#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	48353926	48353926	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:48353926C>A	ENST00000435803.1	+	26	9803	c.9779C>A	c.(9778-9780)tCt>tAt	p.S3260Y		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3260					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S3260Y(2)|p.S3205Y(2)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTTAGCGATTCTAATATGTTT	0.363																																																	4	Substitution - Missense(4)	lung(2)|kidney(2)											77.0	71.0	73.0					7																	48353926		1812	4084	5896	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9779C>A	7.37:g.48353926C>A	ENSP00000411096:p.Ser3260Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574111	0.45902	.	.	ENSG00000179869	ENST00000435803	D	0.86432	-2.12	5.7	5.7	0.88788	.	0.141719	0.32918	N	0.005493	D	0.91971	0.7457	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.68192	0.885;0.956	D	0.92103	0.5690	10	0.72032	D	0.01	.	17.353	0.87329	0.0:1.0:0.0:0.0	.	962;3260	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	Y	3260	ENSP00000411096:S3260Y	ENSP00000411096:S3260Y	S	+	2	0	ABCA13	48324472	0.002000	0.14202	0.092000	0.20876	0.211000	0.24417	1.600000	0.36762	2.848000	0.98002	0.655000	0.94253	TCT		0.363	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2		NM_152701	
ABI2	10152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	204267389	204267389	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr2:204267389C>A	ENST00000422511.2	+	9	1056	c.1025C>A	c.(1024-1026)cCt>cAt	p.P342H	RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000430418.1_Missense_Mutation_p.P320H|ABI2_ENST00000261016.6_Missense_Mutation_p.P263H|ABI2_ENST00000424558.1_Missense_Mutation_p.P369H|ABI2_ENST00000261017.5_Missense_Mutation_p.P308H|ABI2_ENST00000430574.1_3'UTR|ABI2_ENST00000295851.5_Missense_Mutation_p.P375H|ABI2_ENST00000261018.7_Missense_Mutation_p.P161H			Q9NYB9	ABI2_HUMAN	abl-interactor 2	375	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cell migration (GO:0016477)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|Rac protein signal transduction (GO:0016601)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	cytoskeletal adaptor activity (GO:0008093)|DNA binding (GO:0003677)|kinase binding (GO:0019900)|proline-rich region binding (GO:0070064)|protein complex binding (GO:0032403)|SH3 domain binding (GO:0017124)|ubiquitin protein ligase binding (GO:0031625)	p.P308H(1)		breast(1)|kidney(3)|large_intestine(1)|liver(2)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	15						AGACGCCCTCCTTCCATTACT	0.438																																																	1	Substitution - Missense(1)	kidney(1)											105.0	102.0	103.0					2																	204267389		2203	4300	6503	SO:0001583	missense	10152			AF260261	CCDS2358.1, CCDS63093.1, CCDS63094.1, CCDS74634.1	2q33	2010-09-20	2009-07-23		ENSG00000138443	ENSG00000138443			24011	protein-coding gene	gene with protein product		606442				7590236, 10964520	Standard	XM_005246217		Approved	ABI-2, AIP-1, ABI2B, AblBP3, argBPIA, SSH3BP2	uc002uzz.3	Q9NYB9	OTTHUMG00000132879	ENST00000422511.2:c.1025C>A	2.37:g.204267389C>A	ENSP00000396249:p.Pro342His	Somatic		WXS	Illumina HiSeq	Phase_I	B4DSN1|Q13147|Q13249|Q13801|Q9BV70	Missense_Mutation	SNP	ENST00000422511.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.114613|5.114613	0.94339|0.94339	.|.	.|.	ENSG00000138443|ENSG00000138443	ENST00000451591;ENST00000454023|ENST00000295851;ENST00000261017;ENST00000430418;ENST00000424558;ENST00000261016;ENST00000417864;ENST00000422511;ENST00000261018	.|T;T;T;T;T;T;T;T	.|0.52983	.|1.01;0.64;1.2;1.03;0.96;1.25;1.05;0.84	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.100896	.|0.64402	.|D	.|0.000001	T|T	0.66470|0.66470	0.2792|0.2792	L|L	0.55990|0.55990	1.75|1.75	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.997;0.996;0.99;0.994;0.996;0.983;0.999	.|D;D;P;P;P;P;P;P;D	.|0.74674	.|0.984;0.971;0.808;0.827;0.799;0.669;0.855;0.635;0.978	T|T	0.67719|0.67719	-0.5598|-0.5598	5|10	.|0.87932	.|D	.|0	-12.4621|-12.4621	19.6251|19.6251	0.95674|0.95674	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|161;210;100;252;369;320;263;375;308	.|B7Z5L1;B7Z612;B4DMM5;B7Z836;Q9NYB9-4;E9PEZ7;Q9NYB9-3;Q9NYB9;Q9NYB9-2	.|.;.;.;.;.;.;.;ABI2_HUMAN;.	I|H	179;155|375;308;320;369;263;375;342;161	.|ENSP00000295851:P375H;ENSP00000261017:P308H;ENSP00000408898:P320H;ENSP00000391433:P369H;ENSP00000261016:P263H;ENSP00000414703:P375H;ENSP00000396249:P342H;ENSP00000261018:P161H	.|ENSP00000261016:P263H	L|P	+|+	1|2	0|0	ABI2|ABI2	203975634|203975634	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.263000|7.263000	0.78421|0.78421	2.636000|2.636000	0.89361|0.89361	0.655000|0.655000	0.94253|0.94253	CTT|CCT		0.438	ABI2-007	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000336179.2		NM_005759	
ASIC5	51802	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	156757933	156757933	+	Missense_Mutation	SNP	T	T	G	rs142739848		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr4:156757933T>G	ENST00000537611.2	-	8	1189	c.1143A>C	c.(1141-1143)gaA>gaC	p.E381D		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	381					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)	p.E381D(1)									TGGCCGGGTATTCTATTTCTT	0.373																																																	1	Substitution - Missense(1)	kidney(1)											78.0	85.0	83.0					4																	156757933		2203	4300	6503	SO:0001583	missense	0			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.1143A>C	4.37:g.156757933T>G	ENSP00000442477:p.Glu381Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	T	10.65	1.411110	0.25465	.	.	ENSG00000256394	ENST00000537611	T	0.64085	-0.08	4.8	-0.671	0.11381	.	0.492658	0.18953	N	0.126629	T	0.31888	0.0811	N	0.11313	0.125	0.27095	N	0.962757	B	0.09022	0.002	B	0.12837	0.008	T	0.14090	-1.0485	10	0.13108	T	0.6	-14.1874	4.4305	0.11525	0.2686:0.3688:0.0:0.3626	.	381	Q9NY37	ACCN5_HUMAN	D	381	ENSP00000442477:E381D	ENSP00000264432:E381D	E	-	3	2	ACCN5	156977383	0.984000	0.35163	0.988000	0.46212	0.987000	0.75469	-0.005000	0.12855	0.090000	0.17273	0.533000	0.62120	GAA		0.373	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1			
AHDC1	27245	broad.mit.edu;ucsc.edu	37	1	27874531	27874531	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:27874531C>T	ENST00000247087.5	-	5	4692	c.4096G>A	c.(4096-4098)Gac>Aac	p.D1366N	AHDC1_ENST00000374011.2_Missense_Mutation_p.D1366N			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1366							DNA binding (GO:0003677)	p.D1366N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CTGGGCGAGTCGCAGTGGAAG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											75.0	69.0	71.0					1																	27874531		2203	4300	6503	SO:0001583	missense	27245			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.4096G>A	1.37:g.27874531C>T	ENSP00000247087:p.Asp1366Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.782243	0.70222	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.58358	0.34;0.34	5.69	5.69	0.88448	.	0.062070	0.64402	D	0.000007	T	0.61123	0.2322	N	0.24115	0.695	0.45567	D	0.998514	D	0.76494	0.999	D	0.68353	0.957	T	0.64377	-0.6422	10	0.66056	D	0.02	-20.037	18.5868	0.91192	0.0:1.0:0.0:0.0	.	1366	Q5TGY3	AHDC1_HUMAN	N	1366	ENSP00000247087:D1366N;ENSP00000363123:D1366N	ENSP00000247087:D1366N	D	-	1	0	AHDC1	27747118	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.245000	0.58734	2.699000	0.92147	0.655000	0.94253	GAC		0.632	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3			
AKAP13	11214	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	86123604	86123604	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr15:86123604A>G	ENST00000394518.2	+	7	2400	c.2305A>G	c.(2305-2307)Atg>Gtg	p.M769V	AKAP13_ENST00000361243.2_Missense_Mutation_p.M769V|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	769					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.M769V(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TGTCCCTAAAATGGAGAAAGA	0.433																																					Melanoma(94;603 1453 3280 32295 32951)												1	Substitution - Missense(1)	kidney(1)											91.0	92.0	92.0					15																	86123604		2202	4299	6501	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.2305A>G	15.37:g.86123604A>G	ENSP00000378026:p.Met769Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.378416	0.42207	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.09073	3.02;3.02	5.88	2.73	0.32206	.	.	.	.	.	T	0.04634	0.0126	N	0.14661	0.345	0.09310	N	0.999997	B;B	0.13594	0.005;0.008	B;B	0.13407	0.004;0.009	T	0.41858	-0.9485	9	0.56958	D	0.05	.	1.9672	0.03398	0.3917:0.0:0.3505:0.2578	.	769;769	Q12802;Q12802-2	AKP13_HUMAN;.	V	769;769;768;768	ENSP00000354718:M769V;ENSP00000378026:M769V	ENSP00000354718:M769V	M	+	1	0	AKAP13	83924608	0.015000	0.18098	0.000000	0.03702	0.718000	0.41266	1.461000	0.35255	0.235000	0.21160	0.533000	0.62120	ATG		0.433	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1		NM_007200	
ANKHD1	54882	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	139876554	139876554	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr5:139876554G>T	ENST00000360839.2	+	15	2849	c.2695G>T	c.(2695-2697)Gtt>Ttt	p.V899F	ANKHD1_ENST00000462121.1_3'UTR|ANKHD1_ENST00000297183.6_Missense_Mutation_p.V899F|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.V899F	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	899						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.V899F(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTACCTCAGGTTGACACAAT	0.448																																																	2	Substitution - Missense(2)	kidney(2)											102.0	101.0	102.0					5																	139876554		2203	4300	6503	SO:0001583	missense	54882			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.2695G>T	5.37:g.139876554G>T	ENSP00000354085:p.Val899Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291944	0.59976	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000421134;ENST00000532219	T;T;T;T	0.74002	-0.77;-0.8;-0.65;-0.8	5.46	4.58	0.56647	Ankyrin repeat-containing domain (1);	0.067544	0.64402	D	0.000017	T	0.73892	0.3645	L	0.46157	1.445	0.58432	D	0.999995	B;B;B	0.28552	0.215;0.137;0.137	B;B;B	0.37047	0.24;0.121;0.121	T	0.74621	-0.3604	10	0.72032	D	0.01	.	16.8077	0.85710	0.0:0.1286:0.8714:0.0	.	899;899;899	Q8IWZ3-4;Q8IWZ2;Q8IWZ3	.;.;ANKH1_HUMAN	F	899;932;899;899;433;918;899	ENSP00000354085:V899F;ENSP00000297183:V899F;ENSP00000394489:V918F;ENSP00000432016:V899F	ENSP00000432016:V899F	V	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139856738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.576000	0.82467	1.405000	0.46838	0.585000	0.79938	GTT		0.448	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1		NM_017747	
APOA5	116519	hgsc.bcm.edu;ucsc.edu	37	11	116660943	116660944	+	Frame_Shift_Ins	INS	-	-	C	rs147349873	byFrequency	TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr11:116660943_116660944insC	ENST00000227665.4	-	3	1035_1036	c.1001_1002insG	c.(1000-1002)ggcfs	p.G334fs	ZNF259_ENST00000227322.3_5'Flank|APOA5_ENST00000542499.1_Frame_Shift_Ins_p.G334fs			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	334					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		TCAGAACCTTGCCACTGTCTGT	0.619																																																	0																																										SO:0001589	frameshift_variant	116519			AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.1002dupG	11.37:g.116660945_116660945dupC	ENSP00000227665:p.Gly334fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Frame_Shift_Ins	INS	ENST00000227665.4	37	CCDS8376.2																																																																																				0.619	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106285.2			
TPTE	7179	broad.mit.edu	37	21	11026722	11026722	+	Splice_Site	SNP	C	C	A	rs200592940		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr21:11026722C>A	ENST00000415664.2	-	2	239		c.e2+1		BAGE2_ENST00000470054.1_RNA			P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCAAGCCTCACCCCAGGCAAT	0.438																																																	0																																										SO:0001630	splice_region_variant	85319			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000415664.2:c.3097+1G>T	21.37:g.11026722C>A		Somatic		WXS	Illumina GAIIx	Phase_I	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Splice_Site	SNP	ENST00000415664.2	37																																																																																					0.438	TPTE-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000340030.1			Intron
BCL6	604	broad.mit.edu	37	3	187446247	187446247	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:187446247G>A	ENST00000406870.2	-	6	1807	c.1441C>T	c.(1441-1443)Cag>Tag	p.Q481*	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000450123.2_Nonsense_Mutation_p.Q481*|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000232014.4_Nonsense_Mutation_p.Q481*	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	481					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q481*(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		TGTGGGGACTGAGAGCCGCAG	0.612			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	1	Substitution - Nonsense(1)	kidney(1)											71.0	60.0	64.0					3																	187446247		2203	4300	6503	SO:0001587	stop_gained	604				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1441C>T	3.37:g.187446247G>A	ENSP00000384371:p.Gln481*	Somatic		WXS	Illumina GAIIx	Phase_I	A7E241|B8PSA7|D3DNV5	Nonsense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	G	43	9.845172	0.99277	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	.	.	.	4.98	4.98	0.66077	.	0.106321	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	18.1114	0.89537	0.0:0.0:1.0:0.0	.	.	.	.	X	481	.	ENSP00000232014:Q481X	Q	-	1	0	BCL6	188928941	1.000000	0.71417	0.990000	0.47175	0.979000	0.70002	9.256000	0.95535	2.696000	0.92011	0.561000	0.74099	CAG		0.612	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1		NM_138931	
SMCO2	341346	broad.mit.edu;ucsc.edu	37	12	27628533	27628533	+	Silent	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr12:27628533C>T	ENST00000535986.1	+	4	381	c.381C>T	c.(379-381)ttC>ttT	p.F127F	SMCO2_ENST00000298876.4_Intron|SMCO2_ENST00000416383.1_Silent_p.F127F|SMCO2_ENST00000538647.1_3'UTR			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	127						integral component of membrane (GO:0016021)		p.F127F(2)									AGGGCATGTTCCTCAAGCTAA	0.378																																																	2	Substitution - coding silent(2)	kidney(2)											77.0	67.0	70.0					12																	27628533		692	1591	2283	SO:0001819	synonymous_variant	341346				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.381C>T	12.37:g.27628533C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000535986.1	37	CCDS44852.1																																																																																				0.378	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402867.1		NM_001145010	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45693722	45693722	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr14:45693722delT	ENST00000310806.4	-	11	2526	c.2068delA	c.(2068-2070)agtfs	p.S690fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	690					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CTGATGGGACTTTTTTTTTGA	0.373																																																	0										10,4254		2,6,2124	97.0	100.0	99.0			-1.0	0.0	14		100	20,8234		2,16,4109	no	frameshift	MIS18BP1	NM_018353.4		4,22,6233	A1A1,A1R,RR		0.2423,0.2345,0.2397			45693722	30,12488	2203	4300	6503	SO:0001589	frameshift_variant	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2068delA	14.37:g.45693722delT	ENSP00000309790:p.Ser690fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Del	DEL	ENST00000310806.4	37	CCDS9684.1																																																																																				0.373	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2			
