#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AOC1	26	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	150554402	150554402	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr7:150554402T>C	ENST00000493429.1	+	4	1428	c.844T>C	c.(844-846)Ttc>Ctc	p.F282L	AOC1_ENST00000360937.4_Missense_Mutation_p.F282L|AOC1_ENST00000416793.2_Missense_Mutation_p.F282L|AOC1_ENST00000467291.1_Missense_Mutation_p.F282L			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	282					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)	p.F282L(1)								Amiloride(DB00594)	GCCGCCCCTCTTCTCCTCCCA	0.682																																																	1	Substitution - Missense(1)	kidney(1)											16.0	20.0	19.0					7																	150554402		1984	4139	6123	SO:0001583	missense	26			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.844T>C	7.37:g.150554402T>C	ENSP00000418614:p.Phe282Leu	Somatic		WXS	Illumina HiSeq	Phase_I	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.826363	0.90955	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000360937;ENST00000416793;ENST00000437714;ENST00000483043	T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11	5.16	5.16	0.70880	Copper amine oxidase, N-terminal (1);	0.532158	0.17044	N	0.189191	T	0.31979	0.0814	L	0.50333	1.59	0.45502	D	0.99846	D;P	0.58268	0.982;0.914	P;B	0.52909	0.713;0.305	T	0.03139	-1.1068	10	0.66056	D	0.02	-16.2633	12.9888	0.58606	0.0:0.0:0.0:1.0	.	282;282	C9J690;P19801	.;ABP1_HUMAN	L	282;282;282;282;158;282	ENSP00000418614:F282L;ENSP00000418328:F282L;ENSP00000354193:F282L;ENSP00000411613:F282L;ENSP00000417392:F282L	ENSP00000354193:F282L	F	+	1	0	ABP1	150185335	0.025000	0.19082	0.995000	0.50966	0.966000	0.64601	1.540000	0.36115	2.163000	0.67991	0.459000	0.35465	TTC		0.682	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1		NM_001091	
ALS2	57679	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	202590152	202590152	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr2:202590152T>C	ENST00000264276.6	-	20	3646	c.3274A>G	c.(3274-3276)Aag>Gag	p.K1092E	ALS2_ENST00000457679.2_Missense_Mutation_p.K404E	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1092					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.K1092E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTCATTGCCTTGTTTGGGATT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											235.0	228.0	230.0					2																	202590152		1861	4096	5957	SO:0001583	missense	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.3274A>G	2.37:g.202590152T>C	ENSP00000264276:p.Lys1092Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	ENST00000264276.6	37	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289058	0.80914	.	.	ENSG00000003393	ENST00000264276;ENST00000457679	T;T	0.41758	0.99;0.99	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	N	0.12471	0.22	0.58432	D	0.999997	D;P	0.89917	1.0;0.943	D;P	0.79784	0.993;0.867	T	0.43637	-0.9379	10	0.24483	T	0.36	.	15.5582	0.76216	0.0:0.0:0.0:1.0	.	1092;1092	Q6IQ41;Q96Q42	.;ALS2_HUMAN	E	1092;404	ENSP00000264276:K1092E;ENSP00000394823:K404E	ENSP00000264276:K1092E	K	-	1	0	ALS2	202298397	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.998000	0.70653	2.060000	0.61445	0.460000	0.39030	AAG		0.383	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3		NM_020919	
AMN	81693	broad.mit.edu	37	14	103394801	103394801	+	Silent	SNP	A	A	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr14:103394801A>T	ENST00000299155.5	+	4	279	c.246A>T	c.(244-246)ggA>ggT	p.G82G		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	82					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.G82G(1)		kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGCTTCAGGAGCCGGATTCG	0.726																																																	1	Substitution - coding silent(1)	kidney(1)											16.0	16.0	16.0					14																	103394801		2193	4289	6482	SO:0001819	synonymous_variant	81693			AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.246A>T	14.37:g.103394801A>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6UX83	Silent	SNP	ENST00000299155.5	37	CCDS9977.1																																																																																				0.726	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415704.1			
AOC2	314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	40997011	40997011	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr17:40997011T>C	ENST00000253799.3	+	1	395	c.368T>C	c.(367-369)aTc>aCc	p.I123T	AOC2_ENST00000452774.2_Missense_Mutation_p.I123T	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	123					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.I123T(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GCACTGGCCATCGTCCTCTTT	0.657																																																	1	Substitution - Missense(1)	kidney(1)											32.0	31.0	32.0					17																	40997011		2203	4299	6502	SO:0001583	missense	314			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.368T>C	17.37:g.40997011T>C	ENSP00000253799:p.Ile123Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	37	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.782516	0.31502	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.38560	1.13;1.13	5.01	3.93	0.45458	Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);Copper amine oxidase, N2-terminal (1);	0.063958	0.64402	D	0.000009	T	0.49287	0.1548	N	0.26162	0.8	0.40838	D	0.983641	P;B	0.37548	0.599;0.317	P;B	0.62382	0.901;0.126	T	0.47235	-0.9133	10	0.36615	T	0.2	-35.6461	10.5516	0.45092	0.0:0.0759:0.0:0.9241	.	123;123	O75106;O75106-2	AOC2_HUMAN;.	T	123	ENSP00000253799:I123T;ENSP00000406134:I123T	ENSP00000253799:I123T	I	+	2	0	AOC2	38250537	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	5.796000	0.69080	0.929000	0.37192	0.460000	0.39030	ATC		0.657	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1		NM_009590, NM_001158	
AP4E1	23431	hgsc.bcm.edu;ucsc.edu	37	15	51276219	51276221	+	Splice_Site	DEL	TTC	TTC	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr15:51276219_51276221delTTC	ENST00000261842.5	+	16	2073_2075	c.1967_1969delTTC	c.(1966-1971)gttctc>gtc	p.L657del	AP4E1_ENST00000560508.1_Splice_Site_p.L582del	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	657					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		AAAATTCTAGTTCTCAATTTTGA	0.36																																																	0																																										SO:0001630	splice_region_variant	23431			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1967-1TTC>-	15.37:g.51276219_51276221delTTC		Somatic		WXS	Illumina HiSeq	Phase_I	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Frame_Shift_Del	DEL	ENST00000261842.5	37	CCDS32240.1																																																																																				0.360	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1			In_Frame_Del
BTG1	694	broad.mit.edu;hgsc.bcm.edu	37	12	92539272	92539272	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr12:92539272C>T	ENST00000256015.3	-	1	401	c.40G>A	c.(40-42)Gag>Aag	p.E14K	C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	14					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.E14K(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				GCGGCGATCTCGCCTATCATG	0.721			T	MYC	BCLL																																			Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	1	Substitution - Missense(1)	kidney(1)											38.0	43.0	41.0					12																	92539272		2203	4297	6500	SO:0001583	missense	694				CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.40G>A	12.37:g.92539272C>T	ENSP00000256015:p.Glu14Lys	Somatic		WXS	Illumina HiSeq	Phase_I	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	C	31	5.093779	0.94149	.	.	ENSG00000133639	ENST00000256015	T	0.59906	0.23	3.92	3.03	0.35002	Anti-proliferative protein (2);	0.053894	0.64402	D	0.000001	T	0.77909	0.4201	M	0.92604	3.325	0.80722	D	1	D	0.63046	0.992	D	0.64410	0.925	T	0.81355	-0.0970	10	0.62326	D	0.03	-2.2729	11.275	0.49161	0.0:0.9093:0.0:0.0907	.	14	P62324	BTG1_HUMAN	K	14	ENSP00000256015:E14K	ENSP00000256015:E14K	E	-	1	0	BTG1	91063403	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.935000	0.63498	0.840000	0.34995	0.455000	0.32223	GAG		0.721	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1			
