#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM21	8747	hgsc.bcm.edu	37	14	70925438	70925438	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr14:70925438C>T	ENST00000603540.1	+	2	1480	c.1222C>T	c.(1222-1224)Cgc>Tgc	p.R408C	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.R408C	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	408	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TATGCTAAAGCGCTGTGGGAA	0.453																																																	0													77.0	75.0	75.0					14																	70925438		2203	4300	6503	SO:0001583	missense	8747			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.1222C>T	14.37:g.70925438C>T	ENSP00000474385:p.Arg408Cys	Somatic		WXS	SOLID	Phase_I	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318453	0.23994	.	.	ENSG00000139985	ENST00000267499	T	0.01185	5.21	4.2	4.2	0.49525	Blood coagulation inhibitor, Disintegrin (1);	0.317510	0.22250	N	0.062579	T	0.02807	0.0084	M	0.88570	2.965	0.43287	D	0.995267	B	0.31680	0.335	B	0.26693	0.072	T	0.31668	-0.9935	10	0.40728	T	0.16	.	13.0202	0.58781	0.1618:0.8382:0.0:0.0	.	408	Q9UKJ8	ADA21_HUMAN	C	408	ENSP00000267499:R408C	ENSP00000267499:R408C	R	+	1	0	ADAM21	69995191	0.000000	0.05858	0.994000	0.49952	0.062000	0.15995	0.251000	0.18257	2.320000	0.78422	0.557000	0.71058	CGC		0.453	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3			
ADAMTS9	56999	hgsc.bcm.edu	37	3	64607988	64607988	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:64607988T>G	ENST00000498707.1	-	18	2914	c.2572A>C	c.(2572-2574)Aag>Cag	p.K858Q	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.K830Q	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	858	Spacer.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTGTACAACTTTCCCACCGAC	0.458																																																	0													98.0	99.0	99.0					3																	64607988		2203	4300	6503	SO:0001583	missense	56999			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2572A>C	3.37:g.64607988T>G	ENSP00000418735:p.Lys858Gln	Somatic		WXS	SOLID	Phase_I	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.897144	0.52121	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.52057	0.68;0.68	5.78	4.6	0.57074	ADAM-TS Spacer 1 (1);	0.253189	0.39146	N	0.001456	T	0.41511	0.1162	L	0.44542	1.39	0.80722	D	1	B;B;B;B	0.19331	0.026;0.009;0.035;0.015	B;B;B;B	0.22386	0.038;0.022;0.039;0.024	T	0.19289	-1.0310	10	0.40728	T	0.16	.	13.0644	0.59025	0.0:0.0:0.1344:0.8656	.	830;858;858;858	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	Q	830;858	ENSP00000295903:K830Q;ENSP00000418735:K858Q	ENSP00000295903:K830Q	K	-	1	0	ADAMTS9	64583028	1.000000	0.71417	0.365000	0.25901	0.900000	0.52787	4.879000	0.63100	0.991000	0.38814	0.460000	0.39030	AAG		0.458	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			
AHRR	57491	hgsc.bcm.edu	37	5	413518	413518	+	Silent	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:413518A>G	ENST00000505113.1	+	5	467	c.423A>G	c.(421-423)gcA>gcG	p.A141A	AHRR_ENST00000316418.5_Silent_p.A141A|AHRR_ENST00000512529.1_5'UTR	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	141	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			ATGCATCAGCAACGATCGTGG	0.398																																																	0													135.0	124.0	128.0					5																	413518		1907	4115	6022	SO:0001819	synonymous_variant	57491			AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.423A>G	5.37:g.413518A>G		Somatic		WXS	SOLID	Phase_I	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	37	CCDS56355.1																																																																																				0.398	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1		NM_020731	
AIFM3	150209	hgsc.bcm.edu	37	22	21332205	21332205	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr22:21332205T>A	ENST00000399167.2	+	16	1628	c.1388T>A	c.(1387-1389)tTt>tAt	p.F463Y	AIFM3_ENST00000465606.1_3'UTR|AIFM3_ENST00000333607.6_Missense_Mutation_p.F463Y|AIFM3_ENST00000405089.1_Missense_Mutation_p.F469Y|AIFM3_ENST00000440238.2_Missense_Mutation_p.F463Y|AIFM3_ENST00000335375.5_Missense_Mutation_p.F451Y|AIFM3_ENST00000399163.2_Missense_Mutation_p.F463Y	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	463					cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCAGGCGTGTTTGCAGCTGGC	0.587																																																	0													127.0	96.0	107.0					22																	21332205		2203	4300	6503	SO:0001583	missense	150209			AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.1388T>A	22.37:g.21332205T>A	ENSP00000382120:p.Phe463Tyr	Somatic		WXS	SOLID	Phase_I	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Missense_Mutation	SNP	ENST00000399167.2	37	CCDS13786.1	.	.	.	.	.	.	.	.	.	.	T	3.966	-0.009258	0.07727	.	.	ENSG00000183773	ENST00000399167;ENST00000399163;ENST00000405089;ENST00000335375;ENST00000440238;ENST00000333607	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	4.56	4.56	0.56223	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.24275	0.0588	N	0.11927	0.2	0.80722	D	1	B;B;B;B;B	0.30973	0.297;0.302;0.106;0.106;0.13	B;B;B;B;B	0.36666	0.184;0.23;0.147;0.147;0.23	T	0.08086	-1.0739	10	0.02654	T	1	0.1811	12.1655	0.54127	0.0:0.0:0.0:1.0	.	451;451;469;463;463	B7Z9S7;B7Z376;Q96NN9-2;Q96NN9-3;Q96NN9	.;.;.;.;AIFM3_HUMAN	Y	463;463;469;451;463;463	ENSP00000382120:F463Y;ENSP00000382116:F463Y;ENSP00000385800:F469Y;ENSP00000335369:F451Y;ENSP00000390798:F463Y;ENSP00000327671:F463Y	ENSP00000327671:F463Y	F	+	2	0	AIFM3	19662205	1.000000	0.71417	0.996000	0.52242	0.179000	0.23085	4.402000	0.59722	1.822000	0.53115	0.460000	0.39030	TTT		0.587	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320150.1		NM_144704	
ARHGAP31	57514	hgsc.bcm.edu	37	3	119133104	119133104	+	Silent	SNP	T	T	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:119133104T>C	ENST00000264245.4	+	12	2860	c.2328T>C	c.(2326-2328)aaT>aaC	p.N776N		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	776	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GCCCAGGCAATCTGTCTCCTC	0.577																																					Pancreas(7;176 297 5394 51128 51241)												0													54.0	58.0	57.0					3																	119133104		1948	4146	6094	SO:0001819	synonymous_variant	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2328T>C	3.37:g.119133104T>C		Somatic		WXS	SOLID	Phase_I	Q9ULL6	Silent	SNP	ENST00000264245.4	37	CCDS43135.1																																																																																				0.577	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			
ATM	472	hgsc.bcm.edu;ucsc.edu	37	11	108153496	108153496	+	Silent	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:108153496T>A	ENST00000452508.2	+	26	3825	c.3636T>A	c.(3634-3636)tcT>tcA	p.S1212S	ATM_ENST00000278616.4_Silent_p.S1212S			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1212					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTATGGCATCTCATTTAGATT	0.294			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													90.0	93.0	92.0					11																	108153496		2199	4294	6493	SO:0001819	synonymous_variant	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3636T>A	11.37:g.108153496T>A		Somatic		WXS	SOLID	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	ENST00000452508.2	37	CCDS31669.1																																																																																				0.294	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	
AURKAIP1	54998	hgsc.bcm.edu	37	1	1309259	1309259	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:1309259C>A	ENST00000338370.3	-	3	922	c.522G>T	c.(520-522)agG>agT	p.R174S	AURKAIP1_ENST00000489799.1_5'Flank|AURKAIP1_ENST00000338338.5_Missense_Mutation_p.R174S|AURKAIP1_ENST00000321751.5_Missense_Mutation_p.R174S|AURKAIP1_ENST00000378853.3_Missense_Mutation_p.R174S			Q9NWT8	AKIP_HUMAN	aurora kinase A interacting protein 1	174					negative regulation of mitosis (GO:0045839)|positive regulation of proteolysis (GO:0045862)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|lung(2)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.82e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GCCAGATGCGCCTCAGGTCTT	0.602																																																	0													56.0	61.0	59.0					1																	1309259		2203	4296	6499	SO:0001583	missense	54998				CCDS25.1	1p36.33	2014-02-12			ENSG00000175756	ENSG00000175756			24114	protein-coding gene	gene with protein product		609183				12244051	Standard	NM_017900		Approved	AKIP, AIP, FLJ20608	uc009vkb.1	Q9NWT8	OTTHUMG00000001413	ENST00000338370.3:c.522G>T	1.37:g.1309259C>A	ENSP00000342676:p.Arg174Ser	Somatic		WXS	SOLID	Phase_I	Q5TA36|Q8TBD3	Missense_Mutation	SNP	ENST00000338370.3	37	CCDS25.1	.	.	.	.	.	.	.	.	.	.	c	16.09	3.023137	0.54683	.	.	ENSG00000175756	ENST00000338338;ENST00000338370;ENST00000321751;ENST00000378853	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.53	4.53	0.55603	.	0.534602	0.19548	N	0.111633	T	0.39145	0.1067	L	0.51422	1.61	0.37968	D	0.933205	B	0.25105	0.118	B	0.19666	0.026	T	0.42766	-0.9432	10	0.49607	T	0.09	-7.1833	14.7984	0.69894	0.0:1.0:0.0:0.0	.	174	Q9NWT8	AKIP_HUMAN	S	174	ENSP00000340656:R174S;ENSP00000342676:R174S;ENSP00000319778:R174S;ENSP00000368130:R174S	ENSP00000319778:R174S	R	-	3	2	AURKAIP1	1299122	0.915000	0.31059	0.997000	0.53966	0.779000	0.44077	1.248000	0.32827	2.216000	0.71823	0.655000	0.94253	AGG		0.602	AURKAIP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008273.1		NM_017900	
B4GALNT3	283358	hgsc.bcm.edu;ucsc.edu	37	12	657254	657254	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:657254C>A	ENST00000266383.5	+	8	785	c.772C>A	c.(772-774)Cac>Aac	p.H258N	B4GALNT3_ENST00000544638.1_3'UTR	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	258					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GGGCACCGACCACGTGGAAGT	0.607																																																	0													66.0	60.0	62.0					12																	657254		2203	4300	6503	SO:0001583	missense	283358			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.772C>A	12.37:g.657254C>A	ENSP00000266383:p.His258Asn	Somatic		WXS	SOLID	Phase_I	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728793	0.89390	.	.	ENSG00000139044	ENST00000266383;ENST00000322843	T;T	0.20738	2.05;2.05	4.97	4.97	0.65823	PA14 (2);	0.218153	0.46758	D	0.000272	T	0.54029	0.1833	M	0.87456	2.885	0.58432	D	0.999997	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.64002	-0.6509	10	0.87932	D	0	-35.3749	18.2337	0.89942	0.0:1.0:0.0:0.0	.	160;258	E9PHD9;Q6L9W6	.;B4GN3_HUMAN	N	258;160	ENSP00000266383:H258N;ENSP00000322953:H160N	ENSP00000266383:H258N	H	+	1	0	B4GALNT3	527515	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.781000	0.75068	2.283000	0.76528	0.561000	0.74099	CAC		0.607	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2		NM_173593	
BEST2	54831	hgsc.bcm.edu	37	19	12867047	12867047	+	Silent	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr19:12867047C>T	ENST00000549706.1	+	9	1365	c.1041C>T	c.(1039-1041)taC>taT	p.Y347Y	BEST2_ENST00000553030.1_Silent_p.Y347Y|BEST2_ENST00000042931.1_Silent_p.Y347Y			Q8NFU1	BEST2_HUMAN	bestrophin 2	347					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						GCGCCCCATACACAGCGGCTA	0.627																																																	0													116.0	123.0	121.0					19																	12867047		2101	4224	6325	SO:0001819	synonymous_variant	54831			AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	ENST00000549706.1:c.1041C>T	19.37:g.12867047C>T		Somatic		WXS	SOLID	Phase_I	Q53YQ8|Q9NXP0	Silent	SNP	ENST00000549706.1	37	CCDS42506.1	.	.	.	.	.	.	.	.	.	.	C	0.310	-0.968129	0.02232	.	.	ENSG00000039987	ENST00000552539	.	.	.	4.03	1.79	0.24919	.	.	.	.	.	T	0.58395	0.2119	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54529	-0.8280	4	.	.	.	-13.2136	9.5861	0.39517	0.0:0.8126:0.0:0.1874	.	.	.	.	I	57	.	.	T	+	2	0	BEST2	12728047	1.000000	0.71417	0.995000	0.50966	0.009000	0.06853	3.102000	0.50291	0.907000	0.36646	0.491000	0.48974	ACA		0.627	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403343.1		NM_017682	
MROH8	140699	hgsc.bcm.edu	37	20	35752076	35752077	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr20:35752076_35752077delCA	ENST00000400441.3	-	15	1910_1911	c.1911_1912delTG	c.(1909-1914)tctgatfs	p.D638fs	MROH8_ENST00000441008.2_Frame_Shift_Del_p.D624fs|MROH8_ENST00000217333.8_Frame_Shift_Del_p.D467fs			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	47																	ATGTCGACATCAGACATGGTGA	0.48																																																	0																																										SO:0001589	frameshift_variant	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1911_1912delTG	20.37:g.35752076_35752077delCA	ENSP00000383291:p.Asp638fs	Somatic		WXS	SOLID	Phase_I	Q5JYQ6	Frame_Shift_Del	DEL	ENST00000400441.3	37																																																																																					0.480	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_152503	
BRK1	55845	hgsc.bcm.edu;ucsc.edu	37	3	10167959	10167959	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:10167959A>C	ENST00000530758.1	+	3	318	c.208A>C	c.(208-210)Aaa>Caa	p.K70Q	BRK1_ENST00000256463.6_Missense_Mutation_p.K70Q	NM_018462.4	NP_060932.2	Q8WUW1	BRK1_HUMAN	BRICK1, SCAR/WAVE actin-nucleating complex subunit	70					actin cytoskeleton organization (GO:0030036)|cell motility (GO:0048870)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|protein homotrimerization (GO:0070207)|Rac protein signal transduction (GO:0016601)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(1)|skin(1)	2						ACAGGTGACAAAAGGTGAGAC	0.438																																																	0													41.0	37.0	38.0					3																	10167959		1882	4108	5990	SO:0001583	missense	0			AF161418	CCDS54553.1	3p25.3	2011-06-07	2011-06-07	2011-06-07	ENSG00000254999	ENSG00000254999			23057	protein-coding gene	gene with protein product	"""haematopoietic stem/progenitor cell protein 300"", ""BRICK1, SCAR/WAVE actin-nucleating complex subunit, homolog (Arabidopsis thaliana)"""	611183	"""chromosome 3 open reading frame 10"""	C3orf10		14695531	Standard	NM_018462		Approved	MDS027, HSPC300	uc003bvb.3	Q8WUW1	OTTHUMG00000155400	ENST00000530758.1:c.208A>C	3.37:g.10167959A>C	ENSP00000432472:p.Lys70Gln	Somatic		WXS	SOLID	Phase_I	B2R5E2|Q9P082	Missense_Mutation	SNP	ENST00000530758.1	37	CCDS54553.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.808023	0.50421	.	.	ENSG00000254999	ENST00000530758;ENST00000256463	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	.	.	.	0.38394	D	0.945497	B	0.18610	0.029	B	0.14578	0.011	T	0.52548	-0.8561	8	0.39692	T	0.17	.	13.8402	0.63435	1.0:0.0:0.0:0.0	.	70	Q8WUW1	BRK1_HUMAN	Q	70	.	ENSP00000444659:K70Q	K	+	1	0	BRK1	10142959	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.367000	0.66127	2.157000	0.67596	0.524000	0.50904	AAA		0.438	BRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339900.2		NM_018462	
C7orf61	402573	hgsc.bcm.edu;ucsc.edu	37	7	100061219	100061219	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr7:100061219G>A	ENST00000332375.3	-	2	399	c.154C>T	c.(154-156)Cag>Tag	p.Q52*	RN7SL161P_ENST00000582642.1_RNA|TSC22D4_ENST00000496728.1_5'UTR	NM_001004323.1	NP_001004323.1	Q8IZ16	CG061_HUMAN	chromosome 7 open reading frame 61	52						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|prostate(1)|skin(1)	4						TCAACCACCTGGAGAGTCTTC	0.507																																																	0													61.0	70.0	67.0					7																	100061219		2030	4192	6222	SO:0001587	stop_gained	402573				CCDS47661.1	7q22.1	2013-10-11			ENSG00000185955	ENSG00000185955			22135	protein-coding gene	gene with protein product						12690205	Standard	NM_001004323		Approved	IMAGE:4839025	uc003uuz.1	Q8IZ16	OTTHUMG00000150234	ENST00000332375.3:c.154C>T	7.37:g.100061219G>A	ENSP00000327732:p.Gln52*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000332375.3	37	CCDS47661.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.129|9.129	1.010949|1.010949	0.19277|0.19277	.|.	.|.	ENSG00000185955|ENSG00000185955	ENST00000418952|ENST00000332375	.|.	.|.	.|.	3.93|3.93	-1.71|-1.71	0.08133|0.08133	.|.	.|1.073540	.|0.07357	.|N	.|0.883407	T|.	0.14830|.	0.0358|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.29150|.	-1.0021|.	4|.	.|0.02654	.|T	.|1	-34.5073|-34.5073	11.847|11.847	0.52389|0.52389	0.0:0.0:0.6857:0.3143|0.0:0.0:0.6857:0.3143	.|.	.|.	.|.	.|.	L|X	93|52	.|.	.|ENSP00000327732:Q52X	P|Q	-|-	2|1	0|0	C7orf61|C7orf61	99899155|99899155	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.146000|0.146000	0.21551|0.21551	0.032000|0.032000	0.13732|0.13732	-0.266000|-0.266000	0.09339|0.09339	-0.500000|-0.500000	0.04577|0.04577	CCA|CAG		0.507	C7orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316976.2		NM_001004323	
CABYR	26256	hgsc.bcm.edu	37	18	21735912	21735912	+	Silent	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr18:21735912T>A	ENST00000399496.3	+	4	612	c.447T>A	c.(445-447)acT>acA	p.T149T	CABYR_ENST00000399499.1_Silent_p.T149T|CABYR_ENST00000415309.2_Silent_p.T149T|CABYR_ENST00000327201.6_Silent_p.T51T|CABYR_ENST00000399481.2_Silent_p.T51T|CABYR_ENST00000581397.1_Silent_p.T149T	NM_012189.2|NM_153769.1	NP_036321.2|NP_722453.1	O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	149					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					CCCCTAAGACTACTACCCCAC	0.527																																																	0													130.0	96.0	107.0					18																	21735912		2203	4300	6503	SO:0001819	synonymous_variant	26256			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399496.3:c.447T>A	18.37:g.21735912T>A		Somatic		WXS	SOLID	Phase_I	B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Silent	SNP	ENST00000399496.3	37	CCDS42420.1																																																																																				0.527	CABYR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090926.2		NM_153770	
CCDC154	645811	hgsc.bcm.edu	37	16	1484528	1484528	+	Missense_Mutation	SNP	G	G	A	rs61744665	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr16:1484528G>A	ENST00000389176.3	-	17	2072	c.1906C>T	c.(1906-1908)Cgc>Tgc	p.R636C	CCDC154_ENST00000409671.1_Missense_Mutation_p.R484C	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	636						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						GCCTTCCAGCGCAGCCACCTG	0.711													G|||	574	0.114617	0.2814	0.0504	5008	,	,		8608	0.0516		0.0447	False		,,,				2504	0.0716																0													48.0	43.0	44.0					16																	1484528		692	1591	2283	SO:0001583	missense	645811					16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.1906C>T	16.37:g.1484528G>A	ENSP00000373828:p.Arg636Cys	Somatic		WXS	SOLID	Phase_I	G9JV18	Missense_Mutation	SNP	ENST00000389176.3	37		212	0.09706959706959707	137	0.2784552845528455	14	0.03867403314917127	29	0.050699300699300696	32	0.04221635883905013	G	16.40	3.111505	0.56398	.	.	ENSG00000197599	ENST00000409671;ENST00000389176	.	.	.	4.88	2.8	0.32819	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.47350	0.894	B	0.36186	0.219	T	0.29150	-1.0021	7	0.87932	D	0	-2.2298	11.1302	0.48343	0.0:0.0:0.6666:0.3334	.	636	A6NI56	CC154_HUMAN	C	484;636	.	ENSP00000373828:R636C	R	-	1	0	CCDC154	1424529	0.013000	0.17824	0.213000	0.23690	0.089000	0.18198	0.611000	0.24268	1.038000	0.40049	0.491000	0.48974	CGC		0.711	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_001143980	
