#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACVR1B	91	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	52374878	52374878	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr12:52374878T>C	ENST00000257963.4	+	4	783	c.706T>C	c.(706-708)Ttc>Ctc	p.F236L	ACVR1B_ENST00000542485.1_Missense_Mutation_p.F184L|ACVR1B_ENST00000415850.2_Missense_Mutation_p.F236L|ACVR1B_ENST00000541224.1_Missense_Mutation_p.F236L|ACVR1B_ENST00000426655.2_Missense_Mutation_p.F236L	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	236	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.F236L(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TGTGAAAATATTCTCTTCTCG	0.502											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - Missense(2)	kidney(2)											103.0	100.0	101.0					12																	52374878		2203	4300	6503	SO:0001583	missense	91				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.706T>C	12.37:g.52374878T>C	ENSP00000257963:p.Phe236Leu	Somatic	984	WXS	Illumina HiSeq	Phase_I	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	T	33	5.209465	0.95069	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9	5.02	5.02	0.67125	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94318	0.8174	L	0.47190	1.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;0.998;0.999	D	0.95009	0.8150	10	0.87932	D	0	.	15.0788	0.72099	0.0:0.0:0.0:1.0	.	236;236;236;236	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	L	236;236;236;236;184	ENSP00000257963:F236L;ENSP00000442656:F236L;ENSP00000390477:F236L;ENSP00000397550:F236L;ENSP00000442885:F184L	ENSP00000257963:F236L	F	+	1	0	ACVR1B	50661145	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	8.040000	0.89188	2.031000	0.59945	0.533000	0.62120	TTC		0.502	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1		NM_020328	
AGAP6	414189	hgsc.bcm.edu	37	10	51748682	51748682	+	Frame_Shift_Del	DEL	C	C	-	rs575835505	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr10:51748682delC	ENST00000374056.4	+	1	605	c.207delC	c.(205-207)gacfs	p.D69fs	AGAP6_ENST00000412531.3_Frame_Shift_Del_p.D69fs			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	69					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						ACGTTCGTGACCGGGAGATGC	0.592													cc|CC|C|deletion	315	0.0628994	0.1316	0.0231	5008	,	,		19596	0.0248		0.0527	False		,,,				2504	0.0481																0																																										SO:0001589	frameshift_variant	414189				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.207delC	10.37:g.51748682delC	ENSP00000363168:p.Asp69fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000374056.4	37																																																																																					0.592	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001077665	
AHNAK2	113146	broad.mit.edu	37	14	105413709	105413709	+	Silent	SNP	G	G	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr14:105413709G>T	ENST00000333244.5	-	7	8198	c.8079C>A	c.(8077-8079)acC>acA	p.T2693T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2693						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.T2693T(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGATGTCAGTGGTCTTAAGGT	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											157.0	172.0	167.0					14																	105413709		2013	4182	6195	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8079C>A	14.37:g.105413709G>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1		NM_138420	
AKAP13	11214	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	86279333	86279333	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr15:86279333A>T	ENST00000394518.2	+	33	7620	c.7525A>T	c.(7525-7527)Aac>Tac	p.N2509Y	AKAP13_ENST00000394510.2_Missense_Mutation_p.N754Y|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.N2513Y	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2509	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.N2513Y(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TGGAAATGCTAACCTGGTATT	0.299																																					Melanoma(94;603 1453 3280 32295 32951)												1	Substitution - Missense(1)	kidney(1)											119.0	116.0	117.0					15																	86279333		2202	4299	6501	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7525A>T	15.37:g.86279333A>T	ENSP00000378026:p.Asn2509Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580672	0.65992	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.22539	1.95;1.95;1.95	5.75	5.75	0.90469	.	.	.	.	.	T	0.45175	0.1329	M	0.76574	2.34	0.51012	D	0.999902	D;D	0.76494	0.999;0.993	D;D	0.65573	0.936;0.911	T	0.44283	-0.9338	9	0.66056	D	0.02	.	13.8117	0.63268	1.0:0.0:0.0:0.0	.	2509;2513	Q12802;Q12802-2	AKP13_HUMAN;.	Y	2513;2509;2512;2488;754	ENSP00000354718:N2513Y;ENSP00000378026:N2509Y;ENSP00000378018:N754Y	ENSP00000354718:N2513Y	N	+	1	0	AKAP13	84080337	1.000000	0.71417	0.993000	0.49108	0.406000	0.30931	6.822000	0.75277	2.194000	0.70268	0.533000	0.62120	AAC		0.299	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1		NM_007200	
C17orf53	78995	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	42225574	42225574	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr17:42225574C>T	ENST00000319977.4	+	3	640	c.403C>T	c.(403-405)Cac>Tac	p.H135Y	C17orf53_ENST00000245382.6_Missense_Mutation_p.H135Y|C17orf53_ENST00000585683.1_Missense_Mutation_p.H135Y	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	135								p.H135Y(1)		NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTCAGCCTTACACCCCCTACT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											139.0	147.0	144.0					17																	42225574		2203	4300	6503	SO:0001583	missense	78995			AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.403C>T	17.37:g.42225574C>T	ENSP00000313500:p.His135Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	c	12.35	1.911512	0.33721	.	.	ENSG00000125319	ENST00000319977;ENST00000245382	T;T	0.44482	0.92;0.92	5.02	0.79	0.18613	.	1.081740	0.07028	N	0.827991	T	0.38558	0.1045	L	0.55481	1.735	0.09310	N	1	P;P;P	0.52316	0.867;0.681;0.952	B;B;B	0.44044	0.439;0.372;0.439	T	0.26258	-1.0108	10	0.45353	T	0.12	0.3949	4.8113	0.13345	0.0:0.4618:0.2923:0.2459	.	135;135;135	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	Y	135	ENSP00000313500:H135Y;ENSP00000245382:H135Y	ENSP00000245382:H135Y	H	+	1	0	C17orf53	39581100	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.769000	0.04710	0.047000	0.15862	-0.927000	0.02713	CAC		0.512	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1		NM_024032	
C17orf80	55028	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	71232490	71232490	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr17:71232490T>G	ENST00000535032.2	+	2	982	c.869T>G	c.(868-870)aTc>aGc	p.I290S	FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000268942.8_Missense_Mutation_p.I290S|C17orf80_ENST00000426147.2_Missense_Mutation_p.I290S|C17orf80_ENST00000577615.1_Missense_Mutation_p.I290S|C17orf80_ENST00000359042.2_Missense_Mutation_p.I290S|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000255557.4_Missense_Mutation_p.I290S			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	290						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.I290S(1)		kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			TTAGGTAAAATCCAAGTCATG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											53.0	52.0	53.0					17																	71232490		2203	4300	6503	SO:0001583	missense	55028			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.869T>G	17.37:g.71232490T>G	ENSP00000440551:p.Ile290Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Missense_Mutation	SNP	ENST00000535032.2	37	CCDS11694.1	.	.	.	.	.	.	.	.	.	.	T	14.12	2.439735	0.43326	.	.	ENSG00000141219	ENST00000255557;ENST00000359042;ENST00000268942;ENST00000426147;ENST00000535032	D;T;D;D;T	0.83837	-1.77;2.49;-1.77;-1.77;2.49	5.11	-1.06	0.10002	.	1.226200	0.05710	N	0.595769	T	0.70159	0.3192	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.29988	0.264;0.264;0.138;0.169	B;B;B;B	0.24701	0.055;0.055;0.033;0.046	T	0.52003	-0.8633	10	0.14656	T	0.56	-1.1251	5.0176	0.14345	0.0:0.4175:0.1754:0.4071	.	290;290;290;290	B7Z7E5;Q9BSJ5;Q9BSJ5-2;Q9BSJ5-3	.;CQ080_HUMAN;.;.	S	290	ENSP00000255557:I290S;ENSP00000351937:I290S;ENSP00000268942:I290S;ENSP00000396970:I290S;ENSP00000440551:I290S	ENSP00000255557:I290S	I	+	2	0	C17orf80	68744085	0.000000	0.05858	0.000000	0.03702	0.863000	0.49368	-1.067000	0.03451	-0.002000	0.14469	0.459000	0.35465	ATC		0.428	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441893.1		NM_017941	
FAM221A	340277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	23728936	23728936	+	Silent	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr7:23728936C>T	ENST00000344962.4	+	3	377	c.288C>T	c.(286-288)ccC>ccT	p.P96P	FAM221A_ENST00000409192.3_Silent_p.P96P|FAM221A_ENST00000409653.1_Silent_p.P38P|FAM221A_ENST00000409994.3_Silent_p.P38P	NM_199136.3	NP_954587.2	A4D161	F221A_HUMAN	family with sequence similarity 221, member A	96								p.P96P(1)									AGCAGTGCCCCATTGATCTGC	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	84.0	85.0					7																	23728936		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5385.1, CCDS47561.1, CCDS47562.1, CCDS75570.1	7p15.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000188732	ENSG00000188732			27977	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 46"""	C7orf46		12477932	Standard	XR_242080		Approved	FLJ45875, MGC72075, DKFZp686F0810	uc003swo.4	A4D161	OTTHUMG00000128463	ENST00000344962.4:c.288C>T	7.37:g.23728936C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q05CG4|Q4G0Q7|Q6P519	Silent	SNP	ENST00000344962.4	37	CCDS5385.1																																																																																				0.448	FAM221A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250261.1		NM_199136	