C2orf78	388960	broad.mit.edu;ucsc.edu	37	2	74043728	74043728	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr2:74043728A>C	ENST00000409561.1	+	3	2499	c.2378A>C	c.(2377-2379)cAa>cCa	p.Q793P		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	793								p.Q793P(1)|p.Q763P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						aaagcaacccaacccagttca	0.527																																																	2	Substitution - Missense(2)	kidney(2)											61.0	63.0	63.0					2																	74043728		2095	4222	6317	SO:0001583	missense	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.2378A>C	2.37:g.74043728A>C	ENSP00000387124:p.Gln793Pro	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000409561.1	37	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	A	10.69	1.421390	0.25639	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.44083	0.93	5.23	-9.46	0.00597	.	1.008270	0.08007	N	0.989674	T	0.31544	0.0800	L	0.48642	1.525	0.09310	N	1	B	0.29766	0.256	B	0.34779	0.189	T	0.37502	-0.9703	10	0.38643	T	0.18	3.6474	9.5861	0.39517	0.6507:0.1987:0.1506:0.0	.	793	A6NCI8	CB078_HUMAN	P	793;763	ENSP00000387124:Q793P	ENSP00000340692:Q763P	Q	+	2	0	C2orf78	73897236	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.353000	0.07691	-1.520000	0.01773	-0.376000	0.06991	CAA		0.527	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1		NM_001080474	
CACNG3	10368	broad.mit.edu;ucsc.edu	37	16	24268220	24268220	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr16:24268220G>A	ENST00000005284.3	+	1	1347	c.145G>A	c.(145-147)Gaa>Aaa	p.E49K		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	49					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.E49K(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		AAGTGATAATGAAACCAGCAG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											136.0	130.0	132.0					16																	24268220		2197	4300	6497	SO:0001583	missense	10368			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.145G>A	16.37:g.24268220G>A	ENSP00000005284:p.Glu49Lys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293228	0.80914	.	.	ENSG00000006116	ENST00000005284	T	0.56103	0.48	5.49	5.49	0.81192	.	0.060011	0.64402	D	0.000003	T	0.53094	0.1775	M	0.64997	1.995	0.80722	D	1	P	0.36683	0.565	B	0.40256	0.324	T	0.46707	-0.9172	10	0.09843	T	0.71	-13.832	18.1171	0.89559	0.0:0.0:1.0:0.0	.	49	O60359	CCG3_HUMAN	K	49	ENSP00000005284:E49K	ENSP00000005284:E49K	E	+	1	0	CACNG3	24175721	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.865000	0.98341	0.655000	0.94253	GAA		0.443	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1		NM_006539	
CAMSAP1	157922	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	138703212	138703212	+	Silent	SNP	G	G	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr9:138703212G>A	ENST00000389532.4	-	17	4816	c.4752C>T	c.(4750-4752)aaC>aaT	p.N1584N	CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000409386.3_Silent_p.N1595N|CAMSAP1_ENST00000312405.6_Silent_p.N1306N	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1584	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)	p.N1584N(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GCCACAGGTGGTTGTGGATTG	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											151.0	130.0	137.0					9																	138703212		2203	4300	6503	SO:0001819	synonymous_variant	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.4752C>T	9.37:g.138703212G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Silent	SNP	ENST00000389532.4	37	CCDS35176.2																																																																																				0.522	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2		XM_351857	
CLTC	1213	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	57737836	57737836	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr17:57737836G>A	ENST00000269122.3	+	7	1328	c.1054G>A	c.(1054-1056)Gct>Act	p.A352T	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.A352T	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	352	Globular terminal domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)	p.A352T(1)	CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCTGAGAATGGCTGTACGTAA	0.423			T	"""ALK, TFE3"""	"""ALCL, renal """																																			Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	1	Substitution - Missense(1)	kidney(1)											185.0	193.0	190.0					17																	57737836		2203	4300	6503	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1054G>A	17.37:g.57737836G>A	ENSP00000269122:p.Ala352Thr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793433	0.70452	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.60424	0.19;0.19	5.92	5.92	0.95590	Clathrin, heavy chain, linker, core motif (1);Armadillo-type fold (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	D	0.83977	0.5371	H	0.94345	3.525	0.80722	D	1	D;D	0.69078	0.997;0.988	D;D	0.83275	0.996;0.964	D	0.87094	0.2174	10	0.66056	D	0.02	.	20.3151	0.98650	0.0:0.0:1.0:0.0	.	352;352	Q00610;Q00610-2	CLH1_HUMAN;.	T	352	ENSP00000269122:A352T;ENSP00000376763:A352T	ENSP00000269122:A352T	A	+	1	0	CLTC	55092618	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.809000	0.96659	0.467000	0.42956	GCT		0.423	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1		NM_004859	
CCDC40	55036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	78059827	78059827	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr17:78059827T>A	ENST00000397545.4	+	14	2288	c.2261T>A	c.(2260-2262)cTt>cAt	p.L754H	CCDC40_ENST00000374877.3_Missense_Mutation_p.L754H	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	754					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.L754H(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CCCCTGGAGCTTGAAATCAAA	0.567																																																	2	Substitution - Missense(2)	kidney(2)											57.0	62.0	60.0					17																	78059827		1917	4116	6033	SO:0001583	missense	55036			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2261T>A	17.37:g.78059827T>A	ENSP00000380679:p.Leu754His	Somatic		WXS	Illumina HiSeq	Phase_I	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	T	19.59	3.856467	0.71834	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.50548	0.74;0.75	4.73	4.73	0.59995	.	.	.	.	.	T	0.46619	0.1402	L	0.57536	1.79	0.39978	D	0.97487	B;B	0.27450	0.179;0.115	B;B	0.29353	0.047;0.101	T	0.49560	-0.8927	9	0.45353	T	0.12	-14.3054	14.2249	0.65853	0.0:0.0:0.0:1.0	.	754;537	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	H	754	ENSP00000364011:L754H;ENSP00000380679:L754H	ENSP00000364011:L754H	L	+	2	0	CCDC40	75674422	0.993000	0.37304	0.956000	0.39512	0.622000	0.37654	4.346000	0.59367	1.773000	0.52216	0.421000	0.28195	CTT		0.567	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2		XM_371082	
COMMD9	29099	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	36302301	36302301	+	Silent	SNP	T	T	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr11:36302301T>G	ENST00000263401.5	-	2	154	c.138A>C	c.(136-138)acA>acC	p.T46T	COMMD9_ENST00000532705.1_Silent_p.T46T|COMMD9_ENST00000452374.2_Intron	NM_014186.3	NP_054905.2	Q9P000	COMD9_HUMAN	COMM domain containing 9	46								p.T46T(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	5	all_lung(20;0.211)	all_hematologic(20;0.107)				AGCTGGAACATGTAACATCCA	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											115.0	108.0	111.0					11																	36302301		2202	4298	6500	SO:0001819	synonymous_variant	29099			AY542164	CCDS7900.1, CCDS44571.1	11p13	2008-02-05			ENSG00000110442	ENSG00000110442			25014	protein-coding gene	gene with protein product		612299				15799966	Standard	NM_014186		Approved	HSPC166, FLJ31106	uc001mwn.4	Q9P000	OTTHUMG00000166333	ENST00000263401.5:c.138A>C	11.37:g.36302301T>G		Somatic		WXS	Illumina HiSeq	Phase_I	E9PAN2|Q96FI2|Q9H0R0	Silent	SNP	ENST00000263401.5	37	CCDS7900.1																																																																																				0.448	COMMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389196.1		NM_014186	