C1orf94	84970	broad.mit.edu;ucsc.edu	37	1	34684328	34684328	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:34684328A>G	ENST00000488417.1	+	7	1883	c.1763A>G	c.(1762-1764)tAt>tGt	p.Y588C	C1orf94_ENST00000373374.3_Missense_Mutation_p.Y398C	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	588								p.Y588C(1)|p.Y398C(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CACAGCCCCTATTTTTCTTCC	0.493																																																	2	Substitution - Missense(2)	kidney(2)											128.0	124.0	126.0					1																	34684328		2203	4300	6503	SO:0001583	missense	84970			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1763A>G	1.37:g.34684328A>G	ENSP00000435634:p.Tyr588Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000488417.1	37	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801739	0.70682	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	T;T	0.35421	1.37;1.31	5.32	5.32	0.75619	.	0.105857	0.42420	D	0.000706	T	0.57725	0.2073	M	0.70595	2.14	0.38548	D	0.94938	D	0.89917	1.0	D	0.91635	0.999	T	0.64748	-0.6334	10	0.72032	D	0.01	-24.0658	11.6755	0.51427	1.0:0.0:0.0:0.0	.	588	Q6P1W5	CA094_HUMAN	C	398;588	ENSP00000362472:Y398C;ENSP00000435634:Y588C	ENSP00000362472:Y398C	Y	+	2	0	C1orf94	34456915	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.922000	0.63404	2.013000	0.59113	0.533000	0.62120	TAT		0.493	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2		NM_032884	
MROH9	80133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	170985418	170985418	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:170985418A>C	ENST00000367759.4	+	17	2003	c.1849A>C	c.(1849-1851)Aaa>Caa	p.K617Q		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	0								p.K617Q(1)									CGAACTGGACAAAGTGACCTA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											174.0	142.0	151.0					1																	170985418		692	1591	2283	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367759.4:c.1849A>C	1.37:g.170985418A>C	ENSP00000356733:p.Lys617Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367759.4	37	CCDS53429.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.987182	0.53934	.	.	ENSG00000117501	ENST00000367759	T	0.67345	-0.26	5.26	5.26	0.73747	.	.	.	.	.	T	0.49541	0.1563	L	0.29908	0.895	0.25742	N	0.98515	D	0.57899	0.981	P	0.56700	0.804	T	0.36817	-0.9732	9	0.12766	T	0.61	.	11.8601	0.52461	1.0:0.0:0.0:0.0	.	617	F5GWX6	.	Q	617	ENSP00000356733:K617Q	ENSP00000356733:K617Q	K	+	1	0	C1orf129	169252042	0.972000	0.33761	0.913000	0.36048	0.010000	0.07245	2.605000	0.46283	2.113000	0.64589	0.454000	0.30748	AAA		0.413	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_025063	
CASR	846	broad.mit.edu;hgsc.bcm.edu	37	3	122003164	122003164	+	Missense_Mutation	SNP	T	T	A	rs104893701		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:122003164T>A	ENST00000490131.1	+	7	2735	c.2363T>A	c.(2362-2364)tTc>tAc	p.F788Y	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000296154.5_Missense_Mutation_p.F788Y|CASR_ENST00000498619.1_Missense_Mutation_p.F798Y	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	788			F -> C (in HYPOC1; leftward shift in the concentration-response curve for the mutant receptor; cells cotransfected with both the wild-type and the mutant receptor show an EC(50) similar to the mutant; a gain-of-function mutation rendering the receptor more sensitive than normal to activation). {ECO:0000269|PubMed:9661634}.|F -> L (in HYPOC1; induces a significant shift to the left relative to the wild- type protein in the MAPK response to increasing extracellular calcium concentrations). {ECO:0000269|PubMed:12915654}.		anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.F788Y(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GCCATCTGCTTCTTCTTTGCC	0.547																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CM980304	CASR	M	rs104893701						44.0	42.0	43.0					3																	122003164		2203	4300	6503	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2363T>A	3.37:g.122003164T>A	ENSP00000418685:p.Phe788Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.415022	0.83449	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89681	-2.55;-2.55;-2.55	6.04	6.04	0.98038	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95417	0.8512	M	0.89715	3.055	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.81914	0.991;0.995	D	0.96037	0.9021	10	0.72032	D	0.01	.	15.7575	0.78046	0.0:0.0:0.0:1.0	.	798;788	E7ENE0;P41180	.;CASR_HUMAN	Y	788;798;788	ENSP00000418685:F788Y;ENSP00000420194:F798Y;ENSP00000296154:F788Y	ENSP00000296154:F788Y	F	+	2	0	CASR	123485854	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.317000	0.78254	0.459000	0.35465	TTC		0.547	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1		NM_000388	
CEP19	84984	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	196434643	196434643	+	Nonsense_Mutation	SNP	C	C	A	rs139813132	byFrequency	TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:196434643C>A	ENST00000399942.4	-	2	460	c.166G>T	c.(166-168)Gaa>Taa	p.E56*	RNU6-646P_ENST00000364571.1_RNA|CEP19_ENST00000409690.3_Nonsense_Mutation_p.E95*			Q96LK0	CEP19_HUMAN	centrosomal protein 19kDa	91						centriole (GO:0005814)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.E91*(2)		NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	10						TGAATTTGTTCCATTGTTTCT	0.428																																																	2	Substitution - Nonsense(2)	lung(1)|kidney(1)											211.0	193.0	199.0					3																	196434643		1904	4126	6030	SO:0001587	stop_gained	0			BC007827	CCDS43193.2	3q29	2014-02-20	2011-05-06	2011-05-06	ENSG00000174007	ENSG00000174007			28209	protein-coding gene	gene with protein product		615586	"""chromosome 3 open reading frame 34"""	C3orf34		21399614	Standard	XM_005269370		Approved	MGC14126	uc011btw.2	Q96LK0	OTTHUMG00000153933	ENST00000399942.4:c.166G>T	3.37:g.196434643C>A	ENSP00000382823:p.Glu56*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RA74|Q96I48	Nonsense_Mutation	SNP	ENST00000399942.4	37		.	.	.	.	.	.	.	.	.	.	C	37	6.402332	0.97537	.	.	ENSG00000174007	ENST00000409690;ENST00000399942	.	.	.	5.56	4.67	0.58626	.	0.247626	0.47093	D	0.000254	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-3.6719	11.7116	0.51628	0.0:0.8069:0.1245:0.0686	.	.	.	.	X	95;56	.	ENSP00000382823:E56X	E	-	1	0	CEP19	197919040	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.102000	0.50291	1.423000	0.47198	0.655000	0.94253	GAA		0.428	CEP19-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333081.1		NM_032898	
CDC25C	995	broad.mit.edu	37	5	137621505	137621505	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr5:137621505C>A	ENST00000323760.6	-	14	1576	c.1298G>T	c.(1297-1299)tGc>tTc	p.C433F	CDC25C_ENST00000357274.3_Missense_Mutation_p.C390F|CDC25C_ENST00000514555.1_Missense_Mutation_p.C403F|CDC25C_ENST00000348983.3_Missense_Mutation_p.C360F|CDC25C_ENST00000415130.2_Missense_Mutation_p.C360F|CDC25C_ENST00000513970.1_Missense_Mutation_p.C433F|CDC25C_ENST00000356505.3_Missense_Mutation_p.C403F	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	433					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)	p.C433F(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ATGCATAGGGCAGTAGCTCTG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											103.0	93.0	96.0					5																	137621505		2203	4300	6503	SO:0001583	missense	995			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.1298G>T	5.37:g.137621505C>A	ENSP00000321656:p.Cys433Phe	Somatic		WXS	Illumina GAIIx	Phase_I	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	37	CCDS4202.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936206	0.73442	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555	T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.32	5.32	0.75619	Rhodanese-like (2);	0.335257	0.28641	N	0.014622	T	0.52484	0.1737	L	0.56769	1.78	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.71870	0.966;0.975;0.924;0.944	T	0.46484	-0.9188	10	0.49607	T	0.09	-14.9436	17.9328	0.89004	0.0:1.0:0.0:0.0	.	450;403;360;433	G3V1P6;P30307-2;P30307-4;P30307	.;.;.;MPIP3_HUMAN	F	433;403;390;360;360;433;450;403	ENSP00000321656:C433F;ENSP00000348898:C403F;ENSP00000349821:C390F;ENSP00000345205:C360F;ENSP00000392631:C360F;ENSP00000424795:C433F;ENSP00000425470:C403F	ENSP00000321656:C433F	C	-	2	0	CDC25C	137649404	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.763000	0.68818	2.767000	0.95098	0.655000	0.94253	TGC		0.512	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1			
CLEC2L	154790	broad.mit.edu;ucsc.edu	37	7	139221070	139221070	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:139221070A>C	ENST00000422142.2	+	2	313	c.241A>C	c.(241-243)Atc>Ctc	p.I81L		NM_001080511.2	NP_001073980.2	P0C7M8	CLC2L_HUMAN	C-type lectin domain family 2, member L	81						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.I81L(1)		NS(1)|endometrium(1)|kidney(2)|lung(1)	5	Melanoma(164;0.233)					TCTGTTCGCCATCTTGGTGGT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											195.0	156.0	168.0					7																	139221070		692	1591	2283	SO:0001583	missense	154790			AK057548	CCDS47724.1	7q34	2011-05-18			ENSG00000236279	ENSG00000236279		"""C-type lectin domain containing"""	21969	protein-coding gene	gene with protein product							Standard	NM_001080511		Approved	FLJ32986	uc010lnd.3	P0C7M8	OTTHUMG00000164900	ENST00000422142.2:c.241A>C	7.37:g.139221070A>C	ENSP00000390661:p.Ile81Leu	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000422142.2	37	CCDS47724.1	.	.	.	.	.	.	.	.	.	.	A	11.62	1.692598	0.30052	.	.	ENSG00000236279	ENST00000422142	T	0.16897	2.31	4.09	4.09	0.47781	.	.	.	.	.	T	0.08537	0.0212	N	0.12502	0.225	0.28578	N	0.910266	B	0.11235	0.004	B	0.06405	0.002	T	0.27226	-1.0080	9	0.08381	T	0.77	.	9.3772	0.38290	1.0:0.0:0.0:0.0	.	81	P0C7M8	CLC2L_HUMAN	L	81	ENSP00000390661:I81L	ENSP00000390661:I81L	I	+	1	0	CLEC2L	138871610	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.853000	0.55941	1.711000	0.51337	0.418000	0.28097	ATC		0.522	CLEC2L-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380878.1		NM_001080511	
COL4A1	1282	broad.mit.edu	37	13	110833684	110833684	+	Silent	SNP	C	C	T	rs565395841		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr13:110833684C>T	ENST00000375820.4	-	29	2269	c.2148G>A	c.(2146-2148)ccG>ccA	p.P716P		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	716	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.P716P(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CATTAAATCCCGGGCGACCTG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		16346	0.001		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											53.0	52.0	52.0					13																	110833684		2203	4300	6503	SO:0001819	synonymous_variant	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2148G>A	13.37:g.110833684C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	ENST00000375820.4	37	CCDS9511.1																																																																																				0.502	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			
CPLX1	10815	broad.mit.edu	37	4	780370	780370	+	Silent	SNP	C	C	T	rs371785028		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr4:780370C>T	ENST00000304062.6	-	4	555	c.324G>A	c.(322-324)gaG>gaA	p.E108E	CPLX1_ENST00000505203.1_Silent_p.E87E	NM_006651.3	NP_006642.1	O14810	CPLX1_HUMAN	complexin 1	108					exocytosis (GO:0006887)|glutamate secretion (GO:0014047)|insulin secretion (GO:0030073)|neurotransmitter secretion (GO:0007269)|regulation of exocytosis (GO:0017157)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|synapse (GO:0045202)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|synaptobrevin 2-SNAP-25-syntaxin-3-complexin complex (GO:0070554)	neurotransmitter transporter activity (GO:0005326)	p.E108E(1)		kidney(1)|lung(2)	3				Colorectal(103;0.187)		CCTCCTCCACCTCGTCCCCGC	0.701																																																	1	Substitution - coding silent(1)	kidney(1)						C		1,4401	2.1+/-5.4	0,1,2200	27.0	31.0	29.0		324	2.8	1.0	4		29	0,8596		0,0,4298	no	coding-synonymous	CPLX1	NM_006651.3		0,1,6498	TT,TC,CC		0.0,0.0227,0.0077		108/135	780370	1,12997	2201	4298	6499	SO:0001819	synonymous_variant	10815			AF022383	CCDS46995.1	4p16.3	2008-08-07			ENSG00000168993	ENSG00000168993			2309	protein-coding gene	gene with protein product		605032				7553862	Standard	NM_006651		Approved	CPX-I	uc003gbi.3	O14810	OTTHUMG00000160005	ENST00000304062.6:c.324G>A	4.37:g.780370C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NI80|B2R4R5|D3DVN3|F1T0G1	Silent	SNP	ENST00000304062.6	37	CCDS46995.1																																																																																				0.701	CPLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358830.1			
CRISP1	167	broad.mit.edu;ucsc.edu	37	6	49819726	49819726	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr6:49819726G>T	ENST00000335847.4	-	3	284	c.183C>A	c.(181-183)aaC>aaA	p.N61K	CRISP1_ENST00000505118.1_Missense_Mutation_p.N61K|CRISP1_ENST00000507853.1_Missense_Mutation_p.N61K|CRISP1_ENST00000355791.2_Missense_Mutation_p.N61K|CRISP1_ENST00000536021.1_Missense_Mutation_p.N61K|CRISP1_ENST00000329411.5_Missense_Mutation_p.N61K	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	61	SCP.				binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)	p.N61K(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					TCTTCAGCATGTTGCTGGCTG	0.378																																																	1	Substitution - Missense(1)	kidney(1)											173.0	157.0	162.0					6																	49819726		2203	4300	6503	SO:0001583	missense	167			D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.183C>A	6.37:g.49819726G>T	ENSP00000338276:p.Asn61Lys	Somatic		WXS	Illumina GAIIx	Phase_I	B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	37	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912336	0.72983	.	.	ENSG00000124812	ENST00000507853;ENST00000335847;ENST00000355791;ENST00000329411;ENST00000505118;ENST00000536021	T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69	5.06	5.06	0.68205	CAP domain (3);	0.121540	0.64402	D	0.000017	T	0.33847	0.0877	M	0.87180	2.865	0.48185	D	0.999608	D;D	0.89917	0.992;1.0	P;D	0.91635	0.801;0.999	T	0.13229	-1.0517	9	.	.	.	.	13.8043	0.63220	0.0:0.0:1.0:0.0	.	61;61	P54107-2;P54107	.;CRIS1_HUMAN	K	61	ENSP00000425020:N61K;ENSP00000338276:N61K;ENSP00000348044:N61K;ENSP00000331317:N61K;ENSP00000427589:N61K;ENSP00000441798:N61K	.	N	-	3	2	CRISP1	49927685	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.445000	0.44899	2.640000	0.89533	0.655000	0.94253	AAC		0.378	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2		NM_001131	
CSF3R	1441	broad.mit.edu;ucsc.edu	37	1	36939104	36939104	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:36939104C>G	ENST00000373106.1	-	6	1152	c.605G>C	c.(604-606)tGg>tCg	p.W202S	CSF3R_ENST00000373103.1_Missense_Mutation_p.W202S|CSF3R_ENST00000331941.5_Missense_Mutation_p.W202S|CSF3R_ENST00000440588.2_Missense_Mutation_p.W202S|CSF3R_ENST00000361632.4_Missense_Mutation_p.W202S|CSF3R_ENST00000418048.2_Missense_Mutation_p.W202S|CSF3R_ENST00000338937.5_Missense_Mutation_p.W202S|CSF3R_ENST00000373104.1_Missense_Mutation_p.W202S|CSF3R_ENST00000487540.2_5'Flank	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	202	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.W202S(2)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TGCCTGCACCCAGATGCCCAT	0.602																																																	2	Substitution - Missense(2)	kidney(2)											108.0	93.0	98.0					1																	36939104		2203	4300	6503	SO:0001583	missense	1441			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.605G>C	1.37:g.36939104C>G	ENSP00000362198:p.Trp202Ser	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000373106.1	37	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167548	0.78339	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24	5.52	5.52	0.82312	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.918670	0.03125	N	0.164321	T	0.66036	0.2749	M	0.75447	2.3	0.58432	D	0.999999	D;D;D;P	0.89917	1.0;1.0;0.999;0.916	D;D;D;B	0.73380	0.98;0.978;0.95;0.319	T	0.42378	-0.9455	10	0.29301	T	0.29	-9.825	16.5874	0.84731	0.0:1.0:0.0:0.0	.	202;202;202;202	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	S	202	ENSP00000362198:W202S;ENSP00000362196:W202S;ENSP00000362195:W202S;ENSP00000355406:W202S;ENSP00000332180:W202S;ENSP00000401588:W202S;ENSP00000345013:W202S;ENSP00000397568:W202S	ENSP00000332180:W202S	W	-	2	0	CSF3R	36711691	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.342000	0.43992	2.607000	0.88179	0.609000	0.83330	TGG		0.602	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2		NM_156039	
