000	0.77884	CAC		0.597	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2		NM_015219	
FAM57B	83723	broad.mit.edu	37	16	30036624	30036624	+	Silent	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr16:30036624G>A	ENST00000380495.4	-	5	1436	c.705C>T	c.(703-705)aaC>aaT	p.N235N	FAM57B_ENST00000564806.1_3'UTR|FAM57B_ENST00000279389.4_Silent_p.N185N	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	235	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)	p.N235N(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CAGCGCCCAGGTTGACGTGGG	0.726																																																	1	Substitution - coding silent(1)	kidney(1)											30.0	29.0	29.0					16																	30036624		2153	4247	6400	SO:0001819	synonymous_variant	83723			AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.705C>T	16.37:g.30036624G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q9H0J1	Silent	SNP	ENST00000380495.4	37	CCDS10667.2	.	.	.	.	.	.	.	.	.	.	G	9.151	1.016273	0.19355	.	.	ENSG00000149926	ENST00000279389	.	.	.	4.78	3.83	0.44106	.	.	.	.	.	T	0.62684	0.2448	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60301	-0.7290	4	.	.	.	-4.7299	11.8776	0.52556	0.0877:0.0:0.9123:0.0	.	.	.	.	I	202	.	.	T	-	2	0	FAM57B	29944125	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.340000	0.65958	0.996000	0.38943	0.561000	0.74099	ACC		0.726	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255142.2		NM_031478	
FAM71C	196472	broad.mit.edu;ucsc.edu	37	12	100042248	100042248	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr12:100042248G>C	ENST00000324341.1	+	1	718	c.296G>C	c.(295-297)aGg>aCg	p.R99T	ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000329257.7_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	99								p.R99T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		GACAATGCCAGGTGTGGTCCT	0.537																																																	1	Substitution - Missense(1)	kidney(1)											82.0	80.0	81.0					12																	100042248		2203	4300	6503	SO:0001583	missense	196472				CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.296G>C	12.37:g.100042248G>C	ENSP00000315247:p.Arg99Thr	Somatic		WXS	Illumina GAIIx	Phase_I	B2R6Y6	Missense_Mutation	SNP	ENST00000324341.1	37	CCDS9072.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.686528	0.00738	.	.	ENSG00000180219	ENST00000324341	T	0.10099	2.91	3.88	1.02	0.19986	.	2.146400	0.02543	N	0.094859	T	0.09512	0.0234	L	0.36672	1.1	0.09310	N	1	B	0.18166	0.026	B	0.16289	0.015	T	0.30765	-0.9967	9	.	.	.	0.0	3.9814	0.09497	0.2398:0.2371:0.5231:0.0	.	99	Q8NEG0	FA71C_HUMAN	T	99	ENSP00000315247:R99T	.	R	+	2	0	FAM71C	98566379	0.001000	0.12720	0.000000	0.03702	0.028000	0.11728	0.403000	0.20982	0.211000	0.20683	0.555000	0.69702	AGG		0.537	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1		NM_153364	
FN1	2335	broad.mit.edu;ucsc.edu	37	2	216274775	216274775	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr2:216274775G>C	ENST00000359671.1	-	14	2269	c.2004C>G	c.(2002-2004)atC>atG	p.I668M	FN1_ENST00000346544.3_Missense_Mutation_p.I668M|FN1_ENST00000357009.2_Missense_Mutation_p.I668M|FN1_ENST00000345488.5_Missense_Mutation_p.I668M|FN1_ENST00000357867.4_Missense_Mutation_p.I668M|FN1_ENST00000446046.1_Missense_Mutation_p.I668M|FN1_ENST00000443816.1_Missense_Mutation_p.I668M|FN1_ENST00000356005.4_Missense_Mutation_p.I668M|FN1_ENST00000354785.4_Missense_Mutation_p.I668M|FN1_ENST00000421182.1_Missense_Mutation_p.I668M|FN1_ENST00000323926.6_Missense_Mutation_p.I668M|FN1_ENST00000432072.2_Missense_Mutation_p.I668M|FN1_ENST00000336916.4_Missense_Mutation_p.I668M			P02751	FINC_HUMAN	fibronectin 1	668	Fibronectin type-III 1.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.I668M(2)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TCAGGCCTTTGATGGTGTAGG	0.488																																																	2	Substitution - Missense(2)	kidney(2)											178.0	169.0	172.0					2																	216274775		2203	4300	6503	SO:0001583	missense	2335				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2004C>G	2.37:g.216274775G>C	ENSP00000352696:p.Ile668Met	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	18.91	3.724634	0.68959	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23	5.65	3.74	0.42951	.	0.000000	0.64402	D	0.000001	T	0.71324	0.3326	M	0.62723	1.935	0.80722	D	1	D;D;P;D;D;D;D;D;D;D	0.76494	0.982;0.999;0.888;0.997;0.998;0.998;0.992;0.997;0.997;0.983	D;D;P;D;D;D;D;D;D;D	0.97110	0.996;1.0;0.899;0.999;1.0;1.0;0.998;0.999;0.999;0.997	T	0.72802	-0.4183	10	0.87932	D	0	.	11.8622	0.52471	0.149:0.0:0.851:0.0	.	668;668;668;668;668;668;668;668;668;668	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	M	668	ENSP00000394423:I668M;ENSP00000323534:I668M;ENSP00000338200:I668M;ENSP00000350534:I668M;ENSP00000346839:I668M;ENSP00000352696:I668M;ENSP00000265312:I668M;ENSP00000273049:I668M;ENSP00000349509:I668M;ENSP00000410422:I668M;ENSP00000415018:I668M;ENSP00000399538:I668M;ENSP00000348285:I668M	ENSP00000265313:I668M	I	-	3	3	FN1	215983020	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.654000	0.46699	0.755000	0.32990	0.655000	0.94253	ATC		0.488	FN1-204	KNOWN	basic	protein_coding	protein_coding			NM_212476	
FRAS1	80144	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	79420893	79420893	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr4:79420893A>C	ENST00000264895.6	+	61	9574	c.9134A>C	c.(9133-9135)gAa>gCa	p.E3045A		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3041	Calx-beta 5.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.E3045A(1)|p.E3046A(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ATTGAGTTTGAAGAAGCTGCA	0.483																																																	2	Substitution - Missense(2)	kidney(2)											119.0	115.0	116.0					4																	79420893		1889	4128	6017	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9134A>C	4.37:g.79420893A>C	ENSP00000264895:p.Glu3045Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.62|13.62	2.291133|2.291133	0.40494|0.40494	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.35421|.	1.31|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.71065|.	0.3296|.	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.97110|.	0.995;1.0|.	T|.	0.69018|.	-0.5256|.	10|.	0.42905|.	T|.	0.14|.	.|.	16.3513|16.3513	0.83213|0.83213	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3044;3045|.	Q86XX4-2;E9PHH6|.	.;.|.	A|C	3045|1273	ENSP00000264895:E3045A|.	ENSP00000264895:E3045A|.	E|X	+|+	2|3	0|0	FRAS1|FRAS1	79639917|79639917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.267000|0.267000	0.26476|0.26476	9.202000|9.202000	0.95026|0.95026	2.252000|2.252000	0.74401|0.74401	0.533000|0.533000	0.62120|0.62120	GAA|TGA		0.483	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
G2E3	55632	broad.mit.edu;hgsc.bcm.edu	37	14	31074726	31074726	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr14:31074726T>G	ENST00000206595.6	+	11	1180	c.1026T>G	c.(1024-1026)ttT>ttG	p.F342L	G2E3_ENST00000438909.2_Missense_Mutation_p.F296L|G2E3_ENST00000544007.1_Intron|G2E3_ENST00000553504.1_Missense_Mutation_p.F372L	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	342					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F342L(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GCAGCAAATTTAGAAGAAATG	0.274																																																	1	Substitution - Missense(1)	kidney(1)											16.0	17.0	17.0					14																	31074726		2119	4261	6380	SO:0001583	missense	55632			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1026T>G	14.37:g.31074726T>G	ENSP00000206595:p.Phe342Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.728|6.728	0.503024|0.503024	0.12822|0.12822	.|.	.|.	ENSG00000092140|ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504|ENST00000552515	T;T;T|.	0.78595|.	-1.19;1.13;-0.61|.	5.66|5.66	3.18|3.18	0.36537|0.36537	HECT (1);|.	1.083220|.	0.06963|.	N|.	0.816671|.	T|.	0.15176|.	0.0366|.	N|N	0.08118|0.08118	0|0	0.29445|0.29445	N|N	0.858905|0.858905	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.15037|.	-1.0451|.	10|.	0.07482|.	T|.	0.82|.	-9.5042|-9.5042	2.0782|2.0782	0.03629|0.03629	0.1435:0.0882:0.2699:0.4984|0.1435:0.0882:0.2699:0.4984	.|.	342|.	Q7L622|.	G2E3_HUMAN|.	L|E	342;296;372|108	ENSP00000206595:F342L;ENSP00000391068:F296L;ENSP00000451653:F372L|.	ENSP00000206595:F342L|.	F|X	+|+	3|1	2|0	G2E3|G2E3	30144477|30144477	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.664000|0.664000	0.39144|0.39144	1.588000|1.588000	0.36633|0.36633	1.093000|1.093000	0.41377|0.41377	0.528000|0.528000	0.53228|0.53228	TTT|TAG		0.274	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2		NM_017769	
GLDN	342035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	51692438	51692438	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr15:51692438T>A	ENST00000335449.6	+	7	923	c.867T>A	c.(865-867)gaT>gaA	p.D289E	GLDN_ENST00000396399.2_Missense_Mutation_p.D165E	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	289					clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D289E(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		GAAAAGCTGATGAGAAAGCCA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											120.0	114.0	116.0					15																	51692438		2196	4293	6489	SO:0001583	missense	342035			AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.867T>A	15.37:g.51692438T>A	ENSP00000335196:p.Asp289Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXZ7|Q7Z359	Missense_Mutation	SNP	ENST00000335449.6	37	CCDS10140.2	.	.	.	.	.	.	.	.	.	.	T	10.04	1.241592	0.22711	.	.	ENSG00000186417	ENST00000335449;ENST00000396399;ENST00000537339	D;D	0.91295	-2.82;-2.66	5.79	-2.69	0.06022	.	0.000000	0.44902	D	0.000418	T	0.74688	0.3749	N	0.22421	0.69	0.29237	N	0.872865	B	0.26258	0.145	B	0.20955	0.032	T	0.65804	-0.6079	10	0.06099	T	0.92	.	5.3252	0.15903	0.3284:0.364:0.0:0.3076	.	289	Q6ZMI3	GLDN_HUMAN	E	289;165;165	ENSP00000335196:D289E;ENSP00000379681:D165E	ENSP00000335196:D289E	D	+	3	2	GLDN	49479730	0.679000	0.27596	0.986000	0.45419	0.778000	0.44026	-0.349000	0.07731	-0.398000	0.07679	-0.336000	0.08194	GAT		0.418	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254667.2		NM_181789	