CAPRIN2	65981	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	30868061	30868061	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr12:30868061C>T	ENST00000298892.5	-	14	3082	c.2332G>A	c.(2332-2334)Gat>Aat	p.D778N	CAPRIN2_ENST00000417045.1_Missense_Mutation_p.D827N|CAPRIN2_ENST00000395805.2_Intron|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.D828N|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.D494N	NM_023925.3	NP_076414.2			caprin family member 2									p.D828N(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ATAGTTCCATCAGGATGATAA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											130.0	124.0	126.0					12																	30868061		2203	4300	6503	SO:0001583	missense	65981			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2332G>A	12.37:g.30868061C>T	ENSP00000298892:p.Asp778Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000298892.5	37	CCDS8720.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695827	0.88830	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000251071;ENST00000308433;ENST00000417045	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.54	5.54	0.83059	.	0.252414	0.39985	N	0.001202	T	0.46870	0.1415	L	0.57536	1.79	0.40733	D	0.982762	D;D;P;D	0.60575	0.988;0.984;0.893;0.959	P;P;B;P	0.60236	0.871;0.834;0.415;0.652	T	0.44190	-0.9344	10	0.72032	D	0.01	-19.5742	19.4949	0.95069	0.0:1.0:0.0:0.0	.	827;828;778;827	Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;CAPR2_HUMAN;.;.	N	573;778;828;494;827	ENSP00000415407:D573N;ENSP00000298892:D778N;ENSP00000251071:D828N;ENSP00000309785:D494N;ENSP00000391479:D827N	ENSP00000251071:D828N	D	-	1	0	CAPRIN2	30759328	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.044000	0.49830	2.601000	0.87937	0.655000	0.94253	GAT		0.373	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402778.1		NM_023925	
CBFA2T2	9139	broad.mit.edu	37	20	32198915	32198915	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr20:32198915A>G	ENST00000346541.3	+	4	758	c.221A>G	c.(220-222)aAc>aGc	p.N74S	CBFA2T2_ENST00000397800.1_Missense_Mutation_p.N45S|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.N74S|CBFA2T2_ENST00000397798.2_Missense_Mutation_p.N45S|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.N84S|CBFA2T2_ENST00000344201.3_Missense_Mutation_p.N45S|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.N65S|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.N45S	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	74	Pro-rich.				epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.N74S(1)|p.N65S(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						AATGGCATCAACCATTCTCCT	0.428																																					Esophageal Squamous(174;142 1955 14837 21276 28041)												2	Substitution - Missense(2)	kidney(2)											121.0	108.0	112.0					20																	32198915		2203	4300	6503	SO:0001583	missense	9139			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.221A>G	20.37:g.32198915A>G	ENSP00000262653:p.Asn74Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	37	CCDS13221.1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.421376	0.62622	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000417366;ENST00000344201;ENST00000346541;ENST00000397800;ENST00000397798;ENST00000454955;ENST00000359606	T;T;T;T;T	0.38887	1.12;1.12;1.12;1.11;1.7	5.54	3.25	0.37280	.	0.088393	0.85682	N	0.000000	T	0.22820	0.0551	N	0.11201	0.11	0.80722	D	1	P;P	0.52463	0.953;0.925	B;P	0.46339	0.446;0.513	T	0.13575	-1.0504	10	0.02654	T	1	-5.7037	10.2679	0.43466	0.8758:0.0:0.1242:0.0	.	74;65	O43439;F8W6D7	MTG8R_HUMAN;.	S	74;65;65;45;74;45;45;74;84	ENSP00000364428:N74S;ENSP00000345810:N65S;ENSP00000262653:N74S;ENSP00000380902:N45S;ENSP00000352622:N84S	ENSP00000345810:N65S	N	+	2	0	CBFA2T2	31662576	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.469000	0.35343	0.373000	0.24621	0.533000	0.62120	AAC		0.428	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2		NM_001032999	
CNTNAP3	79937	hgsc.bcm.edu	37	9	39103777	39103777	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr9:39103777delG	ENST00000297668.6	-	16	2573	c.2500delC	c.(2500-2502)ctgfs	p.L834fs	CNTNAP3_ENST00000358144.2_Frame_Shift_Del_p.L746fs|CNTNAP3_ENST00000377656.2_Frame_Shift_Del_p.L833fs	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	834	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GTGATCCCCAGGTTCTCCATA	0.463																																																	0													44.0	49.0	47.0					9																	39103777		2203	4300	6503	SO:0001589	frameshift_variant	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2500delC	9.37:g.39103777delG	ENSP00000297668:p.Leu834fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMA0|Q9C0E9	Frame_Shift_Del	DEL	ENST00000297668.6	37	CCDS6616.1																																																																																				0.463	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1		NM_033655	
COL4A6	1288	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	107457373	107457373	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chrX:107457373G>A	ENST00000372216.4	-	6	513	c.413C>T	c.(412-414)cCt>cTt	p.P138L	COL4A6_ENST00000545689.1_Missense_Mutation_p.P137L|COL4A6_ENST00000538570.1_Missense_Mutation_p.P137L|COL4A6_ENST00000334504.7_Missense_Mutation_p.P137L|COL4A6_ENST00000394872.2_Missense_Mutation_p.P136L	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	138	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P137L(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						ATAGCCATCAGGGCCTGGAAA	0.522									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												1	Substitution - Missense(1)	kidney(1)											100.0	88.0	92.0					X																	107457373		2203	4300	6503	SO:0001583	missense	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.413C>T	X.37:g.107457373G>A	ENSP00000361290:p.Pro138Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753653	0.31046	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.96685	-4.09;-4.09;-3.84;-4.09;-4.09	4.92	3.07	0.35406	.	0.391459	0.18904	N	0.127945	D	0.91277	0.7250	N	0.25380	0.74	0.40487	D	0.980508	B;B;B;B	0.15719	0.012;0.012;0.014;0.012	B;B;B;B	0.17098	0.01;0.01;0.017;0.01	D	0.84132	0.0412	10	0.16420	T	0.52	.	11.0245	0.47736	0.0:0.0:0.6641:0.3359	.	137;137;138;137	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	L	138;137;136;137;137;137	ENSP00000361290:P138L;ENSP00000334733:P137L;ENSP00000378340:P136L;ENSP00000443707:P137L;ENSP00000445236:P137L	ENSP00000334733:P137L	P	-	2	0	COL4A6	107344029	0.811000	0.29063	0.993000	0.49108	0.982000	0.71751	1.316000	0.33620	0.502000	0.28037	0.506000	0.49869	CCT		0.522	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			
COL6A1	1291	broad.mit.edu	37	21	47409686	47409686	+	Silent	SNP	G	G	T	rs374654116		TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr21:47409686G>T	ENST00000361866.3	+	11	1038	c.924G>T	c.(922-924)ggG>ggT	p.G308G		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	308	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)	p.G308G(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GGAGCCGTGGGGAGAAGGTGA	0.627																																																	1	Substitution - coding silent(1)	kidney(1)											126.0	85.0	99.0					21																	47409686		2203	4300	6503	SO:0001819	synonymous_variant	1291			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.924G>T	21.37:g.47409686G>T		Somatic		WXS	Illumina GAIIx	Phase_I	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	ENST00000361866.3	37	CCDS13727.1																																																																																				0.627	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1		NM_001848	
CTDSPL2	51496	broad.mit.edu;ucsc.edu	37	15	44776439	44776439	+	Silent	SNP	T	T	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr15:44776439T>G	ENST00000260327.4	+	3	767	c.204T>G	c.(202-204)ccT>ccG	p.P68P	CTDSPL2_ENST00000558966.1_Silent_p.P68P|CTDSPL2_ENST00000396780.1_Silent_p.P68P|CTDSPL2_ENST00000558373.1_Silent_p.P68P	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	68							phosphoprotein phosphatase activity (GO:0004721)	p.P68P(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		GAGAAAATCCTTCAAAACGGA	0.333																																																	1	Substitution - coding silent(1)	kidney(1)											74.0	68.0	70.0					15																	44776439		2198	4298	6496	SO:0001819	synonymous_variant	51496			AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.204T>G	15.37:g.44776439T>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Silent	SNP	ENST00000260327.4	37	CCDS10110.1																																																																																				0.333	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1		NM_016396	
CYP2J2	1573	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	60359336	60359336	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:60359336A>T	ENST00000371204.3	-	9	1539	c.1496T>A	c.(1495-1497)gTt>gAt	p.V499D	CYP2J2_ENST00000492633.1_5'UTR	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	499					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.V499D(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	CACCTGAGGAACAGCGCAGAG	0.468																																																	1	Substitution - Missense(1)	kidney(1)											292.0	317.0	308.0					1																	60359336		2203	4300	6503	SO:0001583	missense	1573			BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.1496T>A	1.37:g.60359336A>T	ENSP00000360247:p.Val499Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.521654	0.85600	.	.	ENSG00000134716	ENST00000371204	T	0.80214	-1.35	5.88	5.88	0.94601	.	0.819556	0.11160	N	0.593137	T	0.71804	0.3383	N	0.08118	0	0.53005	D	0.999961	P	0.44380	0.834	P	0.45474	0.482	T	0.73285	-0.4031	10	0.87932	D	0	.	13.832	0.63386	1.0:0.0:0.0:0.0	.	499	P51589	CP2J2_HUMAN	D	499	ENSP00000360247:V499D	ENSP00000360247:V499D	V	-	2	0	CYP2J2	60131924	0.595000	0.26857	0.340000	0.25575	0.610000	0.37248	5.458000	0.66679	2.255000	0.74692	0.533000	0.62120	GTT		0.468	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1		NM_000775	