CRHBP	1393	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	76249908	76249908	+	Missense_Mutation	SNP	C	C	T	rs79810800		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr5:76249908C>T	ENST00000274368.4	+	3	652	c.230C>T	c.(229-231)cCg>cTg	p.P77L	CRHBP_ENST00000506501.1_Missense_Mutation_p.P77L	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	77					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)	p.P77L(1)		kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		GCCGACCGGCCGCAGCTGCAC	0.652																																																	1	Substitution - Missense(1)	kidney(1)						C	LEU/PRO	0,4406		0,0,2203	54.0	59.0	58.0		230	4.0	1.0	5	dbSNP_131	58	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CRHBP	NM_001882.3	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	77/323	76249908	2,13004	2203	4300	6503	SO:0001583	missense	1393			X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.230C>T	5.37:g.76249908C>T	ENSP00000274368:p.Pro77Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q53F32|Q6FHT5	Missense_Mutation	SNP	ENST00000274368.4	37	CCDS4034.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671149	0.88348	0.0	2.33E-4	ENSG00000145708	ENST00000274368;ENST00000506501	T;T	0.70399	-0.48;-0.48	4.01	4.01	0.46588	CUB (1);	0.000000	0.85682	D	0.000000	D	0.83931	0.5361	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.91635	0.999;0.559	D	0.86784	0.1981	10	0.72032	D	0.01	-11.844	16.6414	0.85128	0.0:1.0:0.0:0.0	.	77;77	D6RHH7;P24387	.;CRHBP_HUMAN	L	77	ENSP00000274368:P77L;ENSP00000426097:P77L	ENSP00000274368:P77L	P	+	2	0	CRHBP	76285664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.481000	0.66826	2.225000	0.72522	0.462000	0.41574	CCG		0.652	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2		NM_001882	
DDC	1644	broad.mit.edu	37	7	50607651	50607651	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr7:50607651T>C	ENST00000444124.2	-	3	477	c.277A>G	c.(277-279)Atg>Gtg	p.M93V	DDC_ENST00000380984.4_Missense_Mutation_p.M93V|DDC_ENST00000357936.5_Missense_Mutation_p.M93V|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000489162.1_5'UTR|DDC_ENST00000431062.1_Missense_Mutation_p.M93V|DDC_ENST00000426377.1_Intron	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	93	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.M93V(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	CCGCACAGCATGTCCGCAAGC	0.662																																																	2	Substitution - Missense(2)	kidney(2)											92.0	76.0	81.0					7																	50607651		2202	4300	6502	SO:0001583	missense	1644				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.277A>G	7.37:g.50607651T>C	ENSP00000403644:p.Met93Val	Somatic		WXS	Illumina GAIIx	Phase_I	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	T	17.75	3.466338	0.63625	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000444124;ENST00000380984	T;T;T;T	0.41065	1.01;1.1;1.01;1.01	5.5	5.5	0.81552	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.073190	0.85682	D	0.000000	T	0.56441	0.1985	M	0.89095	3.005	0.80722	D	1	B;B	0.34103	0.394;0.437	B;B	0.38616	0.277;0.216	T	0.64504	-0.6392	10	0.87932	D	0	-22.6585	15.6119	0.76727	0.0:0.0:0.0:1.0	.	93;93	Q53Y41;P20711	.;DDC_HUMAN	V	93	ENSP00000350616:M93V;ENSP00000399184:M93V;ENSP00000403644:M93V;ENSP00000370371:M93V	ENSP00000350616:M93V	M	-	1	0	DDC	50575145	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	8.008000	0.88588	2.080000	0.62538	0.533000	0.62120	ATG		0.662	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1			
DMXL2	23312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	51837940	51837940	+	Nonsense_Mutation	SNP	A	A	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr15:51837940A>C	ENST00000251076.5	-	8	1057	c.770T>G	c.(769-771)tTa>tGa	p.L257*	DMXL2_ENST00000543779.2_Nonsense_Mutation_p.L257*|DMXL2_ENST00000449909.3_Nonsense_Mutation_p.L257*|DMXL2_ENST00000560421.1_5'Flank	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	257						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.L257*(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ACATGAAGTTAACAACACATT	0.378																																																	1	Substitution - Nonsense(1)	kidney(1)											119.0	119.0	119.0					15																	51837940		2195	4293	6488	SO:0001587	stop_gained	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.770T>G	15.37:g.51837940A>C	ENSP00000251076:p.Leu257*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTR3|B7ZMH3|F5GWF1|O94938	Nonsense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852458	0.71719	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	.	.	.	5.86	4.73	0.59995	.	0.065802	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9671	0.53042	0.9321:0.0:0.0679:0.0	.	.	.	.	X	257	.	ENSP00000251076:L257X	L	-	2	0	DMXL2	49625232	1.000000	0.71417	0.171000	0.22900	0.178000	0.23041	8.910000	0.92685	1.043000	0.40175	-0.290000	0.09829	TTA		0.378	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2		NM_015263	
Unknown	0	broad.mit.edu	37	13	19413033	19413033	+	IGR	SNP	G	G	A	rs202151490		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr13:19413033G>A								LINC00418 (119164 upstream) : RP11-38M15.11 (20933 downstream)																							GCACATCCATGCACTAAAAAG	0.294																																																	0																																										SO:0001628	intergenic_variant	0																															13.37:g.19413033G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.294									
LRP1B	53353	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	141143576	141143576	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr2:141143576T>C	ENST00000389484.3	-	67	11388	c.10417A>G	c.(10417-10419)Aaa>Gaa	p.K3473E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3473					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.K3473E(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGTCTTTTTATCTGTAATG	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	kidney(1)											124.0	121.0	122.0					2																	141143576		2203	4300	6503	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10417A>G	2.37:g.141143576T>C	ENSP00000374135:p.Lys3473Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	11.06	1.526697	0.27299	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.89875	-2.58	6.08	6.08	0.98989	.	0.061222	0.64402	D	0.000004	T	0.75598	0.3871	N	0.11789	0.175	0.39939	D	0.974381	B	0.12013	0.005	B	0.12156	0.007	T	0.69518	-0.5124	10	0.02654	T	1	.	10.9027	0.47062	0.0:0.0695:0.0:0.9305	.	3473	Q9NZR2	LRP1B_HUMAN	E	3473;3411	ENSP00000374135:K3473E	ENSP00000374135:K3473E	K	-	1	0	LRP1B	140860046	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.588000	0.67517	2.333000	0.79357	0.533000	0.62120	AAA		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557	
LRRC8B	23507	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	90049715	90049715	+	Silent	SNP	C	C	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr1:90049715C>T	ENST00000330947.2	+	5	1866	c.1506C>T	c.(1504-1506)atC>atT	p.I502I	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Silent_p.I502I|LRRC8B_ENST00000358200.4_Silent_p.I502I	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	502					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I502I(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGGGAAAAATCCCACGCTGGG	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											45.0	50.0	48.0					1																	90049715		2203	4299	6502	SO:0001819	synonymous_variant	23507			AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.1506C>T	1.37:g.90049715C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DT28|Q6UY21|Q8N106|Q92627	Silent	SNP	ENST00000330947.2	37	CCDS724.1																																																																																				0.453	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1		NM_015350	