GPC3	2719	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	132834052	132834052	+	Missense_Mutation	SNP	C	C	A	rs373916851		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:132834052C>A	ENST00000370818.3	-	4	1482	c.1037G>T	c.(1036-1038)gGc>gTc	p.G346V	GPC3_ENST00000543339.1_Missense_Mutation_p.G292V|GPC3_ENST00000394299.2_Missense_Mutation_p.G369V	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	346					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)	p.G346V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					ACATAACTTGCCAATCTGAAA	0.318			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																														yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	1	Substitution - Missense(1)	kidney(1)						C	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	1,3834		0,1,1631,571	79.0	77.0	78.0		1106,989,875,1037	5.3	1.0	X		78	0,6726		0,0,2428,1870	no	missense,missense,missense,missense	GPC3	NM_001164617.1,NM_001164618.1,NM_001164619.1,NM_004484.3	109,109,109,109	0,1,4059,2441	AA,AC,CC,C		0.0,0.0261,0.0095	benign,benign,benign,benign	369/604,330/565,292/527,346/581	132834052	1,10560	2203	4298	6501	SO:0001583	missense	2719	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.1037G>T	X.37:g.132834052C>A	ENSP00000359854:p.Gly346Val	Somatic		WXS	Illumina HiSeq	Phase_I	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	CCDS14638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.10|14.10	2.435921|2.435921	0.43224|0.43224	2.61E-4|2.61E-4	0.0|0.0	ENSG00000147257|ENSG00000147257	ENST00000406757|ENST00000370818;ENST00000394299;ENST00000543339	.|T;T;T	.|0.47869	.|0.83;0.83;0.83	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.053573	.|0.64402	.|D	.|0.000001	T|T	0.42017|0.42017	0.1184|0.1184	L|L	0.29908|0.29908	0.895|0.895	0.54753|0.54753	D|D	0.999984|0.999984	.|B;B;B;B	.|0.33345	.|0.244;0.356;0.409;0.244	.|B;B;B;B	.|0.41135	.|0.348;0.236;0.348;0.348	T|T	0.44605|0.44605	-0.9317|-0.9317	5|10	.|0.66056	.|D	.|0.02	.|.	10.5674|10.5674	0.45181|0.45181	0.0:0.9099:0.0:0.0901|0.0:0.9099:0.0:0.0901	.|.	.|330;292;369;346	.|B4DTD8;G3V1R0;C9JLE3;P51654	.|.;.;.;GPC3_HUMAN	S|V	76|346;369;292	.|ENSP00000359854:G346V;ENSP00000377836:G369V;ENSP00000444222:G292V	.|ENSP00000359854:G346V	A|G	-|-	1|2	0|0	GPC3|GPC3	132661718|132661718	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	2.250000|2.250000	0.43178|0.43178	2.199000|2.199000	0.70637|0.70637	0.436000|0.436000	0.28706|0.28706	GCA|GGC		0.318	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1		NM_004484	
GPD2	2820	broad.mit.edu;ucsc.edu	37	2	157426664	157426664	+	Silent	SNP	G	G	A	rs370358716		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr2:157426664G>A	ENST00000310454.6	+	12	1914	c.1542G>A	c.(1540-1542)gtG>gtA	p.V514V	GPD2_ENST00000409125.4_Silent_p.V287V|GPD2_ENST00000438166.2_Silent_p.V514V|GPD2_ENST00000540309.1_Intron|GPD2_ENST00000409674.1_Silent_p.V514V	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	514					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)	p.V514V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						TGGCAAGTGTGACTGGCAAAA	0.463																																																	1	Substitution - coding silent(1)	kidney(1)						G	,	0,4406		0,0,2203	166.0	147.0	153.0		1542,1542	0.9	1.0	2		153	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GPD2	NM_000408.4,NM_001083112.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	514/728,514/728	157426664	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2820				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1542G>A	2.37:g.157426664G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Silent	SNP	ENST00000310454.6	37	CCDS2202.1																																																																																				0.463	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3			
SBNO2	22904	broad.mit.edu;ucsc.edu|broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	1106418	1106419	+	IGR	DNP	GC	GC	CT			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:1106418_1106419GC>CT	ENST00000361757.3	-	0	4922				GPX4_ENST00000354171.8_Missense_Mutation_p.G174A|GPX4_ENST00000589115.1_Missense_Mutation_p.A166L	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)						bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)			p.G174G(1)|p.G174A(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACAAGAACGGCTGCGTGGTGA	0.649																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)																																								SO:0001628	intergenic_variant	2879			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.4099_4099delinsCT	19.37:g.1106418_1106419delinsCT		Somatic		WXS	Illumina GAIIx|Illumina HiSeq	Phase_I	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation|Silent	SNP	ENST00000361757.3	37	CCDS45894.1																																																																																				0.649	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2		NM_014963	
HLA-C	3107	hgsc.bcm.edu	37	6	31238126	31238126	+	Silent	SNP	G	G	A	rs2308618	byFrequency	TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr6:31238126G>A	ENST00000376228.5	-	4	770	c.756C>T	c.(754-756)acC>acT	p.T252T	HLA-C_ENST00000383329.3_Silent_p.T252T	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	252	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CCACAAGCTCGGTGTCCTGGG	0.617																																																	0								G		253,4153		17,219,1967	49.0	42.0	45.0		756	-2.7	0.0	6	dbSNP_126	45	740,7856		50,640,3608	no	coding-synonymous	HLA-C	NM_002117.5		67,859,5575	AA,AG,GG		8.6087,5.7422,7.6373		252/367	31238126	993,12009	2203	4298	6501	SO:0001819	synonymous_variant	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.756C>T	6.37:g.31238126G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1																																																																																				0.617	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3		NM_002117	
HMCN1	83872	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	185985179	185985179	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:185985179G>T	ENST00000271588.4	+	32	5228	c.4999G>T	c.(4999-5001)Gga>Tga	p.G1667*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.G1667*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1667	Ig-like C2-type 14.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G1667*(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAAAGCTGCTGGAAACCCTTC	0.448																																																	1	Substitution - Nonsense(1)	kidney(1)											104.0	97.0	99.0					1																	185985179		2203	4300	6503	SO:0001587	stop_gained	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4999G>T	1.37:g.185985179G>T	ENSP00000271588:p.Gly1667*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	47	12.996478	0.99712	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	.	.	.	X	1667	.	ENSP00000271588:G1667X	G	+	1	0	HMCN1	184251802	1.000000	0.71417	0.991000	0.47740	0.588000	0.36517	9.041000	0.93788	2.941000	0.99782	0.655000	0.94253	GGA		0.448	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
HTR1E	3354	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	87725923	87725923	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr6:87725923C>T	ENST00000305344.5	+	2	1574	c.871C>T	c.(871-873)Cgc>Tgc	p.R291C		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	291					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R291C(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GAAGGCAGCACGCATCCTGGG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											172.0	160.0	164.0					6																	87725923		2203	4300	6503	SO:0001583	missense	3354				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.871C>T	6.37:g.87725923C>T	ENSP00000307766:p.Arg291Cys	Somatic		WXS	Illumina HiSeq	Phase_I	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413221	0.25465	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.40476	1.03;1.03	4.44	4.44	0.53790	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	U	0.000022	T	0.57286	0.2043	M	0.74546	2.27	0.47276	D	0.999375	D	0.89917	1.0	D	0.69479	0.964	T	0.65372	-0.6184	10	0.87932	D	0	.	17.0403	0.86487	0.0:1.0:0.0:0.0	.	291	P28566	5HT1E_HUMAN	C	291	ENSP00000307766:R291C;ENSP00000358597:R291C	ENSP00000307766:R291C	R	+	1	0	HTR1E	87782642	0.989000	0.36119	0.988000	0.46212	0.164000	0.22412	2.763000	0.47605	2.041000	0.60428	0.205000	0.17691	CGC		0.517	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2		NM_000865	
ZSWIM8	23053	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	75545700	75545700	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr10:75545700T>G	ENST00000605216.1	+	1	281	c.64T>G	c.(64-66)Ttt>Gtt	p.F22V	ZSWIM8_ENST00000604729.1_Missense_Mutation_p.F22V|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.F22V|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.F22V|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.F22V	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	22							zinc ion binding (GO:0008270)	p.F22V(2)									TTCGGACCGTTTTGAGGAGGA	0.652																																																	2	Substitution - Missense(2)	kidney(2)											30.0	38.0	35.0					10																	75545700		1990	4127	6117	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.64T>G	10.37:g.75545700T>G	ENSP00000474748:p.Phe22Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		.	.	.	.	.	.	.	.	.	.	T	33	5.259232	0.95368	.	.	ENSG00000214655	ENST00000398706	T	0.69561	-0.41	4.62	4.62	0.57501	.	.	.	.	.	T	0.66406	0.2786	M	0.82056	2.57	0.80722	D	1	P;P;P	0.36909	0.573;0.573;0.573	B;B;B	0.30401	0.115;0.115;0.115	T	0.73773	-0.3877	9	0.87932	D	0	.	14.1909	0.65637	0.0:0.0:0.0:1.0	.	22;22;22	A7E2V4;A7E2V4-5;A7E2V4-4	K0913_HUMAN;.;.	V	22	ENSP00000381693:F22V	ENSP00000381693:F22V	F	+	1	0	KIAA0913	75215706	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.306000	0.78905	1.942000	0.56320	0.454000	0.30748	TTT		0.652	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1		NM_001242487	