DDX50	79009	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	70670871	70670871	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr10:70670871C>G	ENST00000373585.3	+	4	615	c.508C>G	c.(508-510)Cct>Gct	p.P170A	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	170	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.P170A(1)		breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						GACCTTTGGTCCTGTATATGA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											134.0	139.0	137.0					10																	70670871		2203	4300	6503	SO:0001583	missense	79009			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.508C>G	10.37:g.70670871C>G	ENSP00000362687:p.Pro170Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	9.850	1.193535	0.22037	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.13420	2.59	5.22	5.22	0.72569	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.204155	0.52532	D	0.000066	T	0.08714	0.0216	N	0.13299	0.325	0.33063	D	0.534341	B;B	0.20368	0.044;0.024	B;B	0.20577	0.03;0.027	T	0.15723	-1.0427	10	0.15952	T	0.53	-10.6962	14.0909	0.64990	0.1506:0.8494:0.0:0.0	.	170;170	Q9BQ39;B4DED6	DDX50_HUMAN;.	A	170	ENSP00000362687:P170A	ENSP00000362687:P170A	P	+	1	0	DDX50	70340877	0.031000	0.19500	0.997000	0.53966	0.997000	0.91878	1.307000	0.33516	2.598000	0.87819	0.485000	0.47835	CCT		0.353	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1		NM_024045	
FAM47B	170062	broad.mit.edu	37	X	34961787	34961787	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chrX:34961787C>T	ENST00000329357.5	+	1	875	c.839C>T	c.(838-840)gCg>gTg	p.A280V		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	280	Pro-rich.							p.A280V(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GATACTGGAGCGTCCCATCTC	0.632																																																	1	Substitution - Missense(1)	kidney(1)											57.0	54.0	55.0					X																	34961787		2202	4300	6502	SO:0001583	missense	170062			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.839C>T	X.37:g.34961787C>T	ENSP00000328307:p.Ala280Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.505051	0.00010	.	.	ENSG00000189132	ENST00000329357	T	0.12984	2.63	0.235	-0.47	0.12131	.	.	.	.	.	T	0.02970	0.0088	N	0.00337	-1.62	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.42783	-0.9431	9	0.23302	T	0.38	.	6.573	0.22549	0.0:0.4543:0.0:0.5457	.	280	Q8NA70	FA47B_HUMAN	V	280	ENSP00000328307:A280V	ENSP00000328307:A280V	A	+	2	0	FAM47B	34871708	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.771000	0.00779	-3.428000	0.00165	-3.424000	0.00037	GCG		0.632	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1		NM_152631	
FZD4	8322	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	86662562	86662562	+	Silent	SNP	G	G	C			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr11:86662562G>C	ENST00000531380.1	-	2	1541	c.1236C>G	c.(1234-1236)gcC>gcG	p.A412A	PRSS23_ENST00000531521.1_3'UTR|PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	412					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.A412A(1)		breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTTTGAACAAGGCCACCAAAC	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											141.0	131.0	134.0					11																	86662562		2201	4299	6500	SO:0001819	synonymous_variant	8322			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1236C>G	11.37:g.86662562G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9Q3|Q14C97|Q6S9E4	Silent	SNP	ENST00000531380.1	37	CCDS8279.1																																																																																				0.448	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2		NM_012193	
GOLGA6L10	647042	broad.mit.edu	37	15	82635163	82635163	+	Silent	SNP	C	C	G	rs28429808	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr15:82635163C>G	ENST00000439287.4	-	9	1506	c.1407G>C	c.(1405-1407)gcG>gcC	p.A469A		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	469								p.A469A(10)		endometrium(1)|kidney(4)	5						CCCTGTTCTCCGCAGCCCGAA	0.478																																																	10	Substitution - coding silent(10)	kidney(8)|endometrium(2)																																								SO:0001819	synonymous_variant	647042				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.1407G>C	15.37:g.82635163C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000439287.4	37	CCDS45325.1																																																																																				0.478	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419403.2		NM_001164465	
GYS1	2997	broad.mit.edu;ucsc.edu	37	19	49477487	49477487	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr19:49477487G>C	ENST00000323798.3	-	12	1728	c.1532C>G	c.(1531-1533)cCt>cGt	p.P511R	GYS1_ENST00000544287.1_Missense_Mutation_p.P144R|GYS1_ENST00000263276.6_Missense_Mutation_p.P447R|GYS1_ENST00000541188.1_Missense_Mutation_p.P431R	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	511					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)	p.P511R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GTAGCCCCAAGGCTCATAGTA	0.602																																																	1	Substitution - Missense(1)	kidney(1)											39.0	31.0	33.0					19																	49477487		2203	4300	6503	SO:0001583	missense	2997				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1532C>G	19.37:g.49477487G>C	ENSP00000317904:p.Pro511Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401309	0.83120	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91773	0.5429	10	0.87932	D	0	-11.6716	16.2011	0.82078	0.0:0.0:1.0:0.0	.	431;447;511	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	R	511;447;431;144	ENSP00000317904:P511R;ENSP00000263276:P447R;ENSP00000437922:P431R;ENSP00000444004:P144R	ENSP00000263276:P447R	P	-	2	0	GYS1	54169299	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.650000	0.98490	2.491000	0.84063	0.561000	0.74099	CCT		0.602	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1		NM_002103	
HPCAL1	3241	broad.mit.edu	37	2	10560058	10560058	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr2:10560058G>A	ENST00000381765.3	+	4	701	c.175G>A	c.(175-177)Ggc>Agc	p.G59S	HPCAL1_ENST00000307845.3_Missense_Mutation_p.G59S	NM_134421.2	NP_602293.1	P37235	HPCL1_HUMAN	hippocalcin-like 1	59					signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G59S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		CTTCCCCTACGGCGACGCTTC	0.607																																					Pancreas(70;1384 1800 31595 46836)												1	Substitution - Missense(1)	kidney(1)											109.0	87.0	95.0					2																	10560058		2203	4300	6503	SO:0001583	missense	3241				CCDS1671.1	2p25.1	2013-01-10			ENSG00000115756	ENSG00000115756		"""EF-hand domain containing"""	5145	protein-coding gene	gene with protein product	"""visinin-like protein 3"", ""calcium-binding protein BDR-1"""	600207				8038222, 14739275	Standard	NM_002149		Approved	BDR1, HLP2, VILIP-3	uc031rnq.1	P37235	OTTHUMG00000090451	ENST00000381765.3:c.175G>A	2.37:g.10560058G>A	ENSP00000371184:p.Gly59Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q969S5	Missense_Mutation	SNP	ENST00000381765.3	37	CCDS1671.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951872	0.92660	.	.	ENSG00000115756	ENST00000307845;ENST00000381765	T;T	0.29142	1.58;1.58	5.17	3.34	0.38264	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46639	0.1403	M	0.76002	2.32	0.80722	D	1	D	0.65815	0.995	P	0.56163	0.793	T	0.42732	-0.9434	9	.	.	.	.	11.836	0.52323	0.145:0.0:0.855:0.0	.	59	P37235	HPCL1_HUMAN	S	59	ENSP00000310749:G59S;ENSP00000371184:G59S	.	G	+	1	0	HPCAL1	10477509	1.000000	0.71417	0.920000	0.36463	0.862000	0.49288	7.943000	0.87716	0.548000	0.28955	0.561000	0.74099	GGC		0.607	HPCAL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206898.1		NM_002149	
HSPA4L	22824	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	128729255	128729255	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr4:128729255A>T	ENST00000296464.4	+	11	1760	c.1349A>T	c.(1348-1350)cAt>cTt	p.H450L	HSPA4L_ENST00000439123.2_Missense_Mutation_p.H481L|HSPA4L_ENST00000508776.1_Missense_Mutation_p.H450L|HSPA4L_ENST00000505726.1_Missense_Mutation_p.H424L	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	450					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.H450L(1)		central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						ACTAATTTACATGAAGTGCCT	0.318																																																	1	Substitution - Missense(1)	kidney(1)											79.0	80.0	80.0					4																	128729255		2203	4298	6501	SO:0001583	missense	22824			AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.1349A>T	4.37:g.128729255A>T	ENSP00000296464:p.His450Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2ICT2|Q4W5M5|Q8IWA2	Missense_Mutation	SNP	ENST00000296464.4	37	CCDS3734.1	.	.	.	.	.	.	.	.	.	.	A	15.59	2.879172	0.51801	.	.	ENSG00000164070	ENST00000508776;ENST00000439123;ENST00000296464;ENST00000508549;ENST00000505726	T;T;T;T;T	0.04360	3.64;3.64;3.64;3.64;3.64	4.99	3.81	0.43845	.	0.185311	0.48286	D	0.000198	T	0.05823	0.0152	L	0.34521	1.04	0.39596	D	0.969656	B;B;B	0.32010	0.022;0.351;0.175	B;B;B	0.37780	0.063;0.258;0.061	T	0.42361	-0.9456	10	0.45353	T	0.12	.	10.6497	0.45640	0.9247:0.0:0.0753:0.0	.	424;450;450	E9PDE8;A2ICT2;O95757	.;.;HS74L_HUMAN	L	450;481;450;409;424	ENSP00000422482:H450L;ENSP00000393926:H481L;ENSP00000296464:H450L;ENSP00000427305:H409L;ENSP00000425645:H424L	ENSP00000296464:H450L	H	+	2	0	HSPA4L	128948705	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	4.409000	0.59768	0.919000	0.36945	0.533000	0.62120	CAT		0.318	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3		NM_014278	
IGSF10	285313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	151160939	151160939	+	Silent	SNP	A	A	C			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:151160939A>C	ENST00000282466.3	-	5	5795	c.5796T>G	c.(5794-5796)ctT>ctG	p.L1932L	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1932	Ig-like C2-type 5.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.L1932L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTTCCATTGTAAGCATTACTA	0.463																																																	1	Substitution - coding silent(1)	kidney(1)											120.0	122.0	121.0					3																	151160939		2203	4300	6503	SO:0001819	synonymous_variant	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5796T>G	3.37:g.151160939A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																				0.463	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1		NM_178822	
