#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ALPPL2	251	hgsc.bcm.edu	37	2	233271669	233271669	+	Missense_Mutation	SNP	C	C	T	rs16836187|rs139018608	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:233271669C>T	ENST00000295453.3	+	1	117	c.65C>T	c.(64-66)cCa>cTa	p.P22L		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	22					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	GGCATCATCCCAGGTAATGAG	0.647																																																	0													72.0	75.0	74.0					2																	233271669		2203	4300	6503	SO:0001583	missense	251			J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.65C>T	2.37:g.233271669C>T	ENSP00000295453:p.Pro22Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679525	0.47886	.	.	ENSG00000163286	ENST00000295453	D	0.83673	-1.75	2.19	2.19	0.27852	Alkaline-phosphatase-like, core domain (1);	0.185016	0.47093	D	0.000260	T	0.81187	0.4770	M	0.87097	2.86	0.58432	D	0.999995	P	0.44139	0.827	B	0.37304	0.246	T	0.82715	-0.0320	10	0.66056	D	0.02	.	7.8156	0.29258	0.2487:0.7513:0.0:0.0	rs16836187	22	P10696	PPBN_HUMAN	L	22	ENSP00000295453:P22L	ENSP00000295453:P22L	P	+	2	0	ALPPL2	232979913	0.080000	0.21391	0.999000	0.59377	0.074000	0.17049	0.145000	0.16157	1.528000	0.49103	0.205000	0.17691	CCA		0.647	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2		NM_031313	
ANGPT1	284	broad.mit.edu;hgsc.bcm.edu	37	8	108348486	108348486	+	5'UTR	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr8:108348486G>T	ENST00000520734.1	-	0	152				ANGPT1_ENST00000520052.1_5'UTR			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.T156N(1)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			AAGTCGAGAAGTTTGATTTAG	0.308																																																	1	Substitution - Missense(1)	kidney(1)											72.0	68.0	69.0					8																	108348486		2202	4300	6502	SO:0001623	5_prime_UTR_variant	284			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.-134C>A	8.37:g.108348486G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37		.	.	.	.	.	.	.	.	.	.	G	31	5.067473	0.93898	.	.	ENSG00000154188	ENST00000517746;ENST00000297450	T;T	0.42900	0.96;0.96	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.61257	-0.7099	10	0.27082	T	0.32	.	19.5096	0.95135	0.0:0.0:1.0:0.0	.	156;156	Q5HYA0;Q15389	.;ANGP1_HUMAN	N	156	ENSP00000428340:T156N;ENSP00000297450:T156N	ENSP00000297450:T156N	T	-	2	0	ANGPT1	108417662	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	9.609000	0.98334	2.709000	0.92574	0.655000	0.94253	ACT		0.308	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2		NM_001146, NM_139290	
AOX1	316	broad.mit.edu;ucsc.edu	37	2	201533423	201533423	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:201533423G>T	ENST00000374700.2	+	33	3936	c.3695G>T	c.(3694-3696)gGt>gTt	p.G1232V	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1232					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.G1232V(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CACACTCGTGGTCCAGACCAA	0.428																																																	1	Substitution - Missense(1)	kidney(1)											158.0	153.0	154.0					2																	201533423		2203	4300	6503	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3695G>T	2.37:g.201533423G>T	ENSP00000363832:p.Gly1232Val	Somatic		WXS	Illumina GAIIx	Phase_I	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539233	0.85917	.	.	ENSG00000138356	ENST00000374700;ENST00000260930;ENST00000439380	T;T;T	0.46451	0.87;0.87;1.07	5.1	5.1	0.69264	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.051183	0.85682	D	0.000000	T	0.77232	0.4100	H	0.97023	3.925	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.85382	0.1120	10	0.87932	D	0	-28.347	18.7004	0.91618	0.0:0.0:1.0:0.0	.	1232	Q06278	ADO_HUMAN	V	1232;96;72	ENSP00000363832:G1232V;ENSP00000260930:G96V;ENSP00000413326:G72V	ENSP00000260930:G96V	G	+	2	0	AOX1	201241668	1.000000	0.71417	0.975000	0.42487	0.922000	0.55478	9.122000	0.94380	2.664000	0.90586	0.563000	0.77884	GGT		0.428	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1		NM_001159	
ATAD3C	219293	hgsc.bcm.edu	37	1	1391612	1391612	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr1:1391612delC	ENST00000378785.2	+	7	1567	c.572delC	c.(571-573)gccfs	p.A191fs		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	191							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CAGAAACTCGCCCTGCACTCA	0.627																																																	0													4.0	17.0	15.0					1																	1391612		374	1409	1783	SO:0001589	frameshift_variant	219293			AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.572delC	1.37:g.1391612delC	ENSP00000368062:p.Ala191fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N1Z5	Frame_Shift_Del	DEL	ENST00000378785.2	37	CCDS44039.1																																																																																				0.627	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001279.3		NM_001039211	
ASH1L	55870	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	155449218	155449218	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr1:155449218G>A	ENST00000368346.3	-	3	4082	c.3443C>T	c.(3442-3444)aCt>aTt	p.T1148I	ASH1L_ENST00000392403.3_Missense_Mutation_p.T1148I			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1148					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.T1148I(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CATTGCAAGAGTCTGAATCAT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											81.0	76.0	78.0					1																	155449218		2203	4300	6503	SO:0001583	missense	55870			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3443C>T	1.37:g.155449218G>A	ENSP00000357330:p.Thr1148Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	G	15.24	2.774526	0.49786	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90504	-2.68;-2.68	5.2	5.2	0.72013	.	0.063358	0.64402	D	0.000009	D	0.91496	0.7315	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.987;0.994	D	0.92698	0.6172	10	0.87932	D	0	.	18.5192	0.90945	0.0:0.0:1.0:0.0	.	1148;1148	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	I	1148	ENSP00000357330:T1148I;ENSP00000376204:T1148I	ENSP00000357330:T1148I	T	-	2	0	ASH1L	153715842	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.021000	0.76425	2.705000	0.92388	0.591000	0.81541	ACT		0.463	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1		NM_018489	
ATXN2	6311	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	111923629	111923629	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:111923629G>A	ENST00000377617.3	-	17	2986	c.2825C>T	c.(2824-2826)gCa>gTa	p.A942V	AC002395.1_ENST00000581907.1_RNA|ATXN2_ENST00000608853.1_Missense_Mutation_p.A782V|ATXN2_ENST00000542287.2_Missense_Mutation_p.A677V|ATXN2_ENST00000535949.1_Missense_Mutation_p.A653V|ATXN2_ENST00000550104.1_Missense_Mutation_p.A942V|ATXN2_ENST00000389153.4_Missense_Mutation_p.A677V	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	942	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.A942V(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						GCTAGGTTGTGCTTGAGGCCG	0.418																																																	1	Substitution - Missense(1)	kidney(1)											157.0	145.0	149.0					12																	111923629		2203	4300	6503	SO:0001583	missense	6311			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.2825C>T	12.37:g.111923629G>A	ENSP00000366843:p.Ala942Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	37	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.151166	0.78001	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949	T;T	0.66815	-0.2;-0.23	5.71	5.71	0.89125	.	0.154140	0.64402	D	0.000016	T	0.50171	0.1600	N	0.08118	0	0.44643	D	0.997622	P;B;P;P	0.52463	0.953;0.267;0.673;0.617	B;B;B;B	0.42462	0.388;0.06;0.327;0.178	T	0.51156	-0.8741	10	0.20519	T	0.43	-10.75	19.8673	0.96808	0.0:0.0:1.0:0.0	.	942;653;677;677	Q99700;Q24JQ7;F8VQP2;F8WB06	ATX2_HUMAN;.;.;.	V	677;942;942;677;653	ENSP00000366843:A942V;ENSP00000446576:A942V	ENSP00000366843:A942V	A	-	2	0	ATXN2	110408012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.246000	0.65411	2.709000	0.92574	0.655000	0.94253	GCA		0.418	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3		NM_002973	
B4GALT5	9334	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	48273175	48273175	+	Silent	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr20:48273175G>A	ENST00000371711.4	-	2	367	c.180C>T	c.(178-180)atC>atT	p.I60I		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	60					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)	p.I60I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CCTGAGCACCGATTGTTCTCA	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											137.0	125.0	129.0					20																	48273175		2203	4300	6503	SO:0001819	synonymous_variant	9334			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.180C>T	20.37:g.48273175G>A		Somatic		WXS	Illumina HiSeq	Phase_I	E1P625|Q2M394|Q9UJQ8	Silent	SNP	ENST00000371711.4	37	CCDS13420.1																																																																																				0.458	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3		NM_004776	
C14orf177	283598	hgsc.bcm.edu	37	14	99182527	99182535	+	Start_Codon_Del	DEL	GGATGCATC	GGATGCATC	-	rs17097718|rs373583218|rs139827156	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	GGATGCATC	GGATGCATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr14:99182527_99182535delGGATGCATC	ENST00000325812.2	+	0	418_426					NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177											endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				CAGTACGACTGGATGCATCGGAAAGAGCC	0.569														134	0.0267572	0.0356	0.0245	5008	,	,		21205	0.004		0.0567	False		,,,				2504	0.0092																0										127,4135		2,123,2006						1.8	0.0		dbSNP_134	53	465,7787		31,403,3692	no	coding	C14orf177	NM_182560.2		33,526,5698	A1A1,A1R,RR		5.635,2.9798,4.7307				592,11922				SO:0001582	initiator_codon_variant	283598			AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745		14.37:g.99182527_99182535delGGATGCATC		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N7D2	Frame_Shift_Del	DEL	ENST00000325812.2	37	CCDS9948.1																																																																																				0.569	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396078.1		NM_182560	
DNAAF3	352909	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	55670934	55670934	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr19:55670934G>T	ENST00000524407.2	-	11	1238	c.1205C>A	c.(1204-1206)gCa>gAa	p.A402E	TNNI3_ENST00000590463.1_5'Flank|DNAAF3_ENST00000391720.4_Missense_Mutation_p.A449E|CTD-2587H24.5_ENST00000591665.1_RNA|CTD-2587H24.4_ENST00000587871.1_Silent_p.G63G|DNAAF3_ENST00000455045.1_Missense_Mutation_p.A348E|DNAAF3_ENST00000587789.2_5'UTR|TNNI3_ENST00000588882.1_5'Flank|TNNI3_ENST00000344887.5_5'Flank|DNAAF3_ENST00000527223.2_Missense_Mutation_p.A469E			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	402					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)		p.A449E(1)									CCCTCCGGGTGCCACACAGGC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											102.0	110.0	107.0					19																	55670934		2027	4187	6214	SO:0001583	missense	0			AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.1205C>A	19.37:g.55670934G>T	ENSP00000432046:p.Ala402Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831170	0.71258	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720;ENST00000530077	T;T	0.18016	2.24;2.24	4.21	3.15	0.36227	.	0.130082	0.49916	D	0.000124	T	0.34366	0.0895	M	0.64404	1.975	0.37253	D	0.906636	D;D;D;D	0.76494	0.989;0.996;0.965;0.999	P;D;P;D	0.70016	0.848;0.944;0.719;0.967	T	0.24154	-1.0168	10	0.36615	T	0.2	-19.6496	11.7241	0.51700	0.0:0.0:0.8213:0.1786	.	469;348;422;402	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	E	469;348;449;97	ENSP00000394343:A348E;ENSP00000375600:A449E	ENSP00000301249:A469E	A	-	2	0	C19orf51	60362746	1.000000	0.71417	0.997000	0.53966	0.670000	0.39368	0.769000	0.26604	1.073000	0.40885	0.485000	0.47835	GCA		0.592	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5		NM_178837	
