#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AAK1	22848	hgsc.bcm.edu	37	2	69741762	69741762	+	Silent	SNP	T	T	C	rs77547121		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr2:69741762T>C	ENST00000409085.4	-	13	1993	c.1617A>G	c.(1615-1617)caA>caG	p.Q539Q	AAK1_ENST00000406297.3_Silent_p.Q539Q|AAK1_ENST00000409068.1_Silent_p.Q539Q|RN7SL604P_ENST00000492589.2_RNA	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	539	Gln-rich.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						gctgttgttgttgctgctgct	0.542																																																	0													32.0	34.0	34.0					2																	69741762		2195	4297	6492	SO:0001819	synonymous_variant	22848			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1617A>G	2.37:g.69741762T>C		Somatic		WXS	SOLID	Phase_I	Q4ZFZ3|Q53RX6|Q9UPV4	Silent	SNP	ENST00000409085.4	37	CCDS1893.2																																																																																				0.542	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4		NM_014911	
ACE	1636	hgsc.bcm.edu;ucsc.edu	37	17	61557828	61557828	+	Silent	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:61557828G>A	ENST00000290866.4	+	5	810	c.786G>A	c.(784-786)ctG>ctA	p.L262L	ACE_ENST00000538928.1_Silent_p.L262L|ACE_ENST00000428043.1_Silent_p.L262L|ACE_ENST00000584529.1_3'UTR	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	262	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GCCGCGCACTGCATCGCCGAT	0.597																																																	0													168.0	146.0	154.0					17																	61557828		2203	4300	6503	SO:0001819	synonymous_variant	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.786G>A	17.37:g.61557828G>A		Somatic		WXS	SOLID	Phase_I	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	ENST00000290866.4	37	CCDS11637.1																																																																																				0.597	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			
ADAM18	8749	hgsc.bcm.edu	37	8	39537679	39537679	+	Silent	SNP	C	C	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr8:39537679C>G	ENST00000265707.5	+	16	1800	c.1755C>G	c.(1753-1755)tcC>tcG	p.S585S	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Silent_p.S561S	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	585	Cys-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CCACTGGTTCCTCCATGAGAT	0.383																																																	0													92.0	85.0	87.0					8																	39537679		2203	4300	6503	SO:0001819	synonymous_variant	8749			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1755C>G	8.37:g.39537679C>G		Somatic		WXS	SOLID	Phase_I	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	ENST00000265707.5	37	CCDS6113.1																																																																																				0.383	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1		NM_014237	
AKR1C1	1645	hgsc.bcm.edu;ucsc.edu	37	10	5009193	5009193	+	Silent	SNP	T	T	C	rs11548049	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr10:5009193T>C	ENST00000380872.4	+	3	519	c.327T>C	c.(325-327)gaT>gaC	p.D109D	AKR1C1_ENST00000434459.2_Silent_p.D109D|AKR1C1_ENST00000380859.1_Silent_p.D111D|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	109					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	TTCAATTGGATTATGTTGACC	0.398													T|||	19	0.00379393	0.003	0.0072	5008	,	,		18958	0.0		0.0089	False		,,,				2504	0.001				Colon(130;2054 2316 13360 15380)												0								T		31,4375	36.8+/-68.6	0,31,2172	127.0	116.0	120.0		327	-1.6	0.1	10	dbSNP_120	120	81,8519	47.6+/-106.9	1,79,4220	no	coding-synonymous	AKR1C1	NM_001353.5		1,110,6392	CC,CT,TT		0.9419,0.7036,0.8611		109/324	5009193	112,12894	2203	4300	6503	SO:0001819	synonymous_variant	1645			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.327T>C	10.37:g.5009193T>C		Somatic		WXS	SOLID	Phase_I	P52896|Q5SR15|Q7M4N2|Q9UCX2	Silent	SNP	ENST00000380872.4	37	CCDS7061.1	14	0.00641025641025641	0	0.0	4	0.011049723756906077	0	0.0	10	0.013192612137203167	T	4.162	0.028587	0.08054	0.007036	0.009419	ENSG00000187134	ENST00000442997	.	.	.	2.95	-1.58	0.08479	.	.	.	.	.	T	0.43523	0.1251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39702	-0.9601	4	.	.	.	.	7.1824	0.25780	0.0:0.3767:0.0:0.6233	rs11548049	.	.	.	T	76	.	.	I	+	2	0	AKR1C1	4999193	0.541000	0.26417	0.077000	0.20336	0.011000	0.07611	-0.389000	0.07342	-0.182000	0.10602	-0.718000	0.03613	ATT		0.398	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2		NM_001353	
ALS2CR11	151254	hgsc.bcm.edu	37	2	202352345	202352345	+	Missense_Mutation	SNP	C	C	A	rs149841146		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr2:202352345C>A	ENST00000286195.3	-	15	1906	c.1862G>T	c.(1861-1863)aGa>aTa	p.R621I	ALS2CR11_ENST00000439802.1_3'UTR|ALS2CR11_ENST00000482942.1_5'Flank|ALS2CR11_ENST00000439140.1_Missense_Mutation_p.R1818I	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	621								p.R621K(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TCAATATCCTCTTTTAATTTT	0.313																																																	1	Substitution - Missense(1)	skin(1)											89.0	89.0	89.0					2																	202352345		2203	4300	6503	SO:0001583	missense	151254			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1862G>T	2.37:g.202352345C>A	ENSP00000286195:p.Arg621Ile	Somatic		WXS	SOLID	Phase_I	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	ENST00000286195.3	37	CCDS2349.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732022	0.30684	.	.	ENSG00000155754	ENST00000286195;ENST00000439140	T;T	0.56103	0.52;0.48	4.46	3.57	0.40892	.	0.353144	0.20763	N	0.086125	T	0.48840	0.1522	N	0.08118	0	0.80722	D	1	D;D	0.61697	0.98;0.99	P;D	0.64410	0.868;0.925	T	0.56105	-0.8034	10	0.87932	D	0	.	10.6311	0.45536	0.0:0.8055:0.1945:0.0	.	1818;621	E9PGG4;Q53TS8	.;AL2SA_HUMAN	I	621;1818	ENSP00000286195:R621I;ENSP00000409937:R1818I	ENSP00000286195:R621I	R	-	2	0	ALS2CR11	202060590	0.996000	0.38824	0.953000	0.39169	0.074000	0.17049	1.326000	0.33735	1.203000	0.43233	-0.165000	0.13383	AGA		0.313	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2		NM_152525	