ILF2	3608	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	153637769	153637769	+	Silent	SNP	A	A	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:153637769A>G	ENST00000361891.4	-	8	629	c.504T>C	c.(502-504)tcT>tcC	p.S168S	ILF2_ENST00000480213.1_5'Flank	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	168	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)	p.S168S(1)		cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAGCATCAGAAGAACTGATTT	0.358																																																	1	Substitution - coding silent(1)	kidney(1)											104.0	101.0	102.0					1																	153637769		2203	4300	6503	SO:0001819	synonymous_variant	3608			U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.504T>C	1.37:g.153637769A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Silent	SNP	ENST00000361891.4	37	CCDS1050.1																																																																																				0.358	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090040.1		NM_004515	
KCNAB1	7881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	156009745	156009745	+	Intron	SNP	G	G	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:156009745G>T	ENST00000490337.1	+	2	339				KCNAB1_ENST00000389636.5_Intron|KCNAB1_ENST00000302490.8_Missense_Mutation_p.G17C|KCNAB1_ENST00000471742.1_Intron|KCNAB1_ENST00000389634.5_Missense_Mutation_p.G17C	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.G17C(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GAGTCGGAATGGTGAGGACCG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											75.0	71.0	72.0					3																	156009745		2203	4300	6503	SO:0001627	intron_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.276-129660G>T	3.37:g.156009745G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	37	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628270	0.87560	.	.	ENSG00000169282	ENST00000302490;ENST00000389634	T;T	0.10382	3.22;2.88	5.04	5.04	0.67666	.	0.264408	0.37483	N	0.002066	T	0.21509	0.0518	L	0.44542	1.39	0.80722	D	1	P;P	0.50443	0.935;0.835	P;P	0.54460	0.753;0.682	T	0.00426	-1.1746	10	0.66056	D	0.02	.	17.9603	0.89083	0.0:0.0:1.0:0.0	.	17;17	F8W6W4;B3KPZ4	.;.	C	17	ENSP00000305858:G17C;ENSP00000374285:G17C	ENSP00000305858:G17C	G	+	1	0	KCNAB1	157492439	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.615000	0.98356	2.349000	0.79799	0.460000	0.39030	GGT		0.597	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1		NM_003471	
SZT2	23334	broad.mit.edu;ucsc.edu	37	1	43897031	43897031	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:43897031C>T	ENST00000562955.1	+	33	4841	c.4841C>T	c.(4840-4842)cCa>cTa	p.P1614L	SZT2_ENST00000372442.1_Missense_Mutation_p.P772L	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1671					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.P772L(2)|p.P1614L(1)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTGCCACCCCCAGAAGAGGAG	0.463																																																	3	Substitution - Missense(3)	kidney(3)											104.0	116.0	112.0					1																	43897031		2203	4300	6503	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.4841C>T	1.37:g.43897031C>T	ENSP00000457168:p.Pro1614Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	10.18	1.279421	0.23307	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.21	4.29	0.51040	.	0.154027	0.47455	D	0.000223	T	0.23886	0.0578	N	0.14661	0.345	0.29483	N	0.856227	B	0.33238	0.403	B	0.28232	0.087	T	0.09952	-1.0651	9	0.20519	T	0.43	.	13.1775	0.59635	0.2906:0.7094:0.0:0.0	.	1614	Q5T011-5	.	L	772	.	ENSP00000361519:P772L	P	+	2	0	SZT2	43669618	0.826000	0.29277	1.000000	0.80357	0.914000	0.54420	2.152000	0.42272	1.312000	0.45043	-0.311000	0.09066	CCA		0.463	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3		NM_015284	
LAMB2	3913	broad.mit.edu	37	3	49168474	49168474	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:49168474T>C	ENST00000418109.1	-	8	988	c.824A>G	c.(823-825)tAt>tGt	p.Y275C	LAMB2_ENST00000305544.4_Missense_Mutation_p.Y275C	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	275	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.Y275C(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AACCAGCTCATAGAGGGCATA	0.587																																																	1	Substitution - Missense(1)	kidney(1)											148.0	136.0	140.0					3																	49168474		2203	4300	6503	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.824A>G	3.37:g.49168474T>C	ENSP00000388325:p.Tyr275Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741166	0.49151	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000494831	T;T;T	0.75938	-0.98;-0.98;-0.98	4.76	4.76	0.60689	Laminin, N-terminal (3);	0.067205	0.64402	D	0.000009	D	0.88786	0.6531	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.90348	0.4364	10	0.45353	T	0.12	.	13.6789	0.62472	0.0:0.0:0.0:1.0	.	275	P55268	LAMB2_HUMAN	C	275;275;126	ENSP00000388325:Y275C;ENSP00000307156:Y275C;ENSP00000444751:Y126C	ENSP00000307156:Y275C	Y	-	2	0	LAMB2	49143478	1.000000	0.71417	0.994000	0.49952	0.182000	0.23217	7.476000	0.81055	2.126000	0.65437	0.533000	0.62120	TAT		0.587	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1		NM_002292	
LNPEP	4012	broad.mit.edu	37	5	96350753	96350753	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr5:96350753A>G	ENST00000231368.5	+	13	3022	c.2330A>G	c.(2329-2331)aAc>aGc	p.N777S	LNPEP_ENST00000395770.3_Missense_Mutation_p.N763S	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	777					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.N777S(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CTCATCTATAACCTCCTTGAA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											107.0	100.0	103.0					5																	96350753		2203	4300	6503	SO:0001583	missense	4012			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2330A>G	5.37:g.96350753A>G	ENSP00000231368:p.Asn777Ser	Somatic		WXS	Illumina GAIIx	Phase_I	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	A	8.732	0.916996	0.17907	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.04603	3.59;3.59	5.55	5.55	0.83447	.	0.248468	0.47852	D	0.000217	T	0.03178	0.0093	N	0.22421	0.69	0.28224	N	0.926402	B	0.02656	0.0	B	0.08055	0.003	T	0.41963	-0.9479	10	0.07325	T	0.83	.	8.2028	0.31434	0.8501:0.0:0.1499:0.0	.	777	Q9UIQ6	LCAP_HUMAN	S	777;763	ENSP00000231368:N777S;ENSP00000379117:N763S	ENSP00000231368:N777S	N	+	2	0	LNPEP	96376509	0.992000	0.36948	0.990000	0.47175	0.509000	0.34042	1.695000	0.37763	2.105000	0.64084	0.533000	0.62120	AAC		0.418	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1		NM_005575	
LPHN3	23284	hgsc.bcm.edu	37	4	62936198	62936198	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr4:62936198delC	ENST00000514591.1	+	25	4311	c.3982delC	c.(3982-3984)cctfs	p.P1328fs	LPHN3_ENST00000506720.1_Frame_Shift_Del_p.P1439fs|LPHN3_ENST00000506746.1_Frame_Shift_Del_p.P1430fs|RP11-84A1.3_ENST00000506704.1_RNA|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000508946.1_Frame_Shift_Del_p.P1371fs|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000507625.1_Frame_Shift_Del_p.P1387fs|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000545650.1_Frame_Shift_Del_p.P1328fs|LPHN3_ENST00000512091.2_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000514996.1_Frame_Shift_Del_p.P1362fs|LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000514157.1_3'UTR			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1306					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ATCTGATGCTCCTTTGCTGCC	0.517																																																	0													85.0	76.0	79.0					4																	62936198		692	1591	2283	SO:0001589	frameshift_variant	23284			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3982delC	4.37:g.62936198delC	ENSP00000422533:p.Pro1328fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PE04|O94867|Q9NWK5	Frame_Shift_Del	DEL	ENST00000514591.1	37	CCDS54768.1																																																																																				0.517	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			
MCC	4163	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	112458491	112458491	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr5:112458491T>G	ENST00000302475.4	-	4	910	c.347A>C	c.(346-348)gAa>gCa	p.E116A	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.E53A|MCC_ENST00000408903.3_Missense_Mutation_p.E306A	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	116					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.E116A(1)|p.E306A(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CTGGCTGAGTTCTGATCGCAG	0.478																																																	2	Substitution - Missense(2)	kidney(2)											148.0	123.0	131.0					5																	112458491		2202	4300	6502	SO:0001583	missense	4163				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.347A>C	5.37:g.112458491T>G	ENSP00000305617:p.Glu116Ala	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490437	0.64074	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.78816	-1.21;2.07;0.84	5.76	5.76	0.90799	.	0.110593	0.64402	D	0.000013	T	0.60209	0.2251	N	0.08118	0	0.58432	D	0.999994	P;B;P;B	0.40731	0.608;0.083;0.728;0.319	B;B;B;B	0.38500	0.052;0.023;0.275;0.052	T	0.62201	-0.6904	10	0.18710	T	0.47	-12.934	15.7436	0.77920	0.0:0.0:0.0:1.0	.	116;78;306;116	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	A	116;53;306	ENSP00000305617:E116A;ENSP00000421615:E53A;ENSP00000386227:E306A	ENSP00000305617:E116A	E	-	2	0	MCC	112486390	1.000000	0.71417	0.988000	0.46212	0.947000	0.59692	6.355000	0.73041	2.200000	0.70718	0.460000	0.39030	GAA		0.478	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3		NM_001085377	
MCM3	4172	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	52129392	52129392	+	Silent	SNP	G	G	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr6:52129392G>A	ENST00000229854.7	-	17	2497	c.2421C>T	c.(2419-2421)ctC>ctT	p.L807L	MCM3_ENST00000419835.2_Silent_p.L761L|MCM3_ENST00000596288.1_Silent_p.L852L			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	807					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.L807L(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					CTCCTCAGATGAGGAAGATGA	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											160.0	134.0	143.0					6																	52129392		2203	4300	6503	SO:0001819	synonymous_variant	4172			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.2421C>T	6.37:g.52129392G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Silent	SNP	ENST00000229854.7	37																																																																																					0.532	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1			