KANSL1L	151050	broad.mit.edu;ucsc.edu	37	2	210889826	210889826	+	Splice_Site	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:210889826G>A	ENST00000281772.9	-	13	2828		c.e13+1		KANSL1L_ENST00000418791.1_Splice_Site	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like							histone acetyltransferase complex (GO:0000123)		p.?(1)									TTTGTAACCTGCCTGCTGTTT	0.423																																																	1	Unknown(1)	kidney(1)											122.0	116.0	118.0					2																	210889826		2203	4300	6503	SO:0001630	splice_region_variant	0			AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2564+1C>T	2.37:g.210889826G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Splice_Site	SNP	ENST00000281772.9	37	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160999	0.57368	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	.	.	.	5.3	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8509	0.57856	0.0814:0.0:0.9186:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C2orf67	210598071	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	1.705000	0.37867	2.636000	0.89361	0.591000	0.81541	.		0.423	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3		NM_152519	Intron
CDH12	1010	broad.mit.edu;ucsc.edu	37	5	21760751	21760751	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr5:21760751G>T	ENST00000382254.1	-	13	2635	c.1549C>A	c.(1549-1551)Ctt>Att	p.L517I	CDH12_ENST00000522262.1_Missense_Mutation_p.L477I|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000504376.2_Missense_Mutation_p.L517I|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	517	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L517I(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GCAGGTGAAAGATCTCGGTCT	0.413										HNSCC(59;0.17)																																							1	Substitution - Missense(1)	kidney(1)											129.0	135.0	133.0					5																	21760751		2203	4300	6503	SO:0001583	missense	1010			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1549C>A	5.37:g.21760751G>T	ENSP00000371689:p.Leu517Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663690	0.47572	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.60171	0.21;0.21;0.21	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.200467	0.43919	D	0.000518	T	0.43897	0.1268	L	0.40543	1.245	0.39314	D	0.965128	B;P	0.34462	0.072;0.454	B;B	0.32090	0.14;0.123	T	0.52335	-0.8589	10	0.87932	D	0	.	5.5624	0.17152	0.1202:0.0:0.6865:0.1934	.	477;517	B7Z2U6;P55289	.;CAD12_HUMAN	I	517;517;477	ENSP00000423577:L517I;ENSP00000371689:L517I;ENSP00000428786:L477I	ENSP00000371689:L517I	L	-	1	0	CDH12	21796508	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.484000	0.35508	2.573000	0.86826	0.650000	0.86243	CTT		0.413	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1		NM_004061	
CELSR1	9620	hgsc.bcm.edu	37	22	46759085	46759111	+	Splice_Site	DEL	CTGATGGTTCAAATTGAAGTTTCATTA	CTGATGGTTCAAATTGAAGTTTCATTA	-	rs114738587|rs576512903|rs369149647|rs372842484	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	CTGATGGTTCAAATTGAAGTTTCATTA	CTGATGGTTCAAATTGAAGTTTCATTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr22:46759085_46759111delCTGATGGTTCAAATTGAAGTTTCATTA	ENST00000262738.3	-	35	9035		c.e35-1			NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1						anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.?(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TCACGGTTTCCTGATGGTTCAAATTGAAGTTTCATTACTGATGGTTC	0.564														320	0.0638978	0.2322	0.0173	5008	,	,		23591	0.0		0.001	False		,,,				2504	0.0																1	Unknown(1)	lung(1)								509,3749		100,309,1720						5.0	1.0			151	2,8250		0,2,4124	no	splice-3	CELSR1	NM_014246.1		100,311,5844	A1A1,A1R,RR		0.0242,11.954,4.0847				511,11999				SO:0001630	splice_region_variant	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.9036-1TAATGAAACTTCAATTTGAACCATCAG>-	22.37:g.46759085_46759111delCTGATGGTTCAAATTGAAGTTTCATTA		Somatic		WXS	Illumina HiSeq	Phase_I	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Frame_Shift_Del	DEL	ENST00000262738.3	37	CCDS14076.1																																																																																				0.564	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1		NM_014246	Intron
CHST15	51363	hgsc.bcm.edu	37	10	125780765	125780765	+	Intron	DEL	T	T	-			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr10:125780765delT	ENST00000346248.5	-	6	1990				CHST15_ENST00000421115.1_Frame_Shift_Del_p.T452fs|CHST15_ENST00000435907.1_Intron	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15						carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						GGGGGGGGGGTACACACAGGC	0.542																																																	0													30.0	28.0	28.0					10																	125780765		2203	4299	6502	SO:0001627	intron_variant	51363			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1347+6A>-	10.37:g.125780765delT		Somatic		WXS	Illumina HiSeq	Phase_I	O60338|O60474|Q86VM4	Frame_Shift_Del	DEL	ENST00000346248.5	37	CCDS7638.1																																																																																				0.542	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1		NM_015892	
CLRN1	7401	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	150659493	150659493	+	Silent	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr3:150659493G>T	ENST00000327047.1	-	2	599	c.309C>A	c.(307-309)ctC>ctA	p.L103L	RP11-166N6.2_ENST00000469268.1_RNA|RP11-166N6.3_ENST00000569170.1_Missense_Mutation_p.S13Y|CLRN1_ENST00000328863.4_Silent_p.L103L|CLRN1_ENST00000295911.2_Silent_p.L27L|CLRN1-AS1_ENST00000476886.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1	103					actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)		p.L103L(1)|p.L27L(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGGCAGAGAAGAGAATGACAT	0.428																																																	2	Substitution - coding silent(2)	kidney(2)											128.0	115.0	119.0					3																	150659493		2203	4300	6503	SO:0001819	synonymous_variant	7401			AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.309C>A	3.37:g.150659493G>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DNJ3|E1ACU9|Q8N6A9	Silent	SNP	ENST00000327047.1	37	CCDS3153.1																																																																																				0.428	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277060.1			
CUEDC2	79004	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	104184284	104184284	+	Silent	SNP	T	T	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr10:104184284T>A	ENST00000369937.4	-	4	397	c.252A>T	c.(250-252)tcA>tcT	p.S84S	PSD_ENST00000492902.2_5'Flank|CUEDC2_ENST00000465409.1_5'Flank	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2	84						cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.S84S(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCAGCTGCCCTGAGAGCTTCT	0.582																																																	1	Substitution - coding silent(1)	kidney(1)											131.0	139.0	136.0					10																	104184284		2059	4209	6268	SO:0001819	synonymous_variant	79004			BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.252A>T	10.37:g.104184284T>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DR88|Q9BWG8	Silent	SNP	ENST00000369937.4	37	CCDS41566.1																																																																																				0.582	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050060.1		NM_024040	
ELTD1	64123	broad.mit.edu;ucsc.edu	37	1	79387470	79387470	+	Splice_Site	SNP	A	A	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr1:79387470A>C	ENST00000370742.3	-	9	1148	c.1085T>G	c.(1084-1086)gTc>gGc	p.V362G		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	362					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.V362G(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CCTATCTGTGACCTGAAAAAA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											80.0	74.0	76.0					1																	79387470		1882	4105	5987	SO:0001630	splice_region_variant	64123			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1084-1T>G	1.37:g.79387470A>C		Somatic		WXS	Illumina GAIIx	Phase_I	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	A	0.552	-0.849036	0.02651	.	.	ENSG00000162618	ENST00000370742	T	0.36157	1.27	5.46	-2.36	0.06663	.	0.633699	0.17850	N	0.159882	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.17098	0.017	T	0.40794	-0.9544	9	.	.	.	.	10.6771	0.45792	0.5696:0.0:0.4304:0.0	.	362	Q9HBW9	ELTD1_HUMAN	G	362	ENSP00000359778:V362G	.	V	-	2	0	ELTD1	79160058	0.492000	0.26027	0.054000	0.19295	0.004000	0.04260	0.612000	0.24283	-0.600000	0.05790	-1.055000	0.02315	GTC		0.343	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1		NM_022159	Missense_Mutation
FAH	2184	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	80452758	80452758	+	Silent	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr15:80452758C>T	ENST00000407106.1	+	5	476	c.321C>T	c.(319-321)ttC>ttT	p.F107F	FAH_ENST00000539156.1_Silent_p.F37F|FAH_ENST00000261755.5_Silent_p.F107F|FAH_ENST00000561421.1_Silent_p.F107F|FAH_ENST00000558627.1_3'UTR			P16930	FAAA_HUMAN	fumarylacetoacetate hydrolase (fumarylacetoacetase)	107					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	fumarylacetoacetase activity (GO:0004334)|metal ion binding (GO:0046872)	p.F107F(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCAGTGCATTCATCTCCCAGG	0.567									Tyrosinemia, type 1																																								1	Substitution - coding silent(1)	kidney(1)											123.0	103.0	110.0					15																	80452758		2203	4300	6503	SO:0001819	synonymous_variant	2184	Familial Cancer Database	Fumarylacetoacetase Deficiency, Hepatorenal Tyrosinemia, Hereditary Tyrosinemia 1, HT1	M55150	CCDS10314.1	15q25.1	2012-08-30			ENSG00000103876	ENSG00000103876	3.7.1.2		3579	protein-coding gene	gene with protein product		613871				1998338, 2336361	Standard	NM_000137		Approved		uc002bfm.2	P16930	OTTHUMG00000144187	ENST00000407106.1:c.321C>T	15.37:g.80452758C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9X1|D3DW95|Q53XA7	Silent	SNP	ENST00000407106.1	37	CCDS10314.1																																																																																				0.567	FAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291392.2			