SOWAHB	345079	hgsc.bcm.edu	37	4	77817362	77817362	+	Silent	SNP	T	T	C	rs2703131	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr4:77817362T>C	ENST00000334306.2	-	1	1640	c.1641A>G	c.(1639-1641)ttA>ttG	p.L547L		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	547																	GTTTTAGTGATAAACCTGCAT	0.617													T|||	975	0.194688	0.2216	0.1844	5008	,	,		18462	0.0873		0.2366	False		,,,				2504	0.2331																0								T		889,3517	343.6+/-307.7	97,695,1411	45.0	47.0	46.0		1641	2.3	0.0	4	dbSNP_100	46	1850,6750	329.6+/-318.8	188,1474,2638	no	coding-synonymous	ANKRD56	NM_001029870.1		285,2169,4049	CC,CT,TT		21.5116,20.177,21.0595		547/794	77817362	2739,10267	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1641A>G	4.37:g.77817362T>C		Somatic		WXS	SOLID	Phase_I	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																				0.617	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1		NM_001029870	
AQP7	364	hgsc.bcm.edu	37	9	33385815	33385815	+	Missense_Mutation	SNP	T	T	C	rs62542745		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:33385815T>C	ENST00000537089.1	-	6	617	c.299A>G	c.(298-300)cAg>cGg	p.Q100R	AQP7_ENST00000541274.1_Silent_p.P60P|AQP7_ENST00000377425.4_Missense_Mutation_p.Q135R|AQP7_ENST00000539936.1_Missense_Mutation_p.Q192R			O14520	AQP7_HUMAN	aquaporin 7	192					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTTGTTCTCCTGGTCCGTGAT	0.612																																																	0													123.0	107.0	113.0					9																	33385815		2203	4300	6503	SO:0001583	missense	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.299A>G	9.37:g.33385815T>C	ENSP00000441619:p.Gln100Arg	Somatic		WXS	SOLID	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	t	2.177	-0.388519	0.04932	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	D;D;D;D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.02	3.85	0.44370	Aquaporin-like (2);	0.260173	0.44483	D	0.000447	T	0.69360	0.3102	N	0.20483	0.58	0.09310	N	1	B;B;B;B	0.14012	0.001;0.001;0.001;0.009	B;B;B;B	0.17098	0.006;0.006;0.01;0.017	T	0.51260	-0.8728	10	0.13853	T	0.58	-14.4887	4.9508	0.14013	0.0:0.0932:0.1892:0.7176	rs62542745	191;192;135;192	Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;AQP7_HUMAN	R	100;191;60;192;135;100;191;192;128	ENSP00000441619:Q100R;ENSP00000368821:Q191R;ENSP00000412868:Q60R;ENSP00000297988:Q192R;ENSP00000396111:Q135R;ENSP00000410138:Q100R;ENSP00000368820:Q191R;ENSP00000439534:Q192R;ENSP00000368817:Q128R	ENSP00000297988:Q192R	Q	-	2	0	AQP7	33375815	0.007000	0.16637	0.339000	0.25562	0.162000	0.22319	0.341000	0.19909	0.903000	0.36546	0.524000	0.50904	CAG		0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding			NM_001170	
ARMC8	25852	hgsc.bcm.edu;ucsc.edu	37	3	137963939	137963939	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:137963939G>A	ENST00000469044.1	+	12	1319	c.1048G>A	c.(1048-1050)Gat>Aat	p.D350N	ARMC8_ENST00000461822.1_Missense_Mutation_p.D283N|ARMC8_ENST00000538260.1_Missense_Mutation_p.D319N|ARMC8_ENST00000485396.1_Missense_Mutation_p.D277N|ARMC8_ENST00000489213.1_Missense_Mutation_p.D308N|ARMC8_ENST00000481646.1_Missense_Mutation_p.D336N|ARMC8_ENST00000393058.3_Missense_Mutation_p.D340N|ARMC8_ENST00000491704.1_Missense_Mutation_p.D308N|ARMC8_ENST00000470821.1_Missense_Mutation_p.D350N|ARMC8_ENST00000358441.2_Missense_Mutation_p.D336N|ARMC8_ENST00000471453.1_Missense_Mutation_p.D336N	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	350										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GCTTGATCATGATTTAAAACA	0.393																																																	0													86.0	80.0	82.0					3																	137963939		2203	4300	6503	SO:0001583	missense	25852				CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1048G>A	3.37:g.137963939G>A	ENSP00000419413:p.Asp350Asn	Somatic		WXS	SOLID	Phase_I	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.240843|4.240843	0.79912|0.79912	.|.	.|.	ENSG00000114098|ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000358441;ENST00000489213;ENST00000461822;ENST00000485396;ENST00000471453;ENST00000470821;ENST00000538260;ENST00000393058;ENST00000463485;ENST00000539459|ENST00000469860	T;T;T;T;T;T;T;T;T;T;T|.	0.65732|.	-0.17;-0.17;-0.17;1.85;1.13;0.25;0.21;1.85;1.84;0.2;-0.17|.	5.42|5.42	5.42|5.42	0.78866|0.78866	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67813|0.67813	0.2933|0.2933	L|L	0.48877|0.48877	1.53|1.53	0.80722|0.80722	D|D	1|1	P;D;P;P;D;D;D|.	0.69078|.	0.799;0.997;0.553;0.734;0.977;0.996;0.99|.	B;P;B;B;P;D;P|.	0.77557|.	0.395;0.908;0.151;0.321;0.787;0.99;0.827|.	T|T	0.64470|0.64470	-0.6400|-0.6400	10|5	0.72032|.	D|.	0.01|.	-5.9985|-5.9985	16.7031|16.7031	0.85364|0.85364	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	277;283;319;350;336;350;336|.	B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2;G5E9V6;Q8IUR7-6|.	.;.;.;ARMC8_HUMAN;.;.;.|.	N|I	336;350;308;336;308;283;277;336;350;319;340;244;207|63	ENSP00000420333:D336N;ENSP00000419413:D350N;ENSP00000417304:D308N;ENSP00000351221:D336N;ENSP00000418412:D308N;ENSP00000420706:D283N;ENSP00000417049:D277N;ENSP00000420440:D336N;ENSP00000418405:D350N;ENSP00000441592:D319N;ENSP00000376778:D340N|.	ENSP00000351221:D336N|.	D|M	+|+	1|3	0|0	ARMC8|ARMC8	139446629|139446629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.869000|9.869000	0.99810|0.99810	2.522000|2.522000	0.85027|0.85027	0.650000|0.650000	0.86243|0.86243	GAT|ATG		0.393	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1		NM_015396	