CCDC82	79780	hgsc.bcm.edu	37	11	96104275	96104275	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:96104275T>A	ENST00000278520.5	-	6	1539	c.1111A>T	c.(1111-1113)Aaa>Taa	p.K371*	CCDC82_ENST00000423339.2_Nonsense_Mutation_p.K371*|CCDC82_ENST00000542662.1_Nonsense_Mutation_p.K371*			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	371										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		AGCATATCTTTTGCATATGAT	0.313																																																	0													87.0	85.0	85.0					11																	96104275		2201	4298	6499	SO:0001587	stop_gained	79780			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.1111A>T	11.37:g.96104275T>A	ENSP00000278520:p.Lys371*	Somatic		WXS	SOLID	Phase_I	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Nonsense_Mutation	SNP	ENST00000278520.5	37	CCDS8307.1	.	.	.	.	.	.	.	.	.	.	T	40	7.912964	0.98557	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339	.	.	.	5.55	1.29	0.21616	.	0.438124	0.24262	N	0.040061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-1.4011	16.1306	0.81436	0.0:0.0:0.2586:0.7414	.	.	.	.	X	371	.	ENSP00000278520:K371X	K	-	1	0	CCDC82	95743923	0.917000	0.31117	0.373000	0.26003	0.864000	0.49448	0.175000	0.16762	-0.028000	0.13850	-0.468000	0.05107	AAA		0.313	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2		NM_024725	
CD300E	342510	hgsc.bcm.edu	37	17	72619748	72619748	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:72619748G>A	ENST00000328630.3	-	1	53	c.13C>T	c.(13-15)Cca>Tca	p.P5S	CD300E_ENST00000392619.1_Missense_Mutation_p.P32S|CD300E_ENST00000426295.2_Missense_Mutation_p.P46S			Q496F6	CLM2_HUMAN	CD300e molecule	5					innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	19						AGTAGAGCTGGGAGCAGCCAC	0.552																																																	0													126.0	118.0	121.0					17																	72619748		2203	4300	6503	SO:0001583	missense	342510			BX648376	CCDS11702.1	17q25.1	2013-01-11	2006-03-28	2006-02-22	ENSG00000186407	ENSG00000186407		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	28874	protein-coding gene	gene with protein product		609801	"""CD300 antigen like family member E"", ""CD300e antigen"""	CD300LE		15549731, 15557162	Standard	NM_181449		Approved	IREM2, CLM2	uc002jlb.2	Q496F6	OTTHUMG00000067605	ENST00000328630.3:c.13C>T	17.37:g.72619748G>A	ENSP00000329942:p.Pro5Ser	Somatic		WXS	SOLID	Phase_I	B4DNS1|Q7Z7I3	Missense_Mutation	SNP	ENST00000328630.3	37	CCDS11702.1	.	.	.	.	.	.	.	.	.	.	G	0.137	-1.107083	0.01813	.	.	ENSG00000186407	ENST00000392619;ENST00000426295;ENST00000328630	T;T;T	0.03301	4.0;3.98;4.03	3.87	-4.37	0.03633	Immunoglobulin-like (1);	2.834750	0.01394	N	0.013347	T	0.02193	0.0068	N	0.16478	0.41	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.42413	-0.9453	10	0.15499	T	0.54	3.4174	2.2993	0.04158	0.2009:0.4314:0.2221:0.1457	.	5	Q496F6	CLM2_HUMAN	S	32;46;5	ENSP00000376395:P32S;ENSP00000416642:P46S;ENSP00000329942:P5S	ENSP00000329942:P5S	P	-	1	0	CD300E	70131343	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.102000	0.15272	-0.529000	0.06358	0.436000	0.28706	CCA		0.552	CD300E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_181449	
C10orf105	414152	hgsc.bcm.edu	37	10	73483833	73483833	+	Intron	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr10:73483833T>A	ENST00000398786.2	-	2	97				CDH23_ENST00000224721.6_Missense_Mutation_p.F1139Y	NM_001168390.1	NP_001161862.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)											GAGGGCGAGTTTGGGCGTGTG	0.587																																																	0													64.0	73.0	70.0					10																	73483833		2055	4163	6218	SO:0001627	intron_variant	64072			AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427	ENST00000398786.2:c.5-7734A>T	10.37:g.73483833T>A		Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000398786.2	37	CCDS44430.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	15.87|15.87	2.960940|2.960940	0.53400|0.53400	.|.	.|.	ENSG00000107736|ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721|ENST00000398792	.|.	.|.	.|.	4.89|4.89	3.7|3.7	0.42460|0.42460	Cadherin (4);Cadherin-like (1);|.	0.136086|.	0.45361|.	D|.	0.000373|.	T|T	0.40719|0.40719	0.1128|0.1128	N|N	0.13327|0.13327	0.33|0.33	0.80722|0.80722	D|D	1|1	B;B|.	0.15719|.	0.014;0.001|.	B;B|.	0.16722|.	0.016;0.01|.	T|T	0.42396|0.42396	-0.9454|-0.9454	9|6	0.56958|0.87932	D|D	0.05|0	.|.	7.6788|7.6788	0.28500|0.28500	0.4629:0.0:0.0:0.5371|0.4629:0.0:0.0:0.5371	.|.	1134;1134|.	Q6P152;Q9H251|.	.;CAD23_HUMAN|.	Y|M	1139;1134;1137|5	.|.	ENSP00000224721:F1139Y|ENSP00000381772:L5M	F|L	+|+	2|1	0|2	CDH23|CDH23	73153839|73153839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.761000|0.761000	0.43186|0.43186	5.557000|5.557000	0.67313|0.67313	1.827000|1.827000	0.53221|0.53221	0.449000|0.449000	0.29647|0.29647	TTT|TTG		0.587	C10orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048551.2		NM_001164375	
CDK2	1017	hgsc.bcm.edu	37	12	56363324	56363324	+	Silent	SNP	G	G	A	rs201952329		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:56363324G>A	ENST00000266970.4	+	5	792	c.552G>A	c.(550-552)gtG>gtA	p.V184V	RP11-973D8.4_ENST00000554022.1_RNA|PMEL_ENST00000548689.1_5'Flank|CDK2_ENST00000556656.1_3'UTR|PMEL_ENST00000539511.1_5'Flank|CDK2_ENST00000553376.1_Silent_p.V184V|PMEL_ENST00000548747.1_5'Flank|PMEL_ENST00000360714.4_5'Flank|PMEL_ENST00000536427.1_5'Flank|CDK2_ENST00000354056.4_Intron|PMEL_ENST00000552882.1_5'Flank|CDK2_ENST00000440311.2_Intron|PMEL_ENST00000548493.1_5'Flank	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	184	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	CCACAGCTGTGGACATCTGGA	0.577																																																	0													102.0	90.0	94.0					12																	56363324		2203	4300	6503	SO:0001819	synonymous_variant	1017			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.552G>A	12.37:g.56363324G>A		Somatic		WXS	SOLID	Phase_I	A8K7C6|O75100	Silent	SNP	ENST00000266970.4	37	CCDS8898.1																																																																																				0.577	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409650.1			
CDR1	1038	hgsc.bcm.edu;ucsc.edu	37	X	139865947	139865947	+	Silent	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chrX:139865947G>A	ENST00000370532.2	-	1	776	c.585C>T	c.(583-585)atC>atT	p.I195I		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	195	5 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				TCTTCCTGAAGATCCACGTCT	0.443																																																	0													128.0	124.0	125.0					X																	139865947		2203	4300	6503	SO:0001819	synonymous_variant	1038				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.585C>T	X.37:g.139865947G>A		Somatic		WXS	SOLID	Phase_I	Q5JXH6	Silent	SNP	ENST00000370532.2	37	CCDS14670.1																																																																																				0.443	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1		NM_004065	
CLIP1	6249	hgsc.bcm.edu;ucsc.edu	37	12	122812834	122812834	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:122812834C>G	ENST00000540338.1	-	15	3048	c.3007G>C	c.(3007-3009)Gaa>Caa	p.E1003Q	CLIP1_ENST00000302528.7_Missense_Mutation_p.E992Q|CLIP1_ENST00000361654.4_Missense_Mutation_p.E881Q|CLIP1_ENST00000545889.1_Missense_Mutation_p.E578Q|CLIP1_ENST00000358808.2_Missense_Mutation_p.E992Q|CLIP1_ENST00000537178.1_Missense_Mutation_p.E957Q			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1003					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTCTCCAATTCTTTCTTTTCT	0.453																																																	0													309.0	305.0	306.0					12																	122812834		2203	4300	6503	SO:0001583	missense	6249				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3007G>C	12.37:g.122812834C>G	ENSP00000439093:p.Glu1003Gln	Somatic		WXS	SOLID	Phase_I	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.200657	0.38905	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000392458;ENST00000537178;ENST00000540338	T;T;T;T;T	0.54866	2.62;0.55;0.55;0.66;0.63	5.25	4.35	0.52113	.	0.460721	0.25714	N	0.028794	T	0.41673	0.1169	L	0.51422	1.61	0.31510	N	0.663688	B;B;B	0.28400	0.21;0.127;0.134	B;B;B	0.29942	0.109;0.109;0.051	T	0.42241	-0.9463	10	0.29301	T	0.29	-5.8324	5.2333	0.15434	0.0:0.716:0.0:0.284	.	957;992;1003	P30622-2;P30622-1;P30622	.;.;CLIP1_HUMAN	Q	578;992;992;722;34;957;1003	ENSP00000438743:E578Q;ENSP00000303585:E992Q;ENSP00000351665:E992Q;ENSP00000445531:E957Q;ENSP00000439093:E1003Q	ENSP00000303585:E992Q	E	-	1	0	CLIP1	121378787	0.784000	0.28713	0.923000	0.36655	0.848000	0.48234	2.517000	0.45529	2.613000	0.88420	0.561000	0.74099	GAA		0.453	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1		NM_002956	
CLUL1	27098	hgsc.bcm.edu	37	18	644931	644931	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr18:644931G>C	ENST00000400606.2	+	8	1376	c.1231G>C	c.(1231-1233)Gga>Cga	p.G411R	CLUL1_ENST00000579494.1_Missense_Mutation_p.G411R|CLUL1_ENST00000540035.1_Missense_Mutation_p.G463R|CLUL1_ENST00000338387.7_Missense_Mutation_p.G411R|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000581619.1_Missense_Mutation_p.G436R	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	411					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						GATTCATGAAGGAAATATTTC	0.353																																																	0													89.0	83.0	85.0					18																	644931		1843	4101	5944	SO:0001583	missense	27098			D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1231G>C	18.37:g.644931G>C	ENSP00000383449:p.Gly411Arg	Somatic		WXS	SOLID	Phase_I	A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	37	CCDS42405.1	.	.	.	.	.	.	.	.	.	.	G	5.685	0.310943	0.10733	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.26067	1.76;1.76;1.76	4.87	3.96	0.45880	Clusterin, C-terminal (1);	0.471068	0.23692	N	0.045513	T	0.25717	0.0626	M	0.64997	1.995	0.49299	D	0.999777	B;B	0.27679	0.185;0.09	B;B	0.29716	0.106;0.105	T	0.05289	-1.0894	10	0.41790	T	0.15	-2.791	7.6923	0.28575	0.2087:0.0:0.7913:0.0	.	463;411	F5GWQ8;Q15846	.;CLUL1_HUMAN	R	411;463;411	ENSP00000383449:G411R;ENSP00000441726:G463R;ENSP00000341128:G411R	ENSP00000341128:G411R	G	+	1	0	CLUL1	634931	1.000000	0.71417	0.370000	0.25965	0.124000	0.20399	2.233000	0.43027	1.196000	0.43129	0.591000	0.81541	GGA		0.353	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			
CNTNAP3	79937	hgsc.bcm.edu	37	9	39103796	39103796	+	Silent	SNP	G	G	A	rs145100345	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr9:39103796G>A	ENST00000297668.6	-	16	2554	c.2481C>T	c.(2479-2481)tcC>tcT	p.S827S	CNTNAP3_ENST00000377656.2_Silent_p.S826S|CNTNAP3_ENST00000358144.2_Silent_p.S739S	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	827	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S827S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TAAACACCCCGGAGGAAACTG	0.483													G|||	11	0.00219649	0.0015	0.0	5008	,	,		15781	0.002		0.002	False		,,,				2504	0.0051																1	Substitution - coding silent(1)	endometrium(1)						G		4,4402	6.2+/-15.9	0,4,2199	34.0	39.0	38.0		2481	-5.6	0.8	9	dbSNP_134	38	6,8594	4.3+/-15.6	0,6,4294	no	coding-synonymous	CNTNAP3	NM_033655.3		0,10,6493	AA,AG,GG		0.0698,0.0908,0.0769		827/1289	39103796	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2481C>T	9.37:g.39103796G>A		Somatic		WXS	SOLID	Phase_I	B1AMA0|Q9C0E9	Silent	SNP	ENST00000297668.6	37	CCDS6616.1																																																																																				0.483	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1		NM_033655	
COL21A1	81578	hgsc.bcm.edu;ucsc.edu	37	6	55942327	55942327	+	Splice_Site	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr6:55942327C>A	ENST00000244728.5	-	18	2254	c.1857G>T	c.(1855-1857)aaG>aaT	p.K619N	COL21A1_ENST00000535941.1_Splice_Site_p.K619N|COL21A1_ENST00000370819.1_Splice_Site_p.K616N|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370808.2_Splice_Site_p.K19N	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	619					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			GAATACTTACCTTTTGGCCCA	0.313																																																	0													48.0	45.0	46.0					6																	55942327		1817	4056	5873	SO:0001630	splice_region_variant	81578			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1857+1G>T	6.37:g.55942327C>A		Somatic		WXS	SOLID	Phase_I	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237605	0.39598	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	T;T;T;D	0.93604	1.57;1.57;1.57;-3.25	5.12	2.14	0.27477	.	0.000000	0.64402	D	0.000015	D	0.92606	0.7651	L	0.60957	1.885	0.43421	D	0.995574	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.80764	0.994;0.987;0.986	D	0.90599	0.4543	9	.	.	.	.	7.5845	0.27985	0.0:0.6979:0.0:0.3021	.	19;619;619	Q96P44-2;B7ZLK3;Q96P44	.;.;COLA1_HUMAN	N	619;616;619;616;19	ENSP00000244728:K619N;ENSP00000359855:K616N;ENSP00000444384:K619N;ENSP00000359844:K19N	.	K	-	3	2	COL21A1	56050286	0.991000	0.36638	0.986000	0.45419	0.772000	0.43724	-0.002000	0.12924	0.459000	0.27016	0.650000	0.86243	AAG		0.313	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			Missense_Mutation
CTTNBP2NL	55917	hgsc.bcm.edu;ucsc.edu	37	1	112997122	112997122	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:112997122G>T	ENST00000271277.6	+	5	607	c.382G>T	c.(382-384)Gaa>Taa	p.E128*		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	128					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGATACGGCTGAAGGAGATGA	0.418																																																	0													131.0	123.0	125.0					1																	112997122		2203	4300	6503	SO:0001587	stop_gained	55917			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.382G>T	1.37:g.112997122G>T	ENSP00000271277:p.Glu128*	Somatic		WXS	SOLID	Phase_I	B3KMS5|Q96B40	Nonsense_Mutation	SNP	ENST00000271277.6	37	CCDS845.1	.	.	.	.	.	.	.	.	.	.	G	38	6.747334	0.97809	.	.	ENSG00000143079	ENST00000271277;ENST00000441739	.	.	.	6.04	6.04	0.98038	.	0.197108	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-21.7777	20.1899	0.98228	0.0:0.0:1.0:0.0	.	.	.	.	X	128	.	ENSP00000271277:E128X	E	+	1	0	CTTNBP2NL	112798645	1.000000	0.71417	0.997000	0.53966	0.928000	0.56348	7.457000	0.80775	2.873000	0.98535	0.563000	0.77884	GAA		0.418	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1		NM_018704	
CRNN	49860	hgsc.bcm.edu	37	1	152384629	152384629	+	Silent	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:152384629C>T	ENST00000271835.3	-	2	143	c.81G>A	c.(79-81)gcG>gcA	p.A27A	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	27			A -> V (in dbSNP:rs35639220).		response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCGGGTGAGCGCTGTGCAGT	0.537																																																	0													147.0	128.0	134.0					1																	152384629		2203	4300	6503	SO:0001819	synonymous_variant	49860			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.81G>A	1.37:g.152384629C>T		Somatic		WXS	SOLID	Phase_I	B2RE60|Q8N613	Silent	SNP	ENST00000271835.3	37	CCDS1010.1																																																																																				0.537	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1		NM_016190	
DDIT4L	115265	hgsc.bcm.edu	37	4	101109221	101109221	+	Silent	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr4:101109221C>A	ENST00000273990.2	-	3	409	c.195G>T	c.(193-195)ctG>ctT	p.L65L	RP11-588P8.1_ENST00000515782.1_RNA|RP11-15B17.1_ENST00000515026.1_RNA	NM_145244.3	NP_660287.1	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like	65					negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(2)	12				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)		TTGATTTGGACAGACAGTTCT	0.438																																																	0													126.0	126.0	126.0					4																	101109221		2203	4300	6503	SO:0001819	synonymous_variant	115265			BC013592	CCDS34036.1	4q23	2008-02-05				ENSG00000145358			30555	protein-coding gene	gene with protein product	"""regulated in development and DNA damage response 2"", "" similar to Smhs1 protein"""	607730				12477932	Standard	NM_145244		Approved	REDD2, Rtp801L	uc003hvq.3	Q96D03		ENST00000273990.2:c.195G>T	4.37:g.101109221C>A		Somatic		WXS	SOLID	Phase_I	B2R7C3	Silent	SNP	ENST00000273990.2	37	CCDS34036.1																																																																																				0.438	DDIT4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363423.1		NM_145244	
DDX54	79039	hgsc.bcm.edu	37	12	113603616	113603616	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:113603616G>A	ENST00000306014.5	-	13	1663	c.1636C>T	c.(1636-1638)Ccc>Tcc	p.P546S	DDX54_ENST00000314045.7_Missense_Mutation_p.P546S	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	546					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)	p.P546S(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTGAAGAGGGGGTGCAGGCCC	0.642																																																	1	Substitution - Missense(1)	skin(1)											36.0	36.0	36.0					12																	113603616		2203	4300	6503	SO:0001583	missense	79039			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.1636C>T	12.37:g.113603616G>A	ENSP00000304072:p.Pro546Ser	Somatic		WXS	SOLID	Phase_I	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	37	CCDS31907.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.82|18.82	3.705756|3.705756	0.68615|0.68615	.|.	.|.	ENSG00000123064|ENSG00000123064	ENST00000546898|ENST00000314045;ENST00000306014	.|T;T	.|0.12672	.|2.67;2.66	4.55|4.55	4.55|4.55	0.56014|0.56014	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.46908|0.46908	0.1417|0.1417	M|M	0.91663|0.91663	3.23|3.23	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.79784	.|0.993;0.984	T|T	0.60934|0.60934	-0.7164|-0.7164	6|10	.|0.87932	.|D	.|0	.|.	17.1136|17.1136	0.86682|0.86682	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|546;546	.|Q8TDD1-2;Q8TDD1	.|.;DDX54_HUMAN	L|S	21|546	.|ENSP00000323858:P546S;ENSP00000304072:P546S	.|ENSP00000304072:P546S	P|P	-|-	2|1	0|0	DDX54|DDX54	112087999|112087999	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.889000|0.889000	0.51656|0.51656	7.158000|7.158000	0.77470|0.77470	2.354000|2.354000	0.79902|0.79902	0.561000|0.561000	0.74099|0.74099	CCC|CCC		0.642	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1		NM_024072	