PIEZO1	9780	broad.mit.edu	37	16	88787608	88787610	+	In_Frame_Del	DEL	CTT	CTT	-	rs3217718|rs150376294|rs113773794	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr16:88787608_88787610delCTT	ENST00000301015.9	-	39	5878_5880	c.5632_5634delAAG	c.(5632-5634)aagdel	p.K1878del	RP5-1142A6.9_ENST00000564984.1_RNA|PIEZO1_ENST00000327397.7_5'Flank	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1878					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.K1878delK(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CTGGGCCCTCCTTCTTCCTTCTT	0.616														1081	0.215855	0.1452	0.2003	5008	,	,		19820	0.0774		0.334	False		,,,				2504	0.3436																1	Deletion - In frame(1)	breast(1)								433,2117		88,257,930						3.8	0.1		dbSNP_131	32	1667,3279		392,883,1198	no	coding	PIEZO1	NM_001142864.2		480,1140,2128	A1A1,A1R,RR		33.704,16.9804,28.0149				2100,5396				SO:0001651	inframe_deletion	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.5632_5634delAAG	16.37:g.88787611_88787613delCTT	ENSP00000301015:p.Lys1878del	Somatic		WXS	Illumina GAIIx	Phase_I	A6NHT9|A7E2B7|Q0KKZ9	In_Frame_Del	DEL	ENST00000301015.9	37	CCDS54058.1																																																																																				0.616	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4		NM_014745	
FAT3	120114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	92088147	92088147	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr11:92088147T>C	ENST00000298047.6	+	1	2886	c.2869T>C	c.(2869-2871)Tgg>Cgg	p.W957R	FAT3_ENST00000409404.2_Missense_Mutation_p.W957R|FAT3_ENST00000541502.1_Missense_Mutation_p.W957R|FAT3_ENST00000525166.1_Missense_Mutation_p.W807R			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	957	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.W957R(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTCATTGCTTGGCTTGAGAC	0.438										TCGA Ovarian(4;0.039)																																							2	Substitution - Missense(2)	kidney(2)											94.0	91.0	92.0					11																	92088147		1887	4132	6019	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2869T>C	11.37:g.92088147T>C	ENSP00000298047:p.Trp957Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	16.72	3.200140	0.58126	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.82	5.82	0.92795	.	.	.	.	.	T	0.29588	0.0738	N	0.00459	-1.475	0.50813	D	0.999892	D	0.89917	1.0	D	0.91635	0.999	T	0.56402	-0.7985	9	0.15066	T	0.55	.	15.3625	0.74492	0.0:0.0:0.0:1.0	.	957	Q8TDW7-3	.	R	957;957;957;807	ENSP00000298047:W957R;ENSP00000387040:W957R;ENSP00000443786:W957R;ENSP00000432586:W807R	ENSP00000298047:W957R	W	+	1	0	FAT3	91727795	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.975000	0.88055	2.234000	0.73211	0.533000	0.62120	TGG		0.438	FAT3-201	KNOWN	basic	protein_coding	protein_coding			NM_001008781	
FLJ33360	401172	broad.mit.edu;hgsc.bcm.edu	37	5	6312489	6312489	+	lincRNA	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr5:6312489C>T	ENST00000507444.1	-	0	483					NR_028351.1																						TGGGTCAGCTCAGAAGAGCAG	0.612																																																	0													20.0	22.0	21.0					5																	6312489		1975	4163	6138			401172																															5.37:g.6312489C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000507444.1	37																																																																																					0.612	CTD-2324F15.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000365707.1			
FNIP2	57600	broad.mit.edu;ucsc.edu	37	4	159789371	159789371	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr4:159789371C>A	ENST00000264433.6	+	13	1658	c.1583C>A	c.(1582-1584)tCt>tAt	p.S528Y	FNIP2_ENST00000379346.3_Missense_Mutation_p.S551Y	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	528					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S528Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CTCCGTTGCTCTGAGCTACAA	0.488																																																	1	Substitution - Missense(1)	kidney(1)											98.0	100.0	99.0					4																	159789371		2051	4207	6258	SO:0001583	missense	57600			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.1583C>A	4.37:g.159789371C>A	ENSP00000264433:p.Ser528Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048120	0.93740	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346	T;T;T	0.34472	1.36;1.36;1.36	5.99	5.99	0.97316	.	.	.	.	.	T	0.60483	0.2272	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53078	-0.8489	8	.	.	.	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	528	Q9P278	FNIP2_HUMAN	Y	528;551;551	ENSP00000264433:S528Y;ENSP00000421488:S551Y;ENSP00000368651:S551Y	.	S	+	2	0	FNIP2	160008821	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.724000	0.84798	2.840000	0.97914	0.655000	0.94253	TCT		0.488	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1		NM_020840	
FREM2	341640	broad.mit.edu;ucsc.edu	37	13	39451341	39451341	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr13:39451341A>G	ENST00000280481.7	+	21	8848	c.8632A>G	c.(8632-8634)Atg>Gtg	p.M2878V		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2878					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.M2878V(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGATGGATCCATGGGATTCGG	0.438																																																	1	Substitution - Missense(1)	kidney(1)											357.0	320.0	333.0					13																	39451341		2203	4300	6503	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8632A>G	13.37:g.39451341A>G	ENSP00000280481:p.Met2878Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	16.78	3.218825	0.58560	.	.	ENSG00000150893	ENST00000280481	T	0.63913	-0.07	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.62841	0.2461	M	0.68593	2.085	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.59445	-0.7453	10	0.48119	T	0.1	.	16.3593	0.83251	1.0:0.0:0.0:0.0	.	2878	Q5SZK8	FREM2_HUMAN	V	2878	ENSP00000280481:M2878V	ENSP00000280481:M2878V	M	+	1	0	FREM2	38349341	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.305000	0.72805	2.267000	0.75376	0.383000	0.25322	ATG		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2		NM_207361	
GOLGA6L10	647042	broad.mit.edu	37	15	82635163	82635163	+	Silent	SNP	C	C	G	rs28429808	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr15:82635163C>G	ENST00000439287.4	-	9	1506	c.1407G>C	c.(1405-1407)gcG>gcC	p.A469A		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	469								p.A469A(10)		endometrium(1)|kidney(4)	5						CCCTGTTCTCCGCAGCCCGAA	0.478																																																	10	Substitution - coding silent(10)	kidney(8)|endometrium(2)																																								SO:0001819	synonymous_variant	647042				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.1407G>C	15.37:g.82635163C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000439287.4	37	CCDS45325.1																																																																																				0.478	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419403.2		NM_001164465	
IDH1	3417	broad.mit.edu;ucsc.edu	37	2	209108295	209108295	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:209108295T>G	ENST00000415913.1	-	6	935	c.554A>C	c.(553-555)cAa>cCa	p.Q185P	IDH1_ENST00000345146.2_Missense_Mutation_p.Q185P|IDH1_ENST00000446179.1_Missense_Mutation_p.Q185P	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	185					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.Q185P(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TGACTTATCTTGATTATACAT	0.403			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)			Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	1	Substitution - Missense(1)	kidney(1)											95.0	89.0	91.0					2																	209108295		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.554A>C	2.37:g.209108295T>G	ENSP00000390265:p.Gln185Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015156	0.54468	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	T;T;T	0.76316	-1.01;-1.01;-1.01	5.37	4.07	0.47477	Isopropylmalate dehydrogenase-like domain (2);	0.238024	0.43579	D	0.000541	T	0.50599	0.1625	N	0.01576	-0.805	0.37236	D	0.905882	B	0.29988	0.264	B	0.35039	0.194	T	0.57568	-0.7789	10	0.62326	D	0.03	-15.8597	5.1464	0.14987	0.2825:0.0:0.1268:0.5907	.	185	O75874	IDHC_HUMAN	P	185	ENSP00000260985:Q185P;ENSP00000410513:Q185P;ENSP00000390265:Q185P	ENSP00000260985:Q185P	Q	-	2	0	IDH1	208816540	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.458000	0.53014	2.168000	0.68352	0.397000	0.26171	CAA		0.403	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			
INADL	10207	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	62288675	62288675	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr1:62288675A>G	ENST00000371158.2	+	15	1856	c.1742A>G	c.(1741-1743)cAt>cGt	p.H581R	INADL_ENST00000316485.6_Missense_Mutation_p.H581R	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	581	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.H581R(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GATGGGCACCATTATATTTCT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											233.0	209.0	217.0					1																	62288675		2203	4300	6503	SO:0001583	missense	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1742A>G	1.37:g.62288675A>G	ENSP00000360200:p.His581Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731767	0.69189	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.26810	1.71;1.71	4.99	4.99	0.66335	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000002	T	0.55970	0.1954	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.995	T	0.63368	-0.6653	10	0.54805	T	0.06	.	14.3646	0.66799	1.0:0.0:0.0:0.0	.	581;581;581	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	R	581	ENSP00000360200:H581R;ENSP00000326199:H581R	ENSP00000255202:H581R	H	+	2	0	INADL	62061263	1.000000	0.71417	0.998000	0.56505	0.763000	0.43281	7.890000	0.87313	1.882000	0.54519	0.459000	0.35465	CAT		0.423	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2		NM_170605	
KRT6B	3854	broad.mit.edu;hgsc.bcm.edu	37	12	52842629	52842629	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:52842629C>A	ENST00000252252.3	-	6	1247	c.1200G>T	c.(1198-1200)aaG>aaT	p.K400N		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	400	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.K400N(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		ACCATACCTGCTTCTTGACGT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											150.0	121.0	131.0					12																	52842629		2203	4300	6503	SO:0001583	missense	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1200G>T	12.37:g.52842629C>A	ENSP00000252252:p.Lys400Asn	Somatic		WXS	Illumina HiSeq	Phase_I	P48669	Missense_Mutation	SNP	ENST00000252252.3	37	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.404246	0.25378	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.87809	-2.3	2.75	0.539	0.17156	Filament (1);	0.000000	0.64402	D	0.000006	D	0.87661	0.6233	L	0.48877	1.53	0.40952	D	0.984555	D	0.69078	0.997	D	0.66196	0.942	D	0.84171	0.0434	10	0.49607	T	0.09	.	6.8523	0.24022	0.0:0.4661:0.0:0.5339	.	400	P04259	K2C6B_HUMAN	N	400;360	ENSP00000252252:K400N	ENSP00000252252:K400N	K	-	3	2	KRT6B	51128896	0.429000	0.25530	0.997000	0.53966	0.136000	0.21042	-0.384000	0.07389	0.121000	0.18284	0.305000	0.20034	AAG		0.473	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1		NM_005555	