ASPN	54829	hgsc.bcm.edu;ucsc.edu	37	9	95233022	95233022	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:95233022T>C	ENST00000375544.3	-	3	559	c.316A>G	c.(316-318)Atg>Gtg	p.M106V	CENPP_ENST00000375587.3_Intron|ASPN_ENST00000450139.2_Silent_p.E77E|ASPN_ENST00000395538.3_Missense_Mutation_p.M106V|ASPN_ENST00000375543.1_Missense_Mutation_p.M106V	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	106					bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						AGATCAAGCATTCGAGTATCA	0.294																																																	0													87.0	92.0	90.0					9																	95233022		2203	4285	6488	SO:0001583	missense	54829			AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.316A>G	9.37:g.95233022T>C	ENSP00000364694:p.Met106Val	Somatic		WXS	SOLID	Phase_I	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	37		.	.	.	.	.	.	.	.	.	.	T	14.57	2.574130	0.45902	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538	T;T;T	0.55760	0.5;0.5;0.5	5.66	1.86	0.25419	Leucine-rich repeat-containing N-terminal (1);	0.317185	0.41938	D	0.000789	T	0.25005	0.0607	N	0.02202	-0.64	0.28012	N	0.934876	B;B	0.16396	0.016;0.017	B;B	0.23150	0.044;0.044	T	0.22765	-1.0207	10	0.48119	T	0.1	.	8.7774	0.34769	0.1117:0.0:0.3353:0.553	.	106;106	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	V	106	ENSP00000364694:M106V;ENSP00000364693:M106V;ENSP00000378909:M106V	ENSP00000364693:M106V	M	-	1	0	ASPN	94272843	0.997000	0.39634	0.999000	0.59377	0.990000	0.78478	1.392000	0.34486	1.061000	0.40601	0.529000	0.55759	ATG		0.294	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1		NM_017680	
BHLHE41	79365	hgsc.bcm.edu	37	12	26277067	26277067	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr12:26277067C>T	ENST00000242728.4	-	3	519	c.172G>A	c.(172-174)Gac>Aac	p.D58N	RP11-283G6.3_ENST00000535914.1_RNA|RP11-283G6.3_ENST00000545819.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	58	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						TTAATTCGGTCTCTTCTTTTC	0.353																																																	0													128.0	125.0	126.0					12																	26277067		2203	4299	6502	SO:0001583	missense	79365			AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.172G>A	12.37:g.26277067C>T	ENSP00000242728:p.Asp58Asn	Somatic		WXS	SOLID	Phase_I	A2I2N8	Missense_Mutation	SNP	ENST00000242728.4	37	CCDS8706.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234952	0.79800	.	.	ENSG00000123095	ENST00000242728;ENST00000540731	D	0.98075	-4.7	4.16	4.16	0.48862	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	U	0.000000	D	0.98074	0.9365	L	0.53671	1.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98847	1.0757	10	0.72032	D	0.01	-10.8985	15.5931	0.76554	0.0:1.0:0.0:0.0	.	58	Q9C0J9	BHE41_HUMAN	N	58	ENSP00000242728:D58N	ENSP00000242728:D58N	D	-	1	0	BHLHE41	26168334	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.493000	0.81493	2.317000	0.78254	0.655000	0.94253	GAC		0.353	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1		NM_030762	
ATF7	11016	hgsc.bcm.edu;ucsc.edu	37	12	53937186	53937186	+	Silent	SNP	C	C	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr12:53937186C>G	ENST00000548446.2	-	4	304	c.192G>C	c.(190-192)gtG>gtC	p.V64V	RP11-793H13.10_ENST00000591834.1_Silent_p.V64V|ATF7_ENST00000328463.7_Silent_p.V64V|ATF7_ENST00000415113.1_Silent_p.V64V|ATF7_ENST00000591397.1_Silent_p.V64V|ATF7_ENST00000548118.2_Silent_p.V64V|ATF7_ENST00000456903.4_Silent_p.V64V|ATF7_ENST00000420353.2_Silent_p.V64V			P17544	ATF7_HUMAN	activating transcription factor 7	64	Transactivation domain.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	TGAAGAGTCCCACCTCCTCAC	0.393											OREG0021875	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													77.0	71.0	73.0					12																	53937186		1947	4193	6140	SO:0001819	synonymous_variant	11016			X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.192G>C	12.37:g.53937186C>G		Somatic	996	WXS	SOLID	Phase_I	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Silent	SNP	ENST00000548446.2	37																																																																																					0.393	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2		NM_001130059	
TIMM21	29090	hgsc.bcm.edu	37	18	71825486	71825486	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr18:71825486G>A	ENST00000169551.6	+	5	915	c.617G>A	c.(616-618)gGa>gAa	p.G206E		NM_014177.2	NP_054896.2	Q9BVV7	TIM21_HUMAN	translocase of inner mitochondrial membrane 21 homolog (yeast)	206					cellular protein metabolic process (GO:0044267)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane presequence translocase complex (GO:0005744)											GGGAAGCAAGGAACGGTGTAT	0.453																																																	0													106.0	107.0	107.0					18																	71825486		2203	4300	6503	SO:0001583	missense	0			BC000892	CCDS12003.1	18q22.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000075336	ENSG00000075336			25010	protein-coding gene	gene with protein product		615180	"""chromosome 18 open reading frame 55"""	C18orf55		11042152	Standard	NM_014177		Approved	HSPC154, TIM21	uc010dqr.1	Q9BVV7	OTTHUMG00000132844	ENST00000169551.6:c.617G>A	18.37:g.71825486G>A	ENSP00000169551:p.Gly206Glu	Somatic		WXS	SOLID	Phase_I	Q9P010	Missense_Mutation	SNP	ENST00000169551.6	37	CCDS12003.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253399	0.39797	.	.	ENSG00000075336	ENST00000169551	T	0.70631	-0.5	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.84848	0.5563	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86015	0.1503	10	0.87932	D	0	-27.7639	19.5505	0.95315	0.0:0.0:1.0:0.0	.	206	Q9BVV7	TI21L_HUMAN	E	206	ENSP00000169551:G206E	ENSP00000169551:G206E	G	+	2	0	C18orf55	69976466	1.000000	0.71417	0.955000	0.39395	0.344000	0.29017	9.444000	0.97578	2.618000	0.88619	0.563000	0.77884	GGA		0.453	TIMM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256318.1		NM_014177	
CENPJ	55835	hgsc.bcm.edu;ucsc.edu	37	13	25457359	25457359	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr13:25457359C>G	ENST00000381884.4	-	17	4158	c.3973G>C	c.(3973-3975)Gtt>Ctt	p.V1325L	CENPJ_ENST00000545981.1_3'UTR|CENPJ_ENST00000493190.1_5'Flank	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1325					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTGTCCTTAACTCTTATCCGA	0.423																																																	0													345.0	289.0	308.0					13																	25457359		2203	4300	6503	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3973G>C	13.37:g.25457359C>G	ENSP00000371308:p.Val1325Leu	Somatic		WXS	SOLID	Phase_I	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108510	0.37242	.	.	ENSG00000151849	ENST00000381884	T	0.77620	-1.11	5.89	3.93	0.45458	.	0.294371	0.37178	N	0.002220	T	0.64940	0.2644	N	0.26042	0.785	0.39784	D	0.972347	B	0.26577	0.153	B	0.31686	0.134	T	0.63897	-0.6533	10	0.46703	T	0.11	.	7.5446	0.27759	0.0:0.704:0.0:0.296	.	1325	Q9HC77	CENPJ_HUMAN	L	1325	ENSP00000371308:V1325L	ENSP00000371308:V1325L	V	-	1	0	CENPJ	24355359	0.991000	0.36638	0.955000	0.39395	0.925000	0.55904	0.220000	0.17660	1.505000	0.48720	0.591000	0.81541	GTT		0.423	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1		NM_018451	