LYSMD4	145748	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	100269538	100269538	+	Silent	SNP	C	C	T	rs150607972		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr15:100269538C>T	ENST00000409796.1	-	3	743	c.681G>A	c.(679-681)ctG>ctA	p.L227L	LYSMD4_ENST00000344791.2_Silent_p.L228L|LYSMD4_ENST00000332728.4_Silent_p.L227L|LYSMD4_ENST00000604213.1_Intron|LYSMD4_ENST00000545021.1_Silent_p.L101L	NM_001284417.1|NM_001284418.1|NM_001284420.1	NP_001271346.1|NP_001271347.1|NP_001271349.1	Q5XG99	LYSM4_HUMAN	LysM, putative peptidoglycan-binding, domain containing 4	227						integral component of membrane (GO:0016021)		p.L228L(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)	10	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			CAATACCAATCAGCAGCATGA	0.478																																																	1	Substitution - coding silent(1)	kidney(1)						C		0,4406		0,0,2203	171.0	160.0	164.0		684	-7.4	0.2	15	dbSNP_134	164	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LYSMD4	NM_152449.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		228/298	100269538	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	145748			BC041097	CCDS10381.1, CCDS66876.1, CCDS66877.1, CCDS73788.1	15q26.3	2005-10-24			ENSG00000183060	ENSG00000183060			26571	protein-coding gene	gene with protein product						12477932	Standard	NM_001284418		Approved	FLJ33008	uc002bvl.3	Q5XG99	OTTHUMG00000149853	ENST00000409796.1:c.681G>A	15.37:g.100269538C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NII6|A8K2N1|Q96LY7	Silent	SNP	ENST00000409796.1	37																																																																																					0.478	LYSMD4-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335634.1		NM_152449	
MAGI2	9863	hgsc.bcm.edu	37	7	77998512	77998513	+	Frame_Shift_Ins	INS	-	-	C	rs202183519		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr7:77998512_77998513insC	ENST00000354212.4	-	7	1316_1317	c.1063_1064insG	c.(1063-1065)gaafs	p.E355fs	MAGI2_ENST00000419488.1_Frame_Shift_Ins_p.E355fs|MAGI2_ENST00000535697.1_Frame_Shift_Ins_p.E192fs|MAGI2_ENST00000522391.1_Frame_Shift_Ins_p.E355fs|MAGI2_ENST00000536571.1_Frame_Shift_Ins_p.E187fs	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	355	Interaction with DDN.|WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATCGATTTTTTCCCAGCCATAT	0.257																																																	0																																										SO:0001589	frameshift_variant	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1064dupG	7.37:g.77998515_77998515dupC	ENSP00000346151:p.Glu355fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Frame_Shift_Ins	INS	ENST00000354212.4	37	CCDS5594.1																																																																																				0.257	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3		NM_012301	
MALAT1	378938	broad.mit.edu;hgsc.bcm.edu	37	11	65272965	65272965	+	lincRNA	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr11:65272965T>C	ENST00000534336.1	+	0	7733					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GGGCAACCACTTTTCCCTAGC	0.483																																																	0													129.0	124.0	126.0					11																	65272965		874	1988	2862			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65272965T>C		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000534336.1	37																																																																																					0.483	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1		NR_002819	
KMT2C	58508	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	151879304	151879304	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr7:151879304C>G	ENST00000262189.6	-	36	5859	c.5641G>C	c.(5641-5643)Gtg>Ctg	p.V1881L	KMT2C_ENST00000355193.2_Missense_Mutation_p.V1881L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1881	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.V1881L(2)									GGTGAAAACACTTGCGGTGAG	0.537																																																	2	Substitution - Missense(2)	kidney(2)											86.0	89.0	88.0					7																	151879304		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5641G>C	7.37:g.151879304C>G	ENSP00000262189:p.Val1881Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	7.425	0.637514	0.14386	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.51325	0.71;0.71	5.41	-6.04	0.02178	.	0.365897	0.21904	N	0.067406	T	0.21227	0.0511	N	0.24115	0.695	0.49483	D	0.999791	B;B	0.15141	0.0;0.012	B;B	0.12156	0.001;0.007	T	0.15235	-1.0444	10	0.13470	T	0.59	.	5.1258	0.14884	0.0844:0.0989:0.085:0.7318	.	1881;942	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	L	1881	ENSP00000262189:V1881L;ENSP00000347325:V1881L	ENSP00000262189:V1881L	V	-	1	0	MLL3	151510237	0.165000	0.22948	0.062000	0.19696	0.629000	0.37895	0.236000	0.17967	-1.422000	0.02004	-0.471000	0.05019	GTG		0.537	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			
MRPL15	29088	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	55055338	55055338	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr8:55055338G>A	ENST00000260102.4	+	4	619	c.545G>A	c.(544-546)aGa>aAa	p.R182K		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	182					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R182K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			TATGATCCAAGAAGTCTGGGT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											139.0	130.0	133.0					8																	55055338		2203	4300	6503	SO:0001583	missense	29088			AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.545G>A	8.37:g.55055338G>A	ENSP00000260102:p.Arg182Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q96Q54|Q9H0Y1	Missense_Mutation	SNP	ENST00000260102.4	37	CCDS6158.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869160	0.32977	.	.	ENSG00000137547	ENST00000260102;ENST00000519831	.	.	.	5.33	2.31	0.28768	Ribosomal protein L18e/L15P (1);	0.131887	0.64402	N	0.000006	T	0.37156	0.0993	L	0.49126	1.545	0.18873	N	0.999988	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	9	0.26408	T	0.33	-9.5985	8.7999	0.34903	0.0702:0.0:0.662:0.2677	.	182	Q9P015	RM15_HUMAN	K	182	.	ENSP00000260102:R182K	R	+	2	0	MRPL15	55217891	0.967000	0.33354	0.027000	0.17364	0.990000	0.78478	4.334000	0.59291	0.710000	0.31997	0.655000	0.94253	AGA		0.368	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378254.1		NM_014175	
MSN	4478	broad.mit.edu	37	X	64958995	64958995	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chrX:64958995G>A	ENST00000360270.5	+	12	1680	c.1508G>A	c.(1507-1509)cGc>cAc	p.R503H		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	503					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)	p.R503H(1)	MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GCCAAGGACCGCAGTGAGGAG	0.547			T	ALK	ALCL																																			Dom	yes		X	Xq11.2-q12	4478	moesin		L	1	Substitution - Missense(1)	kidney(1)											92.0	58.0	70.0					X																	64958995		2203	4300	6503	SO:0001583	missense	4478			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1508G>A	X.37:g.64958995G>A	ENSP00000353408:p.Arg503His	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	g	28.7	4.939996	0.92526	.	.	ENSG00000147065	ENST00000360270	D	0.89270	-2.49	5.36	5.36	0.76844	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90283	0.6961	M	0.84082	2.675	0.80722	D	1	B	0.28820	0.224	B	0.30572	0.117	D	0.89397	0.3693	10	0.52906	T	0.07	.	16.6317	0.85035	0.0:0.0:1.0:0.0	.	503	P26038	MOES_HUMAN	H	503	ENSP00000353408:R503H	ENSP00000353408:R503H	R	+	2	0	MSN	64875720	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.757000	0.98924	2.242000	0.73789	0.519000	0.50382	CGC		0.547	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1		NM_002444	
NLRC5	84166	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	57060312	57060312	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr16:57060312C>G	ENST00000262510.6	+	6	1682	c.1457C>G	c.(1456-1458)gCt>gGt	p.A486G	NLRC5_ENST00000436936.1_Missense_Mutation_p.A486G|NLRC5_ENST00000539144.1_Missense_Mutation_p.A486G|NLRC5_ENST00000308149.7_Missense_Mutation_p.A486G	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	486	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.A486G(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCCTTGATAGCTTTTGGGGCC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											43.0	42.0	42.0					16																	57060312		2198	4300	6498	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1457C>G	16.37:g.57060312C>G	ENSP00000262510:p.Ala486Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.363|6.363	0.435081|0.435081	0.12045|0.12045	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144|ENST00000538805	D;D;D;D|.	0.83914|.	-1.78;-1.78;-1.78;-1.78|.	5.4|5.4	3.43|3.43	0.39272|0.39272	.|.	0.238257|.	0.21782|.	N|.	0.069185|.	T|T	0.28001|0.28001	0.0690|0.0690	L|L	0.35644|0.35644	1.08|1.08	0.20489|0.20489	N|N	0.999891|0.999891	B;B;B;B|.	0.29862|.	0.259;0.259;0.125;0.189|.	B;B;B;B|.	0.32980|.	0.156;0.156;0.037;0.065|.	T|T	0.21211|0.21211	-1.0252|-1.0252	10|5	0.44086|.	T|.	0.13|.	.|.	4.1034|4.1034	0.10025|0.10025	0.2987:0.4926:0.1304:0.0783|0.2987:0.4926:0.1304:0.0783	.|.	486;486;486;486|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	G|R	486|238	ENSP00000262510:A486G;ENSP00000308886:A486G;ENSP00000389739:A486G;ENSP00000441727:A486G|.	ENSP00000262510:A486G|.	A|S	+|+	2|3	0|2	NLRC5|NLRC5	55617813|55617813	0.527000|0.527000	0.26306|0.26306	0.032000|0.032000	0.17829|0.17829	0.057000|0.057000	0.15508|0.15508	0.965000|0.965000	0.29319|0.29319	0.640000|0.640000	0.30582|0.30582	0.561000|0.561000	0.74099|0.74099	GCT|AGC		0.592	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1		NM_032206	