KRTAP9-4	85280	hgsc.bcm.edu	37	17	39406343	39406343	+	Missense_Mutation	SNP	A	A	G	rs148655704	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr17:39406343A>G	ENST00000334109.2	+	1	405	c.371A>G	c.(370-372)aAc>aGc	p.N124S		NM_033191.2	NP_149461.2	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	124	15 X 5 AA repeats of C-C-[RQVGE]-[SPTN]- [TASPF].					keratin filament (GO:0045095)				breast(1)|large_intestine(1)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGTGGCTCCAACTGCTGCCAG	0.587																																																	0													165.0	164.0	164.0					17																	39406343		2203	4298	6501	SO:0001583	missense	85280			AJ406948	CCDS11386.1	17q21.2	2013-06-25			ENSG00000241595	ENSG00000241595		"""Keratin associated proteins"""	18902	protein-coding gene	gene with protein product						11279113	Standard	NM_033191		Approved	KAP9.4	uc002hwi.3	Q9BYQ2	OTTHUMG00000133438	ENST00000334109.2:c.371A>G	17.37:g.39406343A>G	ENSP00000334922:p.Asn124Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VAE3	Missense_Mutation	SNP	ENST00000334109.2	37	CCDS11386.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.064537	0.00386	.	.	ENSG00000241595	ENST00000334109	T	0.00864	5.6	1.95	-0.382	0.12481	.	.	.	.	.	T	0.00328	0.0010	N	0.00483	-1.445	0.09310	N	1	B	0.22276	0.067	B	0.23275	0.045	T	0.42999	-0.9418	9	0.15066	T	0.55	.	0.925	0.01323	0.1577:0.228:0.3831:0.2312	.	124	Q9BYQ2	KRA94_HUMAN	S	124	ENSP00000334922:N124S	ENSP00000334922:N124S	N	+	2	0	KRTAP9-4	36659869	0.000000	0.05858	0.211000	0.23655	0.006000	0.05464	-1.073000	0.03430	-0.046000	0.13446	-1.355000	0.01225	AAC		0.587	KRTAP9-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257306.1			
LRP1	4035	broad.mit.edu;hgsc.bcm.edu	37	12	57577934	57577934	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:57577934G>A	ENST00000243077.3	+	37	6462	c.5996G>A	c.(5995-5997)cGc>cAc	p.R1999H		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1999					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.R1999H(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGCTCCTTCCGCTACGTGGTG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											67.0	55.0	59.0					12																	57577934		2203	4300	6503	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5996G>A	12.37:g.57577934G>A	ENSP00000243077:p.Arg1999His	Somatic		WXS	Illumina HiSeq	Phase_I	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	36	5.884099	0.97062	.	.	ENSG00000123384	ENST00000243077	D	0.97553	-4.43	4.84	4.84	0.62591	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000002	D	0.98400	0.9468	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98808	1.0742	10	0.52906	T	0.07	.	16.9352	0.86201	0.0:0.0:1.0:0.0	.	1999	Q07954	LRP1_HUMAN	H	1999	ENSP00000243077:R1999H	ENSP00000243077:R1999H	R	+	2	0	LRP1	55864201	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	9.657000	0.98554	2.532000	0.85374	0.555000	0.69702	CGC		0.597	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2		NM_002332	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85638646	85638646	+	Frame_Shift_Del	DEL	A	A	-	rs5799725|rs398102301	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:85638646delA	ENST00000393217.2	+	27	5157	c.5096delA	c.(5095-5097)gaafs	p.E1699fs	LRRIQ1_ENST00000528777.3_3'UTR	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1699										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTGAACAGAGAAAAAAAAAAT	0.388													|||unknown(HR)	991	0.197883	0.0893	0.2522	5008	,	,		15671	0.1776		0.2753	False		,,,				2504	0.2474																0													79.0	61.0	67.0					12																	85638646		1828	4079	5907	SO:0001589	frameshift_variant	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.5096delA	12.37:g.85638646delA	ENSP00000376910:p.Glu1699fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q567P4|Q9BS17|Q9HA36	Frame_Shift_Del	DEL	ENST00000393217.2	37	CCDS41816.1																																																																																				0.388	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2		NM_032165	
MYH7	4625	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	23887232	23887232	+	Intron	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr14:23887232G>T	ENST00000355349.3	-	30	4332				CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCTTATATTCGGATCAGAAAC	0.552																																																	0													71.0	70.0	70.0					14																	23887232		1568	3582	5150	SO:0001627	intron_variant	100126336			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4169+186C>A	14.37:g.23887232G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	RNA	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																				0.552	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3		NM_000257	
MSLNL	401827	hgsc.bcm.edu	37	16	830807	830829	+	Intron	DEL	AGCTGTGTGCACGGGTAGGTGAA	AGCTGTGTGCACGGGTAGGTGAA	-	rs3765330|rs199778248|rs374783495|rs548970443|rs371398602	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	AGCTGTGTGCACGGGTAGGTGAA	AGCTGTGTGCACGGGTAGGTGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr16:830807_830829delAGCTGTGTGCACGGGTAGGTGAA	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Frame_Shift_Del_p.FTYPCTQL58fs			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GGTAGGTGACAGCTGTGTGCACGGGTAGGTGAAAGCTGTGTGC	0.587																																																	0										8,3972		0,8,1982						-0.2	0.0			136	57,7953		1,55,3949	no	frameshift	MSLNL	NM_001025190.1		1,63,5931	A1A1,A1R,RR		0.7116,0.201,0.5421				65,11925				SO:0001627	intron_variant	401827					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-645TTCACCTACCCGTGCACACAGCT>-	16.37:g.830807_830829delAGCTGTGTGCACGGGTAGGTGAA		Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000442466.1	37																																																																																					0.587	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001025190	
MUC4	4585	broad.mit.edu	37	3	195510192	195510192	+	Silent	SNP	A	A	C	rs367755087		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr3:195510192A>C	ENST00000463781.3	-	2	8718	c.8259T>G	c.(8257-8259)ctT>ctG	p.L2753L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.L2753L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L2753L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGACAGGAAGAGGGGTGG	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											13.0	8.0	10.0					3																	195510192		667	1473	2140	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8259T>G	3.37:g.195510192A>C		Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	broad.mit.edu	37	3	195510194	195510194	+	Missense_Mutation	SNP	G	G	C	rs200763896		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr3:195510194G>C	ENST00000463781.3	-	2	8716	c.8257C>G	c.(8257-8259)Ctt>Gtt	p.L2753V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2753V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L2753V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGTG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											13.0	8.0	10.0					3																	195510194		668	1470	2138	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8257C>G	3.37:g.195510194G>C	ENSP00000417498:p.Leu2753Val	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.135	-0.651152	0.03506	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34859	1.39;1.34	.	.	.	.	.	.	.	.	T	0.17534	0.0421	N	0.19112	0.55	0.09310	N	1	B	0.17667	0.023	B	0.08055	0.003	T	0.23261	-1.0193	7	.	.	.	.	2.1461	0.03788	0.0:0.3259:0.3502:0.324	.	2625	E7ESK3	.	V	2753	ENSP00000417498:L2753V;ENSP00000420243:L2753V	.	L	-	1	0	MUC4	196994973	0.001000	0.12720	0.038000	0.18304	0.064000	0.16182	-1.239000	0.02916	0.073000	0.16731	0.074000	0.15403	CTT		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195513758	195513758	+	Missense_Mutation	SNP	G	G	C	rs202045385	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr3:195513758G>C	ENST00000463781.3	-	2	5152	c.4693C>G	c.(4693-4695)Cac>Gac	p.H1565D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1565D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H1565D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTGACCTGTGGAT	0.572													.|||	11	0.00219649	0.0053	0.0014	5008	,	,		12530	0.002		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4693C>G	3.37:g.195513758G>C	ENSP00000417498:p.His1565Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.677435	0.00751	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.53	.	.	.	.	.	.	.	.	T	0.13286	0.0322	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22836	-1.0205	7	.	.	.	.	2.1349	0.03759	0.3255:0.3453:0.3292:0.0	.	1565	E7ESK3	.	D	1565	ENSP00000417498:H1565D;ENSP00000420243:H1565D	.	H	-	1	0	MUC4	196998153	0.001000	0.12720	0.012000	0.15200	0.012000	0.07955	-0.789000	0.04609	-1.943000	0.01039	-1.898000	0.00530	CAC		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MYH1	4619	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10408350	10408350	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr17:10408350C>T	ENST00000226207.5	-	22	2562	c.2468G>A	c.(2467-2469)cGt>cAt	p.R823H	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	823					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R823H(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CATGAAGGCACGGACATTGTA	0.423																																																	1	Substitution - Missense(1)	kidney(1)											91.0	86.0	88.0					17																	10408350		2203	4300	6503	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2468G>A	17.37:g.10408350C>T	ENSP00000226207:p.Arg823His	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263520	0.80358	.	.	ENSG00000109061	ENST00000226207	D	0.86956	-2.19	5.47	5.47	0.80525	.	0.000000	0.43579	U	0.000560	D	0.96321	0.8800	H	0.98951	4.38	0.58432	D	0.999999	D	0.71674	0.998	P	0.62885	0.908	D	0.97554	1.0094	10	0.66056	D	0.02	.	19.6961	0.96026	0.0:1.0:0.0:0.0	.	823	P12882	MYH1_HUMAN	H	823	ENSP00000226207:R823H	ENSP00000226207:R823H	R	-	2	0	MYH1	10349075	1.000000	0.71417	0.700000	0.30305	0.437000	0.31866	7.692000	0.84203	2.745000	0.94114	0.650000	0.86243	CGT		0.423	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1		NM_005963	
MYH1	4619	broad.mit.edu;hgsc.bcm.edu	37	17	10409332	10409332	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr17:10409332G>C	ENST00000226207.5	-	18	2147	c.2053C>G	c.(2053-2055)Cct>Gct	p.P685A	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	685	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.P685A(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTCTTACCAGGAGTTTTAGTT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											138.0	137.0	137.0					17																	10409332		2203	4298	6501	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2053C>G	17.37:g.10409332G>C	ENSP00000226207:p.Pro685Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207516	0.58343	.	.	ENSG00000109061	ENST00000226207	T	0.73152	-0.72	4.94	4.94	0.65067	Myosin head, motor domain (2);	0.000000	0.42964	U	0.000624	T	0.73644	0.3613	M	0.75264	2.295	0.80722	D	1	B	0.13594	0.008	B	0.21708	0.036	T	0.72676	-0.4221	10	0.66056	D	0.02	.	18.7276	0.91720	0.0:0.0:1.0:0.0	.	685	P12882	MYH1_HUMAN	A	685	ENSP00000226207:P685A	ENSP00000226207:P685A	P	-	1	0	MYH1	10350057	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.291000	0.96070	2.745000	0.94114	0.650000	0.86243	CCT		0.463	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1		NM_005963	