CUL1	8454	hgsc.bcm.edu;ucsc.edu	37	7	148486899	148486899	+	Frame_Shift_Del	DEL	C	C	-	rs151286359		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:148486899delC	ENST00000325222.4	+	15	1934	c.1655delC	c.(1654-1656)acafs	p.T552fs	CUL1_ENST00000409469.1_Frame_Shift_Del_p.T552fs|CUL1_ENST00000602748.1_Frame_Shift_Del_p.T552fs	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	552					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAGTCTTGTACATTTGCCTTG	0.552																																																	0													158.0	154.0	156.0					7																	148486899		2203	4300	6503	SO:0001589	frameshift_variant	8454			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1655delC	7.37:g.148486899delC	ENSP00000326804:p.Thr552fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DWG3|O60719|Q08AL6|Q8IYW1	Frame_Shift_Del	DEL	ENST00000325222.4	37	CCDS34772.1																																																																																				0.552	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1		NM_003592	
DOCK7	85440	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	62979390	62979390	+	Silent	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:62979390A>G	ENST00000340370.5	-	31	4040	c.4023T>C	c.(4021-4023)taT>taC	p.Y1341Y	DOCK7_ENST00000251157.5_Silent_p.Y1372Y	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1372					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.Y1341Y(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CACTTACTTTATACTCAAAGC	0.363																																																	1	Substitution - coding silent(1)	kidney(1)											90.0	88.0	89.0					1																	62979390		2203	4300	6503	SO:0001819	synonymous_variant	85440				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4023T>C	1.37:g.62979390A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	A	7.211	0.595376	0.13875	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.63	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7788	0.63071	0.0749:0.0:0.9251:0.0	.	.	.	.	Q	544	.	.	X	-	1	0	DOCK7	62751978	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.752000	0.68728	1.347000	0.45714	-0.468000	0.05107	TAA		0.363	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1		NM_033407	
DSEL	92126	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	65181609	65181609	+	Silent	SNP	A	A	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr18:65181609A>T	ENST00000310045.7	-	2	1740	c.267T>A	c.(265-267)tcT>tcA	p.S89S	RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	79					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.S89S(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GGCTTGCACGAGACTTTTGTC	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											124.0	110.0	115.0					18																	65181609		2203	4300	6503	SO:0001819	synonymous_variant	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.267T>A	18.37:g.65181609A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																				0.408	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1		NM_032160	
EEF1A1	1915	broad.mit.edu;hgsc.bcm.edu	37	6	74227570	74227570	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr6:74227570A>T	ENST00000316292.9	-	7	2343	c.1352T>A	c.(1351-1353)gTc>gAc	p.V451D	EEF1A1_ENST00000331523.2_Missense_Mutation_p.V451D|EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000309268.6_Missense_Mutation_p.V451D	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	451					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)	p.V451D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AGACTTGGTGACCTTGCCAGC	0.473											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					1	Substitution - Missense(1)	kidney(1)											21.0	22.0	21.0					6																	74227570		2177	4268	6445	SO:0001583	missense	1915			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1352T>A	6.37:g.74227570A>T	ENSP00000339063:p.Val451Asp	Somatic	1151	WXS	Illumina HiSeq	Phase_I	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	37	CCDS4980.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.25|19.25	3.792359|3.792359	0.70452|0.70452	.|.	.|.	ENSG00000156508|ENSG00000156508	ENST00000456206|ENST00000316292;ENST00000309268;ENST00000331523;ENST00000391977	.|T;T;T	.|0.48201	.|0.82;0.82;0.82	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|0.073105	.|0.53938	.|U	.|0.000052	T|T	0.64994|0.64994	0.2649|0.2649	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	.|D;D;P	.|0.53885	.|0.963;0.963;0.877	.|P;P;P	.|0.62089	.|0.898;0.898;0.84	T|T	0.74041|0.74041	-0.3792|-0.3792	6|10	0.87932|0.87932	D|D	0|0	.|.	14.7177|14.7177	0.69284|0.69284	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|451;451;451	.|P68104;Q6IPS9;Q5VTE0	.|EF1A1_HUMAN;.;EF1A3_HUMAN	T|D	96|451;451;451;430	.|ENSP00000339063:V451D;ENSP00000339053:V451D;ENSP00000330054:V451D	ENSP00000402463:S96T|ENSP00000339053:V451D	S|V	-|-	1|2	0|0	EEF1A1|EEF1A1	74284291|74284291	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.875000|8.875000	0.92372|0.92372	1.929000|1.929000	0.55896|0.55896	0.454000|0.454000	0.30748|0.30748	TCA|GTC		0.473	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2		NM_001402	
ECT2L	345930	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	139206666	139206666	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr6:139206666C>A	ENST00000423192.1	+	16	2213	c.2052C>A	c.(2050-2052)ttC>ttA	p.F684L	ECT2L_ENST00000367682.2_Missense_Mutation_p.F684L|ECT2L_ENST00000541398.1_Intron			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	684	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F684L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TACCAGCATTCCGAACTTTCC	0.453			"""N, Splice, Mis"""		ETP ALL																																			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	1	Substitution - Missense(1)	kidney(1)											110.0	104.0	106.0					6																	139206666		1911	4120	6031	SO:0001583	missense	345930				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2052C>A	6.37:g.139206666C>A	ENSP00000387388:p.Phe684Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169681	0.78452	.	.	ENSG00000203734	ENST00000423192;ENST00000367682	T;T	0.68181	-0.31;-0.31	5.3	4.42	0.53409	Dbl homology (DH) domain (5);	0.000000	0.44483	U	0.000449	T	0.70491	0.3230	M	0.71581	2.175	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.74087	-0.3778	10	0.59425	D	0.04	-5.9409	7.5672	0.27885	0.0:0.8044:0.0:0.1956	.	684	Q008S8	ECT2L_HUMAN	L	684	ENSP00000387388:F684L;ENSP00000356655:F684L	ENSP00000356655:F684L	F	+	3	2	ECT2L	139248359	1.000000	0.71417	0.995000	0.50966	0.959000	0.62525	1.361000	0.34136	1.214000	0.43395	0.655000	0.94253	TTC		0.453	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3		NM_001077706	
FAM187B	148109	broad.mit.edu	37	19	35716084	35716084	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr19:35716084delG	ENST00000324675.3	-	2	802	c.754delC	c.(754-756)ctgfs	p.L252fs		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	252						integral component of membrane (GO:0016021)		p.L252fs*1(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						TCCCACGTCAGGGGGGTGTCG	0.657																																																	1	Deletion - Frameshift(1)	large_intestine(1)											11.0	11.0	11.0					19																	35716084		2187	4279	6466	SO:0001589	frameshift_variant	148109			AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.754delC	19.37:g.35716084delG	ENSP00000323355:p.Leu252fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N7G6	Frame_Shift_Del	DEL	ENST00000324675.3	37	CCDS12448.1																																																																																				0.657	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1		NM_152481	
FAM92A1P2	403315	broad.mit.edu	37	4	183960484	183960484	+	RNA	DEL	A	A	-	rs542231248		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr4:183960484delA	ENST00000502308.1	+	0	1667					NR_003612.1				family with sequence similarity 92, member A1 pseudogene 2																		TTCAACATCCAAAAAAAAAAA	0.308																																																	0																																												0			BC022019		4q35.1	2012-04-19	2012-04-19	2012-04-19	ENSG00000230219	ENSG00000230219			32287	pseudogene	pseudogene			"""family with sequence similarity 92, member A3"""	FAM92A3		12477932	Standard	NR_003612		Approved	MGC71735, MGC102964	uc003ivi.4		OTTHUMG00000160675		4.37:g.183960484delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000502308.1	37																																																																																					0.308	FAM92A1P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000361814.1			
FANCA	2175	broad.mit.edu;ucsc.edu	37	16	89836339	89836339	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr16:89836339C>T	ENST00000389301.3	-	26	2440	c.2410G>A	c.(2410-2412)Ggt>Agt	p.G804S	FANCA_ENST00000567284.2_5'Flank|FANCA_ENST00000568369.1_Missense_Mutation_p.G804S	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	804					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G804S(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GCAGGAGGACCCACATCCACC	0.637			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	1	Substitution - Missense(1)	kidney(1)											89.0	66.0	74.0					16																	89836339		2198	4300	6498	SO:0001583	missense	2175	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.2410G>A	16.37:g.89836339C>T	ENSP00000373952:p.Gly804Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	C	9.440	1.087899	0.20390	.	.	ENSG00000187741	ENST00000389301	D	0.84442	-1.85	3.97	0.856	0.19019	.	0.825105	0.10545	N	0.662265	T	0.66906	0.2837	N	0.25144	0.715	0.09310	N	1	B;B	0.31680	0.335;0.335	B;B	0.26614	0.071;0.071	T	0.54043	-0.8352	10	0.07030	T	0.85	-5.9723	3.9982	0.09568	0.0:0.5821:0.1983:0.2196	.	804;804	B4DRI7;O15360	.;FANCA_HUMAN	S	804	ENSP00000373952:G804S	ENSP00000373952:G804S	G	-	1	0	FANCA	88363840	0.000000	0.05858	0.001000	0.08648	0.307000	0.27823	0.108000	0.15396	0.243000	0.21327	0.650000	0.86243	GGT		0.637	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			
GJA9	81025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	39340771	39340771	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:39340771A>C	ENST00000360786.3	-	1	1252	c.1000T>G	c.(1000-1002)Tcc>Gcc	p.S334A	GJA9_ENST00000454994.2_Missense_Mutation_p.S334A|MYCBP_ENST00000397572.2_5'Flank|RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000357771.3_Missense_Mutation_p.S334A|RP5-864K19.4_ENST00000433671.2_RNA|MYCBP_ENST00000489803.1_5'UTR|RP5-864K19.4_ENST00000456813.1_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	334					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.S334A(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			CTAAGTGTGGAAATCTCATTA	0.318																																																	1	Substitution - Missense(1)	kidney(1)											77.0	80.0	79.0					1																	39340771		2203	4300	6503	SO:0001583	missense	81025			AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1000T>G	1.37:g.39340771A>C	ENSP00000354020:p.Ser334Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000360786.3	37	CCDS432.1	.	.	.	.	.	.	.	.	.	.	A	8.795	0.931573	0.18131	.	.	ENSG00000131233	ENST00000454994;ENST00000357771;ENST00000360786	D;D;D	0.97553	-4.43;-4.34;-4.34	5.03	-1.17	0.09648	.	.	.	.	.	D	0.87665	0.6234	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.79011	-0.1977	9	0.08837	T	0.75	.	2.0294	0.03526	0.3854:0.1338:0.3504:0.1304	.	334	P57773	CXA9_HUMAN	A	334	ENSP00000406846:S334A;ENSP00000350415:S334A;ENSP00000354020:S334A	ENSP00000350415:S334A	S	-	1	0	GJA9	39113358	0.000000	0.05858	0.000000	0.03702	0.664000	0.39144	-0.353000	0.07691	-0.151000	0.11176	0.533000	0.62120	TCC		0.318	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001205.1		NM_030772	
GOLM1	51280	broad.mit.edu;ucsc.edu	37	9	88648293	88648293	+	Silent	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr9:88648293G>A	ENST00000388712.3	-	9	1201	c.1033C>T	c.(1033-1035)Ctg>Ttg	p.L345L	GOLM1_ENST00000257504.6_5'Flank|GOLM1_ENST00000388711.3_Silent_p.L345L	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	345					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)		p.L345L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						TCTCCTCTCAGTTTCTGCTGG	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											203.0	169.0	180.0					9																	88648293		2203	4299	6502	SO:0001819	synonymous_variant	51280			AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.1033C>T	9.37:g.88648293G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q6IAF4|Q9NRB9	Silent	SNP	ENST00000388712.3	37	CCDS35054.1																																																																																				0.428	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052904.2		NM_177937	
GPR64	10149	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	19026097	19026097	+	Splice_Site	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chrX:19026097C>T	ENST00000379869.3	-	19	1730		c.e19+1		GPR64_ENST00000357991.3_Splice_Site|GPR64_ENST00000357544.3_Splice_Site|GPR64_ENST00000360279.4_Splice_Site|GPR64_ENST00000379873.2_Splice_Site|GPR64_ENST00000379878.3_Splice_Site|GPR64_ENST00000379876.1_Splice_Site|GPR64_ENST00000356606.4_Splice_Site|GPR64_ENST00000354791.3_Splice_Site|GPR64_ENST00000340581.3_Intron	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.?(1)		breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					AGCAGTTTTACCTGAAACAAA	0.408																																																	1	Unknown(1)	kidney(1)											63.0	55.0	58.0					X																	19026097		2203	4300	6503	SO:0001630	splice_region_variant	10149			X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1566+1G>A	X.37:g.19026097C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Splice_Site	SNP	ENST00000379869.3	37	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285319	0.80803	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.363	0.90382	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPR64	18936018	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	7.045000	0.76585	2.275000	0.75901	0.600000	0.82982	.		0.408	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2			Intron
GPSM1	26086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	139228923	139228923	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr9:139228923G>C	ENST00000440944.1	+	2	308	c.88G>C	c.(88-90)Gag>Cag	p.E30Q	GPSM1_ENST00000392945.3_Missense_Mutation_p.E30Q	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	30	Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)	p.E7Q(1)		biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		GTCCTGCCTAGAGCTGGCGCT	0.657																																																	1	Substitution - Missense(1)	kidney(1)											44.0	42.0	43.0					9																	139228923		2201	4299	6500	SO:0001583	missense	26086			AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.88G>C	9.37:g.139228923G>C	ENSP00000392828:p.Glu30Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	37	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	g	18.99	3.740183	0.69304	.	.	ENSG00000160360	ENST00000392945;ENST00000440944;ENST00000354753	T;T;D	0.91464	-0.99;-0.99;-2.85	4.66	4.66	0.58398	.	0.000000	0.85682	U	0.000000	D	0.93475	0.7918	M	0.61703	1.905	0.80722	D	1	D;D	0.71674	0.998;0.994	P;P	0.60286	0.831;0.872	D	0.94304	0.7539	10	0.72032	D	0.01	-15.3053	16.5367	0.84374	0.0:0.0:1.0:0.0	.	30;30	Q86YR5;Q86YR5-3	GPSM1_HUMAN;.	Q	30;30;7	ENSP00000376674:E30Q;ENSP00000392828:E30Q;ENSP00000346797:E7Q	ENSP00000346797:E7Q	E	+	1	0	GPSM1	138348744	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.695000	0.84257	2.113000	0.64589	0.556000	0.70494	GAG		0.657	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_015597	