OR4K1	79544	broad.mit.edu;hgsc.bcm.edu	37	14	20403973	20403973	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr14:20403973T>A	ENST00000285600.4	+	1	207	c.148T>A	c.(148-150)Tct>Act	p.S50T		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S50T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TGTCATTATTTCTTTTGACTC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											331.0	348.0	342.0					14																	20403973		2203	4300	6503	SO:0001583	missense	79544				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.148T>A	14.37:g.20403973T>A	ENSP00000285600:p.Ser50Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.974052	0.00452	.	.	ENSG00000155249	ENST00000285600	T	0.01076	5.37	4.77	0.941	0.19519	GPCR, rhodopsin-like superfamily (1);	0.600012	0.15160	N	0.277230	T	0.00440	0.0014	N	0.01277	-0.915	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47407	-0.9120	10	0.02654	T	1	.	5.6255	0.17480	0.2839:0.0:0.1457:0.5704	.	50	Q8NGD4	OR4K1_HUMAN	T	50	ENSP00000285600:S50T	ENSP00000285600:S50T	S	+	1	0	OR4K1	19473813	0.000000	0.05858	0.062000	0.19696	0.329000	0.28539	-0.574000	0.05868	0.826000	0.34661	0.459000	0.35465	TCT		0.373	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1			
OR4K1	79544	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	20404157	20404157	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr14:20404157A>G	ENST00000285600.4	+	1	391	c.332A>G	c.(331-333)gAg>gGg	p.E111G		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E111G(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GTTGGGAGTGAGATGATGTTG	0.418																																																	1	Substitution - Missense(1)	kidney(1)											142.0	138.0	139.0					14																	20404157		2203	4300	6503	SO:0001583	missense	79544				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.332A>G	14.37:g.20404157A>G	ENSP00000285600:p.Glu111Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	19.04	3.749319	0.69533	.	.	ENSG00000155249	ENST00000285600	T	0.00388	7.59	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000023	T	0.01592	0.0051	H	0.95982	3.75	0.34536	D	0.709728	D	0.89917	1.0	D	0.72982	0.979	T	0.06899	-1.0801	10	0.87932	D	0	.	12.5899	0.56437	1.0:0.0:0.0:0.0	.	111	Q8NGD4	OR4K1_HUMAN	G	111	ENSP00000285600:E111G	ENSP00000285600:E111G	E	+	2	0	OR4K1	19473997	0.986000	0.35501	1.000000	0.80357	0.994000	0.84299	4.906000	0.63293	2.066000	0.61787	0.533000	0.62120	GAG		0.418	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1			
OSBPL10	114884	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	31774806	31774806	+	Silent	SNP	G	G	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr3:31774806G>T	ENST00000396556.2	-	6	1160	c.1038C>A	c.(1036-1038)acC>acA	p.T346T	OSBPL10_ENST00000438237.2_Silent_p.T282T|OSBPL10_ENST00000467647.1_5'UTR	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	346					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.T346T(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		AAATTGCCCAGGTTATGTTGG	0.502																																																	2	Substitution - coding silent(2)	kidney(2)											153.0	144.0	147.0					3																	31774806		2203	4300	6503	SO:0001819	synonymous_variant	114884			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1038C>A	3.37:g.31774806G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	8.622	0.891636	0.17613	.	.	ENSG00000144645	ENST00000429492	.	.	.	5.19	2.21	0.28008	.	.	.	.	.	T	0.56187	0.1968	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52275	-0.8597	4	.	.	.	-17.7522	8.1685	0.31241	0.0:0.1288:0.3834:0.4877	.	.	.	.	H	115	.	.	P	-	2	0	OSBPL10	31749810	0.983000	0.35010	1.000000	0.80357	0.925000	0.55904	-0.093000	0.11111	1.310000	0.45006	0.555000	0.69702	CCT		0.502	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2			
PAX1	5075	broad.mit.edu	37	20	21690005	21690005	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr20:21690005C>T	ENST00000398485.2	+	4	1259	c.1205C>T	c.(1204-1206)gCg>gTg	p.A402V	PAX1_ENST00000444366.2_Missense_Mutation_p.A378V|PAX1_ENST00000460221.1_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	402					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A402V(1)|p.A308V(1)		autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CCTCCTCTGGCGCCCCCCGGG	0.741																																																	2	Substitution - Missense(2)	kidney(2)											8.0	11.0	10.0					20																	21690005		2000	3842	5842	SO:0001583	missense	5075				CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1205C>T	20.37:g.21690005C>T	ENSP00000381499:p.Ala402Val	Somatic		WXS	Illumina GAIIx	Phase_I	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868291	0.72065	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.98400	-4.48;-4.91	5.66	5.66	0.87406	.	3.300530	0.01317	N	0.010810	D	0.95765	0.8622	L	0.36672	1.1	0.25391	N	0.988522	P;B;P	0.44659	0.733;0.384;0.84	B;B;B	0.33392	0.131;0.038;0.163	D	0.88585	0.3139	10	0.35671	T	0.21	.	9.8774	0.41211	0.1538:0.6978:0.1484:0.0	.	378;308;402	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	V	402;378	ENSP00000381499:A402V;ENSP00000410355:A378V	ENSP00000381499:A402V	A	+	2	0	PAX1	21638005	0.999000	0.42202	0.826000	0.32828	0.724000	0.41520	3.780000	0.55386	2.667000	0.90743	0.462000	0.41574	GCG		0.741	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3			
PI16	221476	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	36922553	36922553	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr6:36922553G>T	ENST00000373674.3	+	1	345	c.17G>T	c.(16-18)aGt>aTt	p.S6I		NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	6					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)	p.S6I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGCTCCTGCAGTTTCctgatg	0.602																																																	1	Substitution - Missense(1)	kidney(1)											39.0	41.0	40.0					6																	36922553		2203	4300	6503	SO:0001583	missense	221476				CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.17G>T	6.37:g.36922553G>T	ENSP00000362778:p.Ser6Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	37	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262737	0.39995	.	.	ENSG00000164530	ENST00000536757;ENST00000373674	T	0.07800	3.16	5.36	1.28	0.21552	.	1.176140	0.06063	N	0.658753	T	0.02083	0.0065	L	0.29908	0.895	0.09310	N	1	P;B	0.35982	0.531;0.131	B;B	0.31191	0.125;0.081	T	0.44982	-0.9292	10	0.87932	D	0	.	6.3642	0.21445	0.2175:0.0:0.6547:0.1278	.	6;6	Q6UXB8;Q6UXB8-2	PI16_HUMAN;.	I	6	ENSP00000362778:S6I	ENSP00000362778:S6I	S	+	2	0	PI16	37030531	0.000000	0.05858	0.003000	0.11579	0.944000	0.59088	0.397000	0.20883	0.646000	0.30693	0.491000	0.48974	AGT		0.602	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1		NM_153370	