NAV3	89795	broad.mit.edu;ucsc.edu	37	12	78392214	78392214	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:78392214G>A	ENST00000397909.2	+	7	1011	c.838G>A	c.(838-840)Gac>Aac	p.D280N	NAV3_ENST00000228327.6_Missense_Mutation_p.D280N|NAV3_ENST00000266692.7_Missense_Mutation_p.D280N|NAV3_ENST00000536525.2_Missense_Mutation_p.D280N			Q8IVL0	NAV3_HUMAN	neuron navigator 3	280						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.D280N(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TAACAGCATTGACAAAAACAA	0.443										HNSCC(70;0.22)																																							1	Substitution - Missense(1)	kidney(1)											81.0	72.0	75.0					12																	78392214		1855	4104	5959	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.838G>A	12.37:g.78392214G>A	ENSP00000381007:p.Asp280Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	G	21.9	4.211655	0.79240	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	5.57	5.57	0.84162	.	0.000000	0.42172	U	0.000752	T	0.61375	0.2342	L	0.49126	1.545	0.80722	D	1	B;D	0.67145	0.297;0.996	B;D	0.79784	0.172;0.993	T	0.60352	-0.7280	10	0.54805	T	0.06	-11.7156	19.5347	0.95244	0.0:0.0:1.0:0.0	.	280;280	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	N	280	ENSP00000446628:D280N;ENSP00000446132:D280N;ENSP00000381007:D280N;ENSP00000228327:D280N;ENSP00000266692:D280N	ENSP00000228327:D280N	D	+	1	0	NAV3	76916345	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.221000	0.95188	2.612000	0.88384	0.650000	0.86243	GAC		0.443	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1		NM_001024383	
NET1	10276	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	5494480	5494480	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr10:5494480C>T	ENST00000355029.4	+	5	665	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	NET1_ENST00000380359.3_Missense_Mutation_p.R121W|NET1_ENST00000542715.1_5'UTR	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	175	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R175W(1)|p.R121W(1)		breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						GGAGATCAGACGGCAGGAGGT	0.488																																																	2	Substitution - Missense(2)	kidney(2)											87.0	76.0	79.0					10																	5494480		2203	4300	6503	SO:0001583	missense	10276			AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.523C>T	10.37:g.5494480C>T	ENSP00000347134:p.Arg175Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	ENST00000355029.4	37	CCDS41483.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846475	0.51164	.	.	ENSG00000173848	ENST00000355029;ENST00000380359	T;T	0.75154	-0.91;-0.91	5.54	5.54	0.83059	Dbl homology (DH) domain (3);	0.000000	0.42548	D	0.000699	D	0.90655	0.7069	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93140	0.6540	10	0.87932	D	0	-18.1129	18.0526	0.89354	0.0:1.0:0.0:0.0	.	121;175	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	W	175;121	ENSP00000347134:R175W;ENSP00000369717:R121W	ENSP00000347134:R175W	R	+	1	2	NET1	5484480	0.971000	0.33674	0.976000	0.42696	0.067000	0.16453	1.869000	0.39519	2.589000	0.87451	0.655000	0.94253	CGG		0.488	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3		NM_005863	
NRXN1	9378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	50149352	50149352	+	Silent	SNP	T	T	A	rs55923848	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:50149352T>A	ENST00000406316.2	-	22	5640	c.4164A>T	c.(4162-4164)ccA>ccT	p.P1388P	NRXN1_ENST00000406859.3_Silent_p.P1388P|NRXN1_ENST00000342183.5_Silent_p.P353P|NRXN1_ENST00000402717.3_Silent_p.P1410P|NRXN1_ENST00000405472.3_Silent_p.P1410P|NRXN1_ENST00000404971.1_Silent_p.P1458P|NRXN1_ENST00000401710.1_Silent_p.P406P|NRXN1_ENST00000401669.2_Silent_p.P1418P	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1388					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.P353P(1)|p.P1459P(1)|p.P1388P(1)|p.P1458P(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGCTGAGCCTGGATACGGCT	0.542																																																	4	Substitution - coding silent(4)	kidney(4)											54.0	46.0	49.0					2																	50149352		2203	4300	6503	SO:0001819	synonymous_variant	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4164A>T	2.37:g.50149352T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.266|6.266	0.417140|0.417140	0.11870|0.11870	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000412315|ENST00000378262	.|.	.|.	.|.	5.95|5.95	0.618|0.618	0.17624|0.17624	.|.	.|.	.|.	.|.	.|.	T|T	0.42154|0.42154	0.1190|0.1190	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.24261|0.24261	-1.0165|-1.0165	4|4	.|.	.|.	.|.	.|.	1.4043|1.4043	0.02277|0.02277	0.4946:0.1907:0.1272:0.1875|0.4946:0.1907:0.1272:0.1875	.|.	.|.	.|.	.|.	L|W	121|55	.|.	.|.	Q|R	-|-	2|1	0|2	NRXN1|NRXN1	50002856|50002856	0.765000|0.765000	0.28485|0.28485	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	-0.139000|-0.139000	0.10358|0.10358	0.112000|0.112000	0.17975|0.17975	0.460000|0.460000	0.39030|0.39030	CAG|AGG		0.542	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			
OR7D4	125958	broad.mit.edu;hgsc.bcm.edu	37	19	9325393	9325393	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr19:9325393C>T	ENST00000308682.2	-	1	149	c.121G>A	c.(121-123)Ggg>Agg	p.G41R		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G41R(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						AGCAGGTTCCCCAGCACCGTG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											77.0	73.0	74.0					19																	9325393		2203	4300	6503	SO:0001583	missense	125958				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.121G>A	19.37:g.9325393C>T	ENSP00000310488:p.Gly41Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	37	CCDS32901.1	.	.	.	.	.	.	.	.	.	.	C	9.851	1.193628	0.22037	.	.	ENSG00000174667	ENST00000308682	T	0.04406	3.63	4.0	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000015	T	0.17959	0.0431	M	0.91196	3.185	0.38135	D	0.938287	B	0.27166	0.17	B	0.39379	0.298	T	0.10291	-1.0636	10	0.87932	D	0	.	15.2077	0.73192	0.0:1.0:0.0:0.0	.	41	Q8NG98	OR7D4_HUMAN	R	41	ENSP00000310488:G41R	ENSP00000310488:G41R	G	-	1	0	OR7D4	9186393	0.000000	0.05858	0.659000	0.29680	0.046000	0.14306	0.658000	0.24979	2.259000	0.74868	0.436000	0.28706	GGG		0.517	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1			
PAPSS1	9061	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	108608293	108608293	+	Nonsense_Mutation	SNP	A	A	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr4:108608293A>C	ENST00000265174.4	-	4	724	c.452T>G	c.(451-453)tTa>tGa	p.L151*	PAPSS1_ENST00000511304.1_5'UTR	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	151					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)	p.L151*(1)		NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		AAAAAACGGTAAACTTGCACC	0.348																																																	1	Substitution - Nonsense(1)	kidney(1)											96.0	98.0	98.0					4																	108608293		2203	4300	6503	SO:0001587	stop_gained	9061			Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.452T>G	4.37:g.108608293A>C	ENSP00000265174:p.Leu151*	Somatic		WXS	Illumina HiSeq	Phase_I	O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Nonsense_Mutation	SNP	ENST00000265174.4	37	CCDS3676.1	.	.	.	.	.	.	.	.	.	.	A	37	6.009266	0.97195	.	.	ENSG00000138801	ENST00000265174	.	.	.	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.8891	15.0851	0.72145	1.0:0.0:0.0:0.0	.	.	.	.	X	151	.	ENSP00000265174:L151X	L	-	2	0	PAPSS1	108827742	1.000000	0.71417	0.104000	0.21259	0.888000	0.51559	8.692000	0.91284	1.971000	0.57363	0.454000	0.30748	TTA		0.348	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253946.2			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52621464	52621464	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr3:52621464G>A	ENST00000296302.7	-	19	3029	c.3028C>T	c.(3028-3030)Cga>Tga	p.R1010*	PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R1025*|PBRM1_ENST00000410007.1_Intron|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R978*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R1025*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R1010*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R1010*|PBRM1_ENST00000394830.3_Intron			Q86U86	PB1_HUMAN	polybromo 1	1010	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R1010*(4)|p.R978*(2)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGAAATTTTCGTGTAGCCAGG	0.398			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	6	Substitution - Nonsense(6)	kidney(6)											71.0	72.0	71.0					3																	52621464		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3028C>T	3.37:g.52621464G>A	ENSP00000296302:p.Arg1010*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	39	7.356284	0.98231	.	.	ENSG00000163939	ENST00000356770;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.92	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0857	0.72151	0.0:0.0:0.668:0.332	.	.	.	.	X	978;1010;1010;1010;1025;1025;1009;968	.	ENSP00000296302:R1010X	R	-	1	2	PBRM1	52596504	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.097000	0.50251	1.458000	0.47871	0.655000	0.94253	CGA		0.398	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PDE11A	50940	hgsc.bcm.edu	37	2	178936994	178936994	+	Frame_Shift_Del	DEL	A	A	-	rs529789124	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:178936994delA	ENST00000286063.6	-	1	488	c.171delT	c.(169-171)ggtfs	p.G57fs	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	57					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	AGCTGCTGGTACCAGCCAAAG	0.607									Primary Pigmented Nodular Adrenocortical Disease, Familial				A|A|-|deletion	47	0.00938498	0.0	0.0	5008	,	,		17636	0.0		0.0	False		,,,				2504	0.0481																0			GRCh37	CD063588	PDE11A	D			,	1,4265		0,1,2132	43.0	33.0	36.0		,	-1.9	0.0	2		36	5,8249		0,5,4122	no	frameshift,intron	PDE11A	NM_016953.3,NM_001077197.1	,	0,6,6254	A1A1,A1R,RR		0.0606,0.0234,0.0479	,	,	178936994	6,12514	2203	4300	6503	SO:0001589	frameshift_variant	50940	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.171delT	2.37:g.178936994delA	ENSP00000286063:p.Gly57fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Frame_Shift_Del	DEL	ENST00000286063.6	37	CCDS33334.1																																																																																				0.607	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2			
PGLYRP3	114771	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	153271694	153271694	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr1:153271694G>A	ENST00000290722.1	-	6	794	c.742C>T	c.(742-744)Cag>Tag	p.Q248*		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	248					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.Q248*(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCACCATCCTGGCCCACCAGG	0.453																																																	1	Substitution - Nonsense(1)	kidney(1)											63.0	55.0	58.0					1																	153271694		2203	4300	6503	SO:0001587	stop_gained	114771			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.742C>T	1.37:g.153271694G>A	ENSP00000290722:p.Gln248*	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4U8|Q5SY65	Nonsense_Mutation	SNP	ENST00000290722.1	37	CCDS1035.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986374	0.53934	.	.	ENSG00000159527	ENST00000290722	.	.	.	4.59	1.16	0.20824	.	0.521046	0.16689	N	0.203628	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-34.8165	13.0754	0.59083	0.0:0.7089:0.2911:0.0	.	.	.	.	X	248	.	ENSP00000290722:Q248X	Q	-	1	0	PGLYRP3	151538318	0.057000	0.20700	0.972000	0.41901	0.411000	0.31082	0.120000	0.15647	0.250000	0.21479	0.313000	0.20887	CAG		0.453	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1		NM_052891	