GRIN2B	2904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	13906469	13906470	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr12:13906469_13906470CC>AT	ENST00000609686.1	-	3	1000_1001	c.791_792GG>AT	c.(790-792)gGG>gAT	p.G264D		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	264					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.G264G(1)|p.G264E(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGTCTGTATCCCCTGCCACCAG	0.54																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)																																								SO:0001583	missense	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.791_792delinsAT	12.37:g.13906469_13906470delinsAT	ENSP00000477455:p.Gly264Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent|Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1																																																																																				0.540	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			
MROH2B	133558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	41045851	41045851	+	Silent	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr5:41045851C>T	ENST00000399564.4	-	18	2283	c.1833G>A	c.(1831-1833)gaG>gaA	p.E611E	MROH2B_ENST00000506092.2_Silent_p.E166E	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	611								p.E611E(1)									AACCAACCTTCTCAGTGGAGT	0.443																																																	1	Substitution - coding silent(1)	kidney(1)											170.0	162.0	164.0					5																	41045851		1949	4152	6101	SO:0001819	synonymous_variant	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1833G>A	5.37:g.41045851C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	CCDS47202.1																																																																																				0.443	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2		NM_173489	
HECW1	23072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	43548639	43548639	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:43548639G>T	ENST00000395891.2	+	24	4543	c.3938G>T	c.(3937-3939)gGa>gTa	p.G1313V	HECW1_ENST00000453890.1_Missense_Mutation_p.G1279V|AC011738.4_ENST00000436105.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1313	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G1313V(1)|p.G1292V(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CCTTACTATGGACTCTTTGAG	0.488																																																	2	Substitution - Missense(2)	kidney(2)											128.0	123.0	125.0					7																	43548639		1901	4119	6020	SO:0001583	missense	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3938G>T	7.37:g.43548639G>T	ENSP00000379228:p.Gly1313Val	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	33	5.205377	0.95033	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.60920	0.15;0.15	5.92	5.92	0.95590	HECT (4);	0.000000	0.85682	D	0.000000	D	0.82582	0.5068	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85338	0.1094	10	0.87932	D	0	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	1279;1313	B4DH42;Q76N89	.;HECW1_HUMAN	V	1313;1279;1313	ENSP00000379228:G1313V;ENSP00000407774:G1279V	ENSP00000265522:G1313V	G	+	2	0	HECW1	43515164	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.835000	0.99442	2.811000	0.96726	0.555000	0.69702	GGA		0.488	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2		NM_015052	
HEXIM1	10614	broad.mit.edu	37	17	43226612	43226612	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr17:43226612A>C	ENST00000332499.2	+	1	1929	c.55A>C	c.(55-57)Aca>Cca	p.T19P	AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	19					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)	p.T19P(1)		breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TAGCAACTGTACAGGTGCTGC	0.552											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											85.0	97.0	93.0					17																	43226612		2203	4299	6502	SO:0001583	missense	10614			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.55A>C	17.37:g.43226612A>C	ENSP00000328773:p.Thr19Pro	Somatic	914	WXS	Illumina GAIIx	Phase_I	B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	37	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.329802	0.24167	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.27	3.19	0.36642	.	0.757107	0.10832	U	0.629172	T	0.39145	0.1067	L	0.44542	1.39	0.34065	D	0.657781	P	0.45176	0.852	B	0.41332	0.354	T	0.49485	-0.8935	9	0.51188	T	0.08	-0.189	6.318	0.21202	0.887:0.0:0.113:0.0	.	19	O94992	HEXI1_HUMAN	P	19	.	ENSP00000328773:T19P	T	+	1	0	HEXIM1	40582395	1.000000	0.71417	0.999000	0.59377	0.443000	0.32047	1.523000	0.35932	0.696000	0.31696	0.533000	0.62120	ACA		0.552	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2		NM_006460	
INSRR	3645	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	156814334	156814334	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:156814334T>C	ENST00000368195.3	-	14	3053	c.2657A>G	c.(2656-2658)tAc>tGc	p.Y886C	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	886	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Y886C(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCTGGCAGAGTAGTTTCCAGG	0.572																																																	1	Substitution - Missense(1)	kidney(1)											56.0	52.0	53.0					1																	156814334		2203	4300	6503	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2657A>G	1.37:g.156814334T>C	ENSP00000357178:p.Tyr886Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	T	19.11	3.764571	0.69878	.	.	ENSG00000027644	ENST00000368195	D	0.89343	-2.5	4.3	4.3	0.51218	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.40728	N	0.001032	D	0.92821	0.7717	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93813	0.7112	9	0.87932	D	0	.	12.415	0.55488	0.0:0.0:0.0:1.0	.	886	P14616	INSRR_HUMAN	C	886	ENSP00000357178:Y886C	ENSP00000357178:Y886C	Y	-	2	0	INSRR	155080958	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	6.142000	0.71750	1.802000	0.52723	0.460000	0.39030	TAC		0.572	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1		NM_014215	
JAG2	3714	broad.mit.edu	37	14	105624079	105624079	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr14:105624079C>A	ENST00000331782.3	-	3	842	c.439G>T	c.(439-441)Gag>Tag	p.E147*	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Nonsense_Mutation_p.E147*	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	147					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)	p.E147*(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TCCCAGGCCTCCACGATGAGG	0.657																																																	1	Substitution - Nonsense(1)	kidney(1)											78.0	59.0	65.0					14																	105624079		2183	4283	6466	SO:0001587	stop_gained	3714			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.439G>T	14.37:g.105624079C>A	ENSP00000328169:p.Glu147*	Somatic		WXS	Illumina GAIIx	Phase_I	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Nonsense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	C	42	9.270825	0.99120	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	.	.	.	2.8	2.8	0.32819	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	13.2736	0.60175	0.0:1.0:0.0:0.0	.	.	.	.	X	147	.	ENSP00000328169:E147X	E	-	1	0	JAG2	104695124	0.942000	0.31987	1.000000	0.80357	0.996000	0.88848	2.857000	0.48349	1.872000	0.54250	0.563000	0.77884	GAG		0.657	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2			
RIC1	57589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	5763718	5763718	+	Silent	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr9:5763718C>T	ENST00000414202.2	+	19	2882	c.2691C>T	c.(2689-2691)ttC>ttT	p.F897F	KIAA1432_ENST00000381532.2_Silent_p.F818F|KIAA1432_ENST00000418622.3_Silent_p.F818F|KIAA1432_ENST00000251879.6_Silent_p.F897F|KIAA1432_ENST00000449720.2_Silent_p.F781F	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.F818F(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCCCCCTCTTCCTGCAGACAG	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											110.0	107.0	108.0					9																	5763718		2203	4300	6503	SO:0001819	synonymous_variant	57589																														ENST00000414202.2:c.2691C>T	9.37:g.5763718C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000414202.2	37	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	C	8.346	0.829846	0.16749	.	.	ENSG00000107036	ENST00000545641	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	T	0.77039	0.4072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74134	-0.3763	4	.	.	.	-18.288	20.3081	0.98638	0.0:1.0:0.0:0.0	.	.	.	.	S	789	.	.	P	+	1	0	KIAA1432	5753718	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.757000	0.68766	2.795000	0.96236	0.655000	0.94253	CCT		0.498	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3			
LAMP3	27074	broad.mit.edu;ucsc.edu	37	3	182871951	182871951	+	Missense_Mutation	SNP	T	T	C	rs369097974		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:182871951T>C	ENST00000265598.3	-	2	533	c.278A>G	c.(277-279)aAc>aGc	p.N93S	LAMP3_ENST00000466939.1_Missense_Mutation_p.N69S	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	93	Thr-rich.				cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.N93S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GGTTGCAGTGTTTTTTGTAGT	0.488																																																	1	Substitution - Missense(1)	kidney(1)						T	SER/ASN	0,4406		0,0,2203	274.0	260.0	264.0		278	3.6	0.0	3		264	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMP3	NM_014398.3	46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	93/417	182871951	1,13005	2203	4300	6503	SO:0001583	missense	27074			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.278A>G	3.37:g.182871951T>C	ENSP00000265598:p.Asn93Ser	Somatic		WXS	Illumina GAIIx	Phase_I	D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	T	0.287	-0.982828	0.02180	0.0	1.16E-4	ENSG00000078081	ENST00000265598;ENST00000466939;ENST00000476015;ENST00000470251	T;T;T;T	0.36878	1.89;1.87;1.23;1.24	5.47	3.61	0.41365	.	0.789213	0.11957	N	0.513170	T	0.13030	0.0316	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22521	-1.0214	10	0.02654	T	1	-0.4693	10.4841	0.44711	0.0:0.8911:0.0:0.1089	.	93	Q9UQV4	LAMP3_HUMAN	S	93;69;93;69	ENSP00000265598:N93S;ENSP00000418912:N69S;ENSP00000419059:N93S;ENSP00000420589:N69S	ENSP00000265598:N93S	N	-	2	0	LAMP3	184354645	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.102000	0.10956	0.554000	0.29061	-0.274000	0.10170	AAC		0.488	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1			
LOC494141	494141	broad.mit.edu	37	11	18231485	18231485	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr11:18231485G>A	ENST00000527059.1	+	1	731	c.271G>A	c.(271-273)Gga>Aga	p.G91R	RP11-113D6.10_ENST00000340135.3_Missense_Mutation_p.G91R|RP11-113D6.10_ENST00000534640.1_Missense_Mutation_p.G91R														p.G91R(1)									CTTGTATCGGGGAATCTTTCC	0.458																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	494141																														ENST00000527059.1:c.271G>A	11.37:g.18231485G>A	ENSP00000436511:p.Gly91Arg	Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000527059.1	37		.	.	.	.	.	.	.	.	.	.	.	14.65	2.598731	0.46318	.	.	ENSG00000189332	ENST00000340135;ENST00000534640;ENST00000527059	D;D;D	0.98164	-4.76;-4.76;-4.76	0.513	0.513	0.17000	.	0.209016	0.39687	N	0.001294	D	0.97288	0.9113	.	.	.	.	.	.	.	.	.	.	.	.	D	0.97111	0.9804	6	0.87932	D	0	.	6.7635	0.23554	1.0E-4:0.0:0.9999:0.0	.	.	.	.	R	91	ENSP00000342780:G91R;ENSP00000437119:G91R;ENSP00000436511:G91R	ENSP00000342780:G91R	G	+	1	0	RP11-113D6.10	18188061	1.000000	0.71417	0.007000	0.13788	0.004000	0.04260	6.153000	0.71819	0.502000	0.28037	0.305000	0.20034	GGA		0.458	RP11-113D6.10-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389801.2			
Unknown	0	broad.mit.edu	37	15	21934828	21934828	+	IGR	DEL	G	G	-			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr15:21934828delG								RP11-854K16.3 (599404 upstream) : RP11-32B5.7 (6318 downstream)																							TAGATATAGTGGGAATAAAAT	0.279																																																	0																																										SO:0001628	intergenic_variant	646214																															15.37:g.21934828delG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.279									
MANSC1	54682	hgsc.bcm.edu;ucsc.edu	37	12	12491487	12491487	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr12:12491487delT	ENST00000535902.1	-	3	794	c.231delA	c.(229-231)aaafs	p.K77fs	MANSC1_ENST00000396349.3_Frame_Shift_Del_p.K43fs|MANSC1_ENST00000545735.1_5'UTR			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	77	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.					integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		AGTTACATGCTTTGTCCCCTG	0.408																																																	0													155.0	153.0	154.0					12																	12491487		2203	4300	6503	SO:0001589	frameshift_variant	54682			AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.231delA	12.37:g.12491487delT	ENSP00000438205:p.Lys77fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NEC1|Q9NW60	Frame_Shift_Del	DEL	ENST00000535902.1	37	CCDS8648.1																																																																																				0.408	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1		NM_018050	
MICAL3	57553	broad.mit.edu;ucsc.edu	37	22	18382309	18382309	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr22:18382309C>T	ENST00000441493.2	-	7	1205	c.853G>A	c.(853-855)Gac>Aac	p.D285N	MICAL3_ENST00000207726.7_Missense_Mutation_p.D285N|MICAL3_ENST00000444520.1_Missense_Mutation_p.D285N|MICAL3_ENST00000383094.3_Missense_Mutation_p.D285N|MICAL3_ENST00000585038.1_Missense_Mutation_p.D285N|MICAL3_ENST00000400561.2_Missense_Mutation_p.D285N|MICAL3_ENST00000429452.1_Missense_Mutation_p.D285N|MICAL3_ENST00000414725.2_Missense_Mutation_p.D285N	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	285	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.D285N(3)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTCTCCAAGTCAATACCTGGG	0.453																																																	3	Substitution - Missense(3)	kidney(3)											140.0	111.0	120.0					22																	18382309		1568	3581	5149	SO:0001583	missense	57553			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.853G>A	22.37:g.18382309C>T	ENSP00000416015:p.Asp285Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	C	36	5.675954	0.96764	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77;2.77	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	M	0.92268	3.29	0.80722	D	1	D;D;D;D;D	0.89917	0.997;0.984;1.0;1.0;0.984	D;D;D;D;D	0.76575	0.921;0.93;0.983;0.988;0.93	T	0.55704	-0.8099	10	0.87932	D	0	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	285;285;285;285;285	B4DJ91;B2RXJ5;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	N	285	ENSP00000416015:D285N;ENSP00000414846:D285N;ENSP00000383406:D285N;ENSP00000410315:D285N;ENSP00000391827:D285N;ENSP00000372574:D285N;ENSP00000207726:D285N	ENSP00000207726:D285N	D	-	1	0	XXbac-B461K10.4;MICAL3	16762309	1.000000	0.71417	0.623000	0.29173	0.917000	0.54804	7.818000	0.86416	2.820000	0.97059	0.650000	0.86243	GAC		0.453	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			
MIR192	406967	broad.mit.edu	37	11	64658636	64658636	+	lincRNA	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr11:64658636A>G	ENST00000601517.1	-	0	0				MIR192_ENST00000384915.1_RNA|MIR194-2_ENST00000384864.1_lincRNA																							CATACCTGTGACCTATGGAAT	0.622																																																	0													21.0	22.0	22.0					11																	64658636		1551	3560	5111			406967																															11.37:g.64658636A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000601517.1	37																																																																																					0.622	RP11-665N17.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000464673.1			