CENPJ	55835	hgsc.bcm.edu	37	13	25486101	25486101	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr13:25486101C>A	ENST00000381884.4	-	3	736	c.551G>T	c.(550-552)gGg>gTg	p.G184V	CENPJ_ENST00000545981.1_Missense_Mutation_p.G184V	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	184					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TGTGCACTGCCCAGACACCAT	0.453																																																	0													257.0	203.0	221.0					13																	25486101		2203	4300	6503	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.551G>T	13.37:g.25486101C>A	ENSP00000371308:p.Gly184Val	Somatic		WXS	SOLID	Phase_I	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559717	0.45590	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.18174	2.23;2.23	6.07	3.31	0.37934	.	0.351129	0.28349	N	0.015677	T	0.20700	0.0498	M	0.72118	2.19	0.41394	D	0.987634	P	0.43352	0.804	B	0.40506	0.331	T	0.01771	-1.1277	10	0.62326	D	0.03	.	9.6335	0.39793	0.0:0.6582:0.2649:0.0769	.	184	Q9HC77	CENPJ_HUMAN	V	184	ENSP00000371308:G184V;ENSP00000441090:G184V	ENSP00000371308:G184V	G	-	2	0	CENPJ	24384101	0.445000	0.25657	0.897000	0.35233	0.369000	0.29798	0.365000	0.20348	0.390000	0.25115	-0.122000	0.15005	GGG		0.453	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1		NM_018451	
CHRNA6	8973	hgsc.bcm.edu;ucsc.edu	37	8	42611131	42611131	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr8:42611131A>C	ENST00000276410.2	-	5	1566	c.1211T>G	c.(1210-1212)cTt>cGt	p.L404R	CHRNA6_ENST00000534622.1_Missense_Mutation_p.L389R|CHRNA6_ENST00000530869.1_5'Flank	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	404					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	GCTTGTGGCAAGCTCATTTGA	0.483																																																	0													166.0	144.0	151.0					8																	42611131		2203	4300	6503	SO:0001583	missense	8973			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.1211T>G	8.37:g.42611131A>C	ENSP00000276410:p.Leu404Arg	Somatic		WXS	SOLID	Phase_I	B2R8V4|B4DQH1	Missense_Mutation	SNP	ENST00000276410.2	37	CCDS6135.1	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.672631	0.00758	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	T;T	0.69561	-0.41;-0.41	6.07	0.931	0.19460	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.582400	0.03463	N	0.212564	T	0.50446	0.1616	N	0.25380	0.74	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.13407	0.009;0.005	T	0.16158	-1.0412	10	0.18276	T	0.48	.	3.7986	0.08750	0.4728:0.0:0.2812:0.2461	.	389;404	B4DQH1;Q15825	.;ACHA6_HUMAN	R	404;389	ENSP00000276410:L404R;ENSP00000433871:L389R	ENSP00000276410:L404R	L	-	2	0	CHRNA6	42730288	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	0.010000	0.13242	-0.061000	0.13110	0.533000	0.62120	CTT		0.483	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1			
CXorf51A	100129239	hgsc.bcm.edu	37	X	145896115	145896115	+	lincRNA	SNP	C	C	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chrX:145896115C>T	ENST00000458472.1	-	0	129									chromosome X open reading frame 51A																		CTCACCTTAACGCCGCTTCTG	0.542																																																	0																																												0			AA723770		Xq27.3	2013-01-16	2011-09-08	2011-09-08	ENSG00000224440	ENSG00000224440			30533	other	unknown			"""chromosome X open reading frame 51"""	CXorf51			Standard	NM_001144064		Approved		uc011mwv.2		OTTHUMG00000022600		X.37:g.145896115C>T		Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000458472.1	37																																																																																					0.542	CXorf51A-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058639.1		NM_001144064	
DCP1A	55802	hgsc.bcm.edu;ucsc.edu	37	3	53326738	53326738	+	Missense_Mutation	SNP	A	A	C	rs375268167		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:53326738A>C	ENST00000607628.1	-	7	853	c.744T>G	c.(742-744)gaT>gaG	p.D248E	DCP1A_ENST00000294241.6_Missense_Mutation_p.D248E|Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000606822.1_Missense_Mutation_p.D210E|DCP1A_ENST00000480258.1_5'UTR	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	248					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TCTGGGAGGCATCTCCTGGCA	0.507																																																	0													45.0	45.0	45.0					3																	53326738		1909	4128	6037	SO:0001583	missense	55802			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.744T>G	3.37:g.53326738A>C	ENSP00000475920:p.Asp248Glu	Somatic		WXS	SOLID	Phase_I	B4DHN9|U3KQM8	Missense_Mutation	SNP	ENST00000607628.1	37																																																																																					0.507	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_018403	
DDX27	55661	hgsc.bcm.edu	37	20	47835898	47835898	+	Silent	SNP	A	A	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr20:47835898A>G	ENST00000371764.4	+	1	15	c.6A>G	c.(4-6)gtA>gtG	p.V2V	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	2						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GACGCATGGTACTTGCGCAAA	0.607																																																	0													74.0	61.0	65.0					20																	47835898		2203	4300	6503	SO:0001819	synonymous_variant	55661			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.6A>G	20.37:g.47835898A>G		Somatic		WXS	SOLID	Phase_I	A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Silent	SNP	ENST00000371764.4	37	CCDS13416.1																																																																																				0.607	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1			