PGM5	5239	hgsc.bcm.edu	37	9	71094451	71094452	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr9:71094451_71094452insC	ENST00000396396.1	+	8	1506_1507	c.1277_1278insC	c.(1276-1281)ggccgcfs	p.R427fs		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	427					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GCCAAATTTGGCCGCCACTACT	0.52																																																	0																																										SO:0001589	frameshift_variant	5239			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1279dupC	9.37:g.71094453_71094453dupC	ENSP00000379678:p.Arg427fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Frame_Shift_Ins	INS	ENST00000396396.1	37	CCDS6622.2																																																																																				0.520	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2		NM_021965	
PHTF2	57157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	77469587	77469587	+	Silent	SNP	C	C	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr7:77469587C>G	ENST00000248550.7	+	1	91	c.15C>G	c.(13-15)gtC>gtG	p.V5V	PHTF2_ENST00000416283.2_Silent_p.V5V|PHTF2_ENST00000422959.2_Silent_p.V5V|PHTF2_ENST00000450574.1_Silent_p.V5V|PHTF2_ENST00000415251.2_Silent_p.V5V|PHTF2_ENST00000424760.1_Silent_p.V5V|PHTF2_ENST00000275575.7_Silent_p.V5V|PHTF2_ENST00000307305.8_Silent_p.V5V			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V5V(2)		endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						CGTCCAAAGTCACAGATGCTA	0.328																																																	2	Substitution - coding silent(2)	kidney(2)											140.0	132.0	135.0					7																	77469587		1850	4100	5950	SO:0001819	synonymous_variant	57157			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.15C>G	7.37:g.77469587C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Silent	SNP	ENST00000248550.7	37																																																																																					0.328	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2		NM_020432	
PPP1R3F	89801	broad.mit.edu;hgsc.bcm.edu	37	X	49143162	49143162	+	Silent	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chrX:49143162G>A	ENST00000055335.6	+	4	2026	c.2010G>A	c.(2008-2010)ggG>ggA	p.G670G	PPP1R3F_ENST00000438316.1_Silent_p.G341G|PPP1R3F_ENST00000495799.1_Silent_p.G324G|PPP1R3F_ENST00000376188.1_Silent_p.G324G|PPP1R3F_ENST00000466508.1_Silent_p.G324G	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	670					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)	p.G670G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					GGGAGGCCGGGACAGAAGCCC	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	33.0	38.0					X																	49143162		2202	4299	6501	SO:0001819	synonymous_variant	89801				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.2010G>A	X.37:g.49143162G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2VDJ8|B3KPW2|E9PCM3	Silent	SNP	ENST00000055335.6	37	CCDS35254.1																																																																																				0.577	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2		NM_033215	
RBM11	54033	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	15592035	15592035	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr21:15592035A>T	ENST00000400577.3	+	2	257	c.248A>T	c.(247-249)cAg>cTg	p.Q83L	RBM11_ENST00000468643.1_3'UTR	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11	83	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)	p.Q83L(1)		endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		ATTAACGTGCAGTATCGATTT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											95.0	85.0	88.0					21																	15592035		1568	3582	5150	SO:0001583	missense	54033			AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.248A>T	21.37:g.15592035A>T	ENSP00000383421:p.Gln83Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6YNC2|Q8NBA1|Q8NFF6	Missense_Mutation	SNP	ENST00000400577.3	37	CCDS46635.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965674	0.74131	.	.	ENSG00000185272	ENST00000400577	T	0.74632	-0.86	5.29	5.29	0.74685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.100598	0.42682	D	0.000661	T	0.67906	0.2943	N	0.25957	0.775	0.43617	D	0.995996	P	0.50943	0.94	P	0.49140	0.601	T	0.69749	-0.5061	10	0.48119	T	0.1	-15.5523	10.7342	0.46115	0.9232:0.0:0.0768:0.0	.	83	P57052	RBM11_HUMAN	L	83	ENSP00000383421:Q83L	ENSP00000383421:Q83L	Q	+	2	0	RBM11	14513906	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.440000	0.59975	2.150000	0.67090	0.533000	0.62120	CAG		0.368	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157818.1		NM_144770	
RCC2	55920	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	17739593	17739593	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr1:17739593C>T	ENST00000375436.4	-	10	1476	c.1289G>A	c.(1288-1290)tGg>tAg	p.W430*	AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Nonsense_Mutation_p.W430*	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	430					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)	p.W430L(1)|p.W430*(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		CCGGATTCTCCAGCCGCAGAG	0.567																																																	2	Substitution - Missense(1)|Substitution - Nonsense(1)	lung(1)|kidney(1)											44.0	42.0	43.0					1																	17739593		2203	4300	6503	SO:0001587	stop_gained	55920				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.1289G>A	1.37:g.17739593C>T	ENSP00000364585:p.Trp430*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVL9|Q9BSN6|Q9NPV8	Nonsense_Mutation	SNP	ENST00000375436.4	37	CCDS181.1	.	.	.	.	.	.	.	.	.	.	C	40	8.065390	0.98635	.	.	ENSG00000179051	ENST00000375436;ENST00000375433	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-22.7397	17.7539	0.88444	0.0:1.0:0.0:0.0	.	.	.	.	X	430	.	ENSP00000364582:W430X	W	-	2	0	RCC2	17612180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	2.615000	0.88500	0.655000	0.94253	TGG		0.567	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1		NM_018715	
RPL19	6143	hgsc.bcm.edu	37	17	37360844	37360844	+	Silent	SNP	G	G	A	rs72823350		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr17:37360844G>A	ENST00000225430.4	+	6	596	c.534G>A	c.(532-534)caG>caA	p.Q178Q	RPL19_ENST00000579260.1_Silent_p.Q176Q|RPL19_ENST00000582193.1_Silent_p.Q176Q|RPL19_ENST00000579374.1_Silent_p.Q175Q	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	178					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						AGCGCCTCCAGGCCAAGAAGG	0.517																																																	0													66.0	71.0	70.0					17																	37360844		1907	4116	6023	SO:0001819	synonymous_variant	6143				CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.534G>A	17.37:g.37360844G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Silent	SNP	ENST00000225430.4	37	CCDS42312.1																																																																																				0.517	RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444190.1		NM_000981	
RSRC2	65117	broad.mit.edu;ucsc.edu	37	12	123003401	123003401	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:123003401G>T	ENST00000331738.7	-	4	528	c.383C>A	c.(382-384)tCt>tAt	p.S128Y	RSRC2_ENST00000354654.2_Missense_Mutation_p.S80Y	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	128	Ser-rich.						poly(A) RNA binding (GO:0044822)	p.S128Y(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		ACGAGACCTAGATCTTGAGTG	0.378																																																	1	Substitution - Missense(1)	kidney(1)											414.0	381.0	392.0					12																	123003401		2203	4300	6503	SO:0001583	missense	65117			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.383C>A	12.37:g.123003401G>T	ENSP00000330188:p.Ser128Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	ENST00000331738.7	37	CCDS31920.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.941439|3.941439	0.73557|0.73557	.|.	.|.	ENSG00000111011|ENSG00000111011	ENST00000526560|ENST00000331738;ENST00000354654;ENST00000418773;ENST00000344591	T|T;T;T	0.56776|0.26067	0.44|1.76;1.76;1.76	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.42854|0.42854	0.1221|0.1221	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.69078	.|0.997;0.994;0.997;0.994	.|D;D;D;D	.|0.78314	.|0.991;0.983;0.991;0.983	T|T	0.19516|0.19516	-1.0303|-1.0303	7|10	0.87932|0.56958	D|D	0|0.05	.|.	20.263|20.263	0.98456|0.98456	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|128;80;128;69	.|F5GXM2;Q7L4I2-2;Q7L4I2;E1B6W4	.|.;.;RSRC2_HUMAN;.	I|Y	22|128;80;128;69	ENSP00000446470:L22I|ENSP00000330188:S128Y;ENSP00000346678:S80Y;ENSP00000343315:S69Y	ENSP00000446470:L22I|ENSP00000330188:S128Y	L|S	-|-	1|2	2|0	RSRC2|RSRC2	121569354|121569354	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.217000|9.217000	0.95160|0.95160	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	CTA|TCT		0.378	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3		NM_023012	
SIGLEC5	8778	hgsc.bcm.edu	37	19	52131256	52131257	+	Frame_Shift_Ins	INS	-	-	G	rs149243374	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr19:52131256_52131257insG	ENST00000534261.2	-	6	1226_1227	c.827_828insC	c.(826-828)cctfs	p.P276fs	SIGLEC5_ENST00000222107.4_Frame_Shift_Ins_p.P276fs|SIGLEC5_ENST00000429354.3_Frame_Shift_Ins_p.P276fs|SIGLEC5_ENST00000570106.2_Frame_Shift_Ins_p.P276fs|SIGLEC5_ENST00000599649.1_Frame_Shift_Ins_p.P276fs			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	276	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TCAGGTGTGCAGGGGGGTTGCT	0.604													GGGGGG|GGGGGG|GGGGGGG|insertion	4	0.000798722	0.0	0.0014	5008	,	,		16471	0.0		0.003	False		,,,				2504	0.0																0										4,4260		0,4,2128						0.1	0.0		dbSNP_134	61	29,8223		0,29,4097	no	frameshift	SIGLEC5	NM_003830.2		0,33,6225	A1A1,A1R,RR		0.3514,0.0938,0.2637				33,12483				SO:0001589	frameshift_variant	8778			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.828dupC	19.37:g.52131262_52131262dupG	ENSP00000473238:p.Pro276fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000534261.2	37	CCDS33088.1																																																																																				0.604	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2		NM_003830	