KIF21B	23046	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	200943295	200943295	+	Silent	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:200943295G>A	ENST00000422435.2	-	35	5158	c.4842C>T	c.(4840-4842)taC>taT	p.Y1614Y	KIF21B_ENST00000461742.2_Intron|KIF21B_ENST00000332129.2_Silent_p.Y1601Y|KIF21B_ENST00000360529.5_Intron	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1614					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Y1601Y(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GTCCAGGGACGTAATTCCACA	0.627																																																	1	Substitution - coding silent(1)	kidney(1)											88.0	87.0	87.0					1																	200943295		2203	4300	6503	SO:0001819	synonymous_variant	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4842C>T	1.37:g.200943295G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	CCDS58056.1																																																																																				0.627	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1		XM_371332	
KRT4	3851	hgsc.bcm.edu	37	12	53207602	53207603	+	Frame_Shift_Ins	INS	-	-	G	rs7135148|rs71092788		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr12:53207602_53207603insG	ENST00000551956.1	-	1	732_733	c.240_241insC	c.(238-243)tttggcfs	p.G81fs	KRT4_ENST00000458244.2_Frame_Shift_Ins_p.G61fs|KRT4_ENST00000293774.4_Frame_Shift_Ins_p.G155fs			P19013	K2C4_HUMAN	keratin 4	81	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCACCAGTGCCAAAGCCTCCAG	0.599																																					Pancreas(190;284 2995 41444 45903)												0																																										SO:0001589	frameshift_variant	3851				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.240_241insC	12.37:g.53207602_53207603insG	ENSP00000448220:p.Gly81fs	Somatic		WXS	Illumina HiSeq	Phase_I	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Frame_Shift_Ins	INS	ENST00000551956.1	37	CCDS41787.2																																																																																				0.599	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1		NM_002272	
LLGL1	3996	broad.mit.edu;ucsc.edu	37	17	18141525	18141526	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:18141525_18141526insA	ENST00000316843.4	+	15	2145_2146	c.2049_2050insA	c.(2050-2052)aagfs	p.K684fs		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	684					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					ATGCCAGCAGCAAGGTGAGCTG	0.624																																																	0																																										SO:0001589	frameshift_variant	3996				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.2051dupA	17.37:g.18141527_18141527dupA	ENSP00000321537:p.Lys684fs	Somatic		WXS	Illumina GAIIx	Phase_I	A7MBM7|O00188|Q58F11|Q86UK6	Frame_Shift_Ins	INS	ENST00000316843.4	37	CCDS32586.1																																																																																				0.624	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132067.3			
LMO7	4008	hgsc.bcm.edu;ucsc.edu	37	13	76427480	76427480	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr13:76427480delC	ENST00000321797.8	+	26	4639	c.3918delC	c.(3916-3918)agcfs	p.S1306fs	LMO7_ENST00000465261.2_Frame_Shift_Del_p.S1306fs|LMO7_ENST00000526202.1_Frame_Shift_Del_p.S1183fs|LMO7_ENST00000357063.3_Frame_Shift_Del_p.S1591fs|LMO7_ENST00000377534.3_Frame_Shift_Del_p.S1591fs|LMO7_ENST00000341547.4_Frame_Shift_Del_p.S1257fs			Q8WWI1	LMO7_HUMAN	LIM domain 7	1591					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CCCCGAGAAGCCATTCCCCTT	0.557																																																	0													49.0	42.0	45.0					13																	76427480		2203	4300	6503	SO:0001589	frameshift_variant	4008			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.3918delC	13.37:g.76427480delC	ENSP00000317802:p.Ser1306fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Frame_Shift_Del	DEL	ENST00000321797.8	37																																																																																					0.557	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3		NM_005358	
TSSC2	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr11:3427845C>T	ENST00000529482.1	+	0	962									tumor suppressing subtransferable candidate 2 pseudogene																		CTTCAAGTGGCAGGAGCAGAA	0.587																																																	0																																												650368					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3427845C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000529482.1	37																																																																																					0.587	TSSC2-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000392020.1			
MAGEB10	139422	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	27840135	27840135	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:27840135C>A	ENST00000356790.2	+	3	957	c.712C>A	c.(712-714)Cac>Aac	p.H238N		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	238	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.H238N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						CGGAATTGAGCACTTCATGTT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											54.0	49.0	50.0					X																	27840135		2202	4300	6502	SO:0001583	missense	139422				CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.712C>A	X.37:g.27840135C>A	ENSP00000368304:p.His238Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808691	0.31961	.	.	ENSG00000177689	ENST00000356790	T	0.05025	3.51	2.33	1.44	0.22558	.	0.000000	0.85682	U	0.000000	T	0.08846	0.0219	M	0.64080	1.96	0.09310	N	1	P	0.43392	0.805	P	0.44860	0.462	T	0.12528	-1.0544	10	0.62326	D	0.03	.	5.6025	0.17361	0.3225:0.6775:0.0:0.0	.	238	Q96LZ2	MAGBA_HUMAN	N	238	ENSP00000368304:H238N	ENSP00000368304:H238N	H	+	1	0	MAGEB10	27750056	0.053000	0.20554	0.006000	0.13384	0.037000	0.13140	0.994000	0.29693	0.391000	0.25143	0.422000	0.28245	CAC		0.463	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1		NM_182506	
MCM7	4176	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	99695276	99695276	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr7:99695276C>T	ENST00000303887.5	-	9	1723	c.1078G>A	c.(1078-1080)Ggg>Agg	p.G360R	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Missense_Mutation_p.G184R	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	360	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.G184R(2)|p.G360R(2)|p.G360W(1)|p.G184W(1)		endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCACACCCCCGACTAGCAGG	0.507																																																	6	Substitution - Missense(6)	ovary(2)|lung(2)|kidney(2)											255.0	260.0	258.0					7																	99695276		2203	4300	6503	SO:0001583	missense	4176				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1078G>A	7.37:g.99695276C>T	ENSP00000307288:p.Gly360Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	C	34	5.366666	0.95900	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	T;T	0.11604	2.76;2.76	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.49355	0.1552	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67461	-0.5665	10	0.87932	D	0	-17.3236	16.0986	0.81148	0.0:1.0:0.0:0.0	.	360	P33993	MCM7_HUMAN	R	360;297;253;184	ENSP00000307288:G360R;ENSP00000346171:G184R	ENSP00000307288:G360R	G	-	1	0	MCM7	99533212	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.565000	0.82337	2.664000	0.90586	0.655000	0.94253	GGG		0.507	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3			
MICAL2	9645	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	12278355	12278355	+	Silent	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr11:12278355C>T	ENST00000256194.4	+	24	3267	c.2979C>T	c.(2977-2979)ccC>ccT	p.P993P	MICAL2_ENST00000379612.3_Silent_p.P767P|MICAL2_ENST00000537344.1_Silent_p.P803P|MICAL2_ENST00000527546.1_Silent_p.P803P|MICAL2_ENST00000342902.5_Silent_p.P972P	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	993					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.P993P(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		AGTCATTTCCCCTTAACCTGG	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											115.0	95.0	102.0					11																	12278355		2201	4294	6495	SO:0001819	synonymous_variant	9645			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2979C>T	11.37:g.12278355C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Silent	SNP	ENST00000256194.4	37	CCDS7809.1																																																																																				0.522	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1		NM_014632	
SEPT6	23157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	118780702	118780702	+	Intron	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:118780702C>T	ENST00000343984.5	-	5	955				SEPT6_ENST00000354416.3_Intron|SEPT6_ENST00000394616.4_Intron|SEPT6_ENST00000394610.1_Intron|SEPT6_ENST00000360156.7_Intron|MIR766_ENST00000390223.1_RNA|SEPT6_ENST00000489216.1_Intron|SEPT6_ENST00000354228.4_Intron|SEPT6_ENST00000394617.2_Intron	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6						cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						TCCAATCCAGCTCCTATGACA	0.517			T	MLL	AML																																			Dom	yes		X	Xq24	23157	septin 6		L	0													40.0	35.0	37.0					X																	118780702		1566	3582	5148	SO:0001627	intron_variant	768218			D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.690+3197G>A	X.37:g.118780702C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	RNA	SNP	ENST00000343984.5	37	CCDS14584.1																																																																																				0.517	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1		NM_145802	