MKRN1	23608	broad.mit.edu;hgsc.bcm.edu	37	7	140155662	140155662	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:140155662A>G	ENST00000255977.2	-	6	1249	c.1025T>C	c.(1024-1026)aTt>aCt	p.I342T	MKRN1_ENST00000474576.1_Missense_Mutation_p.I278T|MKRN1_ENST00000437223.2_Missense_Mutation_p.I76T	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	342					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I342T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					CTCACTTGGAATGACAAAGTT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											92.0	89.0	90.0					7																	140155662		2203	4300	6503	SO:0001583	missense	23608			AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.1025T>C	7.37:g.140155662A>G	ENSP00000255977:p.Ile342Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	ENST00000255977.2	37	CCDS5860.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588566	0.66105	.	.	ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576;ENST00000463142	T;T;T	0.39997	1.05;1.36;1.05	5.14	5.14	0.70334	Zinc finger, RING/FYVE/PHD-type (1);	0.051756	0.64402	D	0.000001	T	0.54565	0.1866	L	0.45581	1.43	0.80722	D	1	D	0.56521	0.976	P	0.62560	0.904	T	0.53208	-0.8471	10	0.44086	T	0.13	.	15.1262	0.72483	1.0:0.0:0.0:0.0	.	342	Q9UHC7	MKRN1_HUMAN	T	342;278;76;278;17	ENSP00000255977:I342T;ENSP00000439823:I76T;ENSP00000417863:I278T	ENSP00000255977:I342T	I	-	2	0	MKRN1	139802131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.695000	0.91298	2.161000	0.67846	0.528000	0.53228	ATT		0.473	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348752.1		NM_013446	
MUC4	4585	hgsc.bcm.edu	37	3	195513158	195513158	+	Missense_Mutation	SNP	C	C	A	rs541081903	byFrequency	TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:195513158C>A	ENST00000463781.3	-	2	5752	c.5293G>T	c.(5293-5295)Gac>Tac	p.D1765Y	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1765Y	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.587													.|||	19	0.00379393	0.0	0.0	5008	,	,		31696	0.0		0.0	False		,,,				2504	0.0194																0													62.0	56.0	58.0					3																	195513158		692	1591	2283	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5293G>T	3.37:g.195513158C>A	ENSP00000417498:p.Asp1765Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.027	-1.360055	0.01245	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.40476	1.2;1.03	.	.	.	.	.	.	.	.	T	0.16896	0.0406	N	0.19112	0.55	0.09310	N	1	B	0.31581	0.329	B	0.08055	0.003	T	0.09378	-1.0677	7	.	.	.	.	2.1942	0.03906	0.0:0.3362:0.3337:0.3301	.	1765	E7ESK3	.	Y	1765	ENSP00000417498:D1765Y;ENSP00000420243:D1765Y	.	D	-	1	0	MUC4	196997553	0.005000	0.15991	0.002000	0.10522	0.002000	0.02628	0.562000	0.23531	-1.791000	0.01261	-1.780000	0.00649	GAC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MYH13	8735	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10261145	10261145	+	Splice_Site	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr17:10261145C>T	ENST00000418404.3	-	7	809		c.e7-1		MYH13_ENST00000252172.4_Splice_Site			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle						cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.?(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTAGGGTTCCCTAATAATAAA	0.453																																																	2	Unknown(2)	kidney(2)											69.0	75.0	73.0					17																	10261145		2145	4272	6417	SO:0001630	splice_region_variant	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.646-1G>A	17.37:g.10261145C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95252|Q9P0U8	Splice_Site	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846512	0.51164	.	.	ENSG00000006788	ENST00000252172	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5222	0.84320	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH13	10201870	1.000000	0.71417	0.996000	0.52242	0.487000	0.33371	7.492000	0.81482	2.200000	0.70718	0.467000	0.42956	.		0.453	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1		NM_003802	Intron
OR5D18	219438	hgsc.bcm.edu;ucsc.edu	37	11	55587894	55587896	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr11:55587894_55587896delCAA	ENST00000333976.4	+	1	809_811	c.789_791delCAA	c.(787-792)cccaac>ccc	p.N264del		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P263P(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ACTGTGTGCCCAACTCCAAAAAC	0.517																																																	1	Substitution - coding silent(1)	large_intestine(1)																																								SO:0001651	inframe_deletion	219438			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.789_791delCAA	11.37:g.55587894_55587896delCAA	ENSP00000335025:p.Asn264del	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF67|Q6IFD3|Q96RB3	In_Frame_Del	DEL	ENST00000333976.4	37	CCDS31510.1																																																																																				0.517	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1		NM_001001952	
OR7C1	26664	hgsc.bcm.edu	37	19	14910638	14910638	+	Frame_Shift_Del	DEL	A	A	-	rs534928853	byFrequency	TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr19:14910638delA	ENST00000248073.2	-	1	385	c.311delT	c.(310-312)ttcfs	p.F104fs	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	104					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						AAATGAAGTGAAAAAAAAAAT	0.443													|||unknown(HR)	63	0.0125799	0.0076	0.0043	5008	,	,		21296	0.0109		0.002	False		,,,				2504	0.0378																0										3,45,4216		0,0,3,0,45,2084	59.0	60.0	60.0			2.6	0.1	19		61	16,32,8204		0,0,16,2,28,4080	no	codingComplex	OR7C1	NM_198944.1		0,0,19,2,73,6164	A1A1,A1A2,A1R,A2A2,A2R,RR		0.5817,1.1257,0.767			14910638	19,77,12420	2203	4300	6503	SO:0001589	frameshift_variant	26664			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.311delT	19.37:g.14910638delA	ENSP00000248073:p.Phe104fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15621|Q6IFP2|Q96R94	Frame_Shift_Del	DEL	ENST00000248073.2	37	CCDS12317.1																																																																																				0.443	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1			
ORC3	23595	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	88367719	88367719	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr6:88367719C>A	ENST00000392844.3	+	16	1722	c.1674C>A	c.(1672-1674)ttC>ttA	p.F558L	ORC3_ENST00000417380.2_3'UTR|ORC3_ENST00000546266.1_Missense_Mutation_p.F415L|ORC3_ENST00000257789.4_Missense_Mutation_p.F559L	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	558					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)	p.F559L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						TTGTGAACTTCATTGACTGTC	0.333																																																	1	Substitution - Missense(1)	kidney(1)											75.0	74.0	74.0					6																	88367719		2203	4300	6503	SO:0001583	missense	23595			AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.1674C>A	6.37:g.88367719C>A	ENSP00000376586:p.Phe558Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	ENST00000392844.3	37	CCDS43486.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557186	0.45590	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.09538	3.35;3.33;2.97	5.12	2.14	0.27477	.	0.202728	0.52532	D	0.000064	T	0.01523	0.0049	N	0.26042	0.785	0.41520	D	0.98839	B;B;B	0.31680	0.022;0.335;0.079	B;B;B	0.26614	0.015;0.071;0.067	T	0.35025	-0.9805	10	0.07030	T	0.85	-3.6428	5.1749	0.15129	0.0:0.5312:0.1446:0.3243	.	496;558;559	B4E014;Q9UBD5;Q9UBD5-2	.;ORC3_HUMAN;.	L	558;559;415	ENSP00000376586:F558L;ENSP00000257789:F559L;ENSP00000444695:F415L	ENSP00000257789:F559L	F	+	3	2	ORC3	88424438	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.970000	0.29383	0.641000	0.30601	0.557000	0.71058	TTC		0.333	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041452.2			
PADI6	353238	broad.mit.edu;ucsc.edu	37	1	17720899	17720899	+	RNA	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:17720899G>A	ENST00000434762.2	+	0	1337							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.G428E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AAGGTCCAAGGGAAAGAGTAC	0.547																																																	1	Substitution - Missense(1)	kidney(1)											34.0	35.0	35.0					1																	17720899		1938	4135	6073			353238			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17720899G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37																																																																																					0.547	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4		NM_207421	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52643561	52643561	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:52643561G>A	ENST00000296302.7	-	16	2336	c.2335C>T	c.(2335-2337)Caa>Taa	p.Q779*	PBRM1_ENST00000409114.3_Nonsense_Mutation_p.Q794*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.Q779*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.Q794*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.Q779*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.Q779*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.Q747*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.Q779*			Q86U86	PB1_HUMAN	polybromo 1	779					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q779*(5)|p.Q747*(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATAAGCTCTTGAATCAGCAAA	0.448			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	6	Substitution - Nonsense(6)	kidney(5)|breast(1)											90.0	84.0	86.0					3																	52643561		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2335C>T	3.37:g.52643561G>A	ENSP00000296302:p.Gln779*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	40	8.349302	0.98772	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-15.2806	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	747;779;779;779;779;779;794;794;779;738	.	ENSP00000296302:Q779X	Q	-	1	0	PBRM1	52618601	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	CAA		0.448	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PARP14	54625	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	122418640	122418640	+	Silent	SNP	A	A	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:122418640A>T	ENST00000474629.2	+	6	1505	c.1239A>T	c.(1237-1239)atA>atT	p.I413I		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.I250I(1)|p.I413I(1)		NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GGGACACCATAAAAAATGATG	0.398																																																	2	Substitution - coding silent(2)	kidney(2)											132.0	126.0	128.0					3																	122418640		1882	4115	5997	SO:0001819	synonymous_variant	54625			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1239A>T	3.37:g.122418640A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	CCDS46894.1																																																																																				0.398	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2		NM_017554	
PCLO	27445	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	82545945	82545945	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:82545945T>G	ENST00000333891.9	-	7	11694	c.11357A>C	c.(11356-11358)gAg>gCg	p.E3786A	PCLO_ENST00000423517.2_Missense_Mutation_p.E3786A|PCLO_ENST00000437081.1_Missense_Mutation_p.E506A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E3786A(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTCATCAAGCTCTGCTTGTTT	0.433																																																	2	Substitution - Missense(2)	kidney(2)											140.0	125.0	130.0					7																	82545945		1905	4129	6034	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11357A>C	7.37:g.82545945T>G	ENSP00000334319:p.Glu3786Ala	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628594	0.67015	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.54675	0.56;0.59	6.04	6.04	0.98038	.	.	.	.	.	T	0.73385	0.3580	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.998	T	0.76383	-0.2979	9	0.87932	D	0	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	3717;3786;3786	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	A	3786;3786;506	ENSP00000334319:E3786A;ENSP00000388393:E3786A	ENSP00000334319:E3786A	E	-	2	0	PCLO	82383881	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.317000	0.78254	0.460000	0.39030	GAG		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5		NM_014510	
PCNA	5111	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	5099285	5099285	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr20:5099285C>T	ENST00000379160.3	-	4	600	c.358G>A	c.(358-360)Gat>Aat	p.D120N	SNORA26_ENST00000391215.1_RNA|PCNA_ENST00000379143.5_Missense_Mutation_p.D120N	NM_002592.2	NP_002583.1	P12004	PCNA_HUMAN	proliferating cell nuclear antigen	120					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|epithelial cell differentiation (GO:0030855)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|leading strand elongation (GO:0006272)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of deoxyribonuclease activity (GO:0032077)|regulation of DNA replication (GO:0006275)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cadmium ion (GO:0046686)|response to lipid (GO:0033993)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)|translesion synthesis (GO:0019985)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|nuclear replication fork (GO:0043596)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA complex (GO:0043626)|PCNA-p21 complex (GO:0070557)	dinucleotide insertion or deletion binding (GO:0032139)|DNA polymerase binding (GO:0070182)|DNA polymerase processivity factor activity (GO:0030337)|identical protein binding (GO:0042802)|MutLalpha complex binding (GO:0032405)|purine-specific mismatch base pair DNA N-glycosylase activity (GO:0000701)|receptor tyrosine kinase binding (GO:0030971)	p.D120N(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(2)	9						ACATCTAAATCCATCAACTTC	0.363								DNA polymerases (catalytic subunits)																																									1	Substitution - Missense(1)	kidney(1)											147.0	141.0	143.0					20																	5099285		2203	4300	6503	SO:0001583	missense	5111			J04718	CCDS13087.1	20p13-p12.3	2013-09-19			ENSG00000132646	ENSG00000132646			8729	protein-coding gene	gene with protein product		176740				2565339	Standard	NM_002592		Approved		uc002wlp.3	P12004	OTTHUMG00000031798	ENST00000379160.3:c.358G>A	20.37:g.5099285C>T	ENSP00000368458:p.Asp120Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2R897|D3DW02	Missense_Mutation	SNP	ENST00000379160.3	37	CCDS13087.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.841850	0.51057	.	.	ENSG00000132646	ENST00000379143;ENST00000379160	.	.	.	4.46	4.46	0.54185	Proliferating cell nuclear antigen, PCNA, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.62085	0.2399	L	0.56280	1.765	0.80722	D	1	B	0.22003	0.063	B	0.34824	0.19	T	0.60576	-0.7236	9	0.35671	T	0.21	-14.3929	14.6506	0.68794	0.0:1.0:0.0:0.0	.	120	P12004	PCNA_HUMAN	N	120	.	ENSP00000368438:D120N	D	-	1	0	PCNA	5047285	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.734000	0.68580	2.304000	0.77564	0.557000	0.71058	GAT		0.363	PCNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077852.2			
PDE5A	8654	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	120442144	120442144	+	Silent	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr4:120442144A>G	ENST00000354960.3	-	13	2170	c.1851T>C	c.(1849-1851)caT>caC	p.H617H	PDE5A_ENST00000394439.1_Silent_p.H565H|PDE5A_ENST00000512739.1_5'Flank|RP11-33B1.1_ENST00000498873.1_RNA|PDE5A_ENST00000264805.5_Silent_p.H575H	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	617	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.H617H(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	TATTAAAGGCATGTCTCCAAT	0.338																																																	1	Substitution - coding silent(1)	kidney(1)											151.0	153.0	152.0					4																	120442144		2202	4300	6502	SO:0001819	synonymous_variant	8654			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1851T>C	4.37:g.120442144A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	ENST00000354960.3	37	CCDS3713.1																																																																																				0.338	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1		NM_001083	
PGBD5	79605	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	230461073	230461073	+	Silent	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:230461073G>A	ENST00000525115.1	-	6	1178	c.1155C>T	c.(1153-1155)taC>taT	p.Y385Y	PGBD5_ENST00000391860.1_Silent_p.Y339Y|PGBD5_ENST00000321327.2_Silent_p.Y484Y|PGBD5_ENST00000530424.1_5'UTR			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	385						integral component of membrane (GO:0016021)		p.Y484Y(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		ATTTGTCATCGTATCTGCAGA	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											250.0	213.0	226.0					1																	230461073		2203	4300	6503	SO:0001819	synonymous_variant	79605			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.1155C>T	1.37:g.230461073G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	37																																																																																					0.527	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1		NM_024554	