POLE	5426	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	133220012	133220012	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr12:133220012C>G	ENST00000320574.5	-	34	4468	c.4425G>C	c.(4423-4425)caG>caC	p.Q1475H	POLE_ENST00000535270.1_Missense_Mutation_p.Q1448H|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1475					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.Q1475H(2)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGTAGCTGAACTGGGCCAGAG	0.577								DNA polymerases (catalytic subunits)																																									2	Substitution - Missense(2)	kidney(2)											131.0	127.0	128.0					12																	133220012		2203	4300	6503	SO:0001583	missense	5426				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4425G>C	12.37:g.133220012C>G	ENSP00000322570:p.Gln1475His	Somatic		WXS	Illumina HiSeq	Phase_I	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	9.997	1.232431	0.22626	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.02890	4.12;4.12;4.12	5.69	1.82	0.25136	.	0.049872	0.85682	D	0.000000	T	0.03348	0.0097	L	0.45581	1.43	0.80722	D	1	B;B	0.14438	0.01;0.006	B;B	0.17433	0.018;0.008	T	0.45190	-0.9278	10	0.38643	T	0.18	.	9.4433	0.38681	0.0:0.7296:0.0:0.2704	.	1448;1475	F5H1D6;Q07864	.;DPOE1_HUMAN	H	1475;1486;1448	ENSP00000322570:Q1475H;ENSP00000406383:Q1486H;ENSP00000445753:Q1448H	ENSP00000322570:Q1475H	Q	-	3	2	POLE	131730085	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.693000	0.47027	0.349000	0.23975	0.650000	0.86243	CAG		0.577	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2		NM_006231	
PRDX1	5052	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	45984673	45984673	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr1:45984673A>G	ENST00000262746.1	-	2	382	c.43T>C	c.(43-45)Ttc>Ctc	p.F15L	PRDX1_ENST00000372079.1_Missense_Mutation_p.F15L|PRDX1_ENST00000319248.8_Missense_Mutation_p.F15L|PRDX1_ENST00000483583.1_5'UTR	NM_002574.3|NM_181696.2	NP_002565.1|NP_859047.1	Q06830	PRDX1_HUMAN	peroxiredoxin 1	15	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell proliferation (GO:0008283)|erythrocyte homeostasis (GO:0034101)|hydrogen peroxide catabolic process (GO:0042744)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of NF-kappaB import into nucleus (GO:0042345)|regulation of stress-activated MAPK cascade (GO:0032872)|removal of superoxide radicals (GO:0019430)|retina homeostasis (GO:0001895)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)	heme binding (GO:0020037)|peroxidase activity (GO:0004601)|poly(A) RNA binding (GO:0044822)|thioredoxin peroxidase activity (GO:0008379)	p.F15L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	12	Acute lymphoblastic leukemia(166;0.155)					GTGGCTTTGAAGTTGGGGGCA	0.403																																																	1	Substitution - Missense(1)	kidney(1)											97.0	95.0	95.0					1																	45984673		2203	4300	6503	SO:0001583	missense	5052			BC021683	CCDS522.1	1p34.1	2008-02-05			ENSG00000117450	ENSG00000117450			9352	protein-coding gene	gene with protein product		176763		PAGA		8496166	Standard	NM_181697		Approved	NKEFA	uc021omw.1	Q06830	OTTHUMG00000007738	ENST00000262746.1:c.43T>C	1.37:g.45984673A>G	ENSP00000262746:p.Phe15Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B5BU26|D3DPZ8|P35703|Q2V576|Q5T154|Q5T155	Missense_Mutation	SNP	ENST00000262746.1	37	CCDS522.1	.	.	.	.	.	.	.	.	.	.	A	35	5.465763	0.96257	.	.	ENSG00000117450	ENST00000262746;ENST00000319248;ENST00000372079;ENST00000447184;ENST00000424390	T;T;T;T;T	0.47177	0.85;0.85;1.74;0.85;0.85	5.77	5.77	0.91146	Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.74076	0.3669	H	0.95224	3.64	0.80722	D	1	P	0.45634	0.863	P	0.53912	0.737	T	0.82202	-0.0574	10	0.87932	D	0	-12.392	16.3818	0.83467	1.0:0.0:0.0:0.0	.	15	Q06830	PRDX1_HUMAN	L	15	ENSP00000262746:F15L;ENSP00000361152:F15L;ENSP00000361150:F15L;ENSP00000407034:F15L;ENSP00000389047:F15L	ENSP00000262746:F15L	F	-	1	0	PRDX1	45757260	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.715000	0.91416	2.330000	0.79161	0.528000	0.53228	TTC		0.403	PRDX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020845.1		NM_181697	
REPS1	85021	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	139233902	139233902	+	Splice_Site	SNP	C	C	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr6:139233902C>T	ENST00000450536.2	-	16	2545	c.1971G>A	c.(1969-1971)ccG>ccA	p.P657P	REPS1_ENST00000258062.5_Splice_Site_p.P656P|REPS1_ENST00000415951.2_Splice_Site_p.P630P|REPS1_ENST00000367663.4_Splice_Site_p.P630P|REPS1_ENST00000409812.2_Splice_Site_p.P566P			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	657	Interaction with RALBP1. {ECO:0000250}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)	p.P604P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		GAAAACTGACCGGCAGGACTT	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											134.0	124.0	128.0					6																	139233902		2203	4300	6503	SO:0001630	splice_region_variant	85021				CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1971+1G>A	6.37:g.139233902C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Silent	SNP	ENST00000450536.2	37		.	.	.	.	.	.	.	.	.	.	C	14.12	2.441987	0.43326	.	.	ENSG00000135597	ENST00000478483	.	.	.	5.96	4.17	0.49024	.	.	.	.	.	T	0.58409	0.2120	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58787	-0.7575	4	.	.	.	-1.1258	13.331	0.60488	0.0:0.8698:0.0:0.1302	.	.	.	.	Q	36	.	.	R	-	2	0	REPS1	139275595	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	2.475000	0.45162	0.826000	0.34661	0.655000	0.94253	CGG		0.428	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3			Silent
RP1L1	94137	hgsc.bcm.edu	37	8	10467605	10467605	+	Missense_Mutation	SNP	C	C	T	rs61503212		TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr8:10467605C>T	ENST00000382483.3	-	4	4226	c.4003G>A	c.(4003-4005)Ggg>Agg	p.G1335R		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1351	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.		G -> R (in allele RP1L1-2 and allele RP1L1-3; dbSNP:rs61503212).|Missing (in allele RP1L1-1).		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		aactgcaccccctcttcttgc	0.468																																																	0													120.0	116.0	117.0					8																	10467605		1948	4134	6082	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4003G>A	8.37:g.10467605C>T	ENSP00000371923:p.Gly1335Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604607	0.28623	.	.	ENSG00000183638	ENST00000382483	T	0.05996	3.36	2.64	-0.606	0.11619	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.80722	P	0.0	B	0.29862	0.259	B	0.23018	0.043	T	0.36962	-0.9726	8	0.48119	T	0.1	.	7.1242	0.25463	0.0:0.3817:0.0:0.6183	rs61503212	1335	A6NKC6	.	R	1335	ENSP00000371923:G1335R	ENSP00000371923:G1335R	G	-	1	0	RP1L1	10505015	0.000000	0.05858	0.004000	0.12327	0.295000	0.27426	0.159000	0.16442	-0.082000	0.12640	0.462000	0.41574	GGG		0.468	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			
RSU1	6251	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	16737058	16737058	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr10:16737058T>A	ENST00000377921.3	-	7	996	c.695A>T	c.(694-696)cAt>cTt	p.H232L	RSU1_ENST00000464074.2_5'UTR|RSU1_ENST00000345264.5_Missense_Mutation_p.H232L|RSU1_ENST00000602389.1_Missense_Mutation_p.H179L			Q15404	RSU1_HUMAN	Ras suppressor protein 1	232					cell junction assembly (GO:0034329)|positive regulation of neural precursor cell proliferation (GO:2000179)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)		p.H232L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(1;7.54e-08)		CTCAAAAACATGGGACACGCC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											78.0	78.0	78.0					10																	16737058		2203	4300	6503	SO:0001583	missense	6251			AK055596	CCDS7112.1, CCDS31157.1	10p13	2012-09-20			ENSG00000148484	ENSG00000148484			10464	protein-coding gene	gene with protein product		179555				8288261	Standard	NM_152724		Approved	RSP-1, FLJ31034	uc001iol.3	Q15404	OTTHUMG00000017740	ENST00000377921.3:c.695A>T	10.37:g.16737058T>A	ENSP00000367154:p.His232Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA46|D3DRU3|Q6FI17	Missense_Mutation	SNP	ENST00000377921.3	37	CCDS7112.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.582097	0.65992	.	.	ENSG00000148484	ENST00000345264;ENST00000377921;ENST00000377911	T;T	0.38722	1.12;1.12	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	M	0.64170	1.965	0.80722	D	1	P	0.44195	0.828	B	0.39339	0.297	T	0.43988	-0.9357	10	0.45353	T	0.12	.	15.4608	0.75356	0.0:0.0:0.0:1.0	.	232	Q15404	RSU1_HUMAN	L	232;232;179	ENSP00000339521:H232L;ENSP00000367154:H232L	ENSP00000339521:H232L	H	-	2	0	RSU1	16777064	1.000000	0.71417	0.956000	0.39512	0.701000	0.40568	7.698000	0.84413	2.054000	0.61138	0.455000	0.32223	CAT		0.408	RSU1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047006.1		NM_012425, NM_152724	