MRPL48	51642	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	73555925	73555925	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr11:73555925A>G	ENST00000310614.7	+	5	931	c.275A>G	c.(274-276)aAt>aGt	p.N92S	MRPL48_ENST00000411840.2_5'UTR|MRPL48_ENST00000398483.3_5'UTR|MRPL48_ENST00000314282.7_5'UTR|MRPL48_ENST00000542303.1_Intron|MRPL48_ENST00000535529.1_Missense_Mutation_p.N74S	NM_016055.5	NP_057139.1	Q96GC5	RM48_HUMAN	mitochondrial ribosomal protein L48	92						mitochondrial ribosome (GO:0005761)		p.N92S(2)		kidney(1)	1						GGGGTTTTAAATATTCATCTG	0.403																																																	2	Substitution - Missense(2)	kidney(2)											89.0	83.0	85.0					11																	73555925		1833	4080	5913	SO:0001583	missense	51642			AF151876	CCDS44676.1	11q13.4	2012-09-13			ENSG00000175581	ENSG00000175581		"""Mitochondrial ribosomal proteins / large subunits"""	16653	protein-coding gene	gene with protein product		611853				10810093	Standard	NM_016055		Approved	CGI-118	uc001ouh.4	Q96GC5	OTTHUMG00000168048	ENST00000310614.7:c.275A>G	11.37:g.73555925A>G	ENSP00000308717:p.Asn92Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DN34|Q49AK7|Q4U2Q4|Q9P091|Q9Y5J0	Missense_Mutation	SNP	ENST00000310614.7	37	CCDS44676.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.382551	0.82792	.	.	ENSG00000175581	ENST00000310614;ENST00000535529	T	0.52983	0.64	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.64962	0.2646	M	0.67700	2.07	0.58432	D	0.999999	D;D	0.71674	0.998;0.994	D;D	0.69479	0.964;0.917	T	0.66364	-0.5942	10	0.49607	T	0.09	-34.1012	13.6031	0.62031	1.0:0.0:0.0:0.0	.	74;92	B4DN34;Q96GC5	.;RM48_HUMAN	S	92;74	ENSP00000308717:N92S	ENSP00000308717:N92S	N	+	2	0	MRPL48	73233573	1.000000	0.71417	0.977000	0.42913	0.984000	0.73092	5.724000	0.68500	2.101000	0.63845	0.482000	0.46254	AAT		0.403	MRPL48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397733.1		NM_016055	
MUC21	394263	hgsc.bcm.edu	37	6	30954552	30954552	+	Silent	SNP	C	C	T	rs144720609		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr6:30954552C>T	ENST00000376296.3	+	2	841	c.600C>T	c.(598-600)tcC>tcT	p.S200S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	200	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACTCTGAGTCCAGCACAACCT	0.607																																																	0													163.0	157.0	159.0					6																	30954552		2203	4300	6503	SO:0001819	synonymous_variant	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.600C>T	6.37:g.30954552C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																				0.607	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3		NM_001010909	
NENF	29937	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	212619210	212619210	+	Silent	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:212619210G>A	ENST00000366988.3	+	4	438	c.381G>A	c.(379-381)gaG>gaA	p.E127E	NENF_ENST00000473900.1_3'UTR	NM_013349.4	NP_037481.1	Q9UMX5	NENF_HUMAN	neudesin neurotrophic factor	127	Cytochrome b5 heme-binding.				positive regulation of MAPK cascade (GO:0043410)	extracellular space (GO:0005615)	heme binding (GO:0020037)|metal ion binding (GO:0046872)	p.E127E(1)		endometrium(1)|kidney(1)|large_intestine(2)	4				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)		CCCTGGATGAGGTCTTCACCA	0.537																																																	1	Substitution - coding silent(1)	kidney(1)											122.0	120.0	121.0					1																	212619210		2203	4300	6503	SO:0001819	synonymous_variant	29937				CCDS1505.1	1q32.3	2011-07-05	2011-07-05		ENSG00000117691	ENSG00000117691			30384	protein-coding gene	gene with protein product	"""neudesin"""	611874	"""neuron derived neurotrophic factor"""			9771976, 15605373	Standard	NM_013349		Approved	CIR2, SCIRP10, SPUF	uc001hjd.3	Q9UMX5	OTTHUMG00000036744	ENST00000366988.3:c.381G>A	1.37:g.212619210G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1KYQ8|Q53FZ6|Q5TM90	Silent	SNP	ENST00000366988.3	37	CCDS1505.1																																																																																				0.537	NENF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089291.1		NM_013349	
NUAK1	9891	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	106466600	106466600	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr12:106466600T>C	ENST00000261402.2	-	5	1980	c.601A>G	c.(601-603)Aac>Gac	p.N201D		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.N201D(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						TGGTACAGGTTGGAAAGCCCA	0.468																																																	2	Substitution - Missense(2)	kidney(2)											126.0	117.0	120.0					12																	106466600		2203	4300	6503	SO:0001583	missense	9891			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.601A>G	12.37:g.106466600T>C	ENSP00000261402:p.Asn201Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A7MD39|Q96KA8	Missense_Mutation	SNP	ENST00000261402.2	37	CCDS31892.1	.	.	.	.	.	.	.	.	.	.	T	30	5.049850	0.93740	.	.	ENSG00000074590	ENST00000261402;ENST00000548902	T;T	0.24538	1.85;1.85	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	T	0.38054	0.1026	N	0.17901	0.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34354	-0.9832	10	0.87932	D	0	.	16.3123	0.82883	0.0:0.0:0.0:1.0	.	201	O60285	NUAK1_HUMAN	D	201;70	ENSP00000261402:N201D;ENSP00000448288:N70D	ENSP00000261402:N201D	N	-	1	0	NUAK1	104990730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.994000	0.88315	2.254000	0.74563	0.459000	0.35465	AAC		0.468	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405767.2		NM_014840	
OR6F1	343169	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	247875599	247875599	+	Missense_Mutation	SNP	G	G	T	rs144440883	byFrequency	TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:247875599G>T	ENST00000302084.2	-	1	506	c.459C>A	c.(457-459)ttC>ttA	p.F153L	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F153L(1)|p.F153F(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CAATGGCCACGAAACCACACA	0.587																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(1)|skin(1)											67.0	76.0	73.0					1																	247875599		2203	4300	6503	SO:0001583	missense	343169			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.459C>A	1.37:g.247875599G>T	ENSP00000305640:p.Phe153Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	G	8.355	0.831887	0.16820	.	.	ENSG00000169214	ENST00000302084	T	0.00039	8.85	3.99	1.02	0.19986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000322	T	0.00241	0.0007	L	0.31578	0.945	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.55592	-0.8117	10	0.35671	T	0.21	-51.7153	7.9368	0.29935	0.3717:0.0:0.6283:0.0	.	153	Q8NGZ6	OR6F1_HUMAN	L	153	ENSP00000305640:F153L	ENSP00000305640:F153L	F	-	3	2	OR6F1	245942222	0.000000	0.05858	0.007000	0.13788	0.032000	0.12392	-2.297000	0.01141	0.107000	0.17824	0.591000	0.81541	TTC		0.587	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1		NM_001005286	
PCDHB5	26167	broad.mit.edu;hgsc.bcm.edu	37	5	140517263	140517263	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr5:140517263C>A	ENST00000231134.5	+	1	2464	c.2247C>A	c.(2245-2247)caC>caA	p.H749Q		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	749					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H749Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAGCTACCACTACGAGGTGT	0.627																																																	1	Substitution - Missense(1)	kidney(1)											106.0	126.0	119.0					5																	140517263		2203	4300	6503	SO:0001583	missense	26167			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2247C>A	5.37:g.140517263C>A	ENSP00000231134:p.His749Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.747031	0.00005	.	.	ENSG00000113209	ENST00000231134	T	0.46819	0.86	4.38	-1.14	0.09741	.	.	.	.	.	T	0.06416	0.0165	N	0.00027	-2.645	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.38972	-0.9636	9	0.02654	T	1	.	2.3274	0.04226	0.3869:0.3182:0.1891:0.1058	.	749	Q9Y5E4	PCDB5_HUMAN	Q	749	ENSP00000231134:H749Q	ENSP00000231134:H749Q	H	+	3	2	PCDHB5	140497447	0.000000	0.05858	0.833000	0.33012	0.111000	0.19643	-1.049000	0.03514	-0.147000	0.11254	-0.293000	0.09583	CAC		0.627	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1		NM_015669	
PCGF2	7703	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	36892363	36892363	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:36892363A>T	ENST00000580830.1	-	11	1338	c.637T>A	c.(637-639)Tac>Aac	p.Y213N	PCGF2_ENST00000581345.1_Missense_Mutation_p.Y213N|PCGF2_ENST00000578109.1_Missense_Mutation_p.L160Q|PCGF2_ENST00000360797.2_Missense_Mutation_p.Y213N|PCGF2_ENST00000579882.1_Missense_Mutation_p.L214Q|PCGF2_ENST00000585100.1_Missense_Mutation_p.L214Q			P35227	PCGF2_HUMAN	polycomb group ring finger 2	213					anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y213N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GGGTAGATGTAGGCGATGTCC	0.642																																																	1	Substitution - Missense(1)	kidney(1)											107.0	66.0	80.0					17																	36892363		2202	4298	6500	SO:0001583	missense	7703			D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.637T>A	17.37:g.36892363A>T	ENSP00000461961:p.Tyr213Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.936644	0.52972	.	.	ENSG00000056661	ENST00000360797	T	0.38560	1.13	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.69762	0.3147	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.76806	-0.2823	10	0.66056	D	0.02	-18.3931	12.5912	0.56443	1.0:0.0:0.0:0.0	.	213	P35227	PCGF2_HUMAN	N	213	ENSP00000354033:Y213N	ENSP00000354033:Y213N	Y	-	1	0	PCGF2	34145889	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.978000	0.93450	2.082000	0.62665	0.379000	0.24179	TAC		0.642	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2		NM_007144	