DDX4	54514	hgsc.bcm.edu;ucsc.edu	37	5	55109576	55109576	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr5:55109576A>C	ENST00000505374.1	+	19	1783	c.1691A>C	c.(1690-1692)aAa>aCa	p.K564T	DDX4_ENST00000353507.5_Missense_Mutation_p.K530T|DDX4_ENST00000514278.2_Missense_Mutation_p.K544T|DDX4_ENST00000354991.5_Missense_Mutation_p.K530T|DDX4_ENST00000511853.1_Missense_Mutation_p.K415T	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	564	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TGTCAAGAAAAAATATCAACT	0.279																																																	0													72.0	87.0	82.0					5																	55109576		2202	4295	6497	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1691A>C	5.37:g.55109576A>C	ENSP00000424838:p.Lys564Thr	Somatic		WXS	SOLID	Phase_I	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.586776	0.86851	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000354991;ENST00000511853	D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09	6.17	6.17	0.99709	Helicase, C-terminal (3);	0.142439	0.64402	D	0.000007	D	0.90813	0.7115	L	0.33245	0.995	0.47308	D	0.999386	P;P;B;P	0.48998	0.523;0.866;0.391;0.918	B;P;B;B	0.48770	0.257;0.589;0.257;0.42	D	0.91176	0.4972	10	0.51188	T	0.08	-7.0149	16.8222	0.85835	1.0:0.0:0.0:0.0	.	544;415;530;564	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	T	530;544;564;530;415	ENSP00000334167:K530T;ENSP00000425359:K544T;ENSP00000424838:K564T;ENSP00000347087:K530T;ENSP00000423123:K415T	ENSP00000334167:K530T	K	+	2	0	DDX4	55145333	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.895000	0.92512	2.371000	0.80710	0.533000	0.62120	AAA		0.279	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2		NM_024415	
FAM57A	79850	hgsc.bcm.edu;ucsc.edu	37	17	641269	641269	+	Silent	SNP	C	C	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:641269C>A	ENST00000308278.8	+	3	626	c.390C>A	c.(388-390)gtC>gtA	p.V130V	FAM57A_ENST00000301324.8_Silent_p.V130V|FAM57A_ENST00000572018.1_Intron	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	130	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		TTCTCTTTGTCCTTGTGCCAG	0.512																																																	0													102.0	87.0	92.0					17																	641269		2203	4300	6503	SO:0001819	synonymous_variant	79850			AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.390C>A	17.37:g.641269C>A		Somatic		WXS	SOLID	Phase_I	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Silent	SNP	ENST00000308278.8	37	CCDS10996.1																																																																																				0.512	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437155.2		NM_024792	
FAM65B	9750	hgsc.bcm.edu	37	6	24828489	24828489	+	Silent	SNP	C	C	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr6:24828489C>T	ENST00000259698.4	-	19	2779	c.2604G>A	c.(2602-2604)cgG>cgA	p.R868R	FAM65B_ENST00000538035.1_Silent_p.R847R	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	868			R -> Q (in dbSNP:rs9461073). {ECO:0000269|PubMed:9205841}.		cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GAGGCTCAGCCCGGTCCAGAA	0.483																																																	0													49.0	48.0	48.0					6																	24828489		692	1591	2283	SO:0001819	synonymous_variant	9750			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.2604G>A	6.37:g.24828489C>T		Somatic		WXS	SOLID	Phase_I	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Silent	SNP	ENST00000259698.4	37	CCDS47383.1																																																																																				0.483	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			
FBXO40	51725	hgsc.bcm.edu	37	3	121340509	121340509	+	Missense_Mutation	SNP	G	G	A	rs78367832	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:121340509G>A	ENST00000338040.4	+	3	647	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	78					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R78H(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		TCCATGTCCCGCCACAAACTG	0.592													G|||	25	0.00499201	0.0008	0.0	5008	,	,		17444	0.0218		0.0	False		,,,				2504	0.002																1	Substitution - Missense(1)	central_nervous_system(1)						G	HIS/ARG	0,4406		0,0,2203	47.0	51.0	50.0		233	4.6	1.0	3	dbSNP_131	50	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FBXO40	NM_016298.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	78/710	121340509	1,13005	2203	4300	6503	SO:0001583	missense	51725			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.233G>A	3.37:g.121340509G>A	ENSP00000337510:p.Arg78His	Somatic		WXS	SOLID	Phase_I	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	15	0.006868131868131868	0	0.0	0	0.0	15	0.026223776223776224	0	0.0	G	19.05	3.752091	0.69533	0.0	1.16E-4	ENSG00000163833	ENST00000338040	T	0.30182	1.54	5.47	4.6	0.57074	Zinc finger, TRAF-type (1);Seven In Absentia Homolog-type (1);	0.000000	0.85682	D	0.000000	T	0.33673	0.0871	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56420	-0.7982	10	0.87932	D	0	-15.4513	12.002	0.53237	0.0841:0.0:0.9159:0.0	.	78	Q9UH90	FBX40_HUMAN	H	78	ENSP00000337510:R78H	ENSP00000337510:R78H	R	+	2	0	FBXO40	122823199	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.835000	0.99442	1.331000	0.45412	-0.136000	0.14681	CGC		0.592	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1		NM_016298	
FCRLB	127943	hgsc.bcm.edu	37	1	161693269	161693269	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr1:161693269G>T	ENST00000367948.2	+	5	380	c.165G>T	c.(163-165)caG>caT	p.Q55H	FCRLB_ENST00000367946.3_Missense_Mutation_p.Q55H|FCRLB_ENST00000392158.1_Missense_Mutation_p.Q55H|FCRLB_ENST00000336830.5_Missense_Mutation_p.Q55H|FCRLB_ENST00000367945.1_Missense_Mutation_p.Q48H|FCRLB_ENST00000367944.3_Missense_Mutation_p.Q48H			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	55	Ig-like C2-type 1.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TGGAGCTCCAGCCCATCAGCA	0.542																																																	0													138.0	131.0	133.0					1																	161693269		2203	4300	6503	SO:0001583	missense	127943			AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.165G>T	1.37:g.161693269G>T	ENSP00000356925:p.Gln55His	Somatic		WXS	SOLID	Phase_I	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Missense_Mutation	SNP	ENST00000367948.2	37	CCDS30927.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608611	0.46527	.	.	ENSG00000162746	ENST00000367948;ENST00000367946;ENST00000367945;ENST00000336830;ENST00000367944;ENST00000392158	T;T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65;2.65	5.76	-1.04	0.10068	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.495763	0.17071	N	0.188173	T	0.02767	0.0083	L	0.27053	0.805	0.20638	N	0.999876	B;B;P;B;B	0.45348	0.443;0.164;0.856;0.164;0.087	B;B;B;B;B	0.41036	0.243;0.115;0.346;0.115;0.132	T	0.38993	-0.9635	10	0.54805	T	0.06	.	4.6928	0.12788	0.4125:0.0:0.4452:0.1423	.	48;48;55;55;55	Q6BAA4-3;Q6BAA4-5;Q6BAA4-2;Q6BAA4-4;Q6BAA4	.;.;.;.;FCRLB_HUMAN	H	55;55;48;55;48;55	ENSP00000356925:Q55H;ENSP00000356923:Q55H;ENSP00000356922:Q48H;ENSP00000338598:Q55H;ENSP00000356921:Q48H;ENSP00000375999:Q55H	ENSP00000338598:Q55H	Q	+	3	2	FCRLB	159959893	0.149000	0.22717	0.989000	0.46669	0.945000	0.59286	-0.261000	0.08694	0.044000	0.15775	0.655000	0.94253	CAG		0.542	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1		NM_152378	