DHCR7	1717	hgsc.bcm.edu	37	11	71152418	71152418	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:71152418T>C	ENST00000355527.3	-	6	757	c.481A>G	c.(481-483)Aac>Gac	p.N161D	DHCR7_ENST00000407721.2_Missense_Mutation_p.N161D	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	161					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)	p.N161H(1)		endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						AGATGAGCGTTTGCAAACCAG	0.542									Smith-Lemli-Opitz syndrome																																								1	Substitution - Missense(1)	liver(1)											173.0	127.0	143.0					11																	71152418		2200	4294	6494	SO:0001583	missense	1717	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.481A>G	11.37:g.71152418T>C	ENSP00000347717:p.Asn161Asp	Somatic		WXS	SOLID	Phase_I	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	ENST00000355527.3	37	CCDS8200.1	.	.	.	.	.	.	.	.	.	.	T	13.27	2.185690	0.38609	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000524694;ENST00000527316;ENST00000526780	D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.02	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.97558	0.9200	M	0.67953	2.075	0.48901	D	0.999729	D	0.59357	0.985	P	0.58928	0.848	D	0.96308	0.9226	10	0.23302	T	0.38	-38.9747	11.4081	0.49911	0.0:0.0:0.0:1.0	.	161	Q9UBM7	DHCR7_HUMAN	D	161;161;173;129;161	ENSP00000384739:N161D;ENSP00000347717:N161D;ENSP00000435047:N129D;ENSP00000435668:N161D	ENSP00000347717:N161D	N	-	1	0	DHCR7	70830066	1.000000	0.71417	0.002000	0.10522	0.003000	0.03518	6.954000	0.76001	1.654000	0.50703	0.260000	0.18958	AAC		0.542	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1		NM_001360	
DHX40	79665	hgsc.bcm.edu	37	17	57656854	57656854	+	Silent	SNP	C	C	T	rs375795771		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:57656854C>T	ENST00000251241.4	+	9	1242	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	DHX40_ENST00000425628.3_Silent_p.F288F|DHX40_ENST00000451169.2_Silent_p.F317F	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	365	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATGGTGGCTTCGTGAAGCAGT	0.358																																																	0													38.0	57.0	53.0					17																	57656854		984	4080	5064	SO:0001819	synonymous_variant	79665			AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.1095C>T	17.37:g.57656854C>T		Somatic		WXS	SOLID	Phase_I	B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Silent	SNP	ENST00000251241.4	37	CCDS11617.1																																																																																				0.358	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446095.1		NM_024612	
DNAH5	1767	hgsc.bcm.edu;ucsc.edu	37	5	13793789	13793789	+	Missense_Mutation	SNP	T	T	C	rs139797525		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:13793789T>C	ENST00000265104.4	-	49	8163	c.8059A>G	c.(8059-8061)Aat>Gat	p.N2687D		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2687	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCTCTAGATTATAGAATCCA	0.453									Kartagener syndrome																																								0								T	ASP/ASN	0,4406		0,0,2203	96.0	99.0	98.0		8059	5.6	1.0	5	dbSNP_134	98	2,8598	2.2+/-6.3	0,2,4298	yes	missense	DNAH5	NM_001369.2	23	0,2,6501	CC,CT,TT		0.0233,0.0,0.0154	benign	2687/4625	13793789	2,13004	2203	4300	6503	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8059A>G	5.37:g.13793789T>C	ENSP00000265104:p.Asn2687Asp	Somatic		WXS	SOLID	Phase_I	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.426436	0.62733	0.0	2.33E-4	ENSG00000039139	ENST00000265104	T	0.23147	1.92	5.64	5.64	0.86602	ATPase, AAA+ type, core (1);	0.097978	0.64402	D	0.000002	T	0.17534	0.0421	N	0.13352	0.335	0.80722	D	1	B	0.20988	0.05	B	0.27608	0.081	T	0.10154	-1.0642	10	0.15499	T	0.54	.	15.8526	0.78943	0.0:0.0:0.0:1.0	.	2687	Q8TE73	DYH5_HUMAN	D	2687	ENSP00000265104:N2687D	ENSP00000265104:N2687D	N	-	1	0	DNAH5	13846789	1.000000	0.71417	0.990000	0.47175	0.688000	0.40055	7.905000	0.87416	2.156000	0.67533	0.377000	0.23210	AAT		0.453	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2		NM_001369	
DNAJC10	54431	hgsc.bcm.edu;ucsc.edu	37	2	183640093	183640093	+	Silent	SNP	T	T	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:183640093T>C	ENST00000264065.7	+	23	2731	c.2316T>C	c.(2314-2316)gcT>gcC	p.A772A		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	772	Thioredoxin 4. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AAGCAATCGCTGCCTTAATAA	0.323																																					Pancreas(56;860 1183 25669 35822 48585)												0													43.0	43.0	43.0					2																	183640093		2202	4300	6502	SO:0001819	synonymous_variant	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.2316T>C	2.37:g.183640093T>C		Somatic		WXS	SOLID	Phase_I	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	37	CCDS33345.1																																																																																				0.323	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2		NM_018981	
EXOSC2	23404	hgsc.bcm.edu	37	9	133578519	133578519	+	Missense_Mutation	SNP	T	T	A	rs566092143		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr9:133578519T>A	ENST00000372358.5	+	8	823	c.752T>A	c.(751-753)cTg>cAg	p.L251Q	EXOSC2_ENST00000372352.3_Missense_Mutation_p.L243Q|EXOSC2_ENST00000467138.1_3'UTR|EXOSC2_ENST00000372351.3_Missense_Mutation_p.L221Q|EXOSC2_ENST00000546165.1_Missense_Mutation_p.L225Q			Q13868	EXOS2_HUMAN	exosome component 2	251					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		AGGATGATGCTGTATGATACC	0.517																																					Pancreas(134;1683 1824 10118 27928 31640)												0													151.0	127.0	135.0					9																	133578519		2203	4300	6503	SO:0001583	missense	23404			AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.752T>A	9.37:g.133578519T>A	ENSP00000361433:p.Leu251Gln	Somatic		WXS	SOLID	Phase_I	A3KFL3|B4DKK6|Q9NUY4	Missense_Mutation	SNP	ENST00000372358.5	37	CCDS6935.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.801952	0.90538	.	.	ENSG00000130713	ENST00000372358;ENST00000546165;ENST00000372352;ENST00000372351;ENST00000495699	.	.	.	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000001	D	0.84642	0.5517	M	0.90369	3.11	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.971;0.998	D	0.88028	0.2773	9	0.87932	D	0	-11.4367	14.7885	0.69821	0.0:0.0:0.0:1.0	.	225;251	B4DKK6;Q13868	.;EXOS2_HUMAN	Q	251;225;243;221;228	.	ENSP00000361426:L221Q	L	+	2	0	EXOSC2	132568340	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	7.997000	0.88414	2.141000	0.66446	0.528000	0.53228	CTG		0.517	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054673.1		NM_014285	
FAM65B	9750	hgsc.bcm.edu	37	6	24828490	24828490	+	Missense_Mutation	SNP	C	C	T	rs9461073	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr6:24828490C>T	ENST00000259698.4	-	19	2778	c.2603G>A	c.(2602-2604)cGg>cAg	p.R868Q	FAM65B_ENST00000538035.1_Missense_Mutation_p.R847Q	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	868			R -> Q (in dbSNP:rs9461073). {ECO:0000269|PubMed:9205841}.		cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						AGGCTCAGCCCGGTCCAGAAT	0.483													C|||	1136	0.226837	0.3812	0.2161	5008	,	,		18254	0.1786		0.172	False		,,,				2504	0.1319																0								C	GLN/ARG	479,905		99,281,312	48.0	47.0	47.0		2603	1.1	0.1	6	dbSNP_119	47	621,2561		61,499,1031	yes	missense	FAM65B	NM_014722.2	43	160,780,1343	TT,TC,CC		19.516,34.6098,24.0911	probably-damaging	868/1069	24828490	1100,3466	692	1591	2283	SO:0001583	missense	9750			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.2603G>A	6.37:g.24828490C>T	ENSP00000259698:p.Arg868Gln	Somatic		WXS	SOLID	Phase_I	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	501	0.22939560439560439	172	0.34959349593495936	82	0.2265193370165746	117	0.20454545454545456	130	0.17150395778364116	C	8.286	0.816702	0.16607	0.346098	0.19516	ENSG00000111913	ENST00000259698;ENST00000538035	T;T	0.77489	-1.1;-1.1	5.92	1.15	0.20763	.	0.325476	0.35466	N	0.003186	T	0.54303	0.1850	M	0.63843	1.955	0.23882	P	0.9965719	B;B	0.25390	0.068;0.125	B;B	0.16722	0.007;0.016	T	0.38329	-0.9666	9	0.23302	T	0.38	-8.9543	11.5826	0.50900	0.0:0.6318:0.0:0.3682	rs9461073;rs12183109;rs52829952;rs56611383;rs61535973;rs12183109	847;868	F5GX51;Q9Y4F9	.;FA65B_HUMAN	Q	868;847	ENSP00000259698:R868Q;ENSP00000441138:R847Q	ENSP00000259698:R868Q	R	-	2	0	FAM65B	24936469	0.986000	0.35501	0.050000	0.19076	0.446000	0.32137	2.234000	0.43035	-0.061000	0.13110	-1.945000	0.00491	CGG		0.483	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			
FAM69C	125704	hgsc.bcm.edu	37	18	72103854	72103854	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr18:72103854T>A	ENST00000343998.6	-	4	1150	c.1142A>T	c.(1141-1143)gAa>gTa	p.E381V	FAM69C_ENST00000400291.2_Missense_Mutation_p.E82V	NM_001044369.2	NP_001037834.2	Q0P6D2	FA69C_HUMAN	family with sequence similarity 69, member C	381						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|ovary(2)	5						GTCTGCACATTCCTGCACCGC	0.577																																																	0													28.0	32.0	30.0					18																	72103854		1901	4123	6024	SO:0001583	missense	125704			BC019628	CCDS42445.2	18q22.3	2012-08-03	2009-07-23	2009-07-23	ENSG00000187773	ENSG00000187773			31729	protein-coding gene	gene with protein product		614544	"""chromosome 18 open reading frame 51"""	C18orf51		21334309	Standard	NM_001044369		Approved		uc002llk.3	Q0P6D2	OTTHUMG00000156984	ENST00000343998.6:c.1142A>T	18.37:g.72103854T>A	ENSP00000344331:p.Glu381Val	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000343998.6	37	CCDS42445.2	.	.	.	.	.	.	.	.	.	.	T	16.00	2.999565	0.54147	.	.	ENSG00000187773	ENST00000400291;ENST00000343998	.	.	.	4.95	3.79	0.43588	.	0.176546	0.48767	D	0.000165	T	0.68860	0.3047	M	0.64997	1.995	0.51482	D	0.999925	D	0.76494	0.999	D	0.66716	0.946	T	0.71461	-0.4586	9	0.66056	D	0.02	-11.1855	10.3096	0.43702	0.0:0.0782:0.0:0.9218	.	381	Q0P6D2	FA69C_HUMAN	V	82;381	.	ENSP00000344331:E381V	E	-	2	0	FAM69C	70254834	0.989000	0.36119	0.460000	0.27093	0.161000	0.22273	2.681000	0.46926	2.011000	0.59026	0.456000	0.33151	GAA		0.577	FAM69C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346971.2		XM_058931	
FAM78A	286336	hgsc.bcm.edu	37	9	134136486	134136486	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr9:134136486C>A	ENST00000372271.3	-	2	942	c.575G>T	c.(574-576)tGg>tTg	p.W192L	FAM78A_ENST00000372269.3_Missense_Mutation_p.W189L|FAM78A_ENST00000247295.4_5'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	192										NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		GGCCACCAGCCAGGTGGTGAA	0.602																																																	0													103.0	93.0	97.0					9																	134136486		2203	4300	6503	SO:0001583	missense	286336			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.575G>T	9.37:g.134136486C>A	ENSP00000361345:p.Trp192Leu	Somatic		WXS	SOLID	Phase_I	Q86VQ9|Q9H7P4	Missense_Mutation	SNP	ENST00000372271.3	37	CCDS6941.2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824139	0.90873	.	.	ENSG00000126882	ENST00000372269;ENST00000372271;ENST00000464831	D;D;D	0.92911	-3.13;-3.13;-3.13	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.95717	0.8607	M	0.75777	2.31	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.96300	0.9220	10	0.87932	D	0	-16.7531	17.1064	0.86664	0.0:1.0:0.0:0.0	.	192;189	Q5JUQ0;Q5JUQ2	FA78A_HUMAN;.	L	189;192;161	ENSP00000361343:W189L;ENSP00000361345:W192L;ENSP00000419959:W161L	ENSP00000361343:W189L	W	-	2	0	FAM78A	133126307	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.776000	0.85560	2.337000	0.79520	0.462000	0.41574	TGG		0.602	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054720.1		NM_033387	
FAM83B	222584	hgsc.bcm.edu;ucsc.edu	37	6	54791190	54791190	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr6:54791190A>T	ENST00000306858.7	+	3	582	c.466A>T	c.(466-468)Ata>Tta	p.I156L		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	156										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					AGTGATGGATATATTTACAGA	0.308																																																	0													86.0	91.0	89.0					6																	54791190		2203	4298	6501	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.466A>T	6.37:g.54791190A>T	ENSP00000304078:p.Ile156Leu	Somatic		WXS	SOLID	Phase_I	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	14.46	2.542572	0.45280	.	.	ENSG00000168143	ENST00000306858	T	0.15372	2.43	5.31	2.94	0.34122	.	0.389260	0.30800	N	0.008846	T	0.02230	0.0069	N	0.04132	-0.27	0.20403	N	0.99991	B	0.16396	0.017	B	0.17722	0.019	T	0.44907	-0.9297	10	0.32370	T	0.25	-4.3401	8.9183	0.35596	0.8451:0.0:0.1549:0.0	.	156	Q5T0W9	FA83B_HUMAN	L	156	ENSP00000304078:I156L	ENSP00000304078:I156L	I	+	1	0	FAM83B	54899149	1.000000	0.71417	0.963000	0.40424	0.904000	0.53231	1.451000	0.35145	0.349000	0.23975	0.460000	0.39030	ATA		0.308	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1		XM_294139	
FOXO1	2308	hgsc.bcm.edu	37	13	41134062	41134062	+	Silent	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr13:41134062A>G	ENST00000379561.5	-	2	1950	c.1566T>C	c.(1564-1566)caT>caC	p.H522H	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	522	Sufficient for interaction with NLK. {ECO:0000250}.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)		PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		CAGGGTGGGTATGGGAGCTGG	0.572																																																	0													119.0	107.0	111.0					13																	41134062		2203	4300	6503	SO:0001819	synonymous_variant	2308				CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.1566T>C	13.37:g.41134062A>G		Somatic		WXS	SOLID	Phase_I	O43523|Q5VYC7|Q6NSK6	Silent	SNP	ENST00000379561.5	37	CCDS9371.1																																																																																				0.572	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3		NM_002015	
FYB	2533	hgsc.bcm.edu	37	5	39137714	39137714	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:39137714C>G	ENST00000351578.6	-	7	1693	c.1503G>C	c.(1501-1503)aaG>aaC	p.K501N	FYB_ENST00000515010.1_Missense_Mutation_p.K501N|FYB_ENST00000505428.1_Missense_Mutation_p.K501N|FYB_ENST00000512982.1_Missense_Mutation_p.K501N|FYB_ENST00000540520.1_Missense_Mutation_p.K511N	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	501					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TAAAtttcttctttatttctt	0.333																																																	0													344.0	294.0	310.0					5																	39137714		932	2074	3006	SO:0001583	missense	2533			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1503G>C	5.37:g.39137714C>G	ENSP00000316460:p.Lys501Asn	Somatic		WXS	SOLID	Phase_I	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	37	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.353385	0.41700	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.26810	1.71;1.71;1.75;1.75;1.75	4.48	4.48	0.54585	Src homology-3 domain (1);	0.965179	0.08617	N	0.919000	T	0.32224	0.0822	L	0.53249	1.67	0.32653	N	0.51908	P;P	0.44627	0.501;0.839	B;B	0.43623	0.086;0.425	T	0.37314	-0.9711	10	0.62326	D	0.03	-0.0866	12.9708	0.58511	0.0:1.0:0.0:0.0	.	511;501	B4DLN2;O15117	.;FYB_HUMAN	N	501;501;501;501;511;501	ENSP00000316460:K501N;ENSP00000426346:K501N;ENSP00000425845:K501N;ENSP00000427114:K501N;ENSP00000442840:K511N	ENSP00000316460:K501N	K	-	3	2	FYB	39173471	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.758000	0.47565	2.776000	0.95493	0.655000	0.94253	AAG		0.333	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1		NM_001465	
G6PD	2539	hgsc.bcm.edu	37	X	153763534	153763534	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chrX:153763534A>G	ENST00000393564.2	-	5	446	c.334T>C	c.(334-336)Tac>Cac	p.Y112H	G6PD_ENST00000497281.1_5'UTR|G6PD_ENST00000393562.2_Missense_Mutation_p.Y142H|G6PD_ENST00000369620.2_Missense_Mutation_p.Y112H	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	112					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCATCATCGTACTGGCCAGCC	0.607																																																	0													122.0	76.0	92.0					X																	153763534		2203	4300	6503	SO:0001583	missense	2539			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.334T>C	X.37:g.153763534A>G	ENSP00000377194:p.Tyr112His	Somatic		WXS	SOLID	Phase_I	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789846	0.50102	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620;ENST00000439227;ENST00000440967;ENST00000433845	D;D;D;D;D;D	0.98345	-4.88;-4.88;-4.88;-4.88;-4.88;-4.88	5.67	4.48	0.54585	NAD(P)-binding domain (1);Glucose-6-phosphate dehydrogenase, NAD-binding (1);	0.000000	0.85682	D	0.000000	D	0.99199	0.9722	H	0.96861	3.895	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98633	1.0672	10	0.87932	D	0	.	9.3033	0.37858	0.8368:0.0:0.0:0.1632	.	112;142	P11413;P11413-3	G6PD_HUMAN;.	H	142;112;112;112;112;112;112	ENSP00000377192:Y142H;ENSP00000377194:Y112H;ENSP00000358633:Y112H;ENSP00000395599:Y112H;ENSP00000400648:Y112H;ENSP00000394690:Y112H	ENSP00000291567:Y112H	Y	-	1	0	G6PD	153416728	1.000000	0.71417	0.691000	0.30163	0.051000	0.14879	8.868000	0.92320	0.746000	0.32786	0.486000	0.48141	TAC		0.607	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3		NM_000402	
GGT7	2686	hgsc.bcm.edu	37	20	33437824	33437824	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr20:33437824C>T	ENST00000336431.5	-	14	1809	c.1765G>A	c.(1765-1767)Gac>Aac	p.D589N	GGT7_ENST00000469018.1_5'UTR	NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	589					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						GCCAGGCTGTCACTCAGGTTC	0.612																																																	0													37.0	41.0	40.0					20																	33437824		1943	4134	6077	SO:0001583	missense	2686			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.1765G>A	20.37:g.33437824C>T	ENSP00000338964:p.Asp589Asn	Somatic		WXS	SOLID	Phase_I	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	ENST00000336431.5	37	CCDS13242.2	.	.	.	.	.	.	.	.	.	.	C	34	5.340399	0.95783	.	.	ENSG00000131067	ENST00000336431	T	0.23147	1.92	5.87	5.87	0.94306	.	0.092181	0.64402	D	0.000001	T	0.48572	0.1507	M	0.73217	2.22	0.58432	D	0.999999	D;D	0.58620	0.978;0.983	P;P	0.58266	0.836;0.836	T	0.18178	-1.0345	10	0.38643	T	0.18	-7.2752	20.193	0.98233	0.0:1.0:0.0:0.0	.	589;589	A4FU32;Q9UJ14	.;GGT7_HUMAN	N	589	ENSP00000338964:D589N	ENSP00000338964:D589N	D	-	1	0	GGT7	32901485	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.143000	0.77348	2.941000	0.99782	0.655000	0.94253	GAC		0.612	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2		NM_178026	
GJB4	127534	hgsc.bcm.edu;ucsc.edu	37	1	35226981	35226981	+	Silent	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:35226981G>A	ENST00000339480.1	+	2	496	c.126G>A	c.(124-126)gaG>gaA	p.E42E	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	42					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CAGCGGAGGAGGTGTGGGACG	0.592																																																	0													255.0	171.0	200.0					1																	35226981		2203	4300	6503	SO:0001819	synonymous_variant	127534				CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.126G>A	1.37:g.35226981G>A		Somatic		WXS	SOLID	Phase_I	B3KQ82	Silent	SNP	ENST00000339480.1	37	CCDS383.1																																																																																				0.592	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011560.1		NM_153212	