PIP5K1A	8394	hgsc.bcm.edu	37	1	151206687	151206687	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:151206687delC	ENST00000368888.4	+	8	1076	c.654delC	c.(652-654)aacfs	p.N218fs	PIP5K1A_ENST00000441902.2_Frame_Shift_Del_p.N206fs|PIP5K1A_ENST00000368890.4_Frame_Shift_Del_p.N205fs|PIP5K1A_ENST00000409426.1_Frame_Shift_Del_p.N206fs|PIP5K1A_ENST00000464105.1_3'UTR|PIP5K1A_ENST00000414290.2_5'Flank	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	218	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)			breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCAACCAGAACCCTCGGACTT	0.443																																					Pancreas(80;36 1443 2325 16095 21302)												0													105.0	96.0	99.0					1																	151206687		2203	4300	6503	SO:0001589	frameshift_variant	8394			U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.654delC	1.37:g.151206687delC	ENSP00000357883:p.Asn218fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4Q0|B4DIN0|Q99754|Q99756	Frame_Shift_Del	DEL	ENST00000368888.4	37	CCDS44219.1																																																																																				0.443	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2		NM_003557	
PKNOX1	5316	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	44427621	44427621	+	Silent	SNP	A	A	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr21:44427621A>G	ENST00000291547.5	+	3	283	c.72A>G	c.(70-72)ttA>ttG	p.L24L	PKNOX1_ENST00000432907.2_5'UTR	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	24					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L24L(1)		cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						TAACAGAGTTAAAGACAGAAC	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											115.0	112.0	113.0					21																	44427621		2203	4300	6503	SO:0001819	synonymous_variant	5316				CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.72A>G	21.37:g.44427621A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O00528|Q8IWT7	Silent	SNP	ENST00000291547.5	37	CCDS13692.1																																																																																				0.468	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3			
DESI2	51029	broad.mit.edu	37	1	244868992	244868992	+	Silent	SNP	A	A	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:244868992A>G	ENST00000302550.11	+	5	865	c.486A>G	c.(484-486)gaA>gaG	p.E162E	DESI2_ENST00000263831.7_Silent_p.E129E	NM_016076.3	NP_057160.2	Q9BSY9	DESI2_HUMAN	desumoylating isopeptidase 2	162						cytoplasm (GO:0005737)	peptidase activity (GO:0008233)	p.E162E(1)									TCAGCCAAGAACTCCAGGATG	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											64.0	67.0	66.0					1																	244868992		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025651	CCDS1626.1, CCDS73055.1	1q44	2012-05-16	2012-05-16	2012-05-16	ENSG00000121644	ENSG00000121644			24264	protein-coding gene	gene with protein product		614638	"""chromosome 1 open reading frame 121"", ""family with sequence similarity 152, member A"", ""PPPDE peptidase domain containing 1"""	C1orf121, FAM152A, PPPDE1		10810093, 22370726	Standard	XM_005273154		Approved	CGI-146, FLJ21998	uc001iao.3	Q9BSY9	OTTHUMG00000040398	ENST00000302550.11:c.486A>G	1.37:g.244868992A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B1APK6|Q5VVC6|Q9NYS2|Q9Y3E4	Silent	SNP	ENST00000302550.11	37	CCDS1626.1																																																																																				0.572	DESI2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097168.1		NM_016076	
PSG5	5673	broad.mit.edu;hgsc.bcm.edu	37	19	43680096	43680096	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:43680096G>C	ENST00000366175.3	-	3	765	c.635C>G	c.(634-636)aCa>aGa	p.T212R	PSG5_ENST00000404580.1_Missense_Mutation_p.T212R|PSG5_ENST00000342951.6_Missense_Mutation_p.T212R|PSG5_ENST00000599812.1_Missense_Mutation_p.T305R|PSG5_ENST00000407568.1_Intron|PSG5_ENST00000407356.1_Missense_Mutation_p.T212R			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	212	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.T212R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				ATAGGGTCCTGTTTCATTTCT	0.507																																																	1	Substitution - Missense(1)	kidney(1)											137.0	136.0	136.0					19																	43680096		2201	4295	6496	SO:0001583	missense	5673				CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.635C>G	19.37:g.43680096G>C	ENSP00000382334:p.Thr212Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q15239|Q96QJ1|Q9UQ75	Missense_Mutation	SNP	ENST00000366175.3	37	CCDS12617.1	.	.	.	.	.	.	.	.	.	.	g	10.96	1.497942	0.26861	.	.	ENSG00000204941	ENST00000366175;ENST00000407356;ENST00000342951;ENST00000404580	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	1.08	-1.07	0.09968	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18087	0.0434	M	0.66297	2.02	0.42232	D	0.991896	B;P	0.36249	0.002;0.545	B;P	0.46629	0.039;0.522	T	0.21552	-1.0242	9	0.45353	T	0.12	.	3.5098	0.07704	0.0:0.0:0.5573:0.4427	.	305;212	Q15228;Q15238	.;PSG5_HUMAN	R	212	ENSP00000382334:T212R;ENSP00000386008:T212R;ENSP00000344413:T212R;ENSP00000385250:T212R	ENSP00000344413:T212R	T	-	2	0	PSG5	48371936	0.041000	0.20044	0.331000	0.25455	0.024000	0.10985	-0.506000	0.06359	0.504000	0.28082	0.184000	0.17185	ACA		0.507	PSG5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323055.1		NM_002781	
PTPRQ	374462	hgsc.bcm.edu	37	12	80943506	80943523	+	Splice_Site	DEL	TGAAACAGGTAACTAACG	TGAAACAGGTAACTAACG	-	rs141686707|rs190917077	byFrequency	TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	TGAAACAGGTAACTAACG	TGAAACAGGTAACTAACG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr12:80943506_80943523delTGAAACAGGTAACTAACG	ENST00000266688.5	+	30	4266_4273	c.4266_4273delTGAAACAGGTAACTAACG	c.(4264-4275)cctgaaacaggt>ccgt	p.ETG1423del				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1469	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GCACACTACCTGAAACAGGTAACTAACGTGAAACAGGT	0.381																																																	0										21,2253		2,17,1118						3.6	1.0		dbSNP_134	53	261,3959		31,199,1880	no	coding-near-splice	PTPRQ	NM_001145026.1		33,216,2998	A1A1,A1R,RR		6.1848,0.9235,4.3425				282,6212				SO:0001630	splice_region_variant	374462			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4273+1TGAAACAGGTAACTAACG>-	12.37:g.80943506_80943523delTGAAACAGGTAACTAACG		Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000266688.5	37																																																																																					0.381	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001145026	In_Frame_Del
RAB4B	53916	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	41286335	41286335	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:41286335G>A	ENST00000594800.1	+	3	303	c.143G>A	c.(142-144)cGg>cAg	p.R48Q	RAB4B_ENST00000357052.2_Missense_Mutation_p.R48Q|RAB4B-EGLN2_ENST00000594136.1_Missense_Mutation_p.R48Q|MIA-RAB4B_ENST00000600729.1_3'UTR|RAB4B-EGLN2_ENST00000601949.1_Intron|RAB4B_ENST00000602069.1_3'UTR			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	48					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)	p.R83Q(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TTTGGATCCCGGGTGGTCAAC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											84.0	69.0	74.0					19																	41286335		2203	4300	6503	SO:0001583	missense	53916			AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.143G>A	19.37:g.41286335G>A	ENSP00000470246:p.Arg48Gln	Somatic		WXS	Illumina HiSeq	Phase_I	P22750|Q7Z514|Q9HBR6	Missense_Mutation	SNP	ENST00000594800.1	37	CCDS33030.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258909	0.59321	.	.	ENSG00000167578	ENST00000357052;ENST00000378307	T;T	0.76709	-1.04;-1.04	4.89	2.78	0.32641	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.67097	0.2857	L	0.39467	1.215	0.48632	D	0.999682	D;P	0.59357	0.985;0.578	B;B	0.42138	0.377;0.204	T	0.67138	-0.5746	10	0.87932	D	0	.	8.2207	0.31539	0.2596:0.0:0.7404:0.0	.	83;48	P61018-2;P61018	.;RAB4B_HUMAN	Q	48	ENSP00000349560:R48Q;ENSP00000367557:R48Q	ENSP00000349560:R48Q	R	+	2	0	RAB4B	45978175	1.000000	0.71417	0.942000	0.38095	0.771000	0.43674	5.166000	0.64965	0.664000	0.31047	0.491000	0.48974	CGG		0.592	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463168.1		NM_016154	
RAB4B	53916	broad.mit.edu;ucsc.edu	37	19	41286350	41286350	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:41286350G>T	ENST00000594800.1	+	3	318	c.158G>T	c.(157-159)gGt>gTt	p.G53V	RAB4B_ENST00000357052.2_Missense_Mutation_p.G53V|RAB4B-EGLN2_ENST00000594136.1_Missense_Mutation_p.G53V|MIA-RAB4B_ENST00000600729.1_3'UTR|RAB4B-EGLN2_ENST00000601949.1_Intron|RAB4B_ENST00000602069.1_3'UTR			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	53					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)	p.G88V(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GTCAACGTGGGTGGGAAGACT	0.582																																																	1	Substitution - Missense(1)	kidney(1)											90.0	74.0	79.0					19																	41286350		2203	4300	6503	SO:0001583	missense	53916			AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.158G>T	19.37:g.41286350G>T	ENSP00000470246:p.Gly53Val	Somatic		WXS	Illumina GAIIx	Phase_I	P22750|Q7Z514|Q9HBR6	Missense_Mutation	SNP	ENST00000594800.1	37	CCDS33030.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180591	0.57800	.	.	ENSG00000167578	ENST00000357052;ENST00000378307	T;T	0.81163	-1.46;-1.46	4.89	4.89	0.63831	Small GTP-binding protein domain (1);	0.059135	0.64402	D	0.000003	T	0.81669	0.4871	M	0.71581	2.175	0.80722	D	1	B;B	0.21821	0.061;0.047	B;B	0.28232	0.087;0.056	T	0.80705	-0.1263	10	0.66056	D	0.02	.	16.9821	0.86331	0.0:0.0:1.0:0.0	.	88;53	P61018-2;P61018	.;RAB4B_HUMAN	V	53	ENSP00000349560:G53V;ENSP00000367557:G53V	ENSP00000349560:G53V	G	+	2	0	RAB4B	45978190	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.353000	0.66034	2.537000	0.85549	0.491000	0.48974	GGT		0.582	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463168.1		NM_016154	