FER1L5	90342	hgsc.bcm.edu;ucsc.edu	37	2	97366098	97366098	+	RNA	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr2:97366098G>A	ENST00000457909.1	+	0	4463							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						TCATGGTTTGGGACCCAAGAA	0.577																																																	0													101.0	112.0	108.0					2																	97366098		2062	4184	6246			90342			BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97366098G>A		Somatic		WXS	SOLID	Phase_I	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	G	13.29	2.192767	0.38707	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	5.05	4.18	0.49190	.	0.000000	0.44902	U	0.000403	T	0.79799	0.4508	M	0.85462	2.755	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.981;0.999;0.992	D	0.86091	0.1550	8	0.87932	D	0	-18.5804	12.158	0.54087	0.0847:0.0:0.9153:0.0	.	398;1681;399	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	R	1681;1694;399	.	ENSP00000442027:G399R	G	+	1	0	FER1L5	96729825	1.000000	0.71417	0.480000	0.27341	0.924000	0.55760	9.214000	0.95140	1.133000	0.42147	0.561000	0.74099	GGA		0.577	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1		NM_001077400	
FRMPD4	9758	hgsc.bcm.edu;ucsc.edu	37	X	12736245	12736245	+	Silent	SNP	G	G	C	rs373119872		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chrX:12736245G>C	ENST00000380682.1	+	16	3806	c.3300G>C	c.(3298-3300)ggG>ggC	p.G1100G		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1100					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CTGAAGGTGGGATGGCTGAAA	0.502																																																	0													139.0	138.0	138.0					X																	12736245		2203	4300	6503	SO:0001819	synonymous_variant	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3300G>C	X.37:g.12736245G>C		Somatic		WXS	SOLID	Phase_I	A8K0X9|O15032	Silent	SNP	ENST00000380682.1	37	CCDS35201.1																																																																																				0.502	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1		XM_045712	
GALNT7	51809	hgsc.bcm.edu	37	4	174219388	174219388	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr4:174219388A>G	ENST00000265000.4	+	6	1171	c.1088A>G	c.(1087-1089)aAa>aGa	p.K363R	GALNT7_ENST00000512285.1_3'UTR	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	363					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		ATGCTCTGGAAACGGGTGCCT	0.433																																																	0													79.0	80.0	80.0					4																	174219388		2203	4300	6503	SO:0001583	missense	51809			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1088A>G	4.37:g.174219388A>G	ENSP00000265000:p.Lys363Arg	Somatic		WXS	SOLID	Phase_I	B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	ENST00000265000.4	37	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.876722	0.91664	.	.	ENSG00000109586	ENST00000265000	T	0.58797	0.31	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.70133	0.3189	L	0.47190	1.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69143	-0.5223	10	0.40728	T	0.16	.	15.9192	0.79547	1.0:0.0:0.0:0.0	.	363	Q86SF2	GALT7_HUMAN	R	363	ENSP00000265000:K363R	ENSP00000265000:K363R	K	+	2	0	GALNT7	174455963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.164000	0.68074	0.533000	0.62120	AAA		0.433	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2		NM_017423	
GNAI2	2771	hgsc.bcm.edu	37	3	50295032	50295032	+	Silent	SNP	C	C	T	rs587605417		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:50295032C>T	ENST00000313601.6	+	8	1362	c.978C>T	c.(976-978)tgC>tgT	p.C326C	GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000266027.5_Silent_p.C310C|GNAI2_ENST00000440628.1_Silent_p.C274C|GNAI2_ENST00000536647.1_Silent_p.C245C|U73166.2_ENST00000439898.1_lincRNA|GNAI2_ENST00000422163.1_Silent_p.C310C|GNAI2_ENST00000451956.1_Silent_p.C289C	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	326					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		ACTTCACGTGCGCCACCGACA	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		11775	0.0		0.0	False		,,,				2504	0.001																0													91.0	71.0	78.0					3																	50295032		2203	4300	6503	SO:0001819	synonymous_variant	2771			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.978C>T	3.37:g.50295032C>T		Somatic		WXS	SOLID	Phase_I	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Silent	SNP	ENST00000313601.6	37	CCDS2813.1																																																																																				0.537	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1		NM_002070	
GON4L	54856	hgsc.bcm.edu	37	1	155735259	155735259	+	Silent	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr1:155735259T>C	ENST00000368331.1	-	21	4053	c.4005A>G	c.(4003-4005)gaA>gaG	p.E1335E	GON4L_ENST00000437809.1_Silent_p.E1335E|GON4L_ENST00000271883.5_Silent_p.E1335E|GON4L_ENST00000361040.5_Silent_p.E1335E|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1335					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATCCACTGATTTCCTCTCTAG	0.512																																																	0													109.0	104.0	106.0					1																	155735259		2203	4300	6503	SO:0001819	synonymous_variant	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4005A>G	1.37:g.155735259T>C		Somatic		WXS	SOLID	Phase_I	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																					0.512	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_032292	