Unknown	0	broad.mit.edu	37	1	16975045	16975045	+	IGR	SNP	G	G	A	rs55763726	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:16975045G>A								CROCCP2 (13991 upstream) : RNU1-3 (18234 downstream)																							CCTCCGAACCGCATGCACAAC	0.587																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16975045G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.587									
MUC4	4585	hgsc.bcm.edu	37	3	195507129	195507129	+	Silent	SNP	G	G	T	rs74201433		TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:195507129G>T	ENST00000463781.3	-	2	11781	c.11322C>A	c.(11320-11322)gcC>gcA	p.A3774A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.A3774A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGAGGCGTGGCGTGACCTG	0.607																																																	0													25.0	19.0	21.0					3																	195507129		686	1585	2271	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11322C>A	3.37:g.195507129G>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NBPF12	149013	broad.mit.edu	37	1	146398425	146398425	+	Missense_Mutation	SNP	C	C	A	rs587641665	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:146398425C>A	ENST00000442909.2	+	7	1247	c.411C>A	c.(409-411)gaC>gaA	p.D137E	NBPF12_ENST00000446760.2_Missense_Mutation_p.D137E|NBPF12_ENST00000309471.8_Missense_Mutation_p.D62E			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.D137E(6)		ovary(2)	2						ATGAGCCGGACAAGTCCCAGG	0.587													.|||	15	0.00299521	0.0045	0.0014	5008	,	,		19569	0.0		0.0	False		,,,				2504	0.0082																6	Substitution - Missense(6)	kidney(6)																																								SO:0001583	missense	100132406			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.411C>A	1.37:g.146398425C>A	ENSP00000391116:p.Asp137Glu	Somatic		WXS	Illumina GAIIx	Phase_I	O95877	Missense_Mutation	SNP	ENST00000442909.2	37		.	.	.	.	.	.	.	.	.	.	N	10.15	1.271473	0.23221	.	.	ENSG00000186275	ENST00000446760;ENST00000442909;ENST00000309471	T;T;T	0.38722	2.65;3.4;1.12	1.12	1.12	0.20585	.	.	.	.	.	T	0.21145	0.0509	M	0.73598	2.24	0.09310	N	1	B	0.26845	0.161	B	0.18263	0.021	T	0.30031	-0.9992	9	0.72032	D	0.01	.	5.9887	0.19448	0.0:1.0:0.0:0.0	.	137	Q86T75-2	.	E	137;137;62	ENSP00000396525:D137E;ENSP00000391116:D137E;ENSP00000311131:D62E	ENSP00000311131:D62E	D	+	3	2	NBPF12	144765738	0.000000	0.05858	0.004000	0.12327	0.015000	0.08874	0.437000	0.21543	1.012000	0.39366	0.361000	0.22055	GAC		0.587	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000102086.3		XM_003119146	
NHEJ1	79840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	219942000	219942000	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr2:219942000G>A	ENST00000356853.5	-	7	926	c.793C>T	c.(793-795)Cca>Tca	p.P265S	NHEJ1_ENST00000409720.1_Missense_Mutation_p.P265S|NHEJ1_ENST00000483627.1_5'UTR	NM_024782.2	NP_079058.1	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1	265					B cell differentiation (GO:0030183)|central nervous system development (GO:0007417)|DNA recombination (GO:0006310)|double-strand break repair via nonhomologous end joining (GO:0006303)|positive regulation of ligase activity (GO:0051351)|response to ionizing radiation (GO:0010212)|T cell differentiation (GO:0030217)	nonhomologous end joining complex (GO:0070419)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P265S(1)		kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	12		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		GAGAGGGTTGGGGCTGAGGAG	0.522								Non-homologous end-joining																																									1	Substitution - Missense(1)	kidney(1)											180.0	153.0	162.0					2																	219942000		2203	4300	6503	SO:0001583	missense	79840			AJ972687	CCDS2432.1	2q35	2014-09-17			ENSG00000187736	ENSG00000187736			25737	protein-coding gene	gene with protein product		611290				16439204, 16439205	Standard	NM_024782		Approved	Cernunnos, XLF, FLJ12610	uc002vjp.4	Q9H9Q4	OTTHUMG00000133127	ENST00000356853.5:c.793C>T	2.37:g.219942000G>A	ENSP00000349313:p.Pro265Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZA4|Q4ZFW7|Q6IA64|Q96JS9	Missense_Mutation	SNP	ENST00000356853.5	37	CCDS2432.1	.	.	.	.	.	.	.	.	.	.	G	0.280	-0.987258	0.02180	.	.	ENSG00000187736	ENST00000409720;ENST00000356853;ENST00000426304	T;T;T	0.61040	0.14;0.37;0.58	5.0	0.886	0.19194	.	0.981330	0.08286	N	0.969126	T	0.35335	0.0928	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.23368	-1.0190	10	0.07990	T	0.79	-20.4149	3.7964	0.08741	0.0874:0.3039:0.4523:0.1564	.	265	Q9H9Q4	NHEJ1_HUMAN	S	265;265;190	ENSP00000387290:P265S;ENSP00000349313:P265S;ENSP00000394896:P190S	ENSP00000349313:P265S	P	-	1	0	NHEJ1	219650244	0.115000	0.22152	0.000000	0.03702	0.017000	0.09413	0.668000	0.25127	-0.019000	0.14055	0.655000	0.94253	CCA		0.522	NHEJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256817.2		NM_024782	
NKX2-3	159296	broad.mit.edu	37	10	101294877	101294877	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr10:101294877G>A	ENST00000344586.7	+	2	693	c.494G>A	c.(493-495)cGc>cAc	p.R165H		NM_145285.2	NP_660328.2	Q8TAU0	NKX23_HUMAN	NK2 homeobox 3	165					CD4-positive, alpha-beta T cell differentiation (GO:0043367)|gland morphogenesis (GO:0022612)|leukocyte homeostasis (GO:0001776)|leukocyte migration (GO:0050900)|lymph node development (GO:0048535)|macrophage differentiation (GO:0030225)|odontogenesis of dentin-containing tooth (GO:0042475)|Peyer's patch development (GO:0048541)|plasma cell differentiation (GO:0002317)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic digestive tract morphogenesis (GO:0048621)|regulation of cell proliferation (GO:0042127)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)|triglyceride metabolic process (GO:0006641)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R165H(1)		endometrium(1)|kidney(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.45e-08)		GAGCTGGAACGCAGGTTCAAG	0.642																																					Pancreas(173;2021 2035 19403 19989 27291)												1	Substitution - Missense(1)	kidney(1)											17.0	20.0	19.0					10																	101294877		2155	4279	6434	SO:0001583	missense	159296				CCDS41558.1	10q24.2	2013-09-20	2011-06-01	2002-10-04	ENSG00000119919	ENSG00000119919		"""Homeoboxes / ANTP class : NKL subclass"""	7836	protein-coding gene	gene with protein product		606727	"""NK-2 (Drosophila) homolog C"", ""NK2 transcription factor related, locus 3 (Drosophila)"""	NKX2C		1346742, 9142493	Standard	NM_145285		Approved	NKX2.3, CSX3, NKX4-3	uc009xwj.3	Q8TAU0	OTTHUMG00000018887	ENST00000344586.7:c.494G>A	10.37:g.101294877G>A	ENSP00000342828:p.Arg165His	Somatic		WXS	Illumina GAIIx	Phase_I	B4DUZ4|Q9NYS6	Missense_Mutation	SNP	ENST00000344586.7	37	CCDS41558.1	.	.	.	.	.	.	.	.	.	.	G	36	5.663064	0.96745	.	.	ENSG00000119919	ENST00000344586	D	0.96459	-4.02	5.45	5.45	0.79879	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97745	0.9260	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98561	1.0641	10	0.87932	D	0	.	18.8868	0.92381	0.0:0.0:1.0:0.0	.	165	Q8TAU0	NKX23_HUMAN	H	165	ENSP00000342828:R165H	ENSP00000342828:R165H	R	+	2	0	NKX2-3	101284867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.964000	0.87933	2.545000	0.85829	0.561000	0.74099	CGC		0.642	NKX2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049808.2			
NUP210L	91181	broad.mit.edu;ucsc.edu	37	1	154031095	154031095	+	Silent	SNP	T	T	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:154031095T>A	ENST00000368559.3	-	21	2996	c.2925A>T	c.(2923-2925)acA>acT	p.T975T	NUP210L_ENST00000368553.1_5'Flank|NUP210L_ENST00000271854.3_Silent_p.T975T	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	975					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.T975T(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGAGGTGGGCTGTTGCTGGAC	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											95.0	87.0	89.0					1																	154031095		1875	4098	5973	SO:0001819	synonymous_variant	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2925A>T	1.37:g.154031095T>A		Somatic		WXS	Illumina GAIIx	Phase_I	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	37	CCDS41399.1																																																																																				0.413	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3		NM_207308	
OR10A7	121364	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	55614840	55614840	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr12:55614840A>T	ENST00000326258.1	+	1	32	c.32A>T	c.(31-33)gAa>gTa	p.E11V		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E11V(1)		endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						AGAGTCACTGAATTTATTCTT	0.343																																																	1	Substitution - Missense(1)	kidney(1)											157.0	165.0	162.0					12																	55614840		2203	4300	6503	SO:0001583	missense	121364			BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.32A>T	12.37:g.55614840A>T	ENSP00000326718:p.Glu11Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFD5|Q96R19	Missense_Mutation	SNP	ENST00000326258.1	37	CCDS31815.1	.	.	.	.	.	.	.	.	.	.	a	15.38	2.815157	0.50527	.	.	ENSG00000179919	ENST00000326258	T	0.01139	5.28	2.91	2.91	0.33838	.	0.000000	0.42420	D	0.000702	T	0.04227	0.0117	M	0.85041	2.73	0.35410	D	0.792375	P	0.51449	0.945	P	0.54238	0.746	T	0.09596	-1.0667	10	0.87932	D	0	.	6.8605	0.24064	0.8872:0.0:0.1128:0.0	.	11	Q8NGE5	O10A7_HUMAN	V	11	ENSP00000326718:E11V	ENSP00000326718:E11V	E	+	2	0	OR10A7	53901107	0.067000	0.21026	0.979000	0.43373	0.944000	0.59088	1.625000	0.37029	1.581000	0.49865	0.519000	0.50382	GAA		0.343	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1			