SCAF4	57466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	33043798	33043798	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr21:33043798T>A	ENST00000286835.7	-	20	3740	c.3358A>T	c.(3358-3360)Aag>Tag	p.K1120*	SCAF4_ENST00000399804.1_Nonsense_Mutation_p.K1098*|SCAF4_ENST00000434667.3_Nonsense_Mutation_p.K1105*	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	1120						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K1120*(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TCAGAAGGCTTTAGGACTGCA	0.507																																																	1	Substitution - Nonsense(1)	kidney(1)											108.0	98.0	101.0					21																	33043798		2203	4300	6503	SO:0001587	stop_gained	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.3358A>T	21.37:g.33043798T>A	ENSP00000286835:p.Lys1120*	Somatic		WXS	Illumina HiSeq	Phase_I	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Nonsense_Mutation	SNP	ENST00000286835.7	37	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	T	38	7.031395	0.98013	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	.	.	.	5.82	4.65	0.58169	.	0.930942	0.09049	N	0.856155	.	.	.	.	.	.	0.51482	D	0.999922	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6924	13.1361	0.59409	0.0:0.0:0.1336:0.8663	.	.	.	.	X	1105;1120;1098	.	ENSP00000286835:K1120X	K	-	1	0	SCAF4	31965669	0.987000	0.35691	0.027000	0.17364	0.077000	0.17291	3.922000	0.56462	1.011000	0.39340	0.533000	0.62120	AAG		0.507	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1		XM_047889	
SLC23A1	9963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	138707793	138707793	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr5:138707793C>A	ENST00000348729.3	-	14	1745	c.1699G>T	c.(1699-1701)Gtc>Ttc	p.V567F	CTB-43P18.1_ENST00000503553.3_RNA|SLC23A1_ENST00000353963.3_Missense_Mutation_p.V571F	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	567					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)	p.V571F(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CCTTTGAAGACTGGGCAGATA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											144.0	145.0	145.0					5																	138707793		2203	4300	6503	SO:0001583	missense	9963			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1699G>T	5.37:g.138707793C>A	ENSP00000302701:p.Val567Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.337101	0.41398	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881	T;T	0.17691	2.26;2.26	6.02	3.25	0.37280	.	0.413235	0.27004	N	0.021402	T	0.12817	0.0311	L	0.36672	1.1	0.35074	D	0.762769	B;B	0.22800	0.075;0.036	B;B	0.26310	0.068;0.056	T	0.10245	-1.0638	10	0.62326	D	0.03	-24.0446	4.9584	0.14054	0.1239:0.6219:0.12:0.1341	.	567;571	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	F	571;567;228	ENSP00000302851:V571F;ENSP00000302701:V567F	ENSP00000343584:V228F	V	-	1	0	SLC23A1	138735692	0.383000	0.25156	1.000000	0.80357	0.997000	0.91878	0.577000	0.23758	0.861000	0.35504	0.650000	0.86243	GTC		0.408	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1		NM_152685	
SLC25A4	291	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	186066922	186066922	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr4:186066922C>G	ENST00000281456.6	+	3	740	c.608C>G	c.(607-609)cCt>cGt	p.P203R		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	203					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)	p.P203R(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	GGGATGCTGCCTGACCCCAAG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											98.0	79.0	85.0					4																	186066922		2203	4300	6503	SO:0001583	missense	291			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.608C>G	4.37:g.186066922C>G	ENSP00000281456:p.Pro203Arg	Somatic		WXS	Illumina HiSeq	Phase_I	D3DP59	Missense_Mutation	SNP	ENST00000281456.6	37	CCDS34114.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374748	0.61735	.	.	ENSG00000151729	ENST00000281456	T	0.77877	-1.13	5.54	4.7	0.59300	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.72566	0.3476	L	0.47716	1.5	0.80722	D	1	B	0.16603	0.018	B	0.17433	0.018	T	0.70414	-0.4878	10	0.56958	D	0.05	-2.7034	14.3719	0.66846	0.0:0.9297:0.0:0.0703	.	203	P12235	ADT1_HUMAN	R	203	ENSP00000281456:P203R	ENSP00000281456:P203R	P	+	2	0	SLC25A4	186303916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.638000	0.83328	1.578000	0.49821	0.655000	0.94253	CCT		0.577	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259170.3		NM_001151	
SLC2A10	81031	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	45355557	45355557	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr20:45355557T>A	ENST00000359271.2	+	3	1593	c.1343T>A	c.(1342-1344)tTc>tAc	p.F448Y		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	448					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.F448Y(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GGAAGAGCCTTCGCCTTCTGC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											162.0	146.0	151.0					20																	45355557		2203	4300	6503	SO:0001583	missense	81031			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1343T>A	20.37:g.45355557T>A	ENSP00000352216:p.Phe448Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155815	0.57259	.	.	ENSG00000197496	ENST00000359271	T	0.74106	-0.81	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.050750	0.85682	D	0.000000	T	0.77758	0.4178	L	0.35854	1.095	0.44289	D	0.997159	D	0.56968	0.978	D	0.66716	0.946	T	0.72040	-0.4410	10	0.08381	T	0.77	0.7118	16.1525	0.81632	0.0:0.0:0.0:1.0	.	448	O95528	GTR10_HUMAN	Y	448	ENSP00000352216:F448Y	ENSP00000352216:F448Y	F	+	2	0	SLC2A10	44788964	1.000000	0.71417	0.997000	0.53966	0.254000	0.26022	5.847000	0.69451	2.211000	0.71520	0.383000	0.25322	TTC		0.567	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2			
SLFN11	91607	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	33679558	33679558	+	Silent	SNP	T	T	C			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr17:33679558T>C	ENST00000394566.1	-	7	2795	c.2523A>G	c.(2521-2523)gcA>gcG	p.A841A	SLFN11_ENST00000308377.4_Silent_p.A841A	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	841					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.A841A(1)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACATATCACATGCATCACTGA	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											279.0	237.0	251.0					17																	33679558		2203	4300	6503	SO:0001819	synonymous_variant	91607			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2523A>G	17.37:g.33679558T>C		Somatic		WXS	Illumina HiSeq	Phase_I	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	37	CCDS11294.1																																																																																				0.483	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1		NM_152270	
SNX18	112574	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	53814577	53814577	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr5:53814577T>A	ENST00000326277.3	+	1	985	c.795T>A	c.(793-795)taT>taA	p.Y265*	SNX18_ENST00000343017.6_Nonsense_Mutation_p.Y265*|SNX18_ENST00000381410.4_Nonsense_Mutation_p.Y265*	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	265					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.Y265*(2)		endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				TGGGGCCCTATGGCCCCGAGT	0.627																																																	2	Substitution - Nonsense(2)	kidney(2)											66.0	71.0	70.0					5																	53814577		2203	4300	6503	SO:0001587	stop_gained	112574			AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.795T>A	5.37:g.53814577T>A	ENSP00000317332:p.Tyr265*	Somatic		WXS	Illumina HiSeq	Phase_I	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Nonsense_Mutation	SNP	ENST00000326277.3	37	CCDS3962.1	.	.	.	.	.	.	.	.	.	.	C	37	6.581271	0.97680	.	.	ENSG00000178996	ENST00000343017;ENST00000381410;ENST00000326277	.	.	.	4.8	2.08	0.27032	.	0.484880	0.22019	N	0.065760	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.9338	5.6753	0.17745	0.0:0.5751:0.1292:0.2957	.	.	.	.	X	265	.	ENSP00000317332:Y265X	Y	+	3	2	SNX18	53850334	0.051000	0.20477	0.997000	0.53966	0.990000	0.78478	-0.540000	0.06106	0.010000	0.14839	-0.226000	0.12346	TAT		0.627	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2			