GPATCH8	23131	hgsc.bcm.edu;ucsc.edu	37	17	42475564	42475564	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:42475564G>C	ENST00000591680.1	-	8	3911	c.3881C>G	c.(3880-3882)aCa>aGa	p.T1294R	GPATCH8_ENST00000434000.1_Missense_Mutation_p.T1216R	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1294							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		AGCCCCATCTGTTGACTCAAT	0.577																																																	0													106.0	101.0	102.0					17																	42475564		2203	4300	6503	SO:0001583	missense	23131			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.3881C>G	17.37:g.42475564G>C	ENSP00000467556:p.Thr1294Arg	Somatic		WXS	SOLID	Phase_I	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	G	0.156	-1.086596	0.01873	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.11277	2.79	4.52	3.56	0.40772	.	1.018130	0.07830	N	0.961197	T	0.05456	0.0144	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.15484	0.013	T	0.42344	-0.9457	10	0.21014	T	0.42	-0.624	4.6923	0.12786	0.0857:0.1481:0.6138:0.1523	.	1294	Q9UKJ3	GPTC8_HUMAN	R	1294;1216	ENSP00000395016:T1216R	ENSP00000335486:T1294R	T	-	2	0	GPATCH8	39831090	0.049000	0.20398	0.857000	0.33713	0.914000	0.54420	1.643000	0.37217	1.128000	0.42052	0.460000	0.39030	ACA		0.577	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1		NM_001002909	
HIST1H2BD	3017	hgsc.bcm.edu	37	6	26158751	26158751	+	Silent	SNP	C	C	T	rs541069056		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr6:26158751C>T	ENST00000289316.2	+	1	378	c.354C>T	c.(352-354)gcC>gcT	p.A118A	HIST1H2BD_ENST00000377777.4_Silent_p.A118A	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	118					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A118A(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						GCACCAAGGCCGTCACCAAGT	0.547																																																	1	Substitution - coding silent(1)	ovary(1)											70.0	76.0	74.0					6																	26158751		2203	4300	6503	SO:0001819	synonymous_variant	3017			M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.354C>T	6.37:g.26158751C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000289316.2	37	CCDS4587.1																																																																																				0.547	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040088.1		NM_021063	
GPR31	2853	hgsc.bcm.edu	37	6	167570628	167570628	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr6:167570628A>G	ENST00000366834.1	-	1	1189	c.692T>C	c.(691-693)tTt>tCt	p.F231S		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	231					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GCACAGAGCAAACAGCACCAC	0.592																																																	0													79.0	87.0	84.0					6																	167570628		2203	4300	6503	SO:0001583	missense	2853			U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.692T>C	6.37:g.167570628A>G	ENSP00000355799:p.Phe231Ser	Somatic		WXS	SOLID	Phase_I	B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	ENST00000366834.1	37	CCDS5299.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.679573	0.47886	.	.	ENSG00000120436	ENST00000366834	T	0.57107	0.42	3.58	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37955	U	0.001877	T	0.69459	0.3113	M	0.91561	3.22	0.34371	D	0.692095	D	0.89917	1.0	D	0.91635	0.999	T	0.77242	-0.2660	10	0.87932	D	0	-25.5194	11.2039	0.48758	1.0:0.0:0.0:0.0	.	231	O00270	GPR31_HUMAN	S	231	ENSP00000355799:F231S	ENSP00000355799:F231S	F	-	2	0	GPR31	167490618	0.988000	0.35896	0.011000	0.14972	0.270000	0.26580	6.142000	0.71750	1.512000	0.48834	0.165000	0.16767	TTT		0.592	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043111.1		NM_005299	
IGSF10	285313	hgsc.bcm.edu	37	3	151164336	151164336	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:151164336A>C	ENST00000282466.3	-	4	3432	c.3433T>G	c.(3433-3435)Tat>Gat	p.Y1145D		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1145					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTTGGAGCATATGTCATGACT	0.408																																																	0													255.0	242.0	246.0					3																	151164336		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3433T>G	3.37:g.151164336A>C	ENSP00000282466:p.Tyr1145Asp	Somatic		WXS	SOLID	Phase_I	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	A	8.924	0.961840	0.18583	.	.	ENSG00000152580	ENST00000282466	T	0.67523	-0.27	5.34	-0.86	0.10680	.	1.267010	0.05823	N	0.616069	T	0.41534	0.1163	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18429	-1.0337	10	0.36615	T	0.2	.	2.963	0.05899	0.1028:0.2501:0.4086:0.2385	.	1145	Q6WRI0	IGS10_HUMAN	D	1145	ENSP00000282466:Y1145D	ENSP00000282466:Y1145D	Y	-	1	0	IGSF10	152647026	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.497000	0.06428	-0.131000	0.11578	0.482000	0.46254	TAT		0.408	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1		NM_178822	
IL12RB1	3594	hgsc.bcm.edu	37	19	18174754	18174754	+	Missense_Mutation	SNP	G	G	A	rs372578469		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr19:18174754G>A	ENST00000600835.2	-	14	1848	c.1550C>T	c.(1549-1551)aCg>aTg	p.T517M	IL12RB1_ENST00000593993.2_Missense_Mutation_p.T517M			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	517	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						CACCTGCACCGTGTAGGCTAC	0.632																																																	0								G	MET/THR	1,4103		0,1,2051	32.0	36.0	35.0		1550	-1.9	0.0	19		35	1,8401		0,1,4200	no	missense	IL12RB1	NM_005535.1	81	0,2,6251	AA,AG,GG		0.0119,0.0244,0.016	benign	517/663	18174754	2,12504	2052	4201	6253	SO:0001583	missense	3594			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1550C>T	19.37:g.18174754G>A	ENSP00000470788:p.Thr517Met	Somatic		WXS	SOLID	Phase_I	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	ENST00000600835.2	37	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.444984	0.25987	2.44E-4	1.19E-4	ENSG00000096996	ENST00000430026	T	0.59638	0.25	3.21	-1.92	0.07618	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.340040	0.05181	N	0.501327	T	0.31544	0.0800	N	0.17474	0.49	0.09310	N	1	P;P	0.44006	0.789;0.824	B;B	0.34536	0.116;0.185	T	0.20874	-1.0262	10	0.41790	T	0.15	-2.0647	1.4865	0.02447	0.1208:0.1695:0.3014:0.4083	.	517;517	P42701-2;P42701	.;I12R1_HUMAN	M	517	ENSP00000403103:T517M	ENSP00000403103:T517M	T	-	2	0	IL12RB1	18035754	0.007000	0.16637	0.001000	0.08648	0.352000	0.29268	-0.050000	0.11904	-0.277000	0.09193	0.491000	0.48974	ACG		0.632	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3			