GPR112	139378	hgsc.bcm.edu	37	X	135498624	135498624	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chrX:135498624A>G	ENST00000394143.1	+	26	9508	c.9217A>G	c.(9217-9219)Aaa>Gaa	p.K3073E	GPR112_ENST00000412101.1_Missense_Mutation_p.K2868E|GPR112_ENST00000370652.1_Missense_Mutation_p.K3073E|GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Missense_Mutation_p.K2868E	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	3073					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGACTTTGACAAAGATCCTTA	0.328																																																	0													76.0	72.0	73.0					X																	135498624		2202	4299	6501	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.9217A>G	X.37:g.135498624A>G	ENSP00000377699:p.Lys3073Glu	Somatic		WXS	SOLID	Phase_I	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.873902	0.00542	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000394141	T;T;T;T	0.28069	1.67;1.67;1.63;1.63	4.74	3.86	0.44501	.	.	.	.	.	T	0.10294	0.0252	N	0.02011	-0.69	0.47183	D	0.99934	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10660	-1.0620	9	0.11182	T	0.66	.	7.8955	0.29704	0.1251:0.0:0.8749:0.0	.	2868;3073	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	E	3073;3073;2868;2868	ENSP00000377699:K3073E;ENSP00000359686:K3073E;ENSP00000416526:K2868E;ENSP00000377697:K2868E	ENSP00000359686:K3073E	K	+	1	0	GPR112	135326290	1.000000	0.71417	0.106000	0.21319	0.018000	0.09664	1.759000	0.38420	1.030000	0.39839	-0.502000	0.04539	AAA		0.328	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			
HBB	3043	hgsc.bcm.edu	37	11	5247865	5247865	+	Missense_Mutation	SNP	A	A	C	rs35693898		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:5247865A>C	ENST00000335295.4	-	2	306	c.257T>G	c.(256-258)tTt>tGt	p.F86C	CoTC_ribozyme_ENST00000408104.1_RNA	NM_000518.4	NP_000509.1	P68871	HBB_HUMAN	hemoglobin, beta	86					bicarbonate transport (GO:0015701)|blood coagulation (GO:0007596)|hydrogen peroxide catabolic process (GO:0042744)|nitric oxide transport (GO:0030185)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|platelet aggregation (GO:0070527)|positive regulation of cell death (GO:0010942)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein heterooligomerization (GO:0051291)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|renal absorption (GO:0070293)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|hemoglobin binding (GO:0030492)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)	15		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	CAGTGTGGCAAAGGTGCCCTT	0.522									Sickle Cell Trait																																								0			GRCh37	CM034661	HBB	M	rs35693898						137.0	115.0	123.0					11																	5247865		2201	4298	6499	SO:0001583	missense	3043	Familial Cancer Database		J00173	CCDS7753.1	11p15.5	2014-05-19			ENSG00000244734	ENSG00000244734			4827	protein-coding gene	gene with protein product		141900				2649166	Standard	NM_000518		Approved	CD113t-C, HBD, beta-globin	uc001mae.1	P68871	OTTHUMG00000066678	ENST00000335295.4:c.257T>G	11.37:g.5247865A>C	ENSP00000333994:p.Phe86Cys	Somatic		WXS	SOLID	Phase_I	A4GX73|B2ZUE0|P02023|Q13852|Q14481|Q14510|Q45KT0|Q549N7|Q6FI08|Q6R7N2|Q8IZI1|Q9BX96|Q9UCD6|Q9UCP8|Q9UCP9	Missense_Mutation	SNP	ENST00000335295.4	37	CCDS7753.1	.	.	.	.	.	.	.	.	.	.	a	16.08	3.021462	0.54576	.	.	ENSG00000244734	ENST00000335295;ENST00000380315	D;D	0.93076	-3.16;-3.16	5.24	-2.04	0.07343	Globin-like (1);Globin, structural domain (1);	.	.	.	.	D	0.96027	0.8706	M	0.86864	2.845	0.39098	D	0.961229	D	0.53619	0.961	D	0.66602	0.945	D	0.95497	0.8574	9	0.87932	D	0	-0.9634	12.0533	0.53520	0.3821:0.0:0.0:0.6179	.	86	P68871	HBB_HUMAN	C	86	ENSP00000333994:F86C;ENSP00000369671:F86C	ENSP00000333994:F86C	F	-	2	0	HBB	5204441	0.372000	0.25064	0.990000	0.47175	0.432000	0.31715	0.808000	0.27154	-0.109000	0.12044	0.528000	0.53228	TTT		0.522	HBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142977.2		NM_000518	
HEXDC	284004	hgsc.bcm.edu	37	17	80399717	80399717	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:80399717A>C	ENST00000327949.9	+	11	1216	c.1205A>C	c.(1204-1206)aAg>aCg	p.K402T	HEXDC_ENST00000337014.6_Missense_Mutation_p.S432R|HEXDC_ENST00000577944.1_Missense_Mutation_p.E404D			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	402					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CGCCAGCGGAAGCTCATCCAC	0.642																																																	0													83.0	93.0	90.0					17																	80399717		2029	4184	6213	SO:0001583	missense	284004			AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.1205A>C	17.37:g.80399717A>C	ENSP00000332634:p.Lys402Thr	Somatic		WXS	SOLID	Phase_I	B7UUP6|Q8IYN4|Q8TE81	Missense_Mutation	SNP	ENST00000327949.9	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.51|14.51	2.557942|2.557942	0.45590|0.45590	.|.	.|.	ENSG00000169660|ENSG00000169660	ENST00000327949|ENST00000337014	T|T	0.32272|0.38560	1.46|1.13	5.48|5.48	4.4|4.4	0.53042|0.53042	.|.	.|0.776291	.|0.10967	.|N	.|0.614345	T|T	0.31544|0.31544	0.0800|0.0800	.|.	.|.	.|.	0.34234|0.34234	D|D	0.676872|0.676872	D|B	0.59767|0.21606	0.986|0.058	P|B	0.55455|0.15484	0.776|0.013	T|T	0.29427|0.29427	-1.0012|-1.0012	8|9	0.22706|0.29301	T|T	0.39|0.29	-10.0078|-10.0078	10.4151|10.4151	0.44316|0.44316	0.9238:0.0:0.0762:0.0|0.9238:0.0:0.0762:0.0	.|.	402|432	Q8WVB3|Q8WVB3-2	HEXDC_HUMAN|.	T|R	402|432	ENSP00000332634:K402T|ENSP00000337854:S432R	ENSP00000332634:K402T|ENSP00000337854:S432R	K|S	+|+	2|1	0|0	HEXDC|HEXDC	77993006|77993006	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.871000|0.871000	0.50021|0.50021	2.650000|2.650000	0.46665|0.46665	0.927000|0.927000	0.37143|0.37143	0.533000|0.533000	0.62120|0.62120	AAG|AGC		0.642	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000443513.1		NM_173620	
IL1RAP	3556	hgsc.bcm.edu;ucsc.edu	37	3	190322001	190322001	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:190322001T>G	ENST00000412504.2	+	3	401	c.149T>G	c.(148-150)tTt>tGt	p.F50C	IL1RAP_ENST00000072516.3_Missense_Mutation_p.F50C|IL1RAP_ENST00000447382.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000434491.1_Intron|IL1RAP_ENST00000422485.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000443369.2_Missense_Mutation_p.F50C|IL1RAP_ENST00000422940.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000439062.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000317757.3_Missense_Mutation_p.F50C			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	50	Ig-like C2-type 1.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TGCCCACTCTTTGAACACTTC	0.483																																																	0													110.0	99.0	103.0					3																	190322001		2203	4300	6503	SO:0001583	missense	3556			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.149T>G	3.37:g.190322001T>G	ENSP00000412053:p.Phe50Cys	Somatic		WXS	SOLID	Phase_I	B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	ENST00000412504.2	37	CCDS3298.1	.	.	.	.	.	.	.	.	.	.	T	18.62	3.663279	0.67700	.	.	ENSG00000196083	ENST00000072516;ENST00000443369;ENST00000412504;ENST00000439062;ENST00000447382;ENST00000422625;ENST00000422485;ENST00000422940;ENST00000317757;ENST00000453359	T;T;T;T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.46	5.46	0.80206	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85831	0.5788	L	0.58428	1.81	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.991;0.997	D	0.87242	0.2267	10	0.87932	D	0	.	15.0142	0.71570	0.0:0.0:0.0:1.0	.	50;50;50	Q9NPH3-5;Q9NPH3;Q9NPH3-2	.;IL1AP_HUMAN;.	C	50	ENSP00000072516:F50C;ENSP00000408893:F50C;ENSP00000412053:F50C;ENSP00000401132:F50C;ENSP00000390541:F50C;ENSP00000389149:F50C;ENSP00000409352:F50C;ENSP00000387371:F50C;ENSP00000314807:F50C;ENSP00000412008:F50C	ENSP00000072516:F50C	F	+	2	0	IL1RAP	191804695	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.366000	0.79548	2.206000	0.71126	0.533000	0.62120	TTT		0.483	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343497.1			
KCNH3	23416	hgsc.bcm.edu	37	12	49950251	49950251	+	Missense_Mutation	SNP	C	C	G	rs113209368	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:49950251C>G	ENST00000257981.6	+	13	2827	c.2567C>G	c.(2566-2568)cCt>cGt	p.P856R	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	856					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						AGCCCCTCCCCTGGACCAGGT	0.602													C|||	162	0.0323482	0.0038	0.0519	5008	,	,		18702	0.0		0.0547	False		,,,				2504	0.0675																0								C	ARG/PRO	70,4336	62.3+/-99.4	0,70,2133	53.0	48.0	50.0		2567	5.2	1.0	12	dbSNP_132	50	634,7966	159.1+/-212.4	27,580,3693	yes	missense	KCNH3	NM_012284.1	103	27,650,5826	GG,GC,CC		7.3721,1.5887,5.4129	benign	856/1084	49950251	704,12302	2203	4300	6503	SO:0001583	missense	23416			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2567C>G	12.37:g.49950251C>G	ENSP00000257981:p.Pro856Arg	Somatic		WXS	SOLID	Phase_I	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	76	0.0347985347985348	3	0.006097560975609756	24	0.06629834254143646	0	0.0	49	0.06464379947229551	C	17.52	3.411384	0.62399	0.015887	0.073721	ENSG00000135519	ENST00000257981	D	0.98777	-5.13	6.04	5.16	0.70880	.	0.000000	0.43919	D	0.000506	T	0.70518	0.3233	N	0.08118	0	0.35735	D	0.818209	D	0.61080	0.989	P	0.47573	0.55	D	0.84904	0.0844	10	0.17369	T	0.5	.	11.04	0.47825	0.0:0.9157:0.0:0.0843	.	856	Q9ULD8	KCNH3_HUMAN	R	856	ENSP00000257981:P856R	ENSP00000257981:P856R	P	+	2	0	KCNH3	48236518	0.893000	0.30496	0.983000	0.44433	0.949000	0.60115	3.227000	0.51262	1.571000	0.49722	0.563000	0.77884	CCT		0.602	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2		NM_012284	
ITGA5	3678	hgsc.bcm.edu;ucsc.edu	37	12	54798984	54798984	+	Silent	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:54798984G>T	ENST00000293379.4	-	12	1452	c.1191C>A	c.(1189-1191)acC>acA	p.T397T	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	397					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						CCCCCAGGGGGGTCAAGGAGC	0.607																																																	0													63.0	67.0	66.0					12																	54798984		2203	4300	6503	SO:0001819	synonymous_variant	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1191C>A	12.37:g.54798984G>T		Somatic		WXS	SOLID	Phase_I	Q96HA5	Silent	SNP	ENST00000293379.4	37	CCDS8880.1																																																																																				0.607	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1			
KCTD21	283219	hgsc.bcm.edu;ucsc.edu	37	11	77885169	77885169	+	Silent	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:77885169G>A	ENST00000340067.3	-	2	710	c.432C>T	c.(430-432)ttC>ttT	p.F144F	KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000528468.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000530261.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	144					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			TGTTGGCGTTGAAGACCTCCA	0.552																																																	0													145.0	123.0	131.0					11																	77885169		2200	4292	6492	SO:0001819	synonymous_variant	283219			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.432C>T	11.37:g.77885169G>A		Somatic		WXS	SOLID	Phase_I	B4DTR0	Silent	SNP	ENST00000340067.3	37	CCDS31645.1																																																																																				0.552	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390057.1		NM_001029859	
KPTN	11133	hgsc.bcm.edu	37	19	47980067	47980067	+	Missense_Mutation	SNP	T	T	C	rs200822662	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr19:47980067T>C	ENST00000338134.3	-	10	1099	c.992A>G	c.(991-993)tAt>tGt	p.Y331C	KPTN_ENST00000536339.1_Missense_Mutation_p.Y91C	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	331					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		CACCTGTCCATAGGTGGCCAC	0.617																																																	0													21.0	26.0	24.0					19																	47980067		2009	4167	6176	SO:0001583	missense	11133			AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.992A>G	19.37:g.47980067T>C	ENSP00000337850:p.Tyr331Cys	Somatic		WXS	SOLID	Phase_I	B3KN86|B4DQ76|Q96GT1	Missense_Mutation	SNP	ENST00000338134.3	37	CCDS42583.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171908	0.78452	.	.	ENSG00000118162	ENST00000338134;ENST00000536339	T;T	0.51574	0.7;1.94	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.71517	0.3349	M	0.84683	2.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.77151	-0.2693	10	0.87932	D	0	-21.9126	14.1924	0.65646	0.0:0.0:0.0:1.0	.	331	Q9Y664	KPTN_HUMAN	C	331;91	ENSP00000337850:Y331C;ENSP00000442579:Y91C	ENSP00000337850:Y331C	Y	-	2	0	KPTN	52671879	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.976000	0.76135	1.984000	0.57885	0.459000	0.35465	TAT		0.617	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2			
L3MBTL1	26013	hgsc.bcm.edu	37	20	42162041	42162041	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr20:42162041C>A	ENST00000427442.2	+	13	1589	c.1430C>A	c.(1429-1431)cCc>cAc	p.P477H	L3MBTL1_ENST00000418998.1_Missense_Mutation_p.P477H|L3MBTL1_ENST00000444063.1_Missense_Mutation_p.P409H|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.P409H|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.P409H			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	409					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CAAGGAAAGCCCCTCACCCCT	0.582																																																	0													75.0	74.0	75.0					20																	42162041		2203	4300	6503	SO:0001583	missense	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1430C>A	20.37:g.42162041C>A	ENSP00000402107:p.Pro477His	Somatic		WXS	SOLID	Phase_I	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	37	CCDS46602.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.139076|4.139076	0.77775|0.77775	.|.	.|.	ENSG00000185513|ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861;ENST00000373133|ENST00000445228	T;T;T;T;T;T|.	0.48836|.	0.8;0.8;0.8;0.8;0.8;0.8|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.154568|0.154568	0.64402|0.64402	D|D	0.000015|0.000015	T|T	0.61813|0.61813	0.2377|0.2377	M|M	0.68952|0.68952	2.095|2.095	0.50467|0.50467	D|D	0.999872|0.999872	D;P;D;D|.	0.76494|.	0.988;0.95;0.999;0.993|.	P;P;D;D|.	0.74348|.	0.904;0.835;0.983;0.934|.	T|T	0.54761|0.54761	-0.8245|-0.8245	10|7	0.52906|0.13470	T|T	0.07|0.59	.|.	11.274|11.274	0.49155|0.49155	0.0:0.916:0.0:0.084|0.0:0.916:0.0:0.084	.|.	477;61;409;409|.	Q9Y468-5;Q9Y468-3;Q9Y468-2;Q9Y468-1|.	.;.;.;.|.	H|T	477;477;409;409;409;195;61|100	ENSP00000402107:P477H;ENSP00000398516:P477H;ENSP00000362227:P409H;ENSP00000403316:P409H;ENSP00000362226:P409H;ENSP00000410139:P195H|.	ENSP00000362225:P61H|ENSP00000412938:P100T	P|P	+|+	2|1	0|0	L3MBTL1|L3MBTL1	41595455|41595455	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	4.762000|4.762000	0.62250|0.62250	2.747000|2.747000	0.94245|0.94245	0.462000|0.462000	0.41574|0.41574	CCC|CCC		0.582	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3		NM_032107	
LAMC3	10319	hgsc.bcm.edu	37	9	133928345	133928345	+	Silent	SNP	C	C	T	rs12349966	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr9:133928345C>T	ENST00000361069.4	+	11	2065	c.1932C>T	c.(1930-1932)agC>agT	p.S644S	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	644	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCGGCCCCAGCCCTGCCGGTC	0.667											OREG0019556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2403	0.479832	0.621	0.3271	5008	,	,		14176	0.4226		0.4642	False		,,,				2504	0.4724																0								C		2552,1850		761,1030,410	23.0	23.0	23.0		1932	3.9	0.0	9	dbSNP_120	23	3828,4764		874,2080,1342	no	coding-synonymous	LAMC3	NM_006059.3		1635,3110,1752	TT,TC,CC		44.5531,42.0264,49.0996		644/1576	133928345	6380,6614	2201	4296	6497	SO:0001819	synonymous_variant	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1932C>T	9.37:g.133928345C>T		Somatic	1606	WXS	SOLID	Phase_I	B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	37	CCDS6938.1																																																																																				0.667	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3		NM_006059	
MACC1	346389	hgsc.bcm.edu	37	7	20199087	20199087	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr7:20199087A>T	ENST00000400331.5	-	5	1205	c.897T>A	c.(895-897)gaT>gaA	p.D299E	MACC1_ENST00000589011.1_Missense_Mutation_p.D299E|MACC1_ENST00000332878.4_Missense_Mutation_p.D299E	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	299					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						GGCTGAAAGGATCCTTTCTTA	0.423																																																	0													64.0	60.0	62.0					7																	20199087		2203	4300	6503	SO:0001583	missense	346389				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.897T>A	7.37:g.20199087A>T	ENSP00000383185:p.Asp299Glu	Somatic		WXS	SOLID	Phase_I	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.690809	0.48097	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.14266	2.52;2.52	5.47	2.79	0.32731	.	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	L	0.45137	1.4	0.52099	D	0.99994	D	0.62365	0.991	P	0.46362	0.514	T	0.03695	-1.1012	10	0.37606	T	0.19	-23.1066	10.2947	0.43616	0.8436:0.0:0.1564:0.0	.	299	Q6ZN28	MACC1_HUMAN	E	299	ENSP00000383185:D299E;ENSP00000328410:D299E	ENSP00000328410:D299E	D	-	3	2	MACC1	20165612	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.959000	0.40412	0.930000	0.37217	0.477000	0.44152	GAT		0.423	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5		NM_182762	
MANEA	79694	hgsc.bcm.edu	37	6	96053922	96053922	+	Missense_Mutation	SNP	T	T	A	rs35772543	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr6:96053922T>A	ENST00000358812.4	+	5	1164	c.1030T>A	c.(1030-1032)Ttt>Att	p.F344I		NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	344	Catalytic. {ECO:0000305}.			F -> I (in Ref. 2; AAQ75077, 3; BAB14298 and 4; CAE45927). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		CCTAAAATTATTTTGTGATAA	0.378													T|||	226	0.0451278	0.0038	0.0605	5008	,	,		18638	0.0595		0.0765	False		,,,				2504	0.0429																0								T	ILE/PHE	84,4322	68.1+/-105.8	2,80,2121	59.0	64.0	62.0		1030	6.2	0.9	6	dbSNP_126	62	740,7858	177.2+/-226.9	39,662,3598	yes	missense	MANEA	NM_024641.3	21	41,742,5719	AA,AT,TT		8.6067,1.9065,6.3365	probably-damaging	344/463	96053922	824,12180	2203	4299	6502	SO:0001583	missense	79694			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.1030T>A	6.37:g.96053922T>A	ENSP00000351669:p.Phe344Ile	Somatic		WXS	SOLID	Phase_I	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	ENST00000358812.4	37	CCDS5032.1	136	0.06227106227106227	2	0.0040650406504065045	29	0.08011049723756906	37	0.06468531468531469	68	0.08970976253298153	T	29.1	4.981294	0.93044	0.019065	0.086067	ENSG00000172469	ENST00000358812	D	0.92647	-3.08	6.17	6.17	0.99709	.	0.086298	0.85682	N	0.000000	D	0.95990	0.8694	M	0.86740	2.835	0.09310	P	0.9999999800898	D	0.89917	1.0	D	0.87578	0.998	D	0.95687	0.8737	9	0.46703	T	0.11	-24.0744	16.0034	0.80327	0.0:0.0:0.0:1.0	rs35772543	344	Q5SRI9	MANEA_HUMAN	I	344	ENSP00000351669:F344I	ENSP00000351669:F344I	F	+	1	0	MANEA	96160643	1.000000	0.71417	0.915000	0.36163	0.910000	0.53928	7.603000	0.82811	2.371000	0.80710	0.533000	0.62120	TTT		0.378	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1		NM_024641	