SORBS1	10580	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	97135759	97135759	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr10:97135759A>G	ENST00000361941.3	-	17	1734	c.1708T>C	c.(1708-1710)Ttc>Ctc	p.F570L	SORBS1_ENST00000371245.3_Missense_Mutation_p.F455L|SORBS1_ENST00000353505.5_Missense_Mutation_p.F455L|SORBS1_ENST00000354106.3_Missense_Mutation_p.F540L|SORBS1_ENST00000277982.5_Missense_Mutation_p.F592L|SORBS1_ENST00000607232.1_Missense_Mutation_p.F359L|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000393949.1_Missense_Mutation_p.F540L|SORBS1_ENST00000371247.2_Missense_Mutation_p.F570L|SORBS1_ENST00000371239.1_Missense_Mutation_p.F369L|SORBS1_ENST00000347291.4_Missense_Mutation_p.F438L|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371246.2_Missense_Mutation_p.F592L|SORBS1_ENST00000371227.4_Missense_Mutation_p.F524L	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1									p.F455L(1)|p.F570L(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TCCGAAAAGAATTTATACCAA	0.378																																																	2	Substitution - Missense(2)	kidney(2)											83.0	85.0	85.0					10																	97135759		2203	4300	6503	SO:0001583	missense	10580			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.1708T>C	10.37:g.97135759A>G	ENSP00000355136:p.Phe570Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	A	34	5.317095	0.95682	.	.	ENSG00000095637	ENST00000371245;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.66	5.66	0.87406	.	0.000000	0.38005	N	0.001855	T	0.51227	0.1662	N	0.25485	0.75	0.41898	D	0.990401	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.997;0.996;0.989	D;D;D;D;P;P	0.80764	0.957;0.994;0.986;0.967;0.881;0.89	T	0.48692	-0.9013	10	0.32370	T	0.25	-15.3233	15.8933	0.79318	1.0:0.0:0.0:0.0	.	524;455;570;592;438;540	Q9BX66-11;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6;Q9BX66-5	.;.;SRBS1_HUMAN;.;.;.	L	455;570;524;592;540;455;438;570;592;540;369	ENSP00000360291:F455L;ENSP00000360293:F570L;ENSP00000360271:F524L;ENSP00000360292:F592L;ENSP00000377521:F540L;ENSP00000343998:F455L;ENSP00000277985:F438L;ENSP00000355136:F570L;ENSP00000277982:F592L;ENSP00000277984:F540L;ENSP00000360283:F369L	ENSP00000277982:F592L	F	-	1	0	SORBS1	97125749	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.297000	0.96120	2.158000	0.67659	0.533000	0.62120	TTC		0.378	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1			
TBCK	93627	broad.mit.edu;hgsc.bcm.edu	37	4	107157650	107157650	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr4:107157650C>T	ENST00000273980.5	-	15	1694	c.1247G>A	c.(1246-1248)aGc>aAc	p.S416N	TBCK_ENST00000394706.3_Missense_Mutation_p.S377N|TBCK_ENST00000394708.2_Missense_Mutation_p.S416N|TBCK_ENST00000432496.2_Missense_Mutation_p.S416N|TBCK_ENST00000361687.4_Missense_Mutation_p.S353N					TBC1 domain containing kinase									p.S416N(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						CTCATTATTGCTGTTTGAATG	0.343																																																	1	Substitution - Missense(1)	kidney(1)											56.0	56.0	56.0					4																	107157650		2203	4299	6502	SO:0001583	missense	93627				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1247G>A	4.37:g.107157650C>T	ENSP00000273980:p.Ser416Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000273980.5	37	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997455	0.74818	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.31765	0.0807	L	0.59436	1.845	0.80722	D	1	B;D;P	0.76494	0.344;0.999;0.724	B;D;B	0.70716	0.189;0.97;0.19	T	0.00111	-1.2046	10	0.45353	T	0.12	.	20.2169	0.98300	0.0:1.0:0.0:0.0	.	416;377;353	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	N	416;416;353;377;416	ENSP00000273980:S416N;ENSP00000405847:S416N;ENSP00000355338:S353N;ENSP00000378196:S377N;ENSP00000378198:S416N	ENSP00000273980:S416N	S	-	2	0	TBCK	107377099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.618000	0.83043	2.774000	0.95407	0.643000	0.83706	AGC		0.343	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4		NM_033115	
TIAM1	7074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	32638828	32638828	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr21:32638828G>A	ENST00000286827.3	-	5	932	c.461C>T	c.(460-462)tCc>tTc	p.S154F	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Missense_Mutation_p.S154F	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	154					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S154F(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GGGCCCATTGGATGTATAGGA	0.537																																																	2	Substitution - Missense(2)	kidney(2)											109.0	102.0	104.0					21																	32638828		2203	4300	6503	SO:0001583	missense	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.461C>T	21.37:g.32638828G>A	ENSP00000286827:p.Ser154Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290881	0.40494	.	.	ENSG00000156299	ENST00000286827;ENST00000541036;ENST00000455508	T;T	0.44083	0.95;0.93	5.59	5.59	0.84812	.	0.295752	0.29106	N	0.013125	T	0.32285	0.0824	N	0.14661	0.345	0.30841	N	0.735635	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.32534	-0.9903	10	0.87932	D	0	.	19.5961	0.95538	0.0:0.0:1.0:0.0	.	154;154;154	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	F	154	ENSP00000286827:S154F;ENSP00000441570:S154F	ENSP00000286827:S154F	S	-	2	0	TIAM1	31560699	1.000000	0.71417	0.716000	0.30569	0.938000	0.57974	6.451000	0.73481	2.621000	0.88768	0.591000	0.81541	TCC		0.537	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1		NM_003253	
USP9X	8239	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	41091721	41091721	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chrX:41091721C>G	ENST00000324545.8	+	45	8290	c.7657C>G	c.(7657-7659)Caa>Gaa	p.Q2553E	USP9X_ENST00000378308.2_Missense_Mutation_p.Q2537E|RP5-1172N10.4_ENST00000602481.1_RNA	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2553					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.Q2530E(1)|p.Q2553E(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CCAACGAGCACAAGAAAATTA	0.458																																					Ovarian(172;1807 2695 35459 49286)												2	Substitution - Missense(2)	kidney(2)											120.0	101.0	107.0					X																	41091721		2203	4300	6503	SO:0001583	missense	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7657C>G	X.37:g.41091721C>G	ENSP00000316357:p.Gln2553Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299611	0.40694	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03358	3.96;4.04	5.79	5.79	0.91817	.	0.181090	0.49916	D	0.000137	T	0.11153	0.0272	L	0.40543	1.245	0.58432	D	0.999998	P;B	0.43578	0.811;0.378	P;B	0.54924	0.764;0.042	T	0.01039	-1.1472	10	0.66056	D	0.02	.	18.9421	0.92608	0.0:1.0:0.0:0.0	.	2537;2553	Q93008-1;Q93008	.;USP9X_HUMAN	E	2537;2553	ENSP00000367558:Q2537E;ENSP00000316357:Q2553E	ENSP00000316357:Q2553E	Q	+	1	0	USP9X	40976665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.890000	0.75633	2.422000	0.82143	0.594000	0.82650	CAA		0.458	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4		NM_004652	
ZNF2	7549	hgsc.bcm.edu;ucsc.edu	37	2	95847736	95847736	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A3-3370-01A-02D-1421-08	TCGA-A3-3370-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	21ce7121-87b4-4686-9bf6-aff71d8b2223	969705aa-a77d-4084-a692-59819d33068e	g.chr2:95847736delA	ENST00000340539.5	+	5	1625	c.1163delA	c.(1162-1164)catfs	p.H388fs	ZNF2_ENST00000295210.6_Frame_Shift_Del_p.H350fs|ZNF2_ENST00000453539.2_Frame_Shift_Del_p.H401fs|ZNF2_ENST00000398107.2_Frame_Shift_Del_p.H346fs|ZNF2_ENST00000425369.1_Frame_Shift_Del_p.H308fs	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		CTCACGCGGCATCAGCGTGTC	0.512																																																	0													74.0	83.0	80.0					2																	95847736		2143	4273	6416	SO:0001589	frameshift_variant	7549			X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.1163delA	2.37:g.95847736delA	ENSP00000345392:p.His388fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Frame_Shift_Del	DEL	ENST00000340539.5	37	CCDS42712.1																																																																																				0.512	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338595.2		NM_021088	