SETBP1	26040	broad.mit.edu;hgsc.bcm.edu	37	18	42530495	42530495	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr18:42530495C>T	ENST00000282030.5	+	4	1486	c.1190C>T	c.(1189-1191)tCa>tTa	p.S397L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	397						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S343L(1)|p.S397L(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GAAAATGACTCAAGTCATGTC	0.473									Schinzel-Giedion syndrome																																								2	Substitution - Missense(2)	kidney(2)											43.0	43.0	43.0					18																	42530495		2203	4300	6503	SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1190C>T	18.37:g.42530495C>T	ENSP00000282030:p.Ser397Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	C	11.96	1.794662	0.31777	.	.	ENSG00000152217	ENST00000282030	T	0.34275	1.37	5.78	4.69	0.59074	.	0.470158	0.21561	N	0.072566	T	0.23572	0.0570	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.14578	0.011	T	0.07177	-1.0786	10	0.18710	T	0.47	.	13.5007	0.61454	0.0:0.8948:0.0:0.1052	.	397	Q9Y6X0	SETBP_HUMAN	L	397	ENSP00000282030:S397L	ENSP00000282030:S397L	S	+	2	0	SETBP1	40784493	0.006000	0.16342	0.755000	0.31263	0.756000	0.42949	1.848000	0.39309	2.894000	0.99253	0.655000	0.94253	TCA		0.473	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4		NM_001130110	
SETD2	29072	broad.mit.edu;ucsc.edu	37	3	47079269	47079269	+	Splice_Site	SNP	T	T	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr3:47079269T>A	ENST00000409792.3	-	18	7281		c.e18-2			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.?(2)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGAGTCTGCCTAGAAAGAGAC	0.448			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Unknown(2)	kidney(2)											87.0	76.0	80.0					3																	47079269		2203	4300	6503	SO:0001630	splice_region_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7239-2A>T	3.37:g.47079269T>A		Somatic		WXS	Illumina GAIIx	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	28.5	4.927127	0.92389	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47054273	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.922000	0.87538	2.281000	0.76405	0.533000	0.62120	.		0.448	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	Intron
SLC12A4	6560	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	67983803	67983804	+	Missense_Mutation	DNP	CC	CC	GA	rs184951084|rs574622885		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr16:67983803_67983804CC>GA	ENST00000316341.3	-	13	1787_1788	c.1647_1648GG>TC	c.(1645-1650)aaGGtg>aaTCtg	p.549_550KV>NL	SLC12A4_ENST00000537830.2_Missense_Mutation_p.543_544KV>NL|SLC12A4_ENST00000576616.1_Missense_Mutation_p.549_550KV>NL|SLC12A4_ENST00000338335.3_Missense_Mutation_p.549_550KV>NL|SLC12A4_ENST00000541864.2_Missense_Mutation_p.518_519KV>NL|SLC12A4_ENST00000422611.2_Missense_Mutation_p.551_552KV>NL|SLC12A4_ENST00000572010.1_5'Flank|SLC12A4_ENST00000572037.1_Missense_Mutation_p.501_502KV>NL	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	549					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.K549N(1)|p.V550L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCACCATTCACCTTCCCGTGGC	0.629																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	6560				CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1647_1648delinsGA	16.37:g.67983803_67983804delinsGA	ENSP00000318557:p.K549_V550delinsNL	Somatic		WXS	Illumina HiSeq	Phase_I	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	CCDS10855.1																																																																																				0.629	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4		NM_005072	
SPEN	23013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	16255505	16255505	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:16255505C>T	ENST00000375759.3	+	11	2974	c.2770C>T	c.(2770-2772)Cct>Tct	p.P924S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	924					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.P924S(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TCAGACGGAGCCTGCAAAATC	0.453																																																	1	Substitution - Missense(1)	kidney(1)											147.0	162.0	157.0					1																	16255505		2203	4299	6502	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2770C>T	1.37:g.16255505C>T	ENSP00000364912:p.Pro924Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	C	5.171	0.217112	0.09810	.	.	ENSG00000065526	ENST00000375759	T	0.46451	0.87	5.2	2.22	0.28083	.	.	.	.	.	T	0.29945	0.0749	L	0.44542	1.39	0.26879	N	0.96757	B	0.17852	0.024	B	0.10450	0.005	T	0.22173	-1.0224	9	0.11182	T	0.66	-22.8871	8.0753	0.30712	0.1195:0.6953:0.1162:0.069	.	924	Q96T58	MINT_HUMAN	S	924	ENSP00000364912:P924S	ENSP00000364912:P924S	P	+	1	0	SPEN	16128092	0.144000	0.22641	1.000000	0.80357	0.877000	0.50540	0.629000	0.24538	1.422000	0.47177	-0.150000	0.13652	CCT		0.453	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1		NM_015001	
SPTA1	6708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	158609713	158609713	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:158609713G>A	ENST00000368147.4	-	34	5002	c.4822C>T	c.(4822-4824)Cgt>Tgt	p.R1608C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1608					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1608C(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTCTGTTGACGACTGGCCTCA	0.463																																																	1	Substitution - Missense(1)	kidney(1)											201.0	185.0	190.0					1																	158609713		1922	4122	6044	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4822C>T	1.37:g.158609713G>A	ENSP00000357129:p.Arg1608Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934058	0.73442	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.36699	1.24;1.24	5.53	3.63	0.41609	.	0.000000	0.32134	N	0.006521	T	0.41305	0.1153	M	0.68952	2.095	0.49051	D	0.999743	D	0.89917	1.0	D	0.72625	0.978	T	0.43032	-0.9416	10	0.87932	D	0	.	6.8686	0.24108	0.0801:0.0:0.5059:0.4139	.	1608	P02549	SPTA1_HUMAN	C	1608	ENSP00000357130:R1608C;ENSP00000357129:R1608C	ENSP00000357129:R1608C	R	-	1	0	SPTA1	156876337	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.110000	0.64622	0.854000	0.35336	-0.136000	0.14681	CGT		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	
SSH2	85464	hgsc.bcm.edu;ucsc.edu	37	17	27958639	27958642	+	Frame_Shift_Del	DEL	CTGA	CTGA	-			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	CTGA	CTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:27958639_27958642delCTGA	ENST00000269033.3	-	15	3640_3643	c.3489_3492delTCAG	c.(3487-3492)agtcagfs	p.SQ1163fs	SSH2_ENST00000540801.1_Frame_Shift_Del_p.SQ1190fs|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	1163					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGGGCTCTCCTGACTTTCTTCCC	0.52																																																	0																																										SO:0001589	frameshift_variant	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.3489_3492delTCAG	17.37:g.27958639_27958642delCTGA	ENSP00000269033:p.Ser1163fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Frame_Shift_Del	DEL	ENST00000269033.3	37	CCDS11253.1																																																																																				0.520	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1		NM_033389	
STAG3L2	442582	broad.mit.edu	37	7	74300557	74300564	+	RNA	DEL	AGAGCTCC	AGAGCTCC	-	rs367732188		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	AGAGCTCC	AGAGCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr7:74300557_74300564delAGAGCTCC	ENST00000423186.1	-	0	573_580							P0CL84	ST3L2_HUMAN	stromal antigen 3-like 2 (pseudogene)							nucleus (GO:0005634)		p.E82fs*32(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CGGCCAGTGAAGAGCTCCAGGCGTGCGG	0.572																																																	2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)								96,356		38,20,168							0.0			1	208,1036		88,32,502	no	frameshift	STAG3L2	NM_001025202.2		126,52,670	A1A1,A1R,RR		16.7203,21.2389,17.9245				304,1392						442582					7q11.23	2013-06-26	2013-06-26			ENSG00000277072			33886	pseudogene	pseudogene			"""stromal antigen 3-like 2"""				Standard	NR_040584		Approved	MGC131759, STAG3L2P	uc011kfj.2	P0CL84	OTTHUMG00000156216		7.37:g.74300557_74300564delAGAGCTCC		Somatic		WXS	Illumina GAIIx	Phase_I	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	Frame_Shift_Del	DEL	ENST00000423186.1	37																																																																																					0.572	STAG3L2-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000343523.2		NM_001025202	