PRNT	149830	broad.mit.edu	37	20	4721284	4721284	+	5'UTR	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr20:4721284C>A	ENST00000326539.2	-	0	30				PRNT_ENST00000418528.1_5'UTR|PRNT_ENST00000423718.2_5'UTR			Q86SH4	PRNT_HUMAN	prion protein (testis specific)							extracellular region (GO:0005576)				endometrium(2)|lung(5)	7						CTGCAGCTGGCACCCAATCTT	0.512											OREG0025751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													149.0	127.0	134.0					20																	4721284		692	1591	2283	SO:0001623	5_prime_UTR_variant	149830			AL137296, AJ427539		20p13	2013-04-02			ENSG00000180259	ENSG00000180259			18046	other	unknown	"""M8 protein"""					12514748	Standard	NR_024267		Approved	M8	uc010zqq.2	Q86SH4	OTTHUMG00000031785	ENST00000326539.2:c.-908G>T	20.37:g.4721284C>A		Somatic	621	WXS	Illumina GAIIx	Phase_I	B2RPD9|B7ZBI9	RNA	SNP	ENST00000326539.2	37																																																																																					0.512	PRNT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000253006.2		NM_177549	
PSG11	5680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	43519423	43519423	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr19:43519423T>C	ENST00000401740.1	-	4	912	c.809A>G	c.(808-810)cAg>cGg	p.Q270R	PSG11_ENST00000595312.1_5'Flank|PSG11_ENST00000306322.7_Missense_Mutation_p.Q148R|PSG11_ENST00000320078.7_Missense_Mutation_p.Q270R|PSG11_ENST00000403486.1_Missense_Mutation_p.Q148R			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	267	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.Q270R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				CCAAGAATACTGTGCTGGTGG	0.458																																																	1	Substitution - Missense(1)	kidney(1)											151.0	157.0	155.0					19																	43519423		2200	4297	6497	SO:0001583	missense	5680			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.809A>G	19.37:g.43519423T>C	ENSP00000384995:p.Gln270Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	t	4.113	0.019049	0.08006	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	0.976	0.976	0.19727	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.11750	0.0286	L	0.43923	1.385	0.09310	N	1	B;B	0.24092	0.097;0.0	B;B	0.29716	0.106;0.017	T	0.33343	-0.9872	9	0.51188	T	0.08	.	4.0943	0.09983	0.0:0.0:0.0:1.0	.	148;270	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	R	270;148;148;270	ENSP00000319140:Q270R;ENSP00000385427:Q148R;ENSP00000304913:Q148R;ENSP00000384995:Q270R	ENSP00000304913:Q148R	Q	-	2	0	PSG11	48211263	0.124000	0.22315	0.233000	0.24025	0.042000	0.13812	0.487000	0.22356	0.382000	0.24878	0.155000	0.16302	CAG		0.458	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1		NM_002785	
PSMB5	5693	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	23504076	23504076	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr14:23504076G>T	ENST00000361611.6	-	1	278	c.15C>A	c.(13-15)agC>agA	p.S5R	PSMB5_ENST00000493471.2_Missense_Mutation_p.S5R|PSMB5_ENST00000460922.2_Missense_Mutation_p.S5R|AL132780.1_ENST00000385031.1_RNA|PSMB5_ENST00000425762.2_Intron	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	5				LAS -> HEG (in Ref. 6; BC004146). {ECO:0000305}.|LASV -> IRGR (in Ref. 8; BAA06097). {ECO:0000305}.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.S5R(2)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	TCTCCAACACGCTGGCAAGCG	0.572																																																	2	Substitution - Missense(2)	kidney(2)											37.0	36.0	36.0					14																	23504076		2203	4300	6503	SO:0001583	missense	5693			D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.15C>A	14.37:g.23504076G>T	ENSP00000355325:p.Ser5Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	37	CCDS9584.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217959	0.79352	.	.	ENSG00000100804	ENST00000361611;ENST00000493471;ENST00000460922	T;T;T	0.54071	0.59;0.59;0.59	5.22	1.38	0.22167	.	0.088006	0.85682	D	0.000000	T	0.52322	0.1727	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.983	T	0.49234	-0.8961	10	0.54805	T	0.06	-22.205	7.2166	0.25963	0.5179:0.0:0.4821:0.0	.	5;5	P28074-2;P28074	.;PSB5_HUMAN	R	5	ENSP00000355325:S5R;ENSP00000452424:S5R;ENSP00000451286:S5R	ENSP00000334973:S5R	S	-	3	2	PSMB5	22573916	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.527000	0.22987	0.223000	0.20920	0.555000	0.69702	AGC		0.572	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4		NM_002797	
PTCHD3	374308	broad.mit.edu	37	10	27702296	27702296	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr10:27702296A>G	ENST00000438700.3	-	1	1001	c.884T>C	c.(883-885)cTc>cCc	p.L295P		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	295					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.L295P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GGTCAGGTAGAGGGGATGCCT	0.612																																																	1	Substitution - Missense(1)	kidney(1)											57.0	62.0	60.0					10																	27702296		2203	4300	6503	SO:0001583	missense	374308			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.884T>C	10.37:g.27702296A>G	ENSP00000417658:p.Leu295Pro	Somatic		WXS	Illumina GAIIx	Phase_I	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827530	0.50845	.	.	ENSG00000182077	ENST00000438700	D	0.87029	-2.2	3.98	3.98	0.46160	.	2.418810	0.01464	N	0.015986	D	0.82323	0.5012	N	0.20986	0.625	0.19300	N	0.999977	P	0.35383	0.498	B	0.40329	0.326	T	0.71735	-0.4503	10	0.32370	T	0.25	-0.4686	5.6906	0.17827	0.7608:0.0:0.0871:0.1521	.	295	Q3KNS1	PTHD3_HUMAN	P	295	ENSP00000417658:L295P	ENSP00000417658:L295P	L	-	2	0	PTCHD3	27742302	0.776000	0.28616	0.037000	0.18230	0.147000	0.21601	1.723000	0.38053	1.798000	0.52647	0.459000	0.35465	CTC		0.612	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3		XM_370541	
RAET1E	135250	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	150210680	150210680	+	Silent	SNP	G	G	A	rs572045980		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr6:150210680G>A	ENST00000357183.4	-	3	558	c.426C>T	c.(424-426)acC>acT	p.T142T	RAET1E-AS1_ENST00000446954.2_RNA|RAET1E_ENST00000367363.3_Silent_p.T106T|RAET1E_ENST00000532335.1_Silent_p.T142T|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E_ENST00000529948.1_Silent_p.T142T|RAET1E-AS1_ENST00000605899.1_RNA	NM_139165.2	NP_631904.1	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E	142	MHC class I alpha-2 like.		T -> I (in dbSNP:rs9371533).	AT -> TI (in Ref. 8; AAL76417). {ECO:0000305}.	antigen processing and presentation (GO:0019882)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)	p.T142T(2)		cervix(1)|kidney(2)|large_intestine(3)|lung(3)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		TCTCTCCATTGGTGGCGAACT	0.473													N|||	1	0.000199681	0.0008	0.0	5008	,	,		21745	0.0		0.0	False		,,,				2504	0.0																2	Substitution - coding silent(2)	cervix(1)|kidney(1)											156.0	128.0	137.0					6																	150210680		2203	4300	6503	SO:0001819	synonymous_variant	135250			AF359243	CCDS5221.1, CCDS59042.1, CCDS59043.1, CCDS59044.1	6q24.3	2011-02-09			ENSG00000164520	ENSG00000164520			16793	protein-coding gene	gene with protein product		609243				11827464	Standard	NM_139165		Approved	LETAL, bA350J20.7, ULBP4	uc003qnl.1	Q8TD07	OTTHUMG00000015796	ENST00000357183.4:c.426C>T	6.37:g.150210680G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6YF59|Q5VYB7|Q5VYB8|Q8TEZ2|Q96L41	Silent	SNP	ENST00000357183.4	37	CCDS5221.1																																																																																				0.473	RAET1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042659.1		NM_139165	
RANBP3L	202151	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	36255599	36255599	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr5:36255599C>A	ENST00000296604.3	-	11	1482	c.997G>T	c.(997-999)Gac>Tac	p.D333Y	RANBP3L_ENST00000502994.1_Missense_Mutation_p.D358Y	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	333	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)			p.D333Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			GTTCCACAGTCAGTGCTTGCT	0.373																																																	1	Substitution - Missense(1)	kidney(1)											206.0	166.0	179.0					5																	36255599		2203	4299	6502	SO:0001583	missense	202151			BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.997G>T	5.37:g.36255599C>A	ENSP00000296604:p.Asp333Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	ENST00000296604.3	37	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.479565	0.63849	.	.	ENSG00000164188	ENST00000296604;ENST00000502994	T;T	0.26373	1.74;1.75	5.87	2.7	0.31948	Pleckstrin homology-type (1);Ran binding protein 1 (3);	0.489678	0.20668	N	0.087890	T	0.44582	0.1300	M	0.83953	2.67	0.24162	N	0.995651	P;P	0.45176	0.8;0.852	P;P	0.56163	0.793;0.71	T	0.26360	-1.0105	10	0.87932	D	0	-8.1249	7.8825	0.29631	0.0:0.6587:0.0:0.3413	.	358;333	E9PGP9;Q86VV4	.;RNB3L_HUMAN	Y	333;358	ENSP00000296604:D333Y;ENSP00000421853:D358Y	ENSP00000296604:D333Y	D	-	1	0	RANBP3L	36291356	0.937000	0.31787	0.984000	0.44739	0.978000	0.69477	1.343000	0.33930	0.952000	0.37798	-0.137000	0.14449	GAC		0.373	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2		NM_145000	
ROS1	6098	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	117674152	117674152	+	Splice_Site	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr6:117674152C>A	ENST00000368508.3	-	26	4520		c.e26+1		ROS1_ENST00000368507.3_Splice_Site|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase						cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.?(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GACTTTATTACCTGGAAAAGG	0.443			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	2	Unknown(2)	kidney(2)											134.0	125.0	128.0					6																	117674152		2203	4300	6503	SO:0001630	splice_region_variant	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.4321+1G>T	6.37:g.117674152C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q15368|Q5TDB5	Splice_Site	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313890	0.81358	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9045	0.86123	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ROS1	117780845	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.603000	0.61105	2.739000	0.93911	0.650000	0.86243	.		0.443	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			Intron
RSL1D1	26156	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	11935566	11935566	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr16:11935566T>G	ENST00000571133.1	-	7	913	c.841A>C	c.(841-843)Aat>Cat	p.N281H	RSL1D1_ENST00000542106.1_Missense_Mutation_p.N61H	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	281					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.N281H(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						TTCTTCTTATTAAGCAAAGAT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											54.0	56.0	55.0					16																	11935566		2197	4300	6497	SO:0001583	missense	26156			AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.841A>C	16.37:g.11935566T>G	ENSP00000460871:p.Asn281His	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	ENST00000571133.1	37	CCDS10551.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.154414	0.38021	.	.	ENSG00000171490	ENST00000355674;ENST00000396503;ENST00000542106	T	0.44881	0.91	4.72	-3.3	0.05003	.	3.319120	0.00998	N	0.003628	T	0.31167	0.0788	N	0.22421	0.69	0.09310	N	1	P;P	0.38300	0.626;0.626	B;B	0.37601	0.254;0.254	T	0.35724	-0.9777	10	0.45353	T	0.12	12.8272	10.2998	0.43646	0.0:0.4823:0.0:0.5177	.	281;281	Q32Q62;O76021	.;RL1D1_HUMAN	H	280;281;61	ENSP00000347897:N280H	ENSP00000347897:N280H	N	-	1	0	RSL1D1	11843067	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.377000	0.07456	-0.681000	0.05204	0.402000	0.26972	AAT		0.383	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252059.2		NM_015659	
SLC33A1	9197	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	155571204	155571204	+	Missense_Mutation	SNP	T	T	A	rs148999356		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr3:155571204T>A	ENST00000392845.3	-	1	963	c.583A>T	c.(583-585)Att>Ttt	p.I195F	SLC33A1_ENST00000359479.3_Missense_Mutation_p.I195F|SLC33A1_ENST00000460729.1_5'Flank			O00400	ACATN_HUMAN	solute carrier family 33 (acetyl-CoA transporter), member 1	195					acetyl-CoA transport (GO:0015876)|cell death (GO:0008219)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	acetyl-CoA transporter activity (GO:0008521)	p.I195F(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	22			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCGACGGCAATGTCCTGAGTG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											71.0	76.0	75.0					3																	155571204		2203	4300	6503	SO:0001583	missense	9197			D88152	CCDS3173.1	3q25.31	2013-05-22		2002-12-06	ENSG00000169359	ENSG00000169359		"""Solute carriers"""	95	protein-coding gene	gene with protein product		603690	"""acetyl-Coenzyme A transporter"", ""spastic paraplegia 42 (autosomal dominant)"""	ACATN, SPG42		9096318, 19061983	Standard	NM_004733		Approved	AT-1, AT1	uc003fao.2	O00400	OTTHUMG00000158481	ENST00000392845.3:c.583A>T	3.37:g.155571204T>A	ENSP00000376587:p.Ile195Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5Q2|D3DNK4	Missense_Mutation	SNP	ENST00000392845.3	37	CCDS3173.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.3|25.3	4.628921|4.628921	0.87560|0.87560	.|.	.|.	ENSG00000169359|ENSG00000169359	ENST00000475842|ENST00000392845;ENST00000359479	.|T;T	.|0.78126	.|-1.15;-1.15	5.28|5.28	4.11|4.11	0.48088|0.48088	.|Major facilitator superfamily domain, general substrate transporter (1);	.|0.147788	.|0.64402	.|D	.|0.000015	D|D	0.90597|0.90597	0.7052|0.7052	H|H	0.95470|0.95470	3.675|3.675	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.91750|0.91750	0.5411|0.5411	5|10	.|0.87932	.|D	.|0	-9.835|-9.835	11.3297|11.3297	0.49468|0.49468	0.0:0.0717:0.0:0.9283|0.0:0.0717:0.0:0.9283	.|.	.|195	.|O00400	.|ACATN_HUMAN	L|F	26|195	.|ENSP00000376587:I195F;ENSP00000352456:I195F	.|ENSP00000352456:I195F	H|I	-|-	2|1	0|0	SLC33A1|SLC33A1	157053898|157053898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	6.155000|6.155000	0.71833|0.71833	0.947000|0.947000	0.37659|0.37659	0.529000|0.529000	0.55759|0.55759	CAT|ATT		0.498	SLC33A1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351130.3		NM_004733	
SLC6A12	6539	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	300301	300301	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr12:300301C>T	ENST00000428720.1	-	16	2521	c.1778G>A	c.(1777-1779)gGc>gAc	p.G593D	RP11-283I3.1_ENST00000544067.1_RNA|SLC6A12_ENST00000397296.2_Missense_Mutation_p.G593D|SLC6A12_ENST00000536824.1_Missense_Mutation_p.G593D|SLC6A12_ENST00000424061.2_Missense_Mutation_p.G593D|SLC6A12_ENST00000359674.4_Missense_Mutation_p.G593D	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	593					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G593D(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			AAAGTTCCGGCCAGCACTGCC	0.612																																																	1	Substitution - Missense(1)	kidney(1)											50.0	43.0	45.0					12																	300301		2202	4298	6500	SO:0001583	missense	6539			L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1778G>A	12.37:g.300301C>T	ENSP00000388184:p.Gly593Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	ENST00000428720.1	37	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	C	9.474	1.096352	0.20552	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	4.39	-0.969	0.10310	.	.	.	.	.	T	0.48804	0.1520	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.25328	-1.0135	9	0.19147	T	0.46	.	6.8141	0.23820	0.0:0.3959:0.4352:0.1689	.	593	P48065	S6A12_HUMAN	D	593	ENSP00000352702:G593D;ENSP00000380464:G593D;ENSP00000388184:G593D;ENSP00000399136:G593D;ENSP00000444268:G593D	ENSP00000352702:G593D	G	-	2	0	SLC6A12	170562	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.074000	0.14662	-0.300000	0.08895	-0.165000	0.13383	GGC		0.612	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2		NM_003044	