MAP1B	4131	hgsc.bcm.edu;ucsc.edu	37	5	71495734	71495734	+	Silent	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:71495734G>A	ENST00000296755.7	+	5	6850	c.6552G>A	c.(6550-6552)tcG>tcA	p.S2184S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2184					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AAGACGAGTCGGAAACCATCC	0.592																																					Melanoma(17;367 822 11631 31730 47712)												0													128.0	116.0	120.0					5																	71495734		2203	4300	6503	SO:0001819	synonymous_variant	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6552G>A	5.37:g.71495734G>A		Somatic		WXS	SOLID	Phase_I	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																				0.592	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6		NM_005909	
MAP7D1	55700	hgsc.bcm.edu	37	1	36644627	36644627	+	Splice_Site	SNP	G	G	A	rs111254290		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:36644627G>A	ENST00000373151.2	+	12	2346		c.e12+1		MAP7D1_ENST00000373150.4_Splice_Site|MAP7D1_ENST00000373148.4_Splice_Site|MAP7D1_ENST00000316156.4_Splice_Site	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1						microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				GCGCAGAAAGGTGTGCGGACC	0.706																																																	0													21.0	22.0	22.0					1																	36644627		2118	4183	6301	SO:0001630	splice_region_variant	55700			AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.2130+1G>A	1.37:g.36644627G>A		Somatic		WXS	SOLID	Phase_I	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Splice_Site	SNP	ENST00000373151.2	37	CCDS30673.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.333841	0.24253	.	.	ENSG00000116871	ENST00000316156;ENST00000373150;ENST00000373151;ENST00000373153;ENST00000373148	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9957	0.86367	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP7D1	36417214	1.000000	0.71417	0.993000	0.49108	0.036000	0.12997	7.457000	0.80775	2.434000	0.82447	0.514000	0.50259	.		0.706	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1		NM_018067	Intron
MFSD5	84975	hgsc.bcm.edu	37	12	53647204	53647204	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:53647204G>T	ENST00000329548.4	+	2	776	c.585G>T	c.(583-585)tgG>tgT	p.W195C	MFSD5_ENST00000534842.1_Missense_Mutation_p.W302C	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	195					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						TAGCCAGCTGGATAGGGCTGG	0.627																																																	0													86.0	88.0	88.0					12																	53647204		2203	4300	6503	SO:0001583	missense	84975			AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.585G>T	12.37:g.53647204G>T	ENSP00000332624:p.Trp195Cys	Somatic		WXS	SOLID	Phase_I	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	37	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160811	0.38119	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	.	.	.	4.25	4.25	0.50352	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	L	0.49126	1.545	0.80722	D	1	B;B	0.33755	0.424;0.371	B;B	0.35770	0.199;0.21	T	0.56432	-0.7980	9	0.38643	T	0.18	-6.7572	15.5711	0.76337	0.0:0.0:1.0:0.0	.	195;302	Q6N075;G3V1N7	MFSD5_HUMAN;.	C	302;302;302;195	.	ENSP00000331231:W302C	W	+	3	0	MFSD5	51933471	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.235000	0.95353	2.196000	0.70406	0.561000	0.74099	TGG		0.627	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1		NM_032889	
MLH1	4292	hgsc.bcm.edu;ucsc.edu	37	3	37067407	37067407	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:37067407G>A	ENST00000231790.2	+	12	1534	c.1318G>A	c.(1318-1320)Gtg>Atg	p.V440M	MLH1_ENST00000435176.1_Missense_Mutation_p.V342M|MLH1_ENST00000539477.1_Missense_Mutation_p.V199M|MLH1_ENST00000455445.2_Missense_Mutation_p.V199M|MLH1_ENST00000458205.2_Missense_Mutation_p.V199M|MLH1_ENST00000536378.1_Missense_Mutation_p.V199M	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	440	Interaction with EXO1.				ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CCCTGCTGAAGTGGCTGCCAA	0.522		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	1	Whole gene deletion(1)	ovary(1)											76.0	85.0	82.0					3																	37067407		2203	4300	6503	SO:0001583	missense	4292	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1318G>A	3.37:g.37067407G>A	ENSP00000231790:p.Val440Met	Somatic		WXS	SOLID	Phase_I	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	37	CCDS2663.1	.	.	.	.	.	.	.	.	.	.	G	8.422	0.846606	0.16963	.	.	ENSG00000076242	ENST00000231790;ENST00000383761;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000536378	D;D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55;-2.55	4.98	-0.949	0.10376	.	1.701300	0.02783	N	0.121168	T	0.78033	0.4220	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.32203	0.36;0.014;0.001;0.129;0.004;0.002	B;B;B;B;B;B	0.29077	0.098;0.005;0.002;0.098;0.003;0.003	T	0.67300	-0.5705	10	0.33940	T	0.23	0.0539	9.8563	0.41088	0.5789:0.0:0.4211:0.0	.	342;342;199;199;440;440	E9PCU2;B4DQ11;B7Z821;B4DI13;Q53GX1;P40692	.;.;.;.;.;MLH1_HUMAN	M	440;304;199;199;199;342;199	ENSP00000231790:V440M;ENSP00000402667:V199M;ENSP00000443665:V199M;ENSP00000398272:V199M;ENSP00000402564:V342M;ENSP00000444286:V199M	ENSP00000231790:V440M	V	+	1	0	MLH1	37042411	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.163000	0.16520	-0.310000	0.08766	-1.686000	0.00732	GTG		0.522	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2		NM_000249	
MOCOS	55034	hgsc.bcm.edu	37	18	33848526	33848526	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr18:33848526T>C	ENST00000261326.5	+	15	2566	c.2545T>C	c.(2545-2547)Tca>Cca	p.S849P		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GATGCATGCATCATTGGATTT	0.383																																																	0													283.0	243.0	257.0					18																	33848526		2203	4300	6503	SO:0001583	missense	55034			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2545T>C	18.37:g.33848526T>C	ENSP00000261326:p.Ser849Pro	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	T	1.929	-0.446442	0.04604	.	.	ENSG00000075643	ENST00000261326	T	0.36157	1.27	5.74	1.99	0.26369	Molybdenum cofactor sulfurase, C-terminal (2);	0.621040	0.18182	N	0.149116	T	0.20007	0.0481	N	0.20401	0.57	0.09310	N	1	B	0.15930	0.015	B	0.18561	0.022	T	0.17440	-1.0369	10	0.26408	T	0.33	-8.2516	6.5426	0.22388	0.0:0.0818:0.3211:0.5972	.	849	Q96EN8	MOCOS_HUMAN	P	849	ENSP00000261326:S849P	ENSP00000261326:S849P	S	+	1	0	MOCOS	32102524	0.000000	0.05858	0.025000	0.17156	0.002000	0.02628	-0.138000	0.10374	0.517000	0.28361	0.529000	0.55759	TCA		0.383	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			
MYH7B	57644	hgsc.bcm.edu	37	20	33567548	33567548	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr20:33567548C>A	ENST00000262873.7	+	5	501	c.409C>A	c.(409-411)Ctg>Atg	p.L137M		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	95	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GATGACGCACCTGAACGAGGC	0.632																																																	0													70.0	71.0	70.0					20																	33567548		2175	4287	6462	SO:0001583	missense	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.409C>A	20.37:g.33567548C>A	ENSP00000262873:p.Leu137Met	Somatic		WXS	SOLID	Phase_I	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636730	0.87760	.	.	ENSG00000078814	ENST00000262873	D	0.89681	-2.55	4.31	4.31	0.51392	Myosin head, motor domain (2);	0.000000	0.34025	N	0.004332	D	0.97015	0.9025	H	0.99249	4.485	0.53005	D	0.999969	D	0.71674	0.998	D	0.79108	0.992	D	0.98931	1.0787	10	0.87932	D	0	.	16.9287	0.86183	0.0:1.0:0.0:0.0	.	95	A7E2Y1	MYH7B_HUMAN	M	137	ENSP00000262873:L137M	ENSP00000262873:L137M	L	+	1	2	MYH7B	33031209	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.643000	0.83403	2.383000	0.81215	0.561000	0.74099	CTG		0.632	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2		NM_020884	
N4BP1	9683	hgsc.bcm.edu;ucsc.edu	37	16	48596217	48596217	+	Silent	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr16:48596217G>A	ENST00000262384.3	-	2	573	c.337C>T	c.(337-339)Ctg>Ttg	p.L113L	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	113					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				CCAATGTCCAGAATGCAGAGG	0.443																																																	0													60.0	63.0	62.0					16																	48596217		1979	4162	6141	SO:0001819	synonymous_variant	9683			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.337C>T	16.37:g.48596217G>A		Somatic		WXS	SOLID	Phase_I	A7MD49|Q2YDX1	Silent	SNP	ENST00000262384.3	37	CCDS45479.1																																																																																				0.443	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1		NM_014664	
NCBP1	4686	hgsc.bcm.edu;ucsc.edu	37	9	100409780	100409780	+	Silent	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr9:100409780C>T	ENST00000375147.3	+	7	874	c.618C>T	c.(616-618)cgC>cgT	p.R206R		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	206	MIF4G.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				TTAGAAGACGCCAAAAGACTC	0.358																																					Ovarian(36;879 898 2893 44212 50307)												0													116.0	107.0	110.0					9																	100409780		2203	4300	6503	SO:0001819	synonymous_variant	4686			BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.618C>T	9.37:g.100409780C>T		Somatic		WXS	SOLID	Phase_I	B2R718|Q59G76|Q5T1V0|Q5T7X2	Silent	SNP	ENST00000375147.3	37	CCDS6728.1																																																																																				0.358	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1		NM_002486	
NEB	4703	hgsc.bcm.edu	37	2	152554080	152554080	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:152554080A>G	ENST00000172853.10	-	14	1382	c.1235T>C	c.(1234-1236)gTt>gCt	p.V412A	NEB_ENST00000397345.3_Missense_Mutation_p.V412A|NEB_ENST00000427231.2_Missense_Mutation_p.V412A|NEB_ENST00000604864.1_Missense_Mutation_p.V412A|NEB_ENST00000603639.1_Missense_Mutation_p.V412A|NEB_ENST00000409198.1_Missense_Mutation_p.V412A			P20929	NEBU_HUMAN	nebulin	412					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTTCTGCAGAACAGTATCGAG	0.328																																																	0													140.0	134.0	136.0					2																	152554080		1826	4082	5908	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1235T>C	2.37:g.152554080A>G	ENSP00000172853:p.Val412Ala	Somatic		WXS	SOLID	Phase_I	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	10.46	1.357261	0.24598	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000536533	T;T;T;T	0.05025	3.51;3.53;3.53;3.51	5.97	5.97	0.96955	.	0.201042	0.42682	D	0.000674	T	0.05090	0.0136	N	0.22421	0.69	0.80722	D	1	B	0.12013	0.005	B	0.13407	0.009	T	0.47045	-0.9147	10	0.21014	T	0.42	.	11.0372	0.47808	0.9229:0.0:0.0771:0.0	.	412	P20929	NEBU_HUMAN	A	412;412;412;412;138	ENSP00000386259:V412A;ENSP00000380505:V412A;ENSP00000416578:V412A;ENSP00000172853:V412A	ENSP00000172853:V412A	V	-	2	0	NEB	152262326	0.276000	0.24211	0.710000	0.30468	0.932000	0.56968	2.014000	0.40951	2.288000	0.76882	0.533000	0.62120	GTT		0.328	NEB-201	KNOWN	basic	protein_coding	protein_coding			NM_004543	
NFXL1	152518	hgsc.bcm.edu;ucsc.edu	37	4	47877157	47877157	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr4:47877157A>G	ENST00000507489.1	-	18	2409	c.2233T>C	c.(2233-2235)Tat>Cat	p.Y745H	NFXL1_ENST00000381538.3_Missense_Mutation_p.Y745H	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	745						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CATTCCACATACAGGCTTGTG	0.338																																																	0													107.0	100.0	102.0					4																	47877157		2203	4300	6503	SO:0001583	missense	152518			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2233T>C	4.37:g.47877157A>G	ENSP00000422037:p.Tyr745His	Somatic		WXS	SOLID	Phase_I	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	A	14.82	2.649865	0.47362	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	T;T	0.28895	1.59;1.59	5.94	5.94	0.96194	.	0.246785	0.34046	N	0.004320	T	0.26048	0.0635	L	0.35288	1.05	0.80722	D	1	B	0.27229	0.172	B	0.29598	0.104	T	0.06162	-1.0842	10	0.15952	T	0.53	-30.6471	16.3891	0.83525	1.0:0.0:0.0:0.0	.	745	Q6ZNB6	NFXL1_HUMAN	H	745	ENSP00000370949:Y745H;ENSP00000422037:Y745H	ENSP00000370949:Y745H	Y	-	1	0	NFXL1	47571914	1.000000	0.71417	0.930000	0.37139	0.910000	0.53928	7.425000	0.80255	2.276000	0.75962	0.397000	0.26171	TAT		0.338	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1		NM_152995	
NFXL1	152518	hgsc.bcm.edu;ucsc.edu	37	4	47877194	47877194	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr4:47877194C>T	ENST00000507489.1	-	18	2372	c.2196G>A	c.(2194-2196)atG>atA	p.M732I	NFXL1_ENST00000381538.3_Missense_Mutation_p.M732I	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	732						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TTATTCTAAGCATCTGAACAC	0.398																																																	0													125.0	113.0	117.0					4																	47877194		2203	4300	6503	SO:0001583	missense	152518			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2196G>A	4.37:g.47877194C>T	ENSP00000422037:p.Met732Ile	Somatic		WXS	SOLID	Phase_I	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596349	0.66332	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	T;T	0.18502	2.21;2.21	5.94	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.20577	0.0495	L	0.49778	1.585	0.80722	D	1	P	0.42785	0.79	B	0.42555	0.391	T	0.00673	-1.1616	10	0.34782	T	0.22	-13.9747	15.5359	0.76001	0.0:0.9329:0.0:0.0671	.	732	Q6ZNB6	NFXL1_HUMAN	I	732	ENSP00000370949:M732I;ENSP00000422037:M732I	ENSP00000370949:M732I	M	-	3	0	NFXL1	47571951	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.589000	0.61006	2.821000	0.97095	0.484000	0.47621	ATG		0.398	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1		NM_152995	
NOMO2	283820	hgsc.bcm.edu	37	16	18544484	18544484	+	Missense_Mutation	SNP	C	C	T	rs453341		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr16:18544484C>T	ENST00000381474.3	-	12	1303	c.1238G>A	c.(1237-1239)cGg>cAg	p.R413Q	NOMO2_ENST00000543392.1_Missense_Mutation_p.R246Q|NOMO2_ENST00000330537.6_Missense_Mutation_p.R413Q	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	413						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						GATTGATATCCGACCACAGAC	0.458																																																	0													267.0	198.0	221.0					16																	18544484		2197	4300	6497	SO:0001583	missense	283820			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.1238G>A	16.37:g.18544484C>T	ENSP00000370883:p.Arg413Gln	Somatic		WXS	SOLID	Phase_I	Q4G177	Missense_Mutation	SNP	ENST00000381474.3	37	CCDS32394.1	.	.	.	.	.	.	.	.	.	.	.	4.295	0.053887	0.08291	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.03831	3.83;3.79;3.81	2.75	2.75	0.32379	.	0.356515	0.29246	N	0.012704	T	0.01320	0.0043	N	0.00707	-1.245	0.09310	N	0.999998	B;B	0.10296	0.001;0.003	B;B	0.04013	0.0;0.001	T	0.47611	-0.9104	10	0.08599	T	0.76	-3.6137	7.2027	0.25889	0.0:0.1143:0.0:0.8857	.	246;413	Q4G177;Q5JPE7	.;NOMO2_HUMAN	Q	413;413;246	ENSP00000331851:R413Q;ENSP00000370883:R413Q;ENSP00000439970:R246Q	ENSP00000331851:R413Q	R	-	2	0	NOMO2	18451985	1.000000	0.71417	0.855000	0.33649	0.886000	0.51366	1.754000	0.38369	0.271000	0.22005	-0.556000	0.04195	CGG		0.458	NOMO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435858.1		NM_001004060	
NUP93	9688	hgsc.bcm.edu;ucsc.edu	37	16	56871614	56871614	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr16:56871614A>C	ENST00000308159.5	+	18	2115	c.1994A>C	c.(1993-1995)aAc>aCc	p.N665T	NUP93_ENST00000542526.1_Missense_Mutation_p.N542T|NUP93_ENST00000564887.1_Missense_Mutation_p.N542T|NUP93_ENST00000569842.1_Missense_Mutation_p.N665T	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	665					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						AGGCTGAAGAACATGGCACTC	0.587																																					Colon(33;610 796 1305 1705 38917)												0													67.0	57.0	60.0					16																	56871614		2198	4300	6498	SO:0001583	missense	9688			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1994A>C	16.37:g.56871614A>C	ENSP00000310668:p.Asn665Thr	Somatic		WXS	SOLID	Phase_I	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	A	15.57	2.871872	0.51695	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.42513	0.97;0.97	5.76	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.37598	0.1009	L	0.59436	1.845	0.58432	D	0.999998	P	0.39094	0.659	B	0.38225	0.268	T	0.11470	-1.0586	10	0.14656	T	0.56	-23.938	11.9215	0.52795	0.932:0.0:0.068:0.0	.	665	Q8N1F7	NUP93_HUMAN	T	665;542	ENSP00000310668:N665T;ENSP00000440235:N542T	ENSP00000310668:N665T	N	+	2	0	NUP93	55429115	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.091000	0.76923	1.111000	0.41721	0.533000	0.62120	AAC		0.587	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4		NM_014669	
OR4F4	26682	hgsc.bcm.edu	37	15	102463219	102463219	+	Missense_Mutation	SNP	T	T	C	rs201977833	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr15:102463219T>C	ENST00000326183.3	-	1	79	c.44A>G	c.(43-45)gAa>gGa	p.E15G		NM_001004195.2	NP_001004195.2	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F, member 4	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GGTCTGGAGTTCCTGAGAATC	0.393																																																	0													2.0	2.0	2.0					15																	102463219		806	2287	3093	SO:0001583	missense	26682				CCDS32343.1	15q26.3	2012-08-09			ENSG00000177693	ENSG00000177693		"""GPCR / Class A : Olfactory receptors"""	8301	protein-coding gene	gene with protein product							Standard	NM_001004195		Approved	OR4F18	uc002cdf.1	Q96R69		ENST00000326183.3:c.44A>G	15.37:g.102463219T>C	ENSP00000317482:p.Glu15Gly	Somatic		WXS	SOLID	Phase_I	B2RNI5|Q6IFN9	Missense_Mutation	SNP	ENST00000326183.3	37	CCDS32343.1	.	.	.	.	.	.	.	.	.	.	.	9.547	1.114859	0.20795	.	.	ENSG00000177693	ENST00000326183	T	0.00444	7.4	2.97	1.79	0.24919	.	0.481469	0.15411	N	0.263780	T	0.00384	0.0012	M	0.67517	2.055	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36648	-0.9739	9	.	.	.	.	7.6019	0.28081	0.0:0.0:0.2171:0.7829	.	15	Q96R69	OR4F4_HUMAN	G	15	ENSP00000317482:E15G	.	E	-	2	0	OR4F4	100280742	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.479000	0.22228	0.500000	0.27991	0.392000	0.25879	GAA		0.393	OR4F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417599.1		NM_001004195	