SUN5	140732	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	31572986	31572986	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr20:31572986C>T	ENST00000356173.3	-	12	995	c.903G>A	c.(901-903)atG>atA	p.M301I	SUN5_ENST00000375523.3_Missense_Mutation_p.M276I	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	301	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.M301I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						GGGAGCCCTCCATGCCCTGTG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											77.0	76.0	76.0					20																	31572986		2203	4300	6503	SO:0001583	missense	140732			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.903G>A	20.37:g.31572986C>T	ENSP00000348496:p.Met301Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ82|Q5T9R0	Missense_Mutation	SNP	ENST00000356173.3	37	CCDS13209.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947531	0.34377	.	.	ENSG00000167098	ENST00000356173;ENST00000375523	T;T	0.79749	-1.3;-1.3	5.67	3.64	0.41730	Sad1/UNC-like, C-terminal (2);	0.490007	0.23189	N	0.050921	T	0.54983	0.1892	N	0.02751	-0.505	0.80722	D	1	B	0.18610	0.029	B	0.16289	0.015	T	0.48703	-0.9012	10	0.23891	T	0.37	-18.4525	7.6204	0.28181	0.1606:0.6055:0.2339:0.0	.	301	Q8TC36	SUN5_HUMAN	I	301;276	ENSP00000348496:M301I;ENSP00000364673:M276I	ENSP00000348496:M301I	M	-	3	0	SUN5	31036647	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	1.604000	0.36804	1.357000	0.45904	0.561000	0.74099	ATG		0.582	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1		NM_080675	
TMEM150A	129303	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	85828190	85828190	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr2:85828190C>T	ENST00000409668.1	-	3	621	c.154G>A	c.(154-156)Ggg>Agg	p.G52R	TMEM150A_ENST00000334462.5_Missense_Mutation_p.G52R|TMEM150A_ENST00000306353.3_Silent_p.K21K			Q86TG1	T150A_HUMAN	transmembrane protein 150A	52					catabolic process (GO:0009056)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G52R(1)		breast(1)|endometrium(2)|kidney(2)|lung(1)|skin(1)	7						TTGGGACCCCCTTGCTCAGCA	0.642																																																	1	Substitution - Missense(1)	kidney(1)											57.0	50.0	52.0					2																	85828190		2203	4300	6503	SO:0001583	missense	129303			AK098152	CCDS33233.1	2p11.2	2009-06-12	2009-06-12	2009-06-12	ENSG00000168890	ENSG00000168890			24677	protein-coding gene	gene with protein product			"""transmembrane protein 150"""	TMEM150		10858565	Standard	NM_001031738		Approved	TM6P1, FLJ90024	uc002spy.2	Q86TG1	OTTHUMG00000130168	ENST00000409668.1:c.154G>A	2.37:g.85828190C>T	ENSP00000387292:p.Gly52Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K764|B7WPQ9|D6W5L2|Q8N2R6	Missense_Mutation	SNP	ENST00000409668.1	37	CCDS33233.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998689	0.35226	.	.	ENSG00000168890	ENST00000334462;ENST00000409668	T;T	0.44482	0.92;0.92	5.06	4.18	0.49190	.	0.116572	0.64402	D	0.000020	T	0.28001	0.0690	L	0.40543	1.245	0.50813	D	0.999891	B	0.29552	0.248	B	0.25884	0.064	T	0.04255	-1.0965	10	0.08837	T	0.75	-27.3844	9.2416	0.37500	0.0:0.9006:0.0:0.0994	.	52	Q86TG1	T150A_HUMAN	R	52	ENSP00000334708:G52R;ENSP00000387292:G52R	ENSP00000334708:G52R	G	-	1	0	TMEM150A	85681701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.966000	0.63715	1.117000	0.41842	0.655000	0.94253	GGG		0.642	TMEM150A-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329474.1		NM_153342	
TYW1	55253	broad.mit.edu	37	7	66582492	66582492	+	Silent	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr7:66582492C>T	ENST00000359626.5	+	13	1749	c.1585C>T	c.(1585-1587)Ctg>Ttg	p.L529L		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	529					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.L529L(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				GGTTACTCAGCTGTATGTCAG	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	76.0	76.0					7																	66582492		2203	4300	6503	SO:0001819	synonymous_variant	55253			AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.1585C>T	7.37:g.66582492C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Silent	SNP	ENST00000359626.5	37	CCDS5538.1																																																																																				0.398	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2		NM_018264	
UHRF1	29128	broad.mit.edu;hgsc.bcm.edu	37	19	4950899	4950899	+	RNA	SNP	A	A	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:4950899A>G	ENST00000592666.1	+	0	2285							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K583R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		GAGAAGGGGAAGTCCGGGTTT	0.647																																																	1	Substitution - Missense(1)	kidney(1)											72.0	78.0	76.0					19																	4950899		2018	4172	6190			29128			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4950899A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	Missense_Mutation	SNP	ENST00000592666.1	37		.	.	.	.	.	.	.	.	.	.	A	11.59	1.684572	0.29872	.	.	ENSG00000034063	ENST00000262952;ENST00000396708;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.92	4.92	0.64577	SRA-YDG (4);	0.000000	0.85682	D	0.000000	T	0.78052	0.4223	M	0.78049	2.395	0.42803	D	0.993932	D;D	0.60160	0.987;0.963	D;P	0.73380	0.98;0.857	T	0.82868	-0.0244	8	0.49607	T	0.09	7.0E-4	13.729	0.62776	1.0:0.0:0.0:0.0	.	583;570	Q2HIX7;Q96T88	.;UHRF1_HUMAN	R	570;185;570;570;583	.	ENSP00000262952:K570R	K	+	2	0	UHRF1	4901899	1.000000	0.71417	0.667000	0.29798	0.185000	0.23345	9.243000	0.95416	1.849000	0.53698	0.454000	0.30748	AAG		0.647	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000450444.1		NM_001048201	
ULK4	54986	hgsc.bcm.edu	37	3	41860985	41860985	+	Frame_Shift_Del	DEL	T	T	-	rs76318575		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr3:41860985delT	ENST00000301831.4	-	19	2240	c.1778delA	c.(1777-1779)aagfs	p.K593fs		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	593					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.K593fs*17(1)		breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TCTAGGGTTCTTTTTTTTTTC	0.448																																																	1	Deletion - Frameshift(1)	ovary(1)											62.0	63.0	63.0					3																	41860985		1844	4089	5933	SO:0001589	frameshift_variant	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1778delA	3.37:g.41860985delT	ENSP00000301831:p.Lys593fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Frame_Shift_Del	DEL	ENST00000301831.4	37	CCDS43071.1																																																																																				0.448	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1		XM_929989	
UNC13A	23025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17756598	17756598	+	Silent	SNP	G	G	A	rs373430076		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:17756598G>A	ENST00000519716.2	-	19	2240	c.2241C>T	c.(2239-2241)gaC>gaT	p.D747D	UNC13A_ENST00000252773.7_Silent_p.D747D|UNC13A_ENST00000550896.1_Silent_p.D745D|UNC13A_ENST00000428389.2_Silent_p.D835D|UNC13A_ENST00000551649.1_Silent_p.D747D|UNC13A_ENST00000552293.1_Silent_p.D747D	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	747	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.D747D(1)|p.D835D(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						ATTTGATGTCGTCATCCTCGT	0.592													G|||	1	0.000199681	0.0	0.0014	5008	,	,		22421	0.0		0.0	False		,,,				2504	0.0																2	Substitution - coding silent(2)	kidney(2)						G		0,4254		0,0,2127	72.0	73.0	72.0		2241	-1.1	1.0	19		72	1,8507		0,1,4253	no	coding-synonymous	UNC13A	NM_001080421.2		0,1,6380	AA,AG,GG		0.0118,0.0,0.0078		747/1704	17756598	1,12761	2127	4254	6381	SO:0001819	synonymous_variant	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2241C>T	19.37:g.17756598G>A		Somatic		WXS	Illumina HiSeq	Phase_I	E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																				0.592	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2		XM_038604	
UNC45B	146862	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	33495265	33495265	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr17:33495265T>G	ENST00000268876.5	+	10	1434	c.1337T>G	c.(1336-1338)aTc>aGc	p.I446S	UNC45B_ENST00000591048.1_Missense_Mutation_p.I446S|UNC45B_ENST00000394570.2_Missense_Mutation_p.I446S|RP11-799D4.3_ENST00000585646.1_RNA|UNC45B_ENST00000378449.1_Missense_Mutation_p.I446S|UNC45B_ENST00000433649.1_Missense_Mutation_p.I446S	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	446					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.I446S(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GAGGCCCTCATCCATGCCTCC	0.557																																																	1	Substitution - Missense(1)	kidney(1)											109.0	82.0	91.0					17																	33495265		2203	4300	6503	SO:0001583	missense	146862			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1337T>G	17.37:g.33495265T>G	ENSP00000268876:p.Ile446Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.570043	0.86542	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.02	5.02	0.67125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	M	0.73962	2.25	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.997	T	0.68876	-0.5293	10	0.87932	D	0	-28.5699	14.3661	0.66807	0.0:0.0:0.0:1.0	.	446;446;446	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	S	446	ENSP00000378071:I446S;ENSP00000268876:I446S;ENSP00000412840:I446S;ENSP00000367710:I446S	ENSP00000268876:I446S	I	+	2	0	UNC45B	30519378	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.233000	0.73108	0.533000	0.62120	ATC		0.557	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2		NM_173167	
LOC149351	149351	broad.mit.edu	37	1	91296515	91296515	+	lincRNA	DEL	A	A	-			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr1:91296515delA	ENST00000435649.2	-	0	300																											TCAAGAGGGGAAAAAAAGTCT	0.383																																																	0																																												0																															1.37:g.91296515delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000435649.2	37																																																																																					0.383	RP4-665J23.1-004	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000470185.1			