SLC6A13	6540	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	336752	336752	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr12:336752T>C	ENST00000343164.4	-	8	966	c.914A>G	c.(913-915)aAg>aGg	p.K305R	SLC6A13_ENST00000445055.2_Missense_Mutation_p.K213R	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	305					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.K305R(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GTTGTGGTACTTGTTGTAGCT	0.567																																																	1	Substitution - Missense(1)	kidney(1)											147.0	104.0	119.0					12																	336752		2203	4300	6503	SO:0001583	missense	6540			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.914A>G	12.37:g.336752T>C	ENSP00000339260:p.Lys305Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845071	0.51164	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.75589	-0.95;-0.95	5.75	3.26	0.37387	.	0.139643	0.64402	D	0.000004	T	0.71187	0.3310	L	0.58354	1.805	0.53005	D	0.999967	B;B;B	0.28512	0.128;0.214;0.113	B;B;B	0.37451	0.25;0.243;0.243	T	0.68209	-0.5469	10	0.45353	T	0.12	.	8.3088	0.32058	0.0:0.069:0.133:0.7979	.	213;284;305	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	R	213;284;305	ENSP00000407104:K213R;ENSP00000339260:K305R	ENSP00000318097:K284R	K	-	2	0	SLC6A13	207013	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.149000	0.58091	1.003000	0.39130	0.533000	0.62120	AAG		0.567	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1		NM_016615	
SNTG2	54221	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	1094047	1094047	+	Silent	SNP	T	T	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr2:1094047T>G	ENST00000308624.5	+	4	405	c.276T>G	c.(274-276)tcT>tcG	p.S92S	SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	92	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.S92S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AGGGAGGTTCTGAGCACAACG	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											135.0	129.0	131.0					2																	1094047		1885	4105	5990	SO:0001819	synonymous_variant	54221			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.276T>G	2.37:g.1094047T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q05AH5	Silent	SNP	ENST00000308624.5	37	CCDS46220.1																																																																																				0.393	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1		NM_018968	
TRAM1	23471	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	71508498	71508498	+	Splice_Site	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr8:71508498G>A	ENST00000262213.2	-	5	654	c.485C>T	c.(484-486)aCa>aTa	p.T162I	TRAM1_ENST00000521425.1_Splice_Site_p.T76I|TRAM1_ENST00000521049.1_Intron|TRAM1_ENST00000536748.1_Splice_Site_p.T131I	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	162	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T162I(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			AATGACTTACGTCATCAGGTT	0.363																																					Ovarian(85;984 1334 5116 12432 40638)												1	Substitution - Missense(1)	kidney(1)											132.0	131.0	132.0					8																	71508498		2203	4300	6503	SO:0001630	splice_region_variant	23471			X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.485+1C>T	8.37:g.71508498G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4E0K2	Missense_Mutation	SNP	ENST00000262213.2	37	CCDS6207.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046930	0.55110	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	D;D;D	0.85484	-1.99;-1.99;-1.99	6.07	6.07	0.98685	TRAM/LAG1/CLN8 homology domain (3);	0.101168	0.64402	D	0.000002	T	0.82111	0.4966	L	0.50333	1.59	0.49213	D	0.999761	P	0.40180	0.705	B	0.34346	0.18	T	0.80084	-0.1530	9	.	.	.	-23.6136	20.6525	0.99598	0.0:0.0:1.0:0.0	.	162	Q15629	TRAM1_HUMAN	I	76;162;131	ENSP00000428052:T76I;ENSP00000262213:T162I;ENSP00000439359:T131I	.	T	-	2	0	TRAM1	71671052	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.817000	0.55668	2.890000	0.99128	0.585000	0.79938	ACA		0.363	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378738.1		NM_014294	Missense_Mutation
TG	7038	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	133911118	133911118	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr8:133911118C>A	ENST00000220616.4	+	14	3333	c.3293C>A	c.(3292-3294)cCa>cAa	p.P1098Q	TG_ENST00000377869.1_Missense_Mutation_p.P1098Q	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1098	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.P1098Q(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAAGAAAACCCATCTCCAAAA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											75.0	63.0	67.0					8																	133911118		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3293C>A	8.37:g.133911118C>A	ENSP00000220616:p.Pro1098Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.83|15.83	2.947779|2.947779	0.53186|0.53186	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000518505|ENST00000377869;ENST00000220616	.|T;T	.|0.61859	.|0.07;0.07	5.74|5.74	4.87|4.87	0.63330|0.63330	.|Thyroglobulin type-1 (4);	.|0.188178	.|0.37136	.|N	.|0.002230	T|T	0.62780|0.62780	0.2456|0.2456	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	.|P	.|0.49696	.|0.927	.|P	.|0.49192	.|0.602	T|T	0.59994|0.59994	-0.7349|-0.7349	5|10	.|0.59425	.|D	.|0.04	.|.	11.7474|11.7474	0.51828|0.51828	0.0:0.9183:0.0:0.0817|0.0:0.9183:0.0:0.0817	.|.	.|1098	.|P01266	.|THYG_HUMAN	N|Q	65|1098	.|ENSP00000367100:P1098Q;ENSP00000220616:P1098Q	.|ENSP00000220616:P1098Q	H|P	+|+	1|2	0|0	TG|TG	133980300|133980300	0.001000|0.001000	0.12720|0.12720	0.026000|0.026000	0.17262|0.17262	0.686000|0.686000	0.39977|0.39977	0.926000|0.926000	0.28804|0.28804	1.429000|1.429000	0.47314|0.47314	0.655000|0.655000	0.94253|0.94253	CAT|CCA		0.532	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1		NM_003235	
TRIO	7204	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	14497119	14497119	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr5:14497119C>A	ENST00000344204.4	+	50	8036	c.8012C>A	c.(8011-8013)tCt>tAt	p.S2671Y	TRIO_ENST00000537187.1_Missense_Mutation_p.S2495Y|TRIO_ENST00000344135.5_Missense_Mutation_p.S170Y	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2671					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S2671Y(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					AACAAGGTATCTGTGAAGGTG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											117.0	99.0	105.0					5																	14497119		2203	4300	6503	SO:0001583	missense	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8012C>A	5.37:g.14497119C>A	ENSP00000339299:p.Ser2671Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810901	0.90707	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000344135	T;T;T	0.68903	-0.33;-0.23;-0.36	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.79958	0.4536	M	0.61703	1.905	0.35578	D	0.806038	D	0.69078	0.997	D	0.74348	0.983	D	0.85567	0.1231	10	0.87932	D	0	.	17.1098	0.86672	0.0:1.0:0.0:0.0	.	2671	O75962	TRIO_HUMAN	Y	2671;2495;2358;170	ENSP00000339299:S2671Y;ENSP00000446348:S2495Y;ENSP00000339291:S170Y	ENSP00000339291:S170Y	S	+	2	0	TRIO	14550119	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.390000	0.79816	2.461000	0.83175	0.655000	0.94253	TCT		0.493	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2		NM_007118	
TUBB4A	10382	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6496076	6496076	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr19:6496076G>T	ENST00000264071.2	-	4	805	c.434C>A	c.(433-435)tCc>tAc	p.S145Y	CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000598006.1_3'UTR|TUBB4A_ENST00000601152.1_3'UTR|TUBB4A_ENST00000540257.1_Missense_Mutation_p.S145Y			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	145					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.S145Y(1)									GCCCATTCCGGACCCCGTGCC	0.637																																																	1	Substitution - Missense(1)	kidney(1)											97.0	83.0	88.0					19																	6496076		2203	4300	6503	SO:0001583	missense	0			AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.434C>A	19.37:g.6496076G>T	ENSP00000264071:p.Ser145Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478883	0.44044	.	.	ENSG00000104833	ENST00000264071;ENST00000540257	D;D	0.82167	-1.58;-1.58	3.98	3.98	0.46160	.	0.000000	0.64402	D	0.000002	D	0.95974	0.8689	H	0.99987	5.265	0.58432	D	0.999999	D	0.89917	1.0	D	0.74023	0.982	D	0.97955	1.0334	10	0.87932	D	0	.	14.999	0.71455	0.0:0.0:1.0:0.0	.	145	P04350	TBB4A_HUMAN	Y	145	ENSP00000264071:S145Y;ENSP00000443590:S145Y	ENSP00000264071:S145Y	S	-	2	0	TUBB4	6447076	1.000000	0.71417	0.676000	0.29932	0.703000	0.40648	9.700000	0.98707	1.795000	0.52594	0.549000	0.68633	TCC		0.637	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1		NM_006087	
UBC	7316	broad.mit.edu;hgsc.bcm.edu	37	12	125397153	125397153	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr12:125397153T>C	ENST00000536769.1	-	1	2741	c.1165A>G	c.(1165-1167)Act>Gct	p.T389A	UBC_ENST00000339647.5_Missense_Mutation_p.T389A|UBC_ENST00000538617.1_Intron|UBC_ENST00000536661.1_5'Flank|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Missense_Mutation_p.T313A			P0CG48	UBC_HUMAN	ubiquitin C	389	Ubiquitin-like 6. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.T389A(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GTCTTACCAGTCAGGGTCTTC	0.532																																																	1	Substitution - Missense(1)	kidney(1)											215.0	198.0	204.0					12																	125397153		2203	4296	6499	SO:0001583	missense	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1165A>G	12.37:g.125397153T>C	ENSP00000441543:p.Thr389Ala	Somatic		WXS	Illumina HiSeq	Phase_I	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000536769.1	37	CCDS9260.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743662	0.30865	.	.	ENSG00000150991	ENST00000536769;ENST00000541046;ENST00000339647;ENST00000546120	T;T;T	0.32023	1.47;1.47;1.47	3.34	3.34	0.38264	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.47093	U	0.000259	T	0.34164	0.0888	M	0.70275	2.135	0.80722	D	1	B	0.19331	0.035	B	0.28709	0.093	T	0.33548	-0.9864	10	0.87932	D	0	.	9.7647	0.40554	0.0:0.0:0.0:1.0	.	389	P0CG48	UBC_HUMAN	A	389;313;389;313	ENSP00000441543:T389A;ENSP00000344818:T389A;ENSP00000438394:T313A	ENSP00000344818:T389A	T	-	1	0	UBC	123963106	1.000000	0.71417	0.961000	0.40146	0.610000	0.37248	6.722000	0.74735	1.391000	0.46566	0.454000	0.30748	ACT		0.532	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1		NM_021009	
UBE2J2	118424	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	1198752	1198752	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:1198752C>T	ENST00000349431.6	-	3	365	c.146G>A	c.(145-147)cGa>cAa	p.R49Q	UBE2J2_ENST00000400929.2_5'UTR|UBE2J2_ENST00000360466.2_Missense_Mutation_p.R49Q|UBE2J2_ENST00000348298.7_5'UTR|UBE2J2_ENST00000400930.4_Missense_Mutation_p.R65Q|UBE2J2_ENST00000339385.6_Missense_Mutation_p.R14Q|UBE2J2_ENST00000491779.1_Intron|UBE2J2_ENST00000347370.2_5'UTR	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	49					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.R65Q(1)		cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		CTCTGGGCCTCGGACGACATA	0.448																																																	1	Substitution - Missense(1)	kidney(1)											174.0	189.0	184.0					1																	1198752		2203	4300	6503	SO:0001583	missense	118424			AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.146G>A	1.37:g.1198752C>T	ENSP00000305826:p.Arg49Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	ENST00000349431.6	37	CCDS14.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524299	0.27299	.	.	ENSG00000160087	ENST00000349431;ENST00000339385;ENST00000360466;ENST00000400930;ENST00000435198;ENST00000422076;ENST00000502382	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.21	5.21	0.72293	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.35799	0.0944	L	0.33668	1.02	0.80722	D	1	P;P;P	0.51933	0.538;0.949;0.943	B;B;B	0.41088	0.24;0.221;0.347	T	0.16305	-1.0407	10	0.41790	T	0.15	-2.4068	18.1056	0.89519	0.0:1.0:0.0:0.0	.	65;49;82	A8MYC7;Q8N2K1;B1AME9	.;UB2J2_HUMAN;.	Q	49;14;49;65;49;65;49	ENSP00000305826:R49Q;ENSP00000340197:R14Q;ENSP00000353653:R49Q;ENSP00000383719:R65Q;ENSP00000393301:R49Q;ENSP00000401898:R65Q;ENSP00000424342:R49Q	ENSP00000340197:R14Q	R	-	2	0	UBE2J2	1188615	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.259000	0.78381	2.579000	0.87056	0.655000	0.94253	CGA		0.448	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005430.1		NM_058167	
UBE4B	10277	broad.mit.edu;ucsc.edu	37	1	10221342	10221342	+	Missense_Mutation	SNP	C	C	T	rs371058351		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:10221342C>T	ENST00000253251.8	+	22	3648	c.2809C>T	c.(2809-2811)Cgg>Tgg	p.R937W	UBE4B_ENST00000343090.6_Missense_Mutation_p.R1066W|UBE4B_ENST00000377157.3_Missense_Mutation_p.R821W|RNU6-828P_ENST00000364876.1_RNA					ubiquitination factor E4B									p.R937W(1)|p.R1066W(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CCAGTTGCCCCGGGTGAGGAC	0.542																																																	2	Substitution - Missense(2)	kidney(2)						C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	73.0	65.0	68.0		3196,2809	4.5	1.0	1		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	UBE4B	NM_001105562.2,NM_006048.4	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1066/1303,937/1174	10221342	1,13005	2203	4300	6503	SO:0001583	missense	10277			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2809C>T	1.37:g.10221342C>T	ENSP00000253251:p.Arg937Trp	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952055	0.73787	0.0	1.16E-4	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.48201	0.82;0.82;0.82	5.39	4.48	0.54585	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.62319	0.2418	L	0.55481	1.735	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.70935	0.971;0.952	T	0.65302	-0.6201	10	0.72032	D	0.01	-20.1455	13.3614	0.60659	0.4077:0.5923:0.0:0.0	.	1066;937	O95155;O95155-2	UBE4B_HUMAN;.	W	937;821;1066	ENSP00000253251:R937W;ENSP00000366362:R821W;ENSP00000343001:R1066W	ENSP00000253251:R937W	R	+	1	2	UBE4B	10143929	0.344000	0.24827	0.999000	0.59377	0.968000	0.65278	0.886000	0.28241	1.266000	0.44231	0.557000	0.71058	CGG		0.542	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1		NM_006048	
SMG1P7	100506060	broad.mit.edu	37	16	70268080	70268081	+	RNA	DNP	TG	TG	CA			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr16:70268080_70268081TG>CA	ENST00000459379.1	-	0	0																											GTCTTACTGTTGGCTAAAAGGC	0.376																																																	0																																												0																														Exception_encountered	16.37:g.70268080_70268081delinsCA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000459379.1	37																																																																																					0.376	snoU13.216-201	NOVEL	basic	snoRNA	snoRNA				
UBBP4	23666	broad.mit.edu	37	17	21731002	21731002	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr17:21731002G>A	ENST00000578713.1	+	1	308	c.304G>A	c.(304-306)Gtg>Atg	p.V102M	UBBP4_ENST00000583708.1_Missense_Mutation_p.M25I|UBBP4_ENST00000584398.1_Missense_Mutation_p.M25I|UBBP4_ENST00000584755.1_Missense_Mutation_p.V102M					ubiquitin B pseudogene 4									p.V102M(3)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CATCGAAAATGTGAAGGCCAA	0.552																																																	3	Substitution - Missense(3)	kidney(3)																																								SO:0001583	missense	0			X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.304G>A	17.37:g.21731002G>A	ENSP00000464265:p.Val102Met	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000578713.1	37																																																																																					0.552	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			