PAX3	5077	hgsc.bcm.edu;ucsc.edu	37	2	223066781	223066781	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:223066781G>C	ENST00000350526.4	-	8	1438	c.1302C>G	c.(1300-1302)gaC>gaG	p.D434E	PAX3_ENST00000336840.6_Intron|PAX3_ENST00000392070.2_Missense_Mutation_p.D434E|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000344493.4_Intron|PAX3_ENST00000392069.2_Missense_Mutation_p.D434E|PAX3_ENST00000409551.3_Missense_Mutation_p.D433E	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	434					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTTCATATGGTCTAGTCTCT	0.567			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																																	Dom	yes		2	2q35	5077	paired box gene 3	yes	M	0													126.0	111.0	116.0					2																	223066781		2203	4300	6503	SO:0001583	missense	5077				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1302C>G	2.37:g.223066781G>C	ENSP00000343052:p.Asp434Glu	Somatic		WXS	SOLID	Phase_I	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379847	0.24944	.	.	ENSG00000135903	ENST00000392069;ENST00000350526;ENST00000392070;ENST00000409551;ENST00000464706	D;D;D;D	0.93906	-3.31;-3.29;-3.29;-3.3	5.81	-0.255	0.12988	.	0.490245	0.22393	N	0.060660	T	0.74816	0.3766	N	0.02539	-0.55	0.80722	D	1	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.09377	0.003;0.001;0.004	T	0.56968	-0.7891	10	0.14656	T	0.56	.	0.9679	0.01410	0.2653:0.3461:0.1696:0.219	.	434;433;434	P23760;Q494Z4;G5E9C1	PAX3_HUMAN;.;.	E	434;434;434;433;151	ENSP00000375921:D434E;ENSP00000343052:D434E;ENSP00000375922:D434E;ENSP00000386750:D433E	ENSP00000343052:D434E	D	-	3	2	PAX3	222775025	0.082000	0.21442	0.985000	0.45067	0.889000	0.51656	-0.517000	0.06275	-0.116000	0.11893	-0.140000	0.14226	GAC		0.567	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			
PCDHB11	56125	hgsc.bcm.edu;ucsc.edu	37	5	140580452	140580452	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:140580452A>G	ENST00000354757.3	+	1	1105	c.1105A>G	c.(1105-1107)Agt>Ggt	p.S369G	PCDHB11_ENST00000536699.1_Missense_Mutation_p.S4G	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	369	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TATGGTTTTTAGTATCCAAGA	0.413																																																	0													114.0	113.0	113.0					5																	140580452		2203	4300	6503	SO:0001583	missense	56125			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1105A>G	5.37:g.140580452A>G	ENSP00000346802:p.Ser369Gly	Somatic		WXS	SOLID	Phase_I	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.200041	0.58126	.	.	ENSG00000197479	ENST00000536699;ENST00000354757;ENST00000536825	T;T	0.52057	0.68;4.62	2.52	1.33	0.21861	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.54447	0.1859	M	0.77616	2.38	0.09310	N	1	B	0.18863	0.031	B	0.39660	0.306	T	0.57400	-0.7818	9	0.48119	T	0.1	.	6.4991	0.22158	0.8675:0.0:0.1325:0.0	.	369	Q9Y5F2	PCDBB_HUMAN	G	4;369;59	ENSP00000440344:S4G;ENSP00000346802:S369G	ENSP00000346802:S369G	S	+	1	0	PCDHB11	140560636	0.000000	0.05858	0.005000	0.12908	0.733000	0.41908	0.320000	0.19540	0.231000	0.21079	0.254000	0.18369	AGT		0.413	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1		NM_018931	
PIK3CA	5290	hgsc.bcm.edu;ucsc.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	SOLID	Phase_I	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			
PITRM1	10531	hgsc.bcm.edu	37	10	3187802	3187802	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr10:3187802G>T	ENST00000224949.4	-	21	2477	c.2443C>A	c.(2443-2445)Cca>Aca	p.P815T	PITRM1-AS1_ENST00000441377.1_RNA|PITRM1_ENST00000451104.2_Missense_Mutation_p.P717T|PITRM1_ENST00000380994.1_Missense_Mutation_p.P373T|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000464395.1_5'UTR|PITRM1_ENST00000380989.2_Missense_Mutation_p.P816T			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	815					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						ACCGTGTGTGGGCGCACAGGC	0.557																																																	0													46.0	49.0	48.0					10																	3187802		1832	3833	5665	SO:0001583	missense	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2443C>A	10.37:g.3187802G>T	ENSP00000224949:p.Pro815Thr	Somatic		WXS	SOLID	Phase_I	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.210|6.210	0.406982|0.406982	0.11754|0.11754	.|.	.|.	ENSG00000107959|ENSG00000107959	ENST00000451454|ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104;ENST00000424714	.|T;T;T;T;T	.|0.60171	.|3.78;3.78;3.15;3.65;0.21	5.02|5.02	4.11|4.11	0.48088|0.48088	.|Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.160973|0.160973	0.56097|0.56097	D|D	0.000031|0.000031	T|T	0.51584|0.51584	0.1683|0.1683	L|L	0.43923|0.43923	1.385|1.385	0.43924|0.43924	D|D	0.996575|0.996575	.|B;B;B;B;B	.|0.28470	.|0.02;0.213;0.014;0.014;0.014	.|B;B;B;B;B	.|0.33960	.|0.003;0.173;0.017;0.017;0.017	T|T	0.47484|0.47484	-0.9114|-0.9114	6|10	.|0.30078	.|T	.|0.28	-21.3369|-21.3369	13.8938|13.8938	0.63757|0.63757	0.0747:0.0:0.9253:0.0|0.0747:0.0:0.9253:0.0	.|.	.|808;717;816;815;808	.|E9PDX6;E7ES23;C9JSL2;Q5JRX3;B4DH07	.|.;.;.;PREP_HUMAN;.	H|T	148|815;808;816;373;717;34	.|ENSP00000224949:P815T;ENSP00000370377:P816T;ENSP00000370382:P373T;ENSP00000401201:P717T;ENSP00000402072:P34T	.|ENSP00000224949:P815T	P|P	-|-	2|1	0|0	PITRM1|PITRM1	3177802|3177802	1.000000|1.000000	0.71417|0.71417	0.015000|0.015000	0.15790|0.15790	0.006000|0.006000	0.05464|0.05464	3.658000|3.658000	0.54482|0.54482	1.238000|1.238000	0.43771|0.43771	0.462000|0.462000	0.41574|0.41574	CCC|CCA		0.557	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2			
PKD1L2	114780	hgsc.bcm.edu	37	16	81242151	81242151	+	RNA	SNP	T	T	C	rs5818326|rs532218091|rs386792900	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr16:81242151T>C	ENST00000525539.1	-	0	704				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.G235G(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GACACAGGTTTCCAAAGTAGG	0.562													T|||	2211	0.441494	0.1717	0.4625	5008	,	,		20463	0.8026		0.4205	False		,,,				2504	0.4407																2	Substitution - coding silent(2)	lung(2)											86.0	82.0	83.0					16																	81242151		2123	4226	6349			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81242151T>C		Somatic		WXS	SOLID	Phase_I	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37																																																																																					0.562	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			
PKHD1L1	93035	hgsc.bcm.edu;ucsc.edu	37	8	110464467	110464467	+	Silent	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr8:110464467T>A	ENST00000378402.5	+	42	6569	c.6465T>A	c.(6463-6465)gcT>gcA	p.A2155A		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2155	IPT/TIG 14.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CAGGGTGGGCTCCAGTTTGTG	0.448										HNSCC(38;0.096)																																							0													120.0	114.0	116.0					8																	110464467		1941	4155	6096	SO:0001819	synonymous_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6465T>A	8.37:g.110464467T>A		Somatic		WXS	SOLID	Phase_I	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																				0.448	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
PLA2G4A	5321	hgsc.bcm.edu	37	1	186916003	186916003	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:186916003G>T	ENST00000367466.3	+	12	1326	c.1174G>T	c.(1174-1176)Gtc>Ttc	p.V392F	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.V332F	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	392	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TATTTTAGGTGTCTGGGGCAG	0.358																																																	0													141.0	137.0	138.0					1																	186916003		2203	4300	6503	SO:0001583	missense	5321			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1174G>T	1.37:g.186916003G>T	ENSP00000356436:p.Val392Phe	Somatic		WXS	SOLID	Phase_I	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	37	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751497	0.89753	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.08102	3.13;3.13	5.71	5.71	0.89125	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.105450	0.64402	D	0.000004	T	0.32585	0.0834	M	0.79258	2.445	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.76071	0.987;0.985	T	0.01608	-1.1313	10	0.72032	D	0.01	-17.1201	18.8397	0.92177	0.0:0.0:1.0:0.0	.	332;392	E7EU42;P47712	.;PA24A_HUMAN	F	392;332	ENSP00000356436:V392F;ENSP00000406892:V332F	ENSP00000356436:V392F	V	+	1	0	PLA2G4A	185182626	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.485000	0.97942	2.685000	0.91497	0.585000	0.79938	GTC		0.358	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1		NM_024420	
PREB	10113	hgsc.bcm.edu;ucsc.edu	37	2	27355147	27355147	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:27355147G>T	ENST00000260643.2	-	6	1130	c.877C>A	c.(877-879)Ctt>Att	p.L293I	PREB_ENST00000416802.1_5'Flank|PREB_ENST00000406567.3_Intron	NM_013388.4	NP_037520.1	Q9HCU5	PREB_HUMAN	prolactin regulatory element binding	293					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGTCCGAAGGGGCAAGAAG	0.612																																																	0													82.0	90.0	87.0					2																	27355147		2203	4300	6503	SO:0001583	missense	10113				CCDS1738.1	2p23	2013-01-10			ENSG00000138073	ENSG00000138073		"""WD repeat domain containing"""	9356	protein-coding gene	gene with protein product		606395				10194769, 12735795	Standard	NM_013388		Approved	SEC12	uc002rix.1	Q9HCU5	OTTHUMG00000097076	ENST00000260643.2:c.877C>A	2.37:g.27355147G>T	ENSP00000260643:p.Leu293Ile	Somatic		WXS	SOLID	Phase_I	Q53SZ8|Q9UH94	Missense_Mutation	SNP	ENST00000260643.2	37	CCDS1738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.19|17.19	3.326937|3.326937	0.60743|0.60743	.|.	.|.	ENSG00000138073|ENSG00000138073	ENST00000260643;ENST00000546336|ENST00000456259;ENST00000430533	T|T;T	0.32515|0.32272	1.45|1.47;1.46	6.08|6.08	5.18|5.18	0.71444|0.71444	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);|.	0.119632|.	0.64402|.	D|.	0.000017|.	T|T	0.39784|0.39784	0.1091|0.1091	L|L	0.41027|0.41027	1.25|1.25	0.51482|0.51482	D|D	0.999926|0.999926	D|.	0.54397|.	0.966|.	P|.	0.46144|.	0.505|.	T|T	0.25012|0.25012	-1.0144|-1.0144	10|7	0.19147|0.66056	T|D	0.46|0.02	-8.008|-8.008	15.0751|15.0751	0.72071|0.72071	0.0:0.1425:0.8575:0.0|0.0:0.1425:0.8575:0.0	.|.	293|.	Q9HCU5|.	PREB_HUMAN|.	I|H	293|36;48	ENSP00000260643:L293I|ENSP00000397036:P36H;ENSP00000407036:P48H	ENSP00000260643:L293I|ENSP00000407036:P48H	L|P	-|-	1|2	0|0	PREB|PREB	27208651|27208651	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.994000|0.994000	0.84299|0.84299	3.716000|3.716000	0.54904|0.54904	1.537000|1.537000	0.49254|0.49254	0.655000|0.655000	0.94253|0.94253	CTT|CCT		0.612	PREB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214195.1		NM_013388	
PTPN12	5782	hgsc.bcm.edu;ucsc.edu	37	7	77256100	77256100	+	Silent	SNP	T	T	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr7:77256100T>G	ENST00000248594.6	+	13	1376	c.1104T>G	c.(1102-1104)ccT>ccG	p.P368P	PTPN12_ENST00000415482.2_Silent_p.P249P|PTPN12_ENST00000435495.2_Silent_p.P238P	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	368	Interaction with TGFB1I1. {ECO:0000250}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						TCTTGACACCTTCTCCCCCTT	0.438																																																	0													100.0	90.0	93.0					7																	77256100		2203	4300	6503	SO:0001819	synonymous_variant	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1104T>G	7.37:g.77256100T>G		Somatic		WXS	SOLID	Phase_I	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Silent	SNP	ENST00000248594.6	37	CCDS5592.1																																																																																				0.438	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			
PTPRO	5800	hgsc.bcm.edu	37	12	15661567	15661567	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:15661567T>G	ENST00000281171.4	+	7	1660	c.1330T>G	c.(1330-1332)Tta>Gta	p.L444V	PTPRO_ENST00000543886.1_Missense_Mutation_p.L444V|PTPRO_ENST00000348962.2_Missense_Mutation_p.L444V	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	444	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TGTCCACGTTTTAAGCTCAAC	0.512																																																	0													101.0	93.0	96.0					12																	15661567		2203	4300	6503	SO:0001583	missense	5800			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1330T>G	12.37:g.15661567T>G	ENSP00000281171:p.Leu444Val	Somatic		WXS	SOLID	Phase_I	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.363970	0.61513	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T;T	0.54071	0.59;0.59;0.59	5.44	-1.25	0.09405	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.37669	N	0.002000	T	0.52075	0.1712	N	0.19112	0.55	0.80722	D	1	P;D;D	0.76494	0.946;0.957;0.999	P;P;D	0.87578	0.487;0.545;0.998	T	0.42999	-0.9418	10	0.35671	T	0.21	.	12.2912	0.54819	0.0:0.6711:0.0:0.3289	.	444;444;444	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	V	444	ENSP00000281171:L444V;ENSP00000444173:L444V;ENSP00000343434:L444V	ENSP00000281171:L444V	L	+	1	2	PTPRO	15552834	0.713000	0.27926	0.081000	0.20488	0.984000	0.73092	0.131000	0.15870	-0.350000	0.08262	0.533000	0.62120	TTA		0.512	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			
PYGB	5834	hgsc.bcm.edu;ucsc.edu	37	20	25260932	25260932	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr20:25260932T>C	ENST00000216962.4	+	10	1233	c.1123T>C	c.(1123-1125)Tac>Cac	p.Y375H		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	375					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						GACCTGTGCATACACCAACCA	0.532																																																	0													136.0	122.0	127.0					20																	25260932		2203	4300	6503	SO:0001583	missense	5834				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1123T>C	20.37:g.25260932T>C	ENSP00000216962:p.Tyr375His	Somatic		WXS	SOLID	Phase_I	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945783	0.73672	.	.	ENSG00000100994	ENST00000216962	D	0.95171	-3.63	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	D	0.98080	0.9367	H	0.97465	4.01	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.98792	1.0736	10	0.87932	D	0	-34.2926	12.7502	0.57304	0.0:0.0:0.0:1.0	.	375	P11216	PYGB_HUMAN	H	375	ENSP00000216962:Y375H	ENSP00000216962:Y375H	Y	+	1	0	PYGB	25208932	1.000000	0.71417	0.940000	0.37924	0.769000	0.43574	7.731000	0.84895	1.742000	0.51746	0.379000	0.24179	TAC		0.532	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2		NM_002862	
RANBP3	8498	hgsc.bcm.edu	37	19	5923257	5923257	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr19:5923257A>C	ENST00000340578.6	-	13	1214	c.1157T>G	c.(1156-1158)tTg>tGg	p.L386W	RANBP3_ENST00000439268.2_Missense_Mutation_p.L381W|RANBP3_ENST00000034275.8_Missense_Mutation_p.L318W|RANBP3_ENST00000541471.1_Missense_Mutation_p.L258W|RANBP3_ENST00000591092.1_Missense_Mutation_p.L313W	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	386	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CACTTTTTCCAACAAACACTT	0.567																																																	0													118.0	122.0	121.0					19																	5923257		1966	4154	6120	SO:0001583	missense	8498			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1157T>G	19.37:g.5923257A>C	ENSP00000341483:p.Leu386Trp	Somatic		WXS	SOLID	Phase_I	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.650326	0.87958	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807;ENST00000541471	T;T;T;T	0.41400	1.02;1.01;1.76;1.0	5.59	5.59	0.84812	Pleckstrin homology-type (1);Ran binding protein 1 (2);	0.000000	0.64402	D	0.000001	T	0.72890	0.3517	H	0.94306	3.52	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.79325	-0.1850	10	0.46703	T	0.11	-12.854	13.7176	0.62708	1.0:0.0:0.0:0.0	.	258;381;258;313;318;381;386	F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;.;RANB3_HUMAN	W	386;381;318;317;258	ENSP00000341483:L386W;ENSP00000404837:L381W;ENSP00000034275:L318W;ENSP00000445071:L258W	ENSP00000034275:L318W	L	-	2	0	RANBP3	5874257	1.000000	0.71417	0.471000	0.27229	0.982000	0.71751	8.850000	0.92190	2.133000	0.65898	0.379000	0.24179	TTG		0.567	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1		NM_007322	
RASIP1	54922	hgsc.bcm.edu	37	19	49224073	49224073	+	Silent	SNP	G	G	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr19:49224073G>C	ENST00000222145.4	-	12	3078	c.2874C>G	c.(2872-2874)ccC>ccG	p.P958P	MAMSTR_ENST00000318083.6_5'Flank|MAMSTR_ENST00000377367.3_5'Flank|MAMSTR_ENST00000419611.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	958					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		ACGTGGCCACGGGAGGCCCAT	0.602																																																	0													97.0	101.0	100.0					19																	49224073		2203	4300	6503	SO:0001819	synonymous_variant	54922			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2874C>G	19.37:g.49224073G>C		Somatic		WXS	SOLID	Phase_I	Q6U676	Silent	SNP	ENST00000222145.4	37	CCDS12731.1																																																																																				0.602	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1		NM_017805	
RBM6	10180	hgsc.bcm.edu;ucsc.edu	37	3	50006037	50006037	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr3:50006037T>A	ENST00000266022.4	+	3	1438	c.1179T>A	c.(1177-1179)ttT>ttA	p.F393L	RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.F261L|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000441115.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	393					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		GTCTGGACTTTCTTGGGCGGC	0.498																																																	0													81.0	84.0	83.0					3																	50006037		2203	4300	6503	SO:0001583	missense	10180			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1179T>A	3.37:g.50006037T>A	ENSP00000266022:p.Phe393Leu	Somatic		WXS	SOLID	Phase_I	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.037126	0.54896	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.31769	1.48;1.51	5.85	-0.583	0.11706	.	0.000000	0.85682	D	0.000000	T	0.35278	0.0926	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.02519	-1.1147	9	.	.	.	-11.3921	10.3905	0.44166	0.0:0.658:0.0:0.342	.	393	P78332	RBM6_HUMAN	L	393;261	ENSP00000266022:F393L;ENSP00000396466:F261L	.	F	+	3	2	RBM6	49981041	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	0.769000	0.26604	-0.077000	0.12752	0.402000	0.26972	TTT		0.498	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4		NM_005777	