OR10H4	126541	hgsc.bcm.edu;ucsc.edu	37	19	16060085	16060085	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr19:16060085C>A	ENST00000322107.1	+	1	268	c.268C>A	c.(268-270)Cat>Aat	p.H90N		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						GCTTTCCACCCATCATTCCAT	0.517																																																	0													500.0	439.0	459.0					19																	16060085		2203	4300	6503	SO:0001583	missense	126541			AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.268C>A	19.37:g.16060085C>A	ENSP00000318834:p.His90Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFJ2|Q96R57	Missense_Mutation	SNP	ENST00000322107.1	37	CCDS32941.1	.	.	.	.	.	.	.	.	.	.	c	0	-2.747865	0.00086	.	.	ENSG00000176231	ENST00000322107	T	0.05580	3.42	1.53	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.349418	0.20614	U	0.088906	T	0.02342	0.0072	N	0.03967	-0.31	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.46582	-0.9181	10	0.21014	T	0.42	.	5.7094	0.17927	0.0:0.6545:0.3455:0.0	.	90	Q8NGA5	O10H4_HUMAN	N	90	ENSP00000318834:H90N	ENSP00000318834:H90N	H	+	1	0	OR10H4	15921085	0.000000	0.05858	0.051000	0.19133	0.072000	0.16883	-1.768000	0.01794	0.828000	0.34709	0.471000	0.43371	CAT		0.517	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460311.1			
OR5H1	26341	broad.mit.edu	37	3	97851689	97851689	+	Missense_Mutation	SNP	T	T	C	rs201501927	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:97851689T>C	ENST00000354565.2	+	1	148	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W50R(4)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TGCTGTCATCTGGAAAGACCC	0.418																																																	4	Substitution - Missense(4)	endometrium(2)|kidney(2)											56.0	59.0	58.0					3																	97851689		2193	4271	6464	SO:0001583	missense	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.148T>C	3.37:g.97851689T>C	ENSP00000346575:p.Trp50Arg	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	T	5.108	0.205565	0.09704	.	.	ENSG00000231192	ENST00000354565	T	0.03801	3.8	3.63	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	0.983509	0.08277	N	0.970503	T	0.05135	0.0137	N	0.04162	-0.26	0.22435	N	0.999102	D	0.56968	0.978	P	0.55871	0.786	T	0.50145	-0.8862	10	0.24483	T	0.36	.	8.0198	0.30402	0.0:0.0:0.2075:0.7924	.	50	A6NKK0	OR5H1_HUMAN	R	50	ENSP00000346575:W50R	ENSP00000346575:W50R	W	+	1	0	OR5H1	99334379	0.000000	0.05858	0.978000	0.43139	0.160000	0.22226	-0.055000	0.11807	0.438000	0.26450	0.164000	0.16699	TGG		0.418	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2		NM_001005338	
PAIP1	10605	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	43555944	43555944	+	Silent	SNP	A	A	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr5:43555944A>T	ENST00000306846.3	-	2	655	c.423T>A	c.(421-423)tcT>tcA	p.S141S	PAIP1_ENST00000514514.1_Silent_p.S62S|PAIP1_ENST00000436644.2_Silent_p.S62S|PAIP1_ENST00000338972.4_Silent_p.S29S	NM_006451.4|NM_182789.3	NP_006442.2|NP_877590.1	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	141	PABPC1-interacting motif-2 (PAM2).				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.S141S(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Lung NSC(6;2.07e-05)					TGTAACTGGAAGAATAACCTG	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											121.0	131.0	127.0					5																	43555944		2203	4300	6503	SO:0001819	synonymous_variant	10605			AF013758	CCDS3947.1, CCDS3948.1, CCDS47204.1	5p12	2008-02-05			ENSG00000172239	ENSG00000172239			16945	protein-coding gene	gene with protein product		605184				9548260, 11230166	Standard	NM_006451		Approved		uc003job.3	Q9H074	OTTHUMG00000096960	ENST00000306846.3:c.423T>A	5.37:g.43555944A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKV8|O60455|Q96B61|Q9BS63	Silent	SNP	ENST00000306846.3	37	CCDS3947.1																																																																																				0.408	PAIP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214024.1		NM_006451	
PAQR4	124222	broad.mit.edu	37	16	3021699	3021699	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr16:3021699G>T	ENST00000318782.8	+	3	1002	c.572G>T	c.(571-573)cGg>cTg	p.R191L	PAQR4_ENST00000293978.8_Missense_Mutation_p.R152L|PAQR4_ENST00000574988.1_Missense_Mutation_p.R124L|PAQR4_ENST00000572687.1_Missense_Mutation_p.R117L|PAQR4_ENST00000576565.1_Missense_Mutation_p.R124L|PKMYT1_ENST00000571102.1_5'Flank|PKMYT1_ENST00000431515.2_Intron	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	191						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R191L(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						TTTGGGGCCCGGGGAGTGGGT	0.682																																																	1	Substitution - Missense(1)	kidney(1)											31.0	37.0	35.0					16																	3021699		2198	4297	6495	SO:0001583	missense	124222				CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.572G>T	16.37:g.3021699G>T	ENSP00000321804:p.Arg191Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Missense_Mutation	SNP	ENST00000318782.8	37	CCDS10485.1	.	.	.	.	.	.	.	.	.	.	g	16.31	3.086383	0.55861	.	.	ENSG00000162073	ENST00000318782;ENST00000293978	T	0.25749	1.78	5.09	3.1	0.35709	.	0.129612	0.52532	D	0.000070	T	0.42086	0.1187	M	0.79123	2.44	0.80722	D	1	D;D;D	0.76494	0.999;0.966;0.989	D;P;D	0.66196	0.939;0.656;0.942	T	0.45483	-0.9258	10	0.10902	T	0.67	-21.6174	8.6467	0.34009	0.0856:0.1533:0.7611:0.0	.	116;152;191	Q8N4S7-3;Q8N4S7-2;Q8N4S7	.;.;PAQR4_HUMAN	L	191;117	ENSP00000321804:R191L	ENSP00000293978:R117L	R	+	2	0	PAQR4	2961700	1.000000	0.71417	0.989000	0.46669	0.792000	0.44763	5.974000	0.70465	0.528000	0.28580	0.457000	0.33378	CGG		0.682	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1		NM_152341	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52649414	52649414	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:52649414C>A	ENST00000296302.7	-	15	1878	c.1877G>T	c.(1876-1878)gGc>gTc	p.G626V	PBRM1_ENST00000410007.1_Missense_Mutation_p.G626V|PBRM1_ENST00000409057.1_Missense_Mutation_p.G626V|PBRM1_ENST00000394830.3_Missense_Mutation_p.G626V|PBRM1_ENST00000409114.3_Missense_Mutation_p.G641V|PBRM1_ENST00000409767.1_Missense_Mutation_p.G641V|PBRM1_ENST00000356770.4_Missense_Mutation_p.G594V|PBRM1_ENST00000337303.4_Missense_Mutation_p.G626V			Q86U86	PB1_HUMAN	polybromo 1	626					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G626V(2)|p.G594V(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGGCAGTGGGCCCAGCTCTTT	0.378			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Missense(3)	kidney(3)											114.0	103.0	106.0					3																	52649414		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1877G>T	3.37:g.52649414C>A	ENSP00000296302:p.Gly626Val	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	20.7	4.038043	0.75617	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28	5.69	5.69	0.88448	Bromodomain (2);	0.000000	0.85682	D	0.000000	T	0.34395	0.0896	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0;0.991;0.999;0.999	T	0.01951	-1.1241	10	0.51188	T	0.08	-22.5552	19.8084	0.96538	0.0:1.0:0.0:0.0	.	626;626;626;626;641;641;626;594;626	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	V	594;626;626;626;626;626;641;641;626;585	ENSP00000349213:G594V;ENSP00000378307:G626V;ENSP00000296302:G626V;ENSP00000338302:G626V;ENSP00000386593:G626V;ENSP00000386529:G626V;ENSP00000386643:G641V;ENSP00000386601:G641V;ENSP00000387775:G626V;ENSP00000397662:G585V	ENSP00000296302:G626V	G	-	2	0	PBRM1	52624454	1.000000	0.71417	0.999000	0.59377	0.552000	0.35366	7.818000	0.86416	2.687000	0.91594	0.462000	0.41574	GGC		0.378	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PLIN4	729359	hgsc.bcm.edu;ucsc.edu	37	19	4512890	4512890	+	Missense_Mutation	SNP	G	G	A	rs199944112	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr19:4512890G>A	ENST00000301286.3	-	3	1039	c.1040C>T	c.(1039-1041)aCt>aTt	p.T347I		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	347	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						AGTTAGGACAGTCTTGGTGGT	0.577													G|||	613	0.122404	0.3404	0.0735	5008	,	,		19607	0.001		0.0765	False		,,,				2504	0.0348																0													45.0	88.0	76.0					19																	4512890		1706	4160	5866	SO:0001583	missense	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1040C>T	19.37:g.4512890G>A	ENSP00000301286:p.Thr347Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756798	0.49362	.	.	ENSG00000167676	ENST00000301286	T	0.05319	3.46	4.58	-2.82	0.05787	.	0.834705	0.10002	U	0.728326	T	0.06735	0.0172	M	0.63428	1.95	0.09310	N	1	P	0.49185	0.92	B	0.42386	0.386	T	0.29852	-0.9998	10	0.39692	T	0.17	-0.7204	3.5654	0.07897	0.0837:0.1338:0.3723:0.4103	.	347	Q96Q06	PLIN4_HUMAN	I	347	ENSP00000301286:T347I	ENSP00000301286:T347I	T	-	2	0	PLIN4	4463890	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.482000	0.22276	0.054000	0.16065	-0.373000	0.07131	ACT		0.577	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1		XM_170901	
POT1	25913	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	124487019	124487019	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr7:124487019C>A	ENST00000357628.3	-	12	1581	c.983G>T	c.(982-984)aGa>aTa	p.R328I	POT1_ENST00000393329.1_Missense_Mutation_p.R197I	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	328					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)	p.R328I(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						CTGTTGACATCTTTCTACCTC	0.353																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												2	Substitution - Missense(2)	kidney(2)											144.0	125.0	132.0					7																	124487019		2203	4300	6503	SO:0001583	missense	25913			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.983G>T	7.37:g.124487019C>A	ENSP00000350249:p.Arg328Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722035	0.89298	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000265391	T;T	0.51071	0.72;0.72	5.5	5.5	0.81552	.	0.286036	0.39615	N	0.001315	T	0.65144	0.2663	L	0.55481	1.735	0.58432	D	0.999997	D	0.76494	0.999	D	0.85130	0.997	T	0.66044	-0.6021	10	0.72032	D	0.01	-30.0673	16.467	0.84081	0.0:1.0:0.0:0.0	.	328	Q9NUX5	POTE1_HUMAN	I	328;197;328;328;327	ENSP00000350249:R328I;ENSP00000377002:R197I	ENSP00000265391:R327I	R	-	2	0	POT1	124274255	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.077000	0.57598	2.729000	0.93468	0.561000	0.74099	AGA		0.353	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			