LOC349160	349160	broad.mit.edu	37	7	136848967	136848967	+	RNA	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr7:136848967C>T	ENST00000439694.1	-	0	164				hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000599888.2_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA																							TCGCACCAACCGACCACCTCT	0.517																																																	0																																												0																															7.37:g.136848967C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000439694.1	37																																																																																					0.517	hsa-mir-490.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000341008.1			
LINC01289	286184	broad.mit.edu	37	8	64698000	64698000	+	lincRNA	DEL	C	C	-			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr8:64698000delC	ENST00000519550.1	+	0	3654				RP11-32K4.1_ENST00000523191.1_RNA|RP11-32K4.1_ENST00000524360.1_RNA	NR_038875.1																						GCAAGTGAATCCACCTTGCAT	0.363																																																	0																																												0																															8.37:g.64698000delC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000519550.1	37																																																																																					0.363	RP11-579E24.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000378601.1			
WAS	7454	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	48544489	48544489	+	Silent	SNP	A	A	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:48544489A>T	ENST00000376701.4	+	6	600	c.525A>T	c.(523-525)ccA>ccT	p.P175P	WAS_ENST00000483750.1_3'UTR	NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	175					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)	p.P175P(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				GAGGGCTCCCACCCCTGCCCC	0.557			"""Mis, N, F, S"""			lymphoma																																		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	1	Substitution - coding silent(1)	kidney(1)											80.0	69.0	72.0					X																	48544489		2203	4300	6503	SO:0001819	synonymous_variant	7454			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.525A>T	X.37:g.48544489A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9BU11|Q9UNJ9	Silent	SNP	ENST00000376701.4	37	CCDS14303.1																																																																																				0.557	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1		NM_000377	
WNK3	65267	hgsc.bcm.edu;ucsc.edu	37	X	54276546	54276546	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:54276546G>T	ENST00000375159.2	-	15	2593	c.2594C>A	c.(2593-2595)tCa>tAa	p.S865*	WNK3_ENST00000375169.3_Nonsense_Mutation_p.S865*|WNK3_ENST00000354646.2_Nonsense_Mutation_p.S865*			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	865					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						AACTGGGGATGACTGAGGAGC	0.403																																																	0													38.0	33.0	34.0					X																	54276546		2203	4300	6503	SO:0001587	stop_gained	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.2594C>A	X.37:g.54276546G>T	ENSP00000364301:p.Ser865*	Somatic		WXS	Illumina HiSeq	Phase_I	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Nonsense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	G	41	8.856638	0.98980	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	.	.	.	5.5	5.5	0.81552	.	0.000000	0.47093	D	0.000250	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6394	17.1006	0.86648	0.0:0.0:1.0:0.0	.	.	.	.	X	865	.	ENSP00000346667:S865X	S	-	2	0	WNK3	54293271	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.917000	0.87498	2.302000	0.77476	0.506000	0.49869	TCA		0.403	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2		NM_020922	
YIPF4	84272	broad.mit.edu;ucsc.edu	37	2	32517399	32517399	+	Silent	SNP	A	A	G			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr2:32517399A>G	ENST00000238831.4	+	3	633	c.387A>G	c.(385-387)tcA>tcG	p.S129S		NM_032312.3	NP_115688.1	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	129						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)		p.S129S(1)		kidney(2)|lung(3)|prostate(3)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					CCATGATATCATTATATGGAC	0.299																																																	1	Substitution - coding silent(1)	kidney(1)											111.0	108.0	109.0					2																	32517399		2203	4300	6503	SO:0001819	synonymous_variant	84272			AK098486	CCDS1781.1	2p22.3	2008-02-05			ENSG00000119820	ENSG00000119820		"""Yip1 domain family"""	28145	protein-coding gene	gene with protein product						12477932	Standard	NM_032312		Approved	MGC11061, FinGER4	uc002rok.3	Q9BSR8	OTTHUMG00000128452	ENST00000238831.4:c.387A>G	2.37:g.32517399A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000238831.4	37	CCDS1781.1																																																																																				0.299	YIPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250250.3		NM_032312	
YLPM1	56252	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	75248651	75248651	+	Silent	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr14:75248651C>T	ENST00000552421.1	+	4	2029	c.1905C>T	c.(1903-1905)ccC>ccT	p.P635P	YLPM1_ENST00000325680.7_Silent_p.P635P|YLPM1_ENST00000238571.3_Silent_p.P440P			P49750	YLPM1_HUMAN	YLP motif containing 1	0					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.P635P(1)|p.P440P(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GAATACCTCCCCCTGGAGTTC	0.557																																																	2	Substitution - coding silent(2)	kidney(2)											87.0	91.0	89.0					14																	75248651		2011	4169	6180	SO:0001819	synonymous_variant	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1905C>T	14.37:g.75248651C>T		Somatic		WXS	Illumina HiSeq	Phase_I	P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000552421.1	37																																																																																					0.557	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1		NM_019589	
ZNF429	353088	broad.mit.edu;hgsc.bcm.edu	37	19	21720845	21720845	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr19:21720845A>T	ENST00000358491.4	+	4	2198	c.1990A>T	c.(1990-1992)Atc>Ttc	p.I664F	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I664F(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						aggtgggcggatcacgaggtc	0.463																																																	1	Substitution - Missense(1)	kidney(1)											23.0	23.0	23.0					19																	21720845		1876	4109	5985	SO:0001583	missense	353088			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1990A>T	19.37:g.21720845A>T	ENSP00000351280:p.Ile664Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	9.004	0.980870	0.18812	.	.	ENSG00000197013	ENST00000358491	T	0.52754	0.65	0.418	0.418	0.16429	.	.	.	.	.	T	0.43077	0.1231	M	0.80616	2.505	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.37478	-0.9704	9	0.19147	T	0.46	.	4.9353	0.13937	1.0:0.0:0.0:0.0	.	664	Q86V71	ZN429_HUMAN	F	664	ENSP00000351280:I664F	ENSP00000351280:I664F	I	+	1	0	ZNF429	21512685	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.220000	0.09215	0.402000	0.25451	0.392000	0.25879	ATC		0.463	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1		NM_001001415	
ZNF512B	57473	broad.mit.edu;hgsc.bcm.edu	37	20	62596015	62596015	+	Silent	SNP	C	C	T			TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chr20:62596015C>T	ENST00000450537.1	-	6	1149	c.1089G>A	c.(1087-1089)gaG>gaA	p.E363E	ZNF512B_ENST00000217130.3_Silent_p.E363E|ZNF512B_ENST00000369888.1_Silent_p.E363E			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E363E(1)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ACTCCCCATTCTCTGGCCTGG	0.667																																																	1	Substitution - coding silent(1)	kidney(1)											65.0	57.0	60.0					20																	62596015		2203	4300	6503	SO:0001819	synonymous_variant	57473			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1089G>A	20.37:g.62596015C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																				0.667	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1		NM_020713	
ZNF75D	7626	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	134427883	134427883	+	Missense_Mutation	SNP	C	C	T	rs370618867		TCGA-A3-3358-01A-01D-1534-10	TCGA-A3-3358-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fd42afa7-6f0f-48e8-a947-bb9c9f4770ef	a7a2b9c5-641d-4644-99d2-a4beeac3aa0e	g.chrX:134427883C>T	ENST00000370766.3	-	3	2893	c.184G>A	c.(184-186)Gga>Aga	p.G62R	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Missense_Mutation_p.G62R	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	62	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G62R(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TCAAGCGGTCCGGTTGCTTCA	0.473																																																	1	Substitution - Missense(1)	kidney(1)						C	ARG/GLY,ARG/GLY	0,3835		0,0,1632,571	90.0	78.0	82.0		184,184	2.1	0.0	X		82	1,6727		0,1,2427,1872	no	missense,missense	ZNF75D	NM_001185063.1,NM_007131.3	125,125	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging	62/416,62/511	134427883	1,10562	2203	4300	6503	SO:0001583	missense	7626			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.184G>A	X.37:g.134427883C>T	ENSP00000359802:p.Gly62Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	ENST00000370766.3	37	CCDS14648.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.576290	0.45902	0.0	1.49E-4	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.06294	3.32;3.32	2.99	2.08	0.27032	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.18593	0.0446	M	0.83852	2.665	0.09310	N	1	D;D	0.69078	0.993;0.997	P;P	0.56916	0.809;0.809	T	0.05451	-1.0884	9	0.72032	D	0.01	.	7.0197	0.24907	0.0:0.7216:0.2784:0.0	.	62;62	P51815;A6NK62	ZN75D_HUMAN;.	R	62	ENSP00000359802:G62R;ENSP00000359800:G62R	ENSP00000359800:G62R	G	-	1	0	ZNF75D	134255549	0.507000	0.26146	0.002000	0.10522	0.068000	0.16541	2.265000	0.43311	0.628000	0.30357	0.509000	0.49947	GGA		0.473	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058415.1		NM_007131	