SATB2	23314	hgsc.bcm.edu	37	2	200193590	200193590	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:200193590G>C	ENST00000417098.1	-	8	2033	c.1217C>G	c.(1216-1218)aCa>aGa	p.T406R	RP11-486F17.1_ENST00000489557.2_RNA|SATB2_ENST00000457245.1_Missense_Mutation_p.T406R|SATB2_ENST00000428695.1_Missense_Mutation_p.T288R|SATB2_ENST00000443023.1_Missense_Mutation_p.T347R|SATB2_ENST00000260926.5_Missense_Mutation_p.T406R	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	406					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTGAGAGGCTGTCCGAGGGTC	0.488																																					Colon(30;262 767 11040 24421 36230)												0													83.0	79.0	81.0					2																	200193590		2203	4300	6503	SO:0001583	missense	23314			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1217C>G	2.37:g.200193590G>C	ENSP00000401112:p.Thr406Arg	Somatic		WXS	SOLID	Phase_I	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003438	0.74932	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.46819	0.86;0.87;0.86;0.86;0.86	4.98	4.98	0.66077	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.056311	0.64402	D	0.000001	T	0.60261	0.2255	L	0.36672	1.1	0.47476	D	0.999439	B;D	0.63880	0.288;0.993	B;D	0.68483	0.1;0.958	T	0.61446	-0.7061	10	0.59425	D	0.04	-10.673	18.8143	0.92071	0.0:0.0:1.0:0.0	.	288;406	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	R	406;347;406;288;406	ENSP00000401112:T406R;ENSP00000388764:T347R;ENSP00000260926:T406R;ENSP00000388581:T288R;ENSP00000405420:T406R	ENSP00000260926:T406R	T	-	2	0	SATB2	199901835	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	5.501000	0.66950	2.747000	0.94245	0.650000	0.86243	ACA		0.488	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1		NM_015265	
SLC16A14	151473	hgsc.bcm.edu;ucsc.edu	37	2	230914571	230914571	+	Silent	SNP	C	C	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:230914571C>G	ENST00000295190.4	-	3	767	c.309G>C	c.(307-309)gcG>gcC	p.A103A		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CTCCAATGATCGCAGTCTGGC	0.498																																																	0													75.0	73.0	74.0					2																	230914571		2203	4300	6503	SO:0001819	synonymous_variant	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.309G>C	2.37:g.230914571C>G		Somatic		WXS	SOLID	Phase_I	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	CCDS2473.1																																																																																				0.498	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2		NM_152527	
SLC39A13	91252	hgsc.bcm.edu	37	11	47434010	47434010	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:47434010A>T	ENST00000362021.4	+	4	571	c.529A>T	c.(529-531)Acc>Tcc	p.T177S	SLC39A13_ENST00000533076.1_Missense_Mutation_p.T177S|SLC39A13_ENST00000524928.1_Missense_Mutation_p.T177S|SLC39A13_ENST00000354884.4_Missense_Mutation_p.T177S|SLC39A13_ENST00000529740.1_3'UTR	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	177					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		GGAGGAGGGGACCAGCCAGGT	0.622											OREG0020959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	51.0	53.0					11																	47434010		2201	4298	6499	SO:0001583	missense	91252				CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.529A>T	11.37:g.47434010A>T	ENSP00000354689:p.Thr177Ser	Somatic	946	WXS	SOLID	Phase_I	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Missense_Mutation	SNP	ENST00000362021.4	37	CCDS44592.1	.	.	.	.	.	.	.	.	.	.	A	1.483	-0.556615	0.03967	.	.	ENSG00000165915	ENST00000533076;ENST00000531419;ENST00000531865;ENST00000362021;ENST00000354884;ENST00000526614;ENST00000524928	T;T;T;T;T;T;T	0.45276	0.96;1.01;0.9;0.96;0.96;0.96;0.96	4.77	-1.42	0.08913	.	1.110680	0.06522	N	0.739892	T	0.21509	0.0518	N	0.17631	0.505	0.09310	N	1	B;B;B	0.14438	0.003;0.0;0.01	B;B;B	0.14023	0.004;0.002;0.01	T	0.19418	-1.0306	10	0.09338	T	0.73	-7.6117	3.3039	0.06993	0.3292:0.4064:0.172:0.0924	.	177;177;177	Q96H72;Q96H72-2;E9PNE7	S39AD_HUMAN;.;.	S	177	ENSP00000434290:T177S;ENSP00000432302:T177S;ENSP00000434684:T177S;ENSP00000354689:T177S;ENSP00000346956:T177S;ENSP00000432499:T177S;ENSP00000437186:T177S	ENSP00000346956:T177S	T	+	1	0	SLC39A13	47390586	0.000000	0.05858	0.000000	0.03702	0.402000	0.30811	-0.418000	0.07080	-0.517000	0.06461	0.379000	0.24179	ACC		0.622	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395652.1		NM_152264	
SOHLH2	54937	hgsc.bcm.edu	37	13	36767945	36767945	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr13:36767945T>A	ENST00000379881.3	-	3	411	c.323A>T	c.(322-324)aAa>aTa	p.K108I	CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.K185I|SOHLH2_ENST00000554962.1_Missense_Mutation_p.K185I|SOHLH2_ENST00000317764.6_Missense_Mutation_p.K108I	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	108					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GTACATACCTTTAAAATTTTC	0.264																																																	0													51.0	57.0	55.0					13																	36767945		2184	4275	6459	SO:0001583	missense	54937			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.323A>T	13.37:g.36767945T>A	ENSP00000369210:p.Lys108Ile	Somatic		WXS	SOLID	Phase_I	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	T	17.83	3.485407	0.63962	.	.	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	T;T;T;T	0.52983	1.21;1.21;0.64;1.21	5.37	2.84	0.33178	.	0.496323	0.18810	N	0.130559	T	0.40247	0.1109	L	0.27053	0.805	0.34724	D	0.728995	P;P	0.48911	0.917;0.917	P;P	0.49226	0.603;0.603	T	0.52283	-0.8596	10	0.87932	D	0	0.2388	7.5375	0.27719	0.0:0.1755:0.0:0.8245	.	185;108	B4DX90;Q9NX45	.;SOLH2_HUMAN	I	108;185;108;185	ENSP00000369210:K108I;ENSP00000451542:K185I;ENSP00000326838:K108I;ENSP00000421868:K185I	ENSP00000421868:K185I	K	-	2	0	CCDC169-SOHLH2;SOHLH2	35665945	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	0.389000	0.20751	0.390000	0.25115	0.528000	0.53228	AAA		0.264	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2		NM_017826	
SLITRK6	84189	hgsc.bcm.edu;ucsc.edu	37	13	86370165	86370165	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr13:86370165T>G	ENST00000400286.2	-	2	1077	c.479A>C	c.(478-480)aAc>aCc	p.N160T		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	160					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TTTGAGTCTGTTGAGCTTGCT	0.378																																																	0													127.0	120.0	122.0					13																	86370165		1853	4088	5941	SO:0001583	missense	84189			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.479A>C	13.37:g.86370165T>G	ENSP00000383143:p.Asn160Thr	Somatic		WXS	SOLID	Phase_I	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	T	5.081	0.200646	0.09652	.	.	ENSG00000184564	ENST00000400286	T	0.56941	0.43	6.02	3.51	0.40186	.	0.211764	0.48767	D	0.000176	T	0.22166	0.0534	N	0.05124	-0.11	0.28327	N	0.92197	B	0.10296	0.003	B	0.10450	0.005	T	0.12656	-1.0539	10	0.10902	T	0.67	-6.0567	1.3839	0.02236	0.1421:0.1628:0.1482:0.5469	.	160	Q9H5Y7	SLIK6_HUMAN	T	160	ENSP00000383143:N160T	ENSP00000383143:N160T	N	-	2	0	SLITRK6	85268166	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.441000	0.44864	0.474000	0.27392	-1.100000	0.02121	AAC		0.378	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2		NM_032229	
SORD	6652	hgsc.bcm.edu	37	15	45364534	45364534	+	Missense_Mutation	SNP	A	A	C	rs930337		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr15:45364534A>C	ENST00000267814.9	+	8	986	c.806A>C	c.(805-807)aAc>aCc	p.N269T	SORD_ENST00000558580.1_Missense_Mutation_p.N248T|RP11-109D20.2_ENST00000560967.1_RNA|SORD_ENST00000559562.1_3'UTR	NM_003104.5	NP_003095.2	Q00796	DHSO_HUMAN	sorbitol dehydrogenase	269			N -> T (in dbSNP:rs2229659). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7782086, ECO:0000269|PubMed:8088829, ECO:0000269|PubMed:9183016}.		fructose biosynthetic process (GO:0046370)|glucose metabolic process (GO:0006006)|L-xylitol catabolic process (GO:0051160)|L-xylitol metabolic process (GO:0051164)|sorbitol catabolic process (GO:0006062)|sperm motility (GO:0030317)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)	carbohydrate binding (GO:0030246)|L-iditol 2-dehydrogenase activity (GO:0003939)|NAD binding (GO:0051287)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(4)	9		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)		TCTGGTGGGAACCTCGTGCTT	0.498																																																	0													51.0	22.0	36.0					15																	45364534		1900	1995	3895	SO:0001583	missense	6652				CCDS10116.1	15q15-q21.1	2012-10-02			ENSG00000140263	ENSG00000140263	1.1.1.14		11184	protein-coding gene	gene with protein product		182500				7782086	Standard	NM_003104		Approved		uc001zul.4	Q00796	OTTHUMG00000131265	ENST00000267814.9:c.806A>C	15.37:g.45364534A>C	ENSP00000267814:p.Asn269Thr	Somatic		WXS	SOLID	Phase_I	B2R655|B7Z3A6|J3JZZ5|Q16682|Q9UMD6	Missense_Mutation	SNP	ENST00000267814.9	37	CCDS10116.1	1586	0.7261904761904762	198	0.4024390243902439	307	0.8480662983425414	465	0.8129370629370629	616	0.8126649076517151	C	0.578	-0.838147	0.02692	.	.	ENSG00000140263	ENST00000267814	T	0.03553	3.89	5.05	4.12	0.48240	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.460627	0.24815	N	0.035375	T	0.00012	0.0000	N	0.00057	-2.355	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.22243	-1.0222	9	0.02654	T	1	-9.2822	9.4171	0.38528	0.1417:0.7818:0.0:0.0765	rs2229659;rs11542061	269	Q00796	DHSO_HUMAN	T	269	ENSP00000267814:N269T	ENSP00000267814:N269T	N	+	2	0	SORD	43151826	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	3.049000	0.49869	1.152000	0.42452	-0.352000	0.07741	AAC		0.498	SORD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254033.3			
SPAG11A	653423	hgsc.bcm.edu	37	8	7706329	7706329	+	Missense_Mutation	SNP	C	C	T	rs202056068		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr8:7706329C>T	ENST00000400125.2	+	2	349	c.178C>T	c.(178-180)Cgg>Tgg	p.R60W	SPAG11A_ENST00000326558.5_Missense_Mutation_p.R60W|SPAG11A_ENST00000351436.4_Missense_Mutation_p.R60W|SPAG11A_ENST00000434307.2_Missense_Mutation_p.R60W			Q6PDA7	SG11A_HUMAN	sperm associated antigen 11A	60				R -> W (in Ref. 4; AAH58833). {ECO:0000305}.		extracellular region (GO:0005576)				central_nervous_system(1)|lung(2)	3				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		CGCAGTGAAACGGGACCTCTT	0.572																																																	0													6.0	2.0	4.0					8																	7706329		1706	3198	4904	SO:0001583	missense	653423				CCDS43700.1	8p23.1	2009-09-12	2007-03-15		ENSG00000178287	ENSG00000178287			33342	protein-coding gene	gene with protein product	"""epididymal protein 2A"""						Standard	NM_001081552		Approved	HE2, EDDM2A		Q6PDA7	OTTHUMG00000162440	ENST00000400125.2:c.178C>T	8.37:g.7706329C>T	ENSP00000382990:p.Arg60Trp	Somatic		WXS	SOLID	Phase_I	A6NIY0|E9PAK7	Missense_Mutation	SNP	ENST00000400125.2	37		73	0.033424908424908424	10	0.02032520325203252	15	0.04143646408839779	6	0.01048951048951049	42	0.055408970976253295	C	9.009	0.981988	0.18812	.	.	ENSG00000178287	ENST00000400125;ENST00000434307;ENST00000326558;ENST00000351436	T;T	0.62788	0.74;0.0	2.15	0.169	0.15017	.	.	.	.	.	T	0.25568	0.0622	.	.	.	0.09310	N	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;P;D;D	0.83275	0.993;0.855;0.972;0.996	T	0.39143	-0.9628	8	0.66056	D	0.02	.	4.3732	0.11258	0.2616:0.4827:0.2557:0.0	.	60;60;60;60	Q08648-4;Q6PDA7-2;Q6PDA7;C9JN37	.;.;SG11A_HUMAN;.	W	60	ENSP00000416991:R60W;ENSP00000297496:R60W	ENSP00000316012:R60W	R	+	1	2	SPAG11A	7743739	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.549000	0.06041	0.029000	0.15352	0.505000	0.49811	CGG		0.572	SPAG11A-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000383797.1		NM_001081552	
SPSB1	80176	hgsc.bcm.edu;ucsc.edu	37	1	9416577	9416577	+	Silent	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:9416577G>A	ENST00000328089.6	+	2	968	c.627G>A	c.(625-627)ctG>ctA	p.L209L	SPSB1_ENST00000377399.2_Silent_p.L209L|SPSB1_ENST00000357898.3_Silent_p.L209L	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	209	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GCAAAAAACTGTATCCTGTAG	0.547																																																	0													128.0	126.0	127.0					1																	9416577		2203	4300	6503	SO:0001819	synonymous_variant	80176				CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.627G>A	1.37:g.9416577G>A		Somatic		WXS	SOLID	Phase_I	A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Silent	SNP	ENST00000328089.6	37	CCDS102.1																																																																																				0.547	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2		NM_025106	
ST8SIA4	7903	hgsc.bcm.edu;ucsc.edu	37	5	100192026	100192026	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:100192026G>T	ENST00000231461.5	-	4	888	c.578C>A	c.(577-579)tCa>tAa	p.S193*		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	193					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		TTGTACAACTGATGGATTCAT	0.398																																																	0													116.0	108.0	111.0					5																	100192026		2203	4300	6503	SO:0001587	stop_gained	7903			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.578C>A	5.37:g.100192026G>T	ENSP00000231461:p.Ser193*	Somatic		WXS	SOLID	Phase_I	A8KA07|G3V104|Q8N1F4|Q92693	Nonsense_Mutation	SNP	ENST00000231461.5	37	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	G	39	7.658948	0.98415	.	.	ENSG00000113532	ENST00000231461	.	.	.	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.1029	18.1509	0.89674	0.0:0.0:1.0:0.0	.	.	.	.	X	193	.	ENSP00000231461:S193X	S	-	2	0	ST8SIA4	100219925	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.615000	0.98356	2.751000	0.94390	0.591000	0.81541	TCA		0.398	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3		NM_005668	
STARD3	10948	hgsc.bcm.edu;ucsc.edu	37	17	37816464	37816464	+	Splice_Site	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:37816464G>T	ENST00000336308.5	+	10	1014	c.796G>T	c.(796-798)Gaa>Taa	p.E266*	STARD3_ENST00000394250.4_Splice_Site_p.E248*|STARD3_ENST00000544210.2_Splice_Site_p.E266*|STARD3_ENST00000580611.1_Splice_Site_p.E240*	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	266	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCTGCCATAGGAATATGGGGA	0.577																																																	0													95.0	78.0	84.0					17																	37816464		2203	4300	6503	SO:0001630	splice_region_variant	10948				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.796-1G>T	17.37:g.37816464G>T		Somatic		WXS	SOLID	Phase_I	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Nonsense_Mutation	SNP	ENST00000336308.5	37	CCDS11341.1	.	.	.	.	.	.	.	.	.	.	G	40	7.996710	0.98602	.	.	ENSG00000131748	ENST00000336308;ENST00000544210;ENST00000394250	.	.	.	5.44	5.44	0.79542	.	0.209164	0.49916	D	0.000127	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2557	0.93945	0.0:0.0:1.0:0.0	.	.	.	.	X	266;266;248	.	.	E	+	1	0	STARD3	35069990	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.073000	0.93992	2.577000	0.86979	0.561000	0.74099	GAA		0.577	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1			Nonsense_Mutation
TBC1D19	55296	hgsc.bcm.edu;ucsc.edu	37	4	26640457	26640457	+	Splice_Site	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr4:26640457G>A	ENST00000264866.4	+	6	711		c.e6+1		TBC1D19_ENST00000515568.1_Splice_Site|TBC1D19_ENST00000511789.1_Splice_Site|AC093807.1_ENST00000580172.1_RNA	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19								Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				GATGAACCAGGTATGTGAACA	0.328																																																	0													77.0	82.0	81.0					4																	26640457		2203	4299	6502	SO:0001630	splice_region_variant	55296			AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.433+1G>A	4.37:g.26640457G>A		Somatic		WXS	SOLID	Phase_I	B9A6M0|Q9NUX1	Splice_Site	SNP	ENST00000264866.4	37	CCDS3439.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170998	0.78452	.	.	ENSG00000109680	ENST00000512840;ENST00000264866;ENST00000505206;ENST00000511789;ENST00000513596	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.175	0.89759	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D19	26249555	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.770000	0.85390	2.657000	0.90304	0.655000	0.94253	.		0.328	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2		NM_018317	Intron
TCF25	22980	hgsc.bcm.edu	37	16	89977623	89977623	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr16:89977623G>A	ENST00000263346.8	+	18	2064	c.2008G>A	c.(2008-2010)Gag>Aag	p.E670K	MC1R_ENST00000555427.1_5'Flank|RP11-566K11.7_ENST00000570217.1_RNA|TCF25_ENST00000263347.7_Silent_p.*474*	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	670					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		GGACGACGCTGAGGGGGAGGG	0.622																																																	0													45.0	46.0	46.0					16																	89977623		2195	4295	6490	SO:0001583	missense	22980			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.2008G>A	16.37:g.89977623G>A	ENSP00000263346:p.Glu670Lys	Somatic		WXS	SOLID	Phase_I	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	37	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724080	0.48728	.	.	ENSG00000141002	ENST00000263346	.	.	.	5.35	5.35	0.76521	.	0.408692	0.27886	N	0.017448	T	0.48466	0.1501	L	0.34521	1.04	0.80722	D	1	B	0.32717	0.381	B	0.30029	0.11	T	0.52983	-0.8502	9	0.66056	D	0.02	.	16.2201	0.82254	0.0:0.0:1.0:0.0	.	670	Q9BQ70	TCF25_HUMAN	K	670	.	ENSP00000263346:E670K	E	+	1	0	TCF25	88505124	0.952000	0.32445	0.950000	0.38849	0.086000	0.17979	2.212000	0.42835	2.497000	0.84241	0.655000	0.94253	GAG		0.622	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2		NM_014972	
TFB2M	64216	hgsc.bcm.edu	37	1	246720752	246720752	+	Missense_Mutation	SNP	T	T	G	rs200551751		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:246720752T>G	ENST00000366514.4	-	3	672	c.487A>C	c.(487-489)Aaa>Caa	p.K163Q	TFB2M_ENST00000544618.1_Intron	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	163					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			GCAGGTGGTTTTATTACTCCA	0.393																																																	0													98.0	99.0	99.0					1																	246720752		2203	4300	6503	SO:0001583	missense	64216			AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.487A>C	1.37:g.246720752T>G	ENSP00000355471:p.Lys163Gln	Somatic		WXS	SOLID	Phase_I	Q9H626	Missense_Mutation	SNP	ENST00000366514.4	37	CCDS1627.1	32	0.014652014652014652	3	0.006097560975609756	0	0.0	4	0.006993006993006993	25	0.032981530343007916	T	15.92	2.973832	0.53720	.	.	ENSG00000162851	ENST00000366514	T	0.34275	1.37	5.59	3.12	0.35913	.	0.379197	0.28630	N	0.014662	T	0.13798	0.0334	L	0.51422	1.61	0.09310	N	0.999998	P	0.41498	0.752	B	0.41764	0.366	T	0.03240	-1.1057	10	0.35671	T	0.21	-3.8644	11.9276	0.52829	0.0:0.0:0.418:0.582	.	163	Q9H5Q4	TFB2M_HUMAN	Q	163	ENSP00000355471:K163Q	ENSP00000355471:K163Q	K	-	1	0	TFB2M	244787375	0.004000	0.15560	0.001000	0.08648	0.011000	0.07611	1.143000	0.31553	0.903000	0.36546	0.455000	0.32223	AAA		0.393	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096673.1		NM_022366	