R3HDM2	22864	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57648628	57648628	+	Silent	SNP	C	C	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr12:57648628C>G	ENST00000347140.3	-	24	3249	c.2859G>C	c.(2857-2859)gtG>gtC	p.V953V	R3HDM2_ENST00000441731.2_Silent_p.V648V|R3HDM2_ENST00000358907.2_Silent_p.V953V|R3HDM2_ENST00000413953.2_Intron|R3HDM2_ENST00000403821.2_Silent_p.V987V|RP11-123K3.4_ENST00000548184.1_Intron|R3HDM2_ENST00000402412.1_Silent_p.V967V			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	953						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V614V(1)|p.V953V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TGAAGCGACTCACGGAGTTGT	0.562																																																	2	Substitution - coding silent(2)	kidney(2)											83.0	77.0	79.0					12																	57648628		2203	4300	6503	SO:0001819	synonymous_variant	22864			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2859G>C	12.37:g.57648628C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1T9|Q3ZCT5	Silent	SNP	ENST00000347140.3	37	CCDS8937.2																																																																																				0.562	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2		NM_014925	
SCN9A	6335	hgsc.bcm.edu;ucsc.edu	37	2	167055463	167055463	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr2:167055463delT	ENST00000409435.1	-	26	5685	c.5686delA	c.(5686-5688)attfs	p.I1896fs	SCN9A_ENST00000375387.4_Frame_Shift_Del_p.I1897fs|SCN9A_ENST00000409672.1_Frame_Shift_Del_p.I1885fs|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Frame_Shift_Del_p.I1897fs			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1896	IQ.				behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCACGCTGAATGACAGTAGCA	0.378																																																	0													186.0	197.0	193.0					2																	167055463		2189	4293	6482	SO:0001589	frameshift_variant	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5686delA	2.37:g.167055463delT	ENSP00000386330:p.Ile1896fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Frame_Shift_Del	DEL	ENST00000409435.1	37	CCDS46441.1																																																																																				0.378	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1		NM_002977	
SKIV2L	6499	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	31928300	31928300	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr6:31928300C>T	ENST00000375394.2	+	5	559	c.446C>T	c.(445-447)cCa>cTa	p.P149L	NELFE_ENST00000375429.3_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|SKIV2L_ENST00000544581.1_Intron|NELFE_ENST00000375425.5_5'Flank|NELFE_ENST00000444811.2_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	149					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.P149L(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						TGGGGAAATCCAACTCAGTAT	0.532																																																	1	Substitution - Missense(1)	kidney(1)											97.0	105.0	102.0					6																	31928300		2203	4300	6503	SO:0001583	missense	6499				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.446C>T	6.37:g.31928300C>T	ENSP00000364543:p.Pro149Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630056	0.67015	.	.	ENSG00000204351	ENST00000375394	T	0.41758	0.99	5.14	5.14	0.70334	.	0.124468	0.52532	D	0.000077	T	0.24198	0.0586	L	0.50333	1.59	0.80722	D	1	P	0.39480	0.675	B	0.29077	0.098	T	0.19128	-1.0315	10	0.54805	T	0.06	-11.0889	17.398	0.87451	0.0:1.0:0.0:0.0	.	149	Q15477	SKIV2_HUMAN	L	149	ENSP00000364543:P149L	ENSP00000364543:P149L	P	+	2	0	SKIV2L	32036279	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	2.720000	0.47252	2.412000	0.81896	0.655000	0.94253	CCA		0.532	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3			
SLC5A8	160728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	101584327	101584327	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr12:101584327A>G	ENST00000536262.2	-	6	1310	c.752T>C	c.(751-753)tTc>tCc	p.F251S		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8									p.F251S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GGTCCATGTGAAGGTCCCTCC	0.398																																					GBM(60;420 1056 13605 22380 47675)												1	Substitution - Missense(1)	kidney(1)											138.0	133.0	135.0					12																	101584327		2203	4300	6503	SO:0001583	missense	160728			AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.752T>C	12.37:g.101584327A>G	ENSP00000445340:p.Phe251Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000536262.2	37	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.368123	0.82463	.	.	ENSG00000256870	ENST00000536262	D	0.87887	-2.31	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.93051	0.7788	M	0.74546	2.27	0.80722	D	1	D	0.71674	0.998	D	0.74674	0.984	D	0.93750	0.7058	10	0.87932	D	0	.	16.2405	0.82405	1.0:0.0:0.0:0.0	.	251	Q8N695	SC5A8_HUMAN	S	251	ENSP00000445340:F251S	ENSP00000445340:F251S	F	-	2	0	SLC5A8	100108458	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	8.932000	0.92897	2.238000	0.73509	0.477000	0.44152	TTC		0.398	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1		NM_145913	
Unknown	0	broad.mit.edu	37	7	101991206	101991206	+	IGR	SNP	G	G	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr7:101991206G>A								Y_RNA (13824 upstream) : PRKRIP1 (13137 downstream)																							ATTGCCAGGAGGGGAAGCCAG	0.532																																																	0																																										SO:0001628	intergenic_variant	729597																															7.37:g.101991206G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.532									
SPHKAP	80309	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	228882779	228882779	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr2:228882779C>T	ENST00000392056.3	-	7	2837	c.2791G>A	c.(2791-2793)Gaa>Aaa	p.E931K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E931K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	931	PKA-RII subunit binding domain. {ECO:0000250}.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.E931K(2)|p.E931*(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCTAATTCTTCCGCAAAGTCT	0.473																																																	4	Substitution - Missense(2)|Substitution - Nonsense(2)	kidney(4)											189.0	171.0	177.0					2																	228882779		2203	4300	6503	SO:0001583	missense	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2791G>A	2.37:g.228882779C>T	ENSP00000375909:p.Glu931Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.237669	0.79800	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.18657	2.2;2.21	6.08	6.08	0.98989	.	0.092028	0.85682	D	0.000000	T	0.51244	0.1663	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.80764	0.862;0.994	T	0.49224	-0.8962	10	0.87932	D	0	.	19.6516	0.95815	0.0:1.0:0.0:0.0	.	931;931	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	K	931	ENSP00000375909:E931K;ENSP00000339886:E931K	ENSP00000339886:E931K	E	-	1	0	SPHKAP	228591023	1.000000	0.71417	0.980000	0.43619	0.402000	0.30811	7.194000	0.77789	2.894000	0.99253	0.655000	0.94253	GAA		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1		NM_030623	
TAF5L	27097	broad.mit.edu;hgsc.bcm.edu	37	1	229738474	229738474	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr1:229738474T>G	ENST00000366676.1	-	3	439	c.440A>C	c.(439-441)cAg>cCg	p.Q147P	TAF5L_ENST00000258281.2_Missense_Mutation_p.Q147P|TAF5L_ENST00000366675.3_Missense_Mutation_p.Q147P			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	147					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q147P(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				TAGGATGTCCTGGATGGTTTG	0.463																																																	2	Substitution - Missense(2)	kidney(2)											145.0	138.0	141.0					1																	229738474		2203	4300	6503	SO:0001583	missense	27097			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.440A>C	1.37:g.229738474T>G	ENSP00000355636:p.Gln147Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	ENST00000366676.1	37	CCDS1581.1	.	.	.	.	.	.	.	.	.	.	T	19.68	3.873173	0.72180	.	.	ENSG00000135801	ENST00000366676;ENST00000258281;ENST00000366675	T;T;T	0.60672	0.17;0.17;0.72	5.8	4.67	0.58626	TFIID subunit, WD40-associated region (1);	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.974;0.989	T	0.60831	-0.7185	9	.	.	.	-20.9071	11.8181	0.52222	0.0:0.0685:0.0:0.9315	.	147;147	O75529-2;O75529	.;TAF5L_HUMAN	P	147	ENSP00000355636:Q147P;ENSP00000258281:Q147P;ENSP00000355635:Q147P	.	Q	-	2	0	TAF5L	227805097	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	7.661000	0.83786	1.021000	0.39600	0.528000	0.53228	CAG		0.463	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095229.1		NM_014409	
TLN1	7094	broad.mit.edu;ucsc.edu	37	9	35704041	35704041	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr9:35704041C>T	ENST00000314888.9	-	46	6531	c.6178G>A	c.(6178-6180)Gat>Aat	p.D2060N	TLN1_ENST00000540444.1_Missense_Mutation_p.D1954N|TLN1_ENST00000464379.1_5'UTR	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2060					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.D2060N(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGACCACATCAGCGAGGCGG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											48.0	49.0	48.0					9																	35704041		2203	4300	6503	SO:0001583	missense	7094			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6178G>A	9.37:g.35704041C>T	ENSP00000316029:p.Asp2060Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924478	0.92319	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.14266	2.52;2.52	5.41	5.41	0.78517	.	0.203341	0.51477	D	0.000092	T	0.20941	0.0504	M	0.64170	1.965	0.80722	D	1	B	0.25235	0.121	B	0.28638	0.092	T	0.01956	-1.1240	10	0.46703	T	0.11	-15.7874	19.2006	0.93711	0.0:1.0:0.0:0.0	.	2060	Q9Y490	TLN1_HUMAN	N	2060;1954	ENSP00000316029:D2060N;ENSP00000442981:D1954N	ENSP00000316029:D2060N	D	-	1	0	TLN1	35694041	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.814000	0.86154	2.551000	0.86045	0.561000	0.74099	GAT		0.632	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2		NM_006289	