MIR4477B	100616194	broad.mit.edu	37	9	68414462	68414462	+	RNA	SNP	A	A	G	rs149255248		TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr9:68414462A>G	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		ctcattgaccactctgaaaat	0.438																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68414462A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581659.1	37																																																																																					0.438	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
VSNL1	7447	broad.mit.edu;ucsc.edu	37	2	17773470	17773470	+	Silent	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr2:17773470A>G	ENST00000406397.1	+	2	654	c.129A>G	c.(127-129)ctA>ctG	p.L43L	VSNL1_ENST00000295156.4_Silent_p.L43L|VSNL1_ENST00000404666.2_Silent_p.L43L			P62760	VISL1_HUMAN	visinin-like 1	43	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)		calcium ion binding (GO:0005509)	p.L43L(1)		NS(1)|breast(1)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTGGGAGGCTAAATCTCGAGG	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											174.0	165.0	168.0					2																	17773470		2203	4300	6503	SO:0001819	synonymous_variant	7447				CCDS1689.1	2p24.3	2013-01-10			ENSG00000163032	ENSG00000163032		"""EF-hand domain containing"""	12722	protein-coding gene	gene with protein product	"""hippocalcin-like protein 3"""	600817				8530085, 2202488	Standard	NM_003385		Approved	VILIP, HPCAL3, HUVISL1, HLP3, VILIP-1	uc002rcm.3	P62760	OTTHUMG00000090645	ENST00000406397.1:c.129A>G	2.37:g.17773470A>G		Somatic		WXS	Illumina GAIIx	Phase_I	D6W515|P28677|P29103|P42323|Q9UM20	Silent	SNP	ENST00000406397.1	37	CCDS1689.1																																																																																				0.428	VSNL1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323803.1		NM_003385	
ZC3H7A	29066	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	11845212	11845212	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr16:11845212G>C	ENST00000396516.2	-	22	3074	c.2877C>G	c.(2875-2877)gaC>gaG	p.D959E	ZC3H7A_ENST00000575984.1_Missense_Mutation_p.D155E|ZC3H7A_ENST00000355758.4_Missense_Mutation_p.D959E			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	959						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D959E(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						ATTTTCCAAAGTCATTATCAT	0.333																																																	1	Substitution - Missense(1)	kidney(1)											107.0	96.0	99.0					16																	11845212		2197	4300	6497	SO:0001583	missense	29066			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2877C>G	16.37:g.11845212G>C	ENSP00000379773:p.Asp959Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800547	0.70567	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.14893	2.47;2.47	5.8	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.31638	0.0803	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.03394	-1.1041	10	0.59425	D	0.04	.	13.5188	0.61555	0.0739:0.0:0.9261:0.0	.	959	Q8IWR0	Z3H7A_HUMAN	E	959	ENSP00000347999:D959E;ENSP00000379773:D959E	ENSP00000347999:D959E	D	-	3	2	ZC3H7A	11752713	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.605000	0.61119	1.461000	0.47929	0.655000	0.94253	GAC		0.333	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1		NM_014153	
ZC3H18	124245	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	88690383	88690383	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr16:88690383C>T	ENST00000301011.5	+	11	2011	c.1811C>T	c.(1810-1812)tCg>tTg	p.S604L	ZC3H18_ENST00000452588.2_Missense_Mutation_p.S628L	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	604	Ser-rich.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S604L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TCCTTCTCTTCGTCCCCGTCC	0.652																																					Ovarian(121;375 2276 20373 38669)												1	Substitution - Missense(1)	kidney(1)											92.0	82.0	86.0					16																	88690383		2198	4300	6498	SO:0001583	missense	124245			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1811C>T	16.37:g.88690383C>T	ENSP00000301011:p.Ser604Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	37	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598685	0.66332	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588	T;T	0.39997	1.05;1.05	4.83	4.83	0.62350	.	0.138277	0.49916	D	0.000122	T	0.51719	0.1691	L	0.54323	1.7	0.51482	D	0.999928	D;D	0.61080	0.989;0.989	P;P	0.53035	0.716;0.716	T	0.47824	-0.9087	10	0.33141	T	0.24	-3.342	17.8891	0.88866	0.0:1.0:0.0:0.0	.	628;604	E7ERS3;Q86VM9	.;ZCH18_HUMAN	L	604;572;628	ENSP00000301011:S604L;ENSP00000416951:S628L	ENSP00000289509:S572L	S	+	2	0	ZC3H18	87217884	0.981000	0.34729	0.997000	0.53966	0.710000	0.40934	3.993000	0.56987	2.399000	0.81585	0.655000	0.94253	TCG		0.652	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1		NM_144604	
ZDHHC6	64429	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	114201991	114201991	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr10:114201991A>G	ENST00000369405.3	-	4	901	c.478T>C	c.(478-480)Ttc>Ctc	p.F160L	ZDHHC6_ENST00000369404.3_Missense_Mutation_p.F156L	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	160					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.F160L(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		ACAAAAATGAAAGCAGCATGG	0.373																																																	1	Substitution - Missense(1)	kidney(1)											120.0	108.0	112.0					10																	114201991		2203	4300	6503	SO:0001583	missense	64429			AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.478T>C	10.37:g.114201991A>G	ENSP00000358413:p.Phe160Leu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRB6|Q53G45|Q96IV7|Q9H605	Missense_Mutation	SNP	ENST00000369405.3	37	CCDS7574.1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.127714	0.37533	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	T;T	0.20881	2.04;2.04	4.99	4.99	0.66335	.	0.183814	0.48286	D	0.000199	T	0.09598	0.0236	N	0.02708	-0.52	0.37607	D	0.920794	B;B	0.09022	0.002;0.002	B;B	0.14578	0.002;0.011	T	0.21314	-1.0249	10	0.14252	T	0.57	-1.7891	14.9655	0.71188	1.0:0.0:0.0:0.0	.	156;160	Q9H6R6-2;Q9H6R6	.;ZDHC6_HUMAN	L	160;156	ENSP00000358413:F160L;ENSP00000358412:F156L	ENSP00000358412:F156L	F	-	1	0	ZDHHC6	114191981	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.014000	0.40951	2.002000	0.58637	0.377000	0.23210	TTC		0.373	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050393.1		NM_022494	
ZNF112	7771	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44833539	44833539	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr19:44833539A>T	ENST00000337401.4	-	5	877	c.789T>A	c.(787-789)taT>taA	p.Y263*	ZNF112_ENST00000354340.4_Nonsense_Mutation_p.Y257*|ZNF112_ENST00000536500.1_Nonsense_Mutation_p.Y280*	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y257*(1)|p.Y263*(1)									AGGCTTTTCTATACCCAGTAC	0.433																																																	2	Substitution - Nonsense(2)	kidney(2)											103.0	102.0	102.0					19																	44833539		2203	4300	6503	SO:0001587	stop_gained	7771			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.789T>A	19.37:g.44833539A>T	ENSP00000337081:p.Tyr263*	Somatic		WXS	Illumina HiSeq	Phase_I	A4FU53|Q9HCA7	Nonsense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	A	34	5.406805	0.96051	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	.	.	.	5.38	0.457	0.16661	.	0.274634	0.19609	N	0.110199	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-1.535	4.5255	0.11980	0.4795:0.1666:0.3539:0.0	.	.	.	.	X	263;263;257;280;262	.	ENSP00000253426:Y262X	Y	-	3	2	ZNF285	49525379	.	.	0.000000	0.03702	0.598000	0.36846	.	.	0.176000	0.19873	0.459000	0.35465	TAT		0.433	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1		NM_013380	
ZMYM1	79830	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	35578915	35578915	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:35578915T>A	ENST00000373330.1	+	11	1658	c.1484T>A	c.(1483-1485)tTt>tAt	p.F495Y	ZMYM1_ENST00000359858.4_Missense_Mutation_p.F495Y|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	495						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.F495Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGAGAGTCATTTGCAACCCAC	0.353																																																	1	Substitution - Missense(1)	kidney(1)											55.0	56.0	55.0					1																	35578915		1803	4073	5876	SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1484T>A	1.37:g.35578915T>A	ENSP00000362427:p.Phe495Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	T	10.41	1.342517	0.24339	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.26223	2.01;1.75;2.01	4.7	-0.707	0.11245	Zinc finger, TTF-type (1);	1.062970	0.07325	N	0.878299	T	0.28896	0.0717	M	0.78049	2.395	0.09310	N	1	B;B	0.18461	0.016;0.028	B;B	0.18263	0.021;0.021	T	0.36065	-0.9763	9	.	.	.	-1.1639	7.5826	0.27974	0.1339:0.0:0.4158:0.4503	.	476;495	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	Y	495;420;495	ENSP00000352920:F495Y;ENSP00000362426:F420Y;ENSP00000362427:F495Y	.	F	+	2	0	ZMYM1	35351502	0.163000	0.22920	0.001000	0.08648	0.201000	0.24016	0.157000	0.16402	-0.106000	0.12110	0.482000	0.46254	TTT		0.353	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1		NM_024772	
ZNF570	148268	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	37975663	37975663	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr19:37975663A>G	ENST00000330173.1	+	5	1668	c.1139A>G	c.(1138-1140)cAt>cGt	p.H380R	ZNF570_ENST00000586475.1_Missense_Mutation_p.H436R|ZNF570_ENST00000388801.3_Missense_Mutation_p.H177R	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H380R(1)		endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGAGAATACATACTGGAGAG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											81.0	79.0	79.0					19																	37975663		2203	4300	6503	SO:0001583	missense	148268			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1139A>G	19.37:g.37975663A>G	ENSP00000331540:p.His380Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A1L472|B4DMP1	Missense_Mutation	SNP	ENST00000330173.1	37	CCDS12504.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.009715	0.54361	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.67523	-0.27;-0.27	4.17	4.17	0.49024	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39544	N	0.001322	D	0.82646	0.5082	M	0.87971	2.92	0.42463	D	0.992796	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86127	0.1572	10	0.87932	D	0	.	12.6097	0.56544	1.0:0.0:0.0:0.0	.	177;380	B4DMP1;Q96NI8	.;ZN570_HUMAN	R	380;177	ENSP00000331540:H380R;ENSP00000373453:H177R	ENSP00000331540:H380R	H	+	2	0	ZNF570	42667503	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.820000	0.75267	1.874000	0.54306	0.455000	0.32223	CAT		0.423	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1		NM_144694	
ZNF684	127396	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	41012841	41012841	+	Silent	SNP	T	T	C			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:41012841T>C	ENST00000372699.3	+	5	1097	c.846T>C	c.(844-846)taT>taC	p.Y282Y	ZNF684_ENST00000493756.1_3'UTR	NM_152373.3	NP_689586.3	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y282Y(1)		breast(2)|endometrium(2)|kidney(2)|lung(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			CCTTCAGGTATAGTTCATCCC	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											78.0	82.0	81.0					1																	41012841		2203	4300	6503	SO:0001819	synonymous_variant	127396				CCDS454.1	1p34.2	2013-01-08			ENSG00000117010	ENSG00000117010		"""Zinc fingers, C2H2-type"", ""-"""	28418	protein-coding gene	gene with protein product	"""hypothetical protein MGC27466"""					12477932	Standard	NM_152373		Approved	MGC27466	uc001cft.2	Q5T5D7	OTTHUMG00000007359	ENST00000372699.3:c.846T>C	1.37:g.41012841T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKY4	Silent	SNP	ENST00000372699.3	37	CCDS454.1																																																																																				0.383	ZNF684-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019260.3		NM_152373	
ZNF804B	219578	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	88965798	88965798	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr7:88965798C>T	ENST00000333190.4	+	4	4111	c.3502C>T	c.(3502-3504)Cat>Tat	p.H1168Y		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1168							metal ion binding (GO:0046872)	p.H1168Y(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGCCCAGCAGCATATGCAGAA	0.453										HNSCC(36;0.09)																																							1	Substitution - Missense(1)	kidney(1)											69.0	64.0	65.0					7																	88965798		2203	4300	6503	SO:0001583	missense	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3502C>T	7.37:g.88965798C>T	ENSP00000329638:p.His1168Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410688	0.83340	.	.	ENSG00000182348	ENST00000333190	T	0.15487	2.42	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000004	T	0.44953	0.1318	M	0.76328	2.33	0.48511	D	0.999664	D	0.89917	1.0	D	0.85130	0.997	T	0.42241	-0.9463	10	0.87932	D	0	-16.0061	18.8132	0.92065	0.0:1.0:0.0:0.0	.	1168	A4D1E1	Z804B_HUMAN	Y	1168	ENSP00000329638:H1168Y	ENSP00000329638:H1168Y	H	+	1	0	ZNF804B	88803734	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.246000	0.78247	2.736000	0.93811	0.655000	0.94253	CAT		0.453	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2		NM_181646	
ZSCAN20	7579	broad.mit.edu;ucsc.edu	37	1	33960693	33960693	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:33960693A>G	ENST00000361328.3	+	8	2902	c.2749A>G	c.(2749-2751)Acc>Gcc	p.T917A		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	917					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T917A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TAAGAGCTCCACCCTGGCCAA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											71.0	83.0	79.0					1																	33960693		2135	4263	6398	SO:0001583	missense	7579			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2749A>G	1.37:g.33960693A>G	ENSP00000355053:p.Thr917Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	A	5.841	0.339320	0.11069	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.66	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.194964	0.36338	N	0.002642	T	0.21509	0.0518	N	0.13235	0.315	0.09310	N	1	B;B	0.29270	0.053;0.24	B;B	0.39771	0.022;0.309	T	0.37361	-0.9709	9	0.06891	T	0.86	-4.1411	5.9744	0.19371	0.7495:0.1675:0.083:0.0	.	916;917	P17040-3;P17040	.;ZSC20_HUMAN	A	917;851;851	.	ENSP00000324450:T917A	T	+	1	0	ZSCAN20	33733280	0.000000	0.05858	0.995000	0.50966	0.998000	0.95712	0.228000	0.17814	0.946000	0.37632	0.533000	0.62120	ACC		0.512	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2		NM_145238	
HMCN1	83872	broad.mit.edu	37	1	185964002	185964002	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3387-01A-01D-1534-10	TCGA-A3-3387-11A-01D-1534-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	e9e149ff-79e0-48f9-9262-1fbbad865e77	e6bb2386-fa1d-4b73-b853-ce904e1fd667	g.chr1:185964002A>T	ENST00000271588.4	+	24	3790	c.3561A>T	c.(3559-3561)agA>agT	p.R1187S	HMCN1_ENST00000367492.2_Missense_Mutation_p.R1187S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1187	Ig-like C2-type 9.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R1187S(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTGGTCAAAGAGTGGATATTC	0.418																																						.											1	Substitution - Missense(1)	kidney(1)											134.0	127.0	129.0					1																	185964002		2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3561A>T	1.37:g.185964002A>T	ENSP00000271588:p.Arg1187Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.529694	0.27387	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.63255	-0.03;-0.03	5.35	4.2	0.49525	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.390469	0.32372	N	0.006195	T	0.53334	0.1790	N	0.11818	0.18	0.30119	N	0.805854	D	0.64830	0.994	D	0.67382	0.951	T	0.50825	-0.8782	10	0.06365	T	0.9	.	7.8755	0.29590	0.7196:0.1434:0.0:0.137	.	1187	Q96RW7	HMCN1_HUMAN	S	1187	ENSP00000271588:R1187S;ENSP00000356462:R1187S	ENSP00000271588:R1187S	R	+	3	2	HMCN1	184230625	0.965000	0.33210	0.998000	0.56505	0.980000	0.70556	0.475000	0.22164	0.924000	0.37069	0.528000	0.53228	AGA		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