TLK2	11011	hgsc.bcm.edu	37	17	60689867	60689867	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:60689867C>A	ENST00000326270.9	+	23	2528	c.2260C>A	c.(2260-2262)Cct>Act	p.P754T	TLK2_ENST00000343388.7_Missense_Mutation_p.P700T|TLK2_ENST00000542523.1_Missense_Mutation_p.P700T|TLK2_ENST00000346027.5_Missense_Mutation_p.P732T|TLK2_ENST00000582809.1_Missense_Mutation_p.P583T	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	754					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TACAAGTAGCCCTGCTGGAGC	0.502																																																	0													95.0	80.0	85.0					17																	60689867		2203	4300	6503	SO:0001583	missense	11011			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.2260C>A	17.37:g.60689867C>A	ENSP00000316512:p.Pro754Thr	Somatic		WXS	SOLID	Phase_I	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	C	0.478	-0.881015	0.02530	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.64991	-0.11;-0.13;-0.12;-0.13	5.83	4.85	0.62838	Protein kinase-like domain (1);	0.380247	0.32244	N	0.006371	T	0.41926	0.1180	N	0.08118	0	0.48632	D	0.999684	B;B;B;B	0.24426	0.063;0.103;0.103;0.02	B;B;B;B	0.28011	0.039;0.085;0.085;0.016	T	0.29971	-0.9994	10	0.16420	T	0.52	.	14.4435	0.67333	0.0:0.9284:0.0:0.0716	.	754;700;732;732	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	T	732;700;754;700	ENSP00000275780:P732T;ENSP00000340800:P700T;ENSP00000316512:P754T;ENSP00000442311:P700T	ENSP00000316512:P754T	P	+	1	0	TLK2	58043599	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.975000	0.56859	2.763000	0.94921	0.561000	0.74099	CCT		0.502	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1		NM_006852	
TMPRSS2	7113	hgsc.bcm.edu	37	21	42861492	42861492	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr21:42861492C>G	ENST00000332149.5	-	4	401	c.267G>C	c.(265-267)ttG>ttC	p.L89F	TMPRSS2_ENST00000398585.3_Missense_Mutation_p.L126F|TMPRSS2_ENST00000458356.1_Missense_Mutation_p.L89F|TMPRSS2_ENST00000497881.1_Intron	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	89					positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				TCCCCAGGGTCAAGGTGATGC	0.527			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																			Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	0													91.0	78.0	82.0					21																	42861492		2203	4300	6503	SO:0001583	missense	7113			U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.267G>C	21.37:g.42861492C>G	ENSP00000330330:p.Leu89Phe	Somatic		WXS	SOLID	Phase_I	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	ENST00000332149.5	37	CCDS33564.1	.	.	.	.	.	.	.	.	.	.	C	4.983	0.182531	0.09495	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356;ENST00000454499;ENST00000424093	D;D;D;D;T	0.88431	-2.35;-2.38;-2.35;-2.37;-0.03	4.51	-9.02	0.00741	.	1.741660	0.03429	N	0.207538	T	0.75302	0.3831	N	0.19112	0.55	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.16289	0.015;0.002	T	0.67558	-0.5640	10	0.02654	T	1	.	9.9598	0.41688	0.5549:0.1201:0.325:0.0	.	126;89	F8WES1;O15393	.;TMPS2_HUMAN	F	89;126;89;89;89	ENSP00000330330:L89F;ENSP00000381588:L126F;ENSP00000391216:L89F;ENSP00000389006:L89F;ENSP00000397846:L89F	ENSP00000330330:L89F	L	-	3	2	TMPRSS2	41783362	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.443000	0.00233	-2.559000	0.00474	-1.045000	0.02358	TTG		0.527	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195189.1			
TRIP10	9322	hgsc.bcm.edu	37	19	6744909	6744909	+	Silent	SNP	C	C	T	rs62125119	byFrequency	TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr19:6744909C>T	ENST00000313244.9	+	9	923	c.888C>T	c.(886-888)tcC>tcT	p.S296S	TRIP10_ENST00000313285.8_Silent_p.S296S|TRIP10_ENST00000600428.1_Silent_p.S188S|TRIP10_ENST00000596758.1_Silent_p.S296S			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	296	Interaction with CDC42.|Interaction with PDE6G. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						GTGCACCCTCCGACAGCAGTC	0.632													C|||	69	0.013778	0.0	0.0159	5008	,	,		16150	0.006		0.0278	False		,,,				2504	0.0245																0								C		26,4380	32.6+/-62.9	0,26,2177	60.0	60.0	60.0		888	-10.6	0.2	19	dbSNP_129	60	183,8417	82.0+/-144.6	4,175,4121	no	coding-synonymous	TRIP10	NM_004240.2		4,201,6298	TT,TC,CC		2.1279,0.5901,1.607		296/546	6744909	209,12797	2203	4300	6503	SO:0001819	synonymous_variant	9322			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.888C>T	19.37:g.6744909C>T		Somatic		WXS	SOLID	Phase_I	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Silent	SNP	ENST00000313244.9	37																																																																																					0.632	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2			
TTN	7273	hgsc.bcm.edu;ucsc.edu	37	2	179401198	179401198	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr2:179401198T>A	ENST00000591111.1	-	307	95577	c.95353A>T	c.(95353-95355)Aat>Tat	p.N31785Y	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.N24486Y|TTN_ENST00000460472.2_Missense_Mutation_p.N24361Y|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N33426Y|TTN-AS1_ENST00000585358.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N24553Y|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.N30858Y|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588804.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31785	Fibronectin type-III 131. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGTAGTAATTTCTAATCTTT	0.423																																																	0													82.0	79.0	80.0					2																	179401198		1866	4107	5973	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95353A>T	2.37:g.179401198T>A	ENSP00000465570:p.Asn31785Tyr	Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	15.76	2.930020	0.52759	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.76	5.76	0.90799	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60090	0.2242	L	0.55213	1.73	0.37775	D	0.926811	P;P;P;P	0.42203	0.773;0.773;0.773;0.773	P;P;P;P	0.48524	0.58;0.58;0.58;0.58	T	0.67581	-0.5634	9	0.87932	D	0	.	16.0677	0.80897	0.0:0.0:0.0:1.0	.	24361;24486;24553;31785	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	30858;24361;24553;24486;24358	ENSP00000343764:N30858Y;ENSP00000434586:N24361Y;ENSP00000340554:N24553Y;ENSP00000352154:N24486Y	ENSP00000340554:N24553Y	N	-	1	0	TTN	179109444	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.120000	0.64685	2.185000	0.69588	0.460000	0.39030	AAT		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
TXNDC17	84817	hgsc.bcm.edu;ucsc.edu	37	17	6545596	6545596	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:6545596A>C	ENST00000250101.5	+	3	580	c.255A>C	c.(253-255)agA>agC	p.R85S	TXNDC17_ENST00000570330.1_Missense_Mutation_p.R60S|TXNDC17_ENST00000574838.1_Intron|KIAA0753_ENST00000361413.3_5'Flank|KIAA0753_ENST00000572370.1_5'Flank|TXNDC17_ENST00000577146.1_3'UTR	NM_032731.3	NP_116120.1	Q9BRA2	TXD17_HUMAN	thioredoxin domain containing 17	85	Thioredoxin.				oxidation-reduction process (GO:0055114)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|peroxidase activity (GO:0004601)|protein-disulfide reductase activity (GO:0047134)			endometrium(1)|kidney(1)|ovary(1)	3						ATGACTTCAGAAAAAACTTGA	0.308																																																	0													60.0	63.0	62.0					17																	6545596		2203	4300	6503	SO:0001583	missense	84817			BC006405	CCDS11077.1	17p13.2	2007-08-16	2007-08-16	2007-08-16	ENSG00000129235	ENSG00000129235			28218	protein-coding gene	gene with protein product	"""thioredoxin (Trx)-related protein, 14 kDa"""		"""thioredoxin-like 5"""	TXNL5		14607844, 14607843	Standard	NM_032731		Approved	MGC14353, TRP14	uc002gdf.4	Q9BRA2	OTTHUMG00000102053	ENST00000250101.5:c.255A>C	17.37:g.6545596A>C	ENSP00000250101:p.Arg85Ser	Somatic		WXS	SOLID	Phase_I	A8K7E8	Missense_Mutation	SNP	ENST00000250101.5	37	CCDS11077.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.821998	0.50739	.	.	ENSG00000129235	ENST00000250101	.	.	.	5.48	-0.667	0.11395	Thioredoxin-like fold (2);	0.148027	0.64402	D	0.000014	T	0.76521	0.3999	M	0.91972	3.26	0.80722	D	1	D	0.61080	0.989	P	0.58331	0.837	T	0.79115	-0.1936	9	0.87932	D	0	-22.9809	10.6548	0.45669	0.4865:0.0:0.5135:0.0	.	85	Q9BRA2	TXD17_HUMAN	S	85	.	ENSP00000250101:R85S	R	+	3	2	TXNDC17	6486320	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	1.000000	0.29770	-0.090000	0.12462	-0.256000	0.11100	AGA		0.308	TXNDC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219854.2		NM_032731	
UBR5	51366	hgsc.bcm.edu;ucsc.edu	37	8	103266717	103266717	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr8:103266717G>T	ENST00000520539.1	-	59	8819	c.8213C>A	c.(8212-8214)tCa>tAa	p.S2738*	UBR5_ENST00000518205.1_Nonsense_Mutation_p.S466*|UBR5_ENST00000521922.1_Nonsense_Mutation_p.S2731*|KB-431C1.4_ENST00000520820.1_RNA|KB-431C1.5_ENST00000606361.1_RNA|KB-431C1.4_ENST00000499653.1_RNA|UBR5_ENST00000220959.4_Nonsense_Mutation_p.S2737*	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2738	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.|Pro-rich.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GGCTGGCAGTGATGGGCTTGA	0.403																																					Ovarian(131;96 1741 5634 7352 27489)												0													148.0	133.0	138.0					8																	103266717		2203	4300	6503	SO:0001587	stop_gained	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.8213C>A	8.37:g.103266717G>T	ENSP00000429084:p.Ser2738*	Somatic		WXS	SOLID	Phase_I	B2RP24|J3KMW7|O94970|Q9NPL3	Nonsense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	G	52	18.614992	0.99908	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	.	.	.	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	19.7009	0.96052	0.0:0.0:1.0:0.0	.	.	.	.	X	2738;2737;466;2731	.	ENSP00000220959:S2737X	S	-	2	0	UBR5	103335893	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.932000	0.87634	2.646000	0.89796	0.563000	0.77884	TCA		0.403	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2		NM_015902	
USP28	57646	hgsc.bcm.edu	37	11	113684670	113684670	+	Missense_Mutation	SNP	C	C	A	rs137875806		TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr11:113684670C>A	ENST00000003302.4	-	15	1748	c.1680G>T	c.(1678-1680)aaG>aaT	p.K560N	USP28_ENST00000537706.1_Missense_Mutation_p.K560N|USP28_ENST00000545540.1_Missense_Mutation_p.K435N|USP28_ENST00000544967.1_Missense_Mutation_p.K268N|USP28_ENST00000260188.5_Missense_Mutation_p.K560N	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	560	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CAATACAAGTCTTTAAATCTG	0.363																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												0								C	ASN/LYS	1,4401	2.1+/-5.4	0,1,2200	77.0	69.0	72.0		1680	4.6	1.0	11	dbSNP_134	72	0,8592		0,0,4296	no	missense	USP28	NM_020886.2	94	0,1,6496	AA,AC,CC		0.0,0.0227,0.0077	probably-damaging	560/1078	113684670	1,12993	2201	4296	6497	SO:0001583	missense	57646			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1680G>T	11.37:g.113684670C>A	ENSP00000003302:p.Lys560Asn	Somatic		WXS	SOLID	Phase_I	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194694	0.78902	2.27E-4	0.0	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475;ENST00000537706	T;T;T;T;T;T	0.47869	1.41;1.42;0.83;1.43;0.84;1.74	5.53	4.61	0.57282	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.63616	0.2526	L	0.59436	1.845	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.998;0.998;1.0	D;D;D;D	0.97110	1.0;0.937;0.978;0.999	T	0.61540	-0.7042	10	0.40728	T	0.16	-27.3398	14.6234	0.68602	0.0:0.929:0.0:0.071	.	435;560;560;268	B4E3L3;Q6NZX9;Q96RU2;G3V1N5	.;.;UBP28_HUMAN;.	N	560;560;268;435;264;560	ENSP00000003302:K560N;ENSP00000260188:K560N;ENSP00000442431:K268N;ENSP00000444991:K435N;ENSP00000442257:K264N;ENSP00000445743:K560N	ENSP00000003302:K560N	K	-	3	2	USP28	113189880	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.736000	0.55052	2.597000	0.87782	0.462000	0.41574	AAG		0.363	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1			
USP6	9098	hgsc.bcm.edu;ucsc.edu	37	17	5048736	5048736	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr17:5048736A>G	ENST00000574788.1	+	27	4259	c.2029A>G	c.(2029-2031)Att>Gtt	p.I677V	USP6_ENST00000250066.6_Missense_Mutation_p.I677V|USP6_ENST00000332776.4_Missense_Mutation_p.I677V|USP6_ENST00000304328.5_Missense_Mutation_p.I360V			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	677	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TAGATCAATTATTGTGGATTT	0.358			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													121.0	112.0	115.0					17																	5048736		2203	4300	6503	SO:0001583	missense	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2029A>G	17.37:g.5048736A>G	ENSP00000460380:p.Ile677Val	Somatic		WXS	SOLID	Phase_I	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	a	2.594	-0.294431	0.05568	.	.	ENSG00000129204	ENST00000332776;ENST00000250066;ENST00000304328	T;T;T	0.32515	1.45;1.45;1.45	2.36	1.36	0.22044	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.106325	0.64402	N	0.000005	T	0.11707	0.0285	N	0.05306	-0.075	0.26704	N	0.971101	B;B	0.02656	0.0;0.0	B;B	0.09377	0.0;0.004	T	0.29852	-0.9998	10	0.14252	T	0.57	.	7.1998	0.25874	0.1495:0.0:0.8505:0.0	.	360;677	P35125-2;P35125	.;UBP6_HUMAN	V	677;677;360	ENSP00000328010:I677V;ENSP00000250066:I677V;ENSP00000305473:I360V	ENSP00000250066:I677V	I	+	1	0	USP6	4989460	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	4.638000	0.61353	0.320000	0.23234	-1.355000	0.01225	ATT		0.358	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1		NM_004505	
WSCD2	9671	hgsc.bcm.edu;ucsc.edu	37	12	108641973	108641973	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr12:108641973C>A	ENST00000332082.4	+	10	2369	c.1551C>A	c.(1549-1551)aaC>aaA	p.N517K	WSCD2_ENST00000547525.1_Missense_Mutation_p.N517K|WSCD2_ENST00000261400.3_Missense_Mutation_p.N537K|WSCD2_ENST00000549903.1_Missense_Mutation_p.N537K			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	517						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						AGGATGGCAACTTCAAGCGCT	0.597																																																	0													59.0	67.0	65.0					12																	108641973		2044	4206	6250	SO:0001583	missense	9671				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1551C>A	12.37:g.108641973C>A	ENSP00000331933:p.Asn517Lys	Somatic		WXS	SOLID	Phase_I	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279124	0.59758	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.30448	1.53;4.78;1.53;4.78	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.45975	0.1369	L	0.45698	1.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.25257	-1.0137	10	0.13470	T	0.59	-54.6034	16.1113	0.81266	0.0:1.0:0.0:0.0	.	537;517	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	K	517;537;517;537	ENSP00000448047:N517K;ENSP00000261400:N537K;ENSP00000331933:N517K;ENSP00000447272:N537K	ENSP00000261400:N537K	N	+	3	2	WSCD2	107166103	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.607000	0.61133	2.029000	0.59856	0.655000	0.94253	AAC		0.597	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1		NM_014653	
ZBTB37	84614	hgsc.bcm.edu;ucsc.edu	37	1	173854955	173854955	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr1:173854955T>A	ENST00000367701.5	+	4	1396	c.1205T>A	c.(1204-1206)gTc>gAc	p.V402D	ZBTB37_ENST00000427304.1_Missense_Mutation_p.V402D|ZBTB37_ENST00000367704.1_3'UTR			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						ACACCATTCGTCTGCCGCATG	0.527																																																	0													134.0	112.0	118.0					1																	173854955		692	1591	2283	SO:0001583	missense	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.1205T>A	1.37:g.173854955T>A	ENSP00000356674:p.Val402Asp	Somatic		WXS	SOLID	Phase_I	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	ENST00000367701.5	37	CCDS44278.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518503	0.64634	.	.	ENSG00000185278	ENST00000427304;ENST00000367703;ENST00000367701	T;T	0.18338	2.22;2.22	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.053333	0.85682	D	0.000000	T	0.20292	0.0488	L	0.43701	1.375	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.04991	-1.0913	10	0.12766	T	0.61	.	16.0707	0.80928	0.0:0.0:0.0:1.0	.	402	Q5TC79	ZBT37_HUMAN	D	402;310;402	ENSP00000415293:V402D;ENSP00000356674:V402D	ENSP00000356674:V402D	V	+	2	0	ZBTB37	172121578	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	6.264000	0.72527	2.194000	0.70268	0.533000	0.62120	GTC		0.527	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090729.2		NM_032522	
ZFR2	23217	hgsc.bcm.edu	37	19	3833722	3833722	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr19:3833722A>T	ENST00000262961.4	-	3	329	c.319T>A	c.(319-321)Tac>Aac	p.Y107N	ZFR2_ENST00000591965.1_5'UTR	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	107							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GACTGGAAGTACGGCCTGTCC	0.627																																																	0													38.0	46.0	43.0					19																	3833722		2198	4294	6492	SO:0001583	missense	23217			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.319T>A	19.37:g.3833722A>T	ENSP00000262961:p.Tyr107Asn	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	A	9.541	1.113345	0.20795	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.18960	2.99;2.18	3.03	-4.06	0.03986	.	0.840574	0.10362	U	0.683940	T	0.14098	0.0341	L	0.46157	1.445	0.09310	N	0.999999	P	0.35011	0.48	B	0.28553	0.091	T	0.08066	-1.0740	10	0.72032	D	0.01	1.1747	6.903	0.24293	0.2822:0.6018:0.116:0.0	.	107	Q9UPR6	ZFR2_HUMAN	N	107	ENSP00000262961:Y107N;ENSP00000388974:Y107N	ENSP00000262961:Y107N	Y	-	1	0	ZFR2	3784722	0.047000	0.20315	0.000000	0.03702	0.001000	0.01503	0.807000	0.27140	-1.149000	0.02843	-0.558000	0.04189	TAC		0.627	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2		NM_015174	
ZFR	51663	hgsc.bcm.edu	37	5	32390431	32390431	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4693-01A-01D-1361-10	TCGA-B0-4693-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4700126-bb06-4618-9aa9-555139e4403a	819dd79c-b4d5-49c4-9b60-4c652ab13a5f	g.chr5:32390431C>T	ENST00000265069.8	-	12	2194	c.2092G>A	c.(2092-2094)Ggc>Agc	p.G698S		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	698					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		CCCAGAAGGCCTAATGGGCCT	0.557																																																	0													132.0	126.0	128.0					5																	32390431		2203	4300	6503	SO:0001583	missense	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2092G>A	5.37:g.32390431C>T	ENSP00000265069:p.Gly698Ser	Somatic		WXS	SOLID	Phase_I	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141848	0.77775	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.05258	3.47	5.42	5.42	0.78866	.	0.044279	0.85682	D	0.000000	T	0.17916	0.0430	L	0.37630	1.12	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.01617	-1.1311	10	0.33940	T	0.23	.	19.2198	0.93791	0.0:1.0:0.0:0.0	.	698	Q96KR1	ZFR_HUMAN	S	698;676	ENSP00000265069:G698S	ENSP00000265069:G698S	G	-	1	0	ZFR	32426188	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.955000	0.76007	2.550000	0.86006	0.561000	0.74099	GGC		0.557	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1			