SNRNP27	11017	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	70122252	70122252	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:70122252C>T	ENST00000244227.3	+	2	486	c.61C>T	c.(61-63)Cgg>Tgg	p.R21W	SNRNP27_ENST00000409116.1_Missense_Mutation_p.R21W	NM_006857.2	NP_006848.1	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa (U4/U6.U5)	21	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R21W(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	11						GTCCACATCCCGGGAGAGAGA	0.562																																																	1	Substitution - Missense(1)	kidney(1)											91.0	103.0	99.0					2																	70122252		2203	4300	6503	SO:0001583	missense	11017			X76302	CCDS33219.1	2p14	2011-10-11			ENSG00000124380	ENSG00000124380			30240	protein-coding gene	gene with protein product	"""nucleic acid binding protein RY 1"""					7931148	Standard	NM_006857		Approved	RY1	uc002sfw.3	Q8WVK2	OTTHUMG00000152689	ENST00000244227.3:c.61C>T	2.37:g.70122252C>T	ENSP00000244227:p.Arg21Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q15410	Missense_Mutation	SNP	ENST00000244227.3	37	CCDS33219.1	.	.	.	.	.	.	.	.	.	.	c	15.09	2.730819	0.48939	.	.	ENSG00000124380	ENST00000244227;ENST00000409116	T;T	0.55234	0.53;0.53	4.22	1.09	0.20402	Domain of unknown function DUF1777 (1);	0.058863	0.64402	D	0.000003	T	0.65471	0.2694	M	0.81802	2.56	0.58432	D	0.999997	D;D	0.69078	0.997;0.983	P;B	0.57720	0.826;0.381	T	0.69716	-0.5070	10	0.66056	D	0.02	.	11.1329	0.48358	0.464:0.5359:0.0:0.0	.	21;21	B8ZZ98;Q8WVK2	.;SNR27_HUMAN	W	21	ENSP00000244227:R21W;ENSP00000386608:R21W	ENSP00000244227:R21W	R	+	1	2	SNRNP27	69975756	0.863000	0.29885	0.964000	0.40570	0.969000	0.65631	1.526000	0.35964	0.505000	0.28104	-0.358000	0.07595	CGG		0.562	SNRNP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327369.1		NM_006857	
SLC9A2	6549	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	103281704	103281704	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:103281704C>G	ENST00000233969.2	+	3	1041	c.899C>G	c.(898-900)aCt>aGt	p.T300S		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	300					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.T300S(1)		breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GCATTTACTACTCGATTCACC	0.453																																																	1	Substitution - Missense(1)	kidney(1)											223.0	201.0	208.0					2																	103281704		2203	4300	6503	SO:0001583	missense	6549				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.899C>G	2.37:g.103281704C>G	ENSP00000233969:p.Thr300Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761324	0.69763	.	.	ENSG00000115616	ENST00000233969	T	0.15372	2.43	5.66	5.66	0.87406	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.38799	0.1054	L	0.50993	1.605	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00749	-1.1582	10	0.34782	T	0.22	.	20.1225	0.97967	0.0:1.0:0.0:0.0	.	300	Q9UBY0	SL9A2_HUMAN	S	300	ENSP00000233969:T300S	ENSP00000233969:T300S	T	+	2	0	SLC9A2	102648136	1.000000	0.71417	0.364000	0.25888	0.988000	0.76386	7.758000	0.85224	2.831000	0.97527	0.650000	0.86243	ACT		0.453	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			
SPPL3	121665	broad.mit.edu;ucsc.edu	37	12	121206288	121206288	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr12:121206288A>T	ENST00000353487.2	-	8	1116	c.613T>A	c.(613-615)Ttt>Att	p.F205I		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	206						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.F205I(1)				all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCTGAGAAAAATACCTGCCGA	0.522																																																	1	Substitution - Missense(1)	kidney(1)											101.0	96.0	97.0					12																	121206288		2203	4300	6503	SO:0001583	missense	121665				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.613T>A	12.37:g.121206288A>T	ENSP00000288680:p.Phe205Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	ENST00000353487.2	37	CCDS9208.1	.	.	.	.	.	.	.	.	.	.	A	35	5.473777	0.96291	.	.	ENSG00000157837	ENST00000353487;ENST00000405631;ENST00000536996	T;T	0.48522	0.81;0.81	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.78648	0.4316	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.991;0.993	D	0.85964	0.1472	10	0.87932	D	0	-23.8081	15.6471	0.77063	1.0:0.0:0.0:0.0	.	206;205	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	I	205;204;168	ENSP00000288680:F205I;ENSP00000442484:F168I	ENSP00000288680:F205I	F	-	1	0	AC069214.1	119690671	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.962000	0.93254	2.101000	0.63845	0.482000	0.46254	TTT		0.522	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2		NM_139015	
STAMBP	10617	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	74087228	74087228	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:74087228T>C	ENST00000394070.2	+	9	1671	c.1168T>C	c.(1168-1170)Tgt>Cgt	p.C390R	STAMBP_ENST00000339566.3_Missense_Mutation_p.C390R|STAMBP_ENST00000409707.1_Missense_Mutation_p.C390R|STAMBP_ENST00000486458.1_3'UTR|STAMBP_ENST00000394073.1_Missense_Mutation_p.C390R	NM_213622.2	NP_998787.1	O95630	STABP_HUMAN	STAM binding protein	390					JAK-STAT cascade (GO:0007259)|mitotic cytokinesis (GO:0000281)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of cell proliferation (GO:0008284)|protein deubiquitination (GO:0016579)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|ubiquitin-specific protease activity (GO:0004843)	p.C390R(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	18						GATTTCTTCCTGTCGCCAGAA	0.438																																																	1	Substitution - Missense(1)	kidney(1)											102.0	91.0	95.0					2																	74087228		2203	4300	6503	SO:0001583	missense	10617			BC007682	CCDS1929.1	2p24.3-p24.1	2008-02-05			ENSG00000124356	ENSG00000124356			16950	protein-coding gene	gene with protein product		606247				10383417	Standard	NM_006463		Approved	AMSH	uc002sjs.3	O95630	OTTHUMG00000129817	ENST00000394070.2:c.1168T>C	2.37:g.74087228T>C	ENSP00000377633:p.Cys390Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B5M0B6|D6W5H7|Q3MJE7	Missense_Mutation	SNP	ENST00000394070.2	37	CCDS1929.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.417631	0.83449	.	.	ENSG00000124356	ENST00000339566;ENST00000409707;ENST00000394073;ENST00000394070	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.84973	0.5591	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.88450	0.3048	10	0.87932	D	0	-21.9625	14.8849	0.70560	0.0:0.0:0.0:1.0	.	390	O95630	STABP_HUMAN	R	390	ENSP00000344742:C390R;ENSP00000386548:C390R;ENSP00000377636:C390R;ENSP00000377633:C390R	ENSP00000344742:C390R	C	+	1	0	STAMBP	73940736	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.756000	0.85195	2.153000	0.67306	0.533000	0.62120	TGT		0.438	STAMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252048.2		NM_006463	
STK24	8428	hgsc.bcm.edu;ucsc.edu	37	13	99118770	99118771	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr13:99118770_99118771insA	ENST00000376547.3	-	6	823_824	c.678_679insT	c.(676-681)agagggfs	p.G227fs	STK24_ENST00000397517.2_Frame_Shift_Ins_p.G215fs|STK24_ENST00000539966.1_Frame_Shift_Ins_p.G196fs	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	227	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGTGGTTCCCCTCTTGCAAGTT	0.455											OREG0022476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001589	frameshift_variant	8428			AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.678_679insT	13.37:g.99118770_99118771insA	ENSP00000365730:p.Gly227fs	Somatic	1341	WXS	Illumina HiSeq	Phase_I	O14840|Q5JV92	Frame_Shift_Ins	INS	ENST00000376547.3	37	CCDS9488.1																																																																																				0.455	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2		NM_003576	
SYT5	6861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	55686305	55686305	+	Silent	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr19:55686305G>A	ENST00000354308.3	-	7	1140	c.771C>T	c.(769-771)acC>acT	p.T257T	SYT5_ENST00000590851.1_Silent_p.T253T|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000537500.1_Silent_p.T257T	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	257	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.T257T(1)		kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGACGATGACGGTGAGCTTCC	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											119.0	113.0	115.0					19																	55686305		2203	4300	6503	SO:0001819	synonymous_variant	6861			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.771C>T	19.37:g.55686305G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B3KWJ8|B7Z300|Q86X72	Silent	SNP	ENST00000354308.3	37	CCDS12919.1																																																																																				0.617	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1		NM_003180	
TBC1D3	729873	hgsc.bcm.edu	37	17	36338191	36338192	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr17:36338191_36338192insG	ENST00000354664.4	-	14	1640_1641	c.1484_1485insC	c.(1483-1485)gctfs	p.A495fs	TBC1D3_ENST00000519532.1_Frame_Shift_Ins_p.A473fs|TBC1D3_ENST00000537432.1_Frame_Shift_Ins_p.A495fs|TBC1D3_ENST00000339023.4_3'UTR	NM_001123391.2	NP_001116863.2	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3	495						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGGGTGTTCAGCCTGCCAGCA	0.629																																																	0																																										SO:0001589	frameshift_variant	84218				CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000354664.4:c.1485dupC	17.37:g.36338192_36338192dupG	ENSP00000346691:p.Ala495fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Frame_Shift_Ins	INS	ENST00000354664.4	37	CCDS45658.1																																																																																				0.629	TBC1D3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378681.1		NM_001123391	
TCF12	6938	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	57458628	57458628	+	Silent	SNP	C	C	A	rs147522860		TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr15:57458628C>A	ENST00000267811.5	+	6	658	c.354C>A	c.(352-354)tcC>tcA	p.S118S	TCF12_ENST00000452095.2_Silent_p.S114S|TCF12_ENST00000438423.2_Silent_p.S118S|TCF12_ENST00000333725.5_Silent_p.S118S|TCF12_ENST00000557843.1_Silent_p.S118S	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	118					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.S118S(4)|p.S114S(2)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GCTCATTTTCCCTGTACAGCA	0.308			T	TEC	extraskeletal myxoid chondrosarcoma																																			Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	6	Substitution - coding silent(6)	lung(3)|kidney(3)											91.0	103.0	99.0					15																	57458628		2192	4286	6478	SO:0001819	synonymous_variant	6938			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.354C>A	15.37:g.57458628C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z3D9|Q86TC1|Q86VM2	Silent	SNP	ENST00000267811.5	37	CCDS10159.1																																																																																				0.308	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3		NM_003205	
TMEM154	201799	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	153564272	153564272	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr4:153564272A>T	ENST00000304385.3	-	5	677	c.446T>A	c.(445-447)cTt>cAt	p.L149H		NM_152680.2	NP_689893.1	Q6P9G4	TM154_HUMAN	transmembrane protein 154	149						integral component of membrane (GO:0016021)		p.L149H(1)		kidney(2)|large_intestine(1)	3	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CCATTTATCAAGCTCTTCCAT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											183.0	178.0	180.0					4																	153564272		2202	4300	6502	SO:0001583	missense	201799			AK056590	CCDS3779.1	4q31.3	2008-02-05			ENSG00000170006	ENSG00000170006			26489	protein-coding gene	gene with protein product						12477932	Standard	NM_152680		Approved	FLJ32028	uc003imw.2	Q6P9G4	OTTHUMG00000161463	ENST00000304385.3:c.446T>A	4.37:g.153564272A>T	ENSP00000302144:p.Leu149His	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WUT7|Q96MQ8	Missense_Mutation	SNP	ENST00000304385.3	37	CCDS3779.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.142580	0.77888	.	.	ENSG00000170006	ENST00000304385	T	0.61627	0.09	5.88	5.88	0.94601	.	0.100040	0.46758	D	0.000272	T	0.73313	0.3571	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76002	-0.3118	10	0.87932	D	0	-13.4088	14.2482	0.66001	1.0:0.0:0.0:0.0	.	149	Q6P9G4	TM154_HUMAN	H	149	ENSP00000302144:L149H	ENSP00000302144:L149H	L	-	2	0	TMEM154	153783722	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	5.840000	0.69402	2.250000	0.74265	0.454000	0.30748	CTT		0.348	TMEM154-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365024.1		NM_152680	