TMEM55B	90809	broad.mit.edu	37	14	20927414	20927414	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr14:20927414C>A	ENST00000250489.4	-	6	927	c.641G>T	c.(640-642)tGc>tTc	p.C214F	TMEM55B_ENST00000554028.1_Missense_Mutation_p.C47F|TMEM55B_ENST00000398020.4_Missense_Mutation_p.C221F			Q86T03	TM55B_HUMAN	transmembrane protein 55B	214						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)	p.C214F(2)		endometrium(3)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)		CAAGAAGCAGCAGATACATCT	0.498																																																	2	Substitution - Missense(2)	endometrium(1)|kidney(1)											163.0	154.0	157.0					14																	20927414		2203	4300	6503	SO:0001583	missense	90809			BC002867	CCDS9551.1, CCDS41911.1	14q11.1	2002-11-27	2005-07-18	2005-07-18	ENSG00000165782	ENSG00000165782			19299	protein-coding gene	gene with protein product		609865	"""chromosome 14 open reading frame 9"""	C14orf9			Standard	NM_144568		Approved	MGC26684	uc001vxk.2	Q86T03	OTTHUMG00000029545	ENST00000250489.4:c.641G>T	14.37:g.20927414C>A	ENSP00000250489:p.Cys214Phe	Somatic		WXS	Illumina GAIIx	Phase_I	B2RA35|Q86U09|Q8WUC0|Q9BU67|Q9NSU8	Missense_Mutation	SNP	ENST00000250489.4	37	CCDS9551.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306273	0.40795	.	.	ENSG00000165782	ENST00000250489;ENST00000398020;ENST00000554028	.	.	.	5.06	5.06	0.68205	.	0.053239	0.85682	D	0.000000	T	0.35856	0.0946	N	0.11927	0.2	0.42188	D	0.991717	B;B	0.33413	0.411;0.358	B;B	0.28991	0.097;0.059	T	0.32052	-0.9921	9	0.42905	T	0.14	-4.8273	17.2077	0.86922	0.0:1.0:0.0:0.0	.	214;221	Q86T03;Q86T03-2	TM55B_HUMAN;.	F	214;221;47	.	ENSP00000250489:C214F	C	-	2	0	TMEM55B	19997254	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.708000	0.37899	2.351000	0.79841	0.655000	0.94253	TGC		0.498	TMEM55B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000073643.3		NM_144568	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179468975	179468975	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr2:179468975A>G	ENST00000591111.1	-	232	49740	c.49516T>C	c.(49516-49518)Tat>Cat	p.Y16506H	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Y18147H|TTN_ENST00000342992.6_Missense_Mutation_p.Y15579H|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Y9274H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Y9207H|TTN_ENST00000460472.2_Missense_Mutation_p.Y9082H			Q8WZ42	TITIN_HUMAN	titin	16506	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Y15579H(2)|p.Y9207H(1)|p.Y9274H(1)|p.Y9082H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGATTCCATATTTATTCACT	0.383																																																	5	Substitution - Missense(5)	kidney(5)											78.0	75.0	76.0					2																	179468975		1888	4121	6009	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49516T>C	2.37:g.179468975A>G	ENSP00000465570:p.Tyr16506His	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	14.36	2.512438	0.44660	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69940	0.3167	L	0.58510	1.815	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.75020	0.972;0.972;0.972;0.985	T	0.72007	-0.4420	9	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	9082;9207;9274;16506	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	15579;9082;9274;9207;9082	ENSP00000343764:Y15579H;ENSP00000434586:Y9082H;ENSP00000340554:Y9274H;ENSP00000352154:Y9207H	ENSP00000340554:Y9274H	Y	-	1	0	TTN	179177220	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.281000	0.95811	2.371000	0.80710	0.533000	0.62120	TAT		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
UHRF2	115426	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	6420988	6420988	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr9:6420988C>G	ENST00000276893.5	+	2	398	c.230C>G	c.(229-231)cCt>cGt	p.P77R	RP11-307L3.4_ENST00000411561.1_RNA|UHRF2_ENST00000381373.3_Missense_Mutation_p.P77R	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	77	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P77R(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		CGCCCAGACCCTGATCATCTT	0.398																																																	1	Substitution - Missense(1)	kidney(1)											139.0	129.0	133.0					9																	6420988		2203	4300	6503	SO:0001583	missense	115426			AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.230C>G	9.37:g.6420988C>G	ENSP00000276893:p.Pro77Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	ENST00000276893.5	37	CCDS6469.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671129	0.47781	.	.	ENSG00000147854	ENST00000276893;ENST00000381373	T;T	0.42900	0.96;0.96	5.55	4.66	0.58398	.	0.325583	0.34338	N	0.004059	T	0.43166	0.1235	M	0.61703	1.905	0.32357	N	0.557726	B	0.16166	0.016	B	0.16722	0.016	T	0.54077	-0.8347	10	0.56958	D	0.05	-0.4419	14.6268	0.68626	0.0:0.9298:0.0:0.0702	.	77	Q96PU4	UHRF2_HUMAN	R	77	ENSP00000276893:P77R;ENSP00000370778:P77R	ENSP00000276893:P77R	P	+	2	0	UHRF2	6410988	0.998000	0.40836	0.990000	0.47175	0.980000	0.70556	4.998000	0.63927	1.345000	0.45676	-0.444000	0.05651	CCT		0.398	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3		NM_152306	
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10188321	10188321	+	Splice_Site	SNP	G	G	C	rs5030814	byFrequency	TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr3:10188321G>C	ENST00000256474.2	+	2	1303		c.e2+1		VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_Splice_Site	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase						cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(13)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ACACTGCCAGGTACTGACGTT	0.403		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	13	Unknown(13)	kidney(12)|endometrium(1)	GRCh37	CS004297|CS961708	VHL	S	rs5030814						166.0	158.0	161.0					3																	10188321		2203	4300	6503	SO:0001630	splice_region_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.463+1G>C	3.37:g.10188321G>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Splice_Site	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501642	0.64298	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4002	0.74834	0.0:0.0:1.0:0.0	rs5030814	.	.	.	.	-1	.	.	.	+	.	.	VHL	10163321	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.278000	0.78587	2.310000	0.77875	0.462000	0.41574	.		0.403	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	Intron
YTHDC2	64848	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	112899071	112899071	+	Splice_Site	SNP	A	A	T			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr5:112899071A>T	ENST00000161863.4	+	19	2537	c.2324A>T	c.(2323-2325)gAa>gTa	p.E775V		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	775	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)	p.E775V(1)		NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GGTTTATAGGAACTTTGCTTA	0.328																																																	1	Substitution - Missense(1)	kidney(1)											49.0	46.0	47.0					5																	112899071		2201	4300	6501	SO:0001630	splice_region_variant	64848			AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.2323-1A>T	5.37:g.112899071A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	37	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	A	18.09	3.546033	0.65198	.	.	ENSG00000047188	ENST00000161863;ENST00000511372	T	0.47177	0.85	5.47	4.28	0.50868	Helicase, C-terminal (1);	0.049336	0.85682	D	0.000000	T	0.58424	0.2121	M	0.87547	2.89	0.80722	D	1	P	0.47604	0.898	P	0.46362	0.514	T	0.64626	-0.6363	10	0.59425	D	0.04	.	11.6948	0.51538	0.8673:0.0:0.0:0.1326	.	775	Q9H6S0	YTDC2_HUMAN	V	775;685	ENSP00000161863:E775V	ENSP00000161863:E775V	E	+	2	0	YTHDC2	112926970	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	8.573000	0.90759	0.878000	0.35920	0.528000	0.53228	GAA		0.328	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2		NM_022828	Missense_Mutation
ZNF483	158399	hgsc.bcm.edu;ucsc.edu	37	9	114305026	114305026	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr9:114305026delA	ENST00000309235.5	+	6	1969	c.1811delA	c.(1810-1812)gaafs	p.E604fs	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	604					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						CACACTGGAGAAAAACCATAT	0.383																																																	0													57.0	60.0	59.0					9																	114305026		2203	4300	6503	SO:0001589	frameshift_variant	158399			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1811delA	9.37:g.114305026delA	ENSP00000311679:p.Glu604fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VZN2|Q8NAE1	Frame_Shift_Del	DEL	ENST00000309235.5	37	CCDS35106.1																																																																																				0.383	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1		XM_088567	
ZNF91	7644	broad.mit.edu	37	19	23543539	23543539	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3362-01A-02D-1386-10	TCGA-A3-3362-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	03c9042a-0206-4f12-b444-62f435140e8d	0ec37c53-395f-4201-92d3-fbaa43f84e51	g.chr19:23543539C>A	ENST00000300619.7	-	4	2447	c.2242G>T	c.(2242-2244)Ggc>Tgc	p.G748C	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.G716C|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	748					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G748C(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AATGCTTTGCCACATTCTTCA	0.333																																																	1	Substitution - Missense(1)	kidney(1)											26.0	29.0	28.0					19																	23543539		2102	4243	6345	SO:0001583	missense	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2242G>T	19.37:g.23543539C>A	ENSP00000300619:p.Gly748Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646611	0.47258	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.58797	0.31;0.31	1.71	1.71	0.24356	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81894	0.4919	H	0.97516	4.02	0.39543	D	0.968851	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.927	D	0.85642	0.1277	9	0.87932	D	0	.	10.3697	0.44046	0.0:1.0:0.0:0.0	.	716;748	Q05481-2;Q05481	.;ZNF91_HUMAN	C	748;716	ENSP00000300619:G748C;ENSP00000380272:G716C	ENSP00000300619:G748C	G	-	1	0	ZNF91	23335379	0.656000	0.27385	0.074000	0.20217	0.213000	0.24496	1.015000	0.29963	0.921000	0.36994	0.205000	0.17691	GGC		0.333	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1		NM_003430	