TRIM59	286827	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	160156326	160156326	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr3:160156326G>C	ENST00000309784.4	-	3	831	c.646C>G	c.(646-648)Caa>Gaa	p.Q216E	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.Q216E|TRIM59_ENST00000543469.1_Missense_Mutation_p.Q216E	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	216					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q216E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GTATATTCTTGATTAATTAGA	0.348																																																	1	Substitution - Missense(1)	kidney(1)											76.0	80.0	78.0					3																	160156326		2201	4297	6498	SO:0001583	missense	286827			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.646C>G	3.37:g.160156326G>C	ENSP00000311219:p.Gln216Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5G9|D3DNL9	Missense_Mutation	SNP	ENST00000309784.4	37	CCDS3190.1	.	.	.	.	.	.	.	.	.	.	G	8.325	0.825081	0.16678	.	.	ENSG00000213186	ENST00000543469;ENST00000309784	T;T	0.24151	2.06;1.87	5.77	3.9	0.45041	.	0.357214	0.29383	N	0.012318	T	0.13157	0.0319	N	0.11255	0.115	0.26665	N	0.971831	B	0.11235	0.004	B	0.04013	0.001	T	0.12682	-1.0538	9	.	.	.	-15.8028	12.9079	0.58162	0.0:0.1894:0.7079:0.1027	.	216	Q8IWR1	TRI59_HUMAN	E	216	ENSP00000444313:Q216E;ENSP00000311219:Q216E	.	Q	-	1	0	TRIM59	161639020	0.297000	0.24408	1.000000	0.80357	0.976000	0.68499	0.668000	0.25127	2.724000	0.93272	0.561000	0.74099	CAA		0.348	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352963.1		NM_173084	
UBE2D3	7323	broad.mit.edu;ucsc.edu	37	4	103723780	103723780	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr4:103723780G>A	ENST00000453744.2	-	5	649	c.136C>T	c.(136-138)Caa>Taa	p.Q46*	UBE2D3_ENST00000357194.6_Nonsense_Mutation_p.Q48*|UBE2D3_ENST00000505207.1_Nonsense_Mutation_p.Q17*|UBE2D3_ENST00000343106.5_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000349311.8_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000394803.5_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000504211.1_Nonsense_Mutation_p.Q17*|UBE2D3_ENST00000394804.2_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000338145.3_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000507845.1_Nonsense_Mutation_p.Q17*|UBE2D3_ENST00000350435.7_Nonsense_Mutation_p.Q40*|UBE2D3_ENST00000321805.7_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000394801.4_Nonsense_Mutation_p.Q46*|UBE2D3_ENST00000502404.1_Nonsense_Mutation_p.Q17*	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	46					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.Q48*(1)|p.Q46*(1)		kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		ACACCGCCTTGATATGGGCTG	0.318																																																	2	Substitution - Nonsense(2)	kidney(2)											90.0	95.0	93.0					4																	103723780		2203	4300	6503	SO:0001587	stop_gained	7323			U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.136C>T	4.37:g.103723780G>A	ENSP00000396901:p.Gln46*	Somatic		WXS	Illumina GAIIx	Phase_I	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Nonsense_Mutation	SNP	ENST00000453744.2	37	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	G	37	6.250117	0.97412	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000504211;ENST00000357194;ENST00000505207;ENST00000507845;ENST00000502404;ENST00000508476;ENST00000508238;ENST00000502690;ENST00000508249	.	.	.	5.74	4.89	0.63831	.	0.049416	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	16.1117	0.81270	0.0:0.0:0.8651:0.1349	.	.	.	.	X	46;46;46;46;46;46;40;46;46;17;48;17;17;17;17;46;46;46	.	ENSP00000318494:Q46X	Q	-	1	0	UBE2D3	103942890	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.498000	0.97972	1.398000	0.46701	0.491000	0.48974	CAA		0.318	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2		NM_181893	
UBR3	130507	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	170885902	170885902	+	Silent	SNP	T	T	A			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr2:170885902T>A	ENST00000272793.5	+	31	4550	c.4500T>A	c.(4498-4500)atT>atA	p.I1500I	UBR3_ENST00000392631.1_Silent_p.I321I|UBR3_ENST00000418381.1_Silent_p.I1500I|UBR3_ENST00000465630.1_3'UTR			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1500					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I353I(1)|p.I1500I(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TTTATAGCATTGACTCTGAGT	0.338																																																	2	Substitution - coding silent(2)	kidney(2)											92.0	88.0	90.0					2																	170885902		2203	4300	6503	SO:0001819	synonymous_variant	130507			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4500T>A	2.37:g.170885902T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Silent	SNP	ENST00000272793.5	37		.	.	.	.	.	.	.	.	.	.	T	10.31	1.314265	0.23908	.	.	ENSG00000144357	ENST00000392632	.	.	.	4.55	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2861	0.37758	0.0:0.0891:0.0:0.9109	.	.	.	.	X	562	.	.	L	+	2	0	UBR3	170594148	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.342000	0.43992	0.690000	0.31570	-0.376000	0.06991	TTG		0.338	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2		NM_172070	
Unknown	0	broad.mit.edu	37	15	30771339	30771339	+	IGR	SNP	A	A	G	rs199544145	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr15:30771339A>G								GOLGA8R (64876 upstream) : CTD-3092A11.1 (5407 downstream)																							AGACTCTGCAACTCATGAGAG	0.398																																																	0																																										SO:0001628	intergenic_variant	0																															15.37:g.30771339A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.398									
URGCP	55665	broad.mit.edu;hgsc.bcm.edu	37	7	43918173	43918173	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr7:43918173C>G	ENST00000453200.1	-	6	1382	c.889G>C	c.(889-891)Gac>Cac	p.D297H	URGCP_ENST00000447717.3_Missense_Mutation_p.D254H|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Missense_Mutation_p.D254H|URGCP_ENST00000402306.3_Missense_Mutation_p.D288H|URGCP_ENST00000336086.6_Missense_Mutation_p.D254H|URGCP_ENST00000223341.7_Missense_Mutation_p.D254H|URGCP-MRPS24_ENST00000603700.1_Intron			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	297					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.D297H(1)|p.D254H(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAGTTGAGGTCCCGATGCCAG	0.577																																																	2	Substitution - Missense(2)	kidney(2)											44.0	47.0	46.0					7																	43918173		1964	4135	6099	SO:0001583	missense	55665				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.889G>C	7.37:g.43918173C>G	ENSP00000396918:p.Asp297His	Somatic		WXS	Illumina HiSeq	Phase_I	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214335	0.79352	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92;2.92	5.52	5.52	0.82312	.	0.221270	0.44902	D	0.000404	T	0.28001	0.0690	L	0.52364	1.645	0.48511	D	0.999668	D;D	0.89917	1.0;1.0	D;D	0.70016	0.967;0.967	T	0.00171	-1.1959	10	0.51188	T	0.08	-35.6799	16.928	0.86182	0.0:1.0:0.0:0.0	.	288;297	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	H	254;254;288;254;297;254	ENSP00000223341:D254H;ENSP00000336872:D254H;ENSP00000384955:D288H;ENSP00000392136:D254H;ENSP00000396918:D297H;ENSP00000402803:D254H	ENSP00000223341:D254H	D	-	1	0	URGCP	43884698	0.887000	0.30362	0.978000	0.43139	0.993000	0.82548	1.878000	0.39608	2.604000	0.88044	0.491000	0.48974	GAC		0.577	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1		NM_001077664	
XIAP	331	broad.mit.edu	37	X	123025168	123025168	+	Splice_Site	SNP	T	T	C			TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chrX:123025168T>C	ENST00000371199.3	+	4	1355		c.e4+2		XIAP_ENST00000434753.3_Splice_Site|XIAP_ENST00000355640.3_Splice_Site|XIAP_ENST00000468691.1_Intron	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GAGTGTCTGGTAAGTCTCata	0.219									X-linked Lymphoproliferative syndrome																																								1	Unknown(1)	kidney(1)											28.0	27.0	27.0					X																	123025168		2171	4229	6400	SO:0001630	splice_region_variant	331	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.1056+2T>C	X.37:g.123025168T>C		Somatic		WXS	Illumina GAIIx	Phase_I	D3DTF2|Q9NQ14	Splice_Site	SNP	ENST00000371199.3	37	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.985810	0.35036	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	.	.	.	4.97	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4015	0.21640	0.1589:0.0:0.1621:0.679	.	.	.	.	.	-1	.	.	.	+	.	.	XIAP	122852849	1.000000	0.71417	0.991000	0.47740	0.570000	0.35934	2.718000	0.47236	0.618000	0.30179	0.441000	0.28932	.		0.219	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5		NM_001167	Intron
ZNF519	162655	hgsc.bcm.edu	37	18	14105166	14105249	+	In_Frame_Del	DEL	TTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGT	TTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGT	-	rs145735313|rs543489203|rs148982947|rs147242149|rs149803578|rs564983246|rs144389001|rs542875576|rs139675432|rs145376132|rs532361810|rs185469686|rs576494908	byFrequency	TCGA-AK-3436-01A-02D-1386-10	TCGA-AK-3436-10A-01D-1251-10	TTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGT	TTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	714cd118-7f2b-47a5-83f6-41b20674ad03	593c9ff9-5933-4eed-9477-3c0fa7c9dc95	g.chr18:14105166_14105249delTTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGT	ENST00000590202.1	-	3	1442_1525	c.1290_1373delACACTTCAAATGTAAAGAATGTGGCAAAGCCTTTAACAGGGGCTCACACCTTACTCGACATCAAAGAATCCATACTGGAGAGAA	c.(1288-1374)aaacacttcaaatgtaaagaatgtggcaaagcctttaacaggggctcacaccttactcgacatcaaagaatccatactggagagaag>aag	p.430_458KHFKCKECGKAFNRGSHLTRHQRIHTGEK>K	ZNF519_ENST00000589203.1_Intron|ZNF519_ENST00000589498.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	430					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TTTGAAAGACTTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGTTTCTCTCCAG	0.405																																																	0																																										SO:0001651	inframe_deletion	162655			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1290_1373delACACTTCAAATGTAAAGAATGTGGCAAAGCCTTTAACAGGGGCTCACACCTTACTCGACATCAAAGAATCCATACTGGAGAGAA	18.37:g.14105166_14105249delTTCTCTCCAGTATGGATTCTTTGATGTCGAGTAAGGTGTGAGCCCCTGTTAAAGGCTTTGCCACATTCTTTACATTTGAAGTGT	ENSP00000464872:p.Lys430_Glu457del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000590202.1	37	CCDS32797.1																																																																																				0.405	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1		NM_145287	