IL4	3565	hgsc.bcm.edu	37	5	132018257	132018257	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr5:132018257A>G	ENST00000231449.2	+	4	505	c.440A>G	c.(439-441)aAa>aGa	p.K147R	IL4_ENST00000350025.2_Missense_Mutation_p.K131R	NM_000589.3	NP_000580.1	P05112	IL4_HUMAN	interleukin 4	147					B cell costimulation (GO:0031296)|B cell differentiation (GO:0030183)|cellular defense response (GO:0006968)|cellular response to mercury ion (GO:0071288)|chemotaxis (GO:0006935)|cholesterol metabolic process (GO:0008203)|connective tissue growth factor biosynthetic process (GO:0045189)|defense response to protozoan (GO:0042832)|dendritic cell differentiation (GO:0097028)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female pregnancy (GO:0007565)|immune response (GO:0006955)|innate immune response in mucosa (GO:0002227)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of macrophage activation (GO:0043031)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of T-helper 17 cell differentiation (GO:2000320)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of immune response (GO:0050776)|regulation of isotype switching (GO:0045191)|regulation of phosphorylation (GO:0042325)|regulation of proton transport (GO:0010155)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|T-helper 1 cell lineage commitment (GO:0002296)|T-helper 2 cell cytokine production (GO:0035745)|T-helper 2 cell differentiation (GO:0045064)|type 2 immune response (GO:0042092)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-4 receptor binding (GO:0005136)			NS(1)|large_intestine(3)|lung(3)|prostate(1)	8		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)		ATGAGAGAGAAATATTCAAAG	0.294																																																	0													79.0	80.0	80.0					5																	132018257		2203	4300	6503	SO:0001583	missense	3565			M23442	CCDS4158.1, CCDS4159.1	5q23-q31	2011-07-14			ENSG00000113520	ENSG00000113520		"""Interleukins and interleukin receptors"""	6014	protein-coding gene	gene with protein product	"""B_cell stimulatory factor 1"", ""lymphocyte stimulatory factor 1"", ""B cell growth factor 1"""	147780				3016727	Standard	NM_000589		Approved	BSF1, IL-4, BCGF1, BCGF-1, MGC79402	uc003kxk.2	P05112	OTTHUMG00000059724	ENST00000231449.2:c.440A>G	5.37:g.132018257A>G	ENSP00000231449:p.Lys147Arg	Somatic		WXS	SOLID	Phase_I	Q14630|Q6NZ77	Missense_Mutation	SNP	ENST00000231449.2	37	CCDS4158.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.014101	0.35511	.	.	ENSG00000113520	ENST00000231449;ENST00000350025	T;T	0.53857	0.6;0.6	5.24	1.22	0.21188	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.376546	0.23116	N	0.051754	T	0.43277	0.1240	L	0.49126	1.545	0.23879	N	0.99658	B;B	0.20261	0.043;0.043	B;B	0.30646	0.118;0.118	T	0.43925	-0.9361	10	0.72032	D	0.01	-11.1676	3.7203	0.08453	0.4717:0.0:0.1016:0.4266	.	131;147	Q5FC01;P05112	.;IL4_HUMAN	R	147;131	ENSP00000231449:K147R;ENSP00000325190:K131R	ENSP00000231449:K147R	K	+	2	0	IL4	132046156	1.000000	0.71417	0.869000	0.34112	0.720000	0.41350	1.350000	0.34010	0.320000	0.23234	-0.301000	0.09380	AAA		0.294	IL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132786.1		NM_000589	
KDM7A	80853	hgsc.bcm.edu	37	7	139826594	139826594	+	Missense_Mutation	SNP	A	A	G	rs182952796	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr7:139826594A>G	ENST00000397560.2	-	6	828	c.731T>C	c.(730-732)aTa>aCa	p.I244T	JHDM1D_ENST00000006967.5_Missense_Mutation_p.I244T	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		244	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					TTTTTTGGCTATATCAGGGAC	0.368													A|||	3	0.000599042	0.0	0.0	5008	,	,		16976	0.0		0.003	False		,,,				2504	0.0																0								A	THR/ILE	0,3636		0,0,1818	73.0	69.0	71.0		731	5.9	1.0	7		71	1,8171		0,1,4085	yes	missense	JHDM1D	NM_030647.1	89	0,1,5903	GG,GA,AA		0.0122,0.0,0.0085	probably-damaging	244/942	139826594	1,11807	1818	4086	5904	SO:0001583	missense	80853																														ENST00000397560.2:c.731T>C	7.37:g.139826594A>G	ENSP00000380692:p.Ile244Thr	Somatic		WXS	SOLID	Phase_I	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	ENST00000397560.2	37	CCDS43658.1	11	0.005036630036630037	0	0.0	0	0.0	0	0.0	11	0.014511873350923483	A	25.4	4.630809	0.87660	0.0	1.22E-4	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.70749	-0.51;-0.51	5.9	5.9	0.94986	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.098532	0.64402	D	0.000001	T	0.78553	0.4301	M	0.71871	2.18	0.80722	D	1	D	0.61080	0.989	D	0.68765	0.96	T	0.82499	-0.0427	10	0.62326	D	0.03	-18.9221	16.315	0.82915	1.0:0.0:0.0:0.0	.	244	Q6ZMT4	KDM7_HUMAN	T	244	ENSP00000380692:I244T;ENSP00000006967:I244T	ENSP00000006967:I244T	I	-	2	0	JHDM1D	139473063	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.250000	0.74265	0.533000	0.62120	ATA		0.368	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1			
KIAA0368	23392	hgsc.bcm.edu;ucsc.edu	37	9	114133030	114133030	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:114133030C>T	ENST00000338205.5	-	43	4972	c.4753G>A	c.(4753-4755)Gcc>Acc	p.A1585T	KIAA0368_ENST00000374378.3_Missense_Mutation_p.A49T|KIAA0368_ENST00000259335.4_Missense_Mutation_p.A1763T|KIAA0368_ENST00000465499.1_5'Flank			Q5VYK3	ECM29_HUMAN	KIAA0368	1591					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						CAGGCAATGGCTTTCAATAGC	0.393																																																	0													44.0	43.0	43.0					9																	114133030		1896	4108	6004	SO:0001583	missense	23392			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.4753G>A	9.37:g.114133030C>T	ENSP00000339889:p.Ala1585Thr	Somatic		WXS	SOLID	Phase_I	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	C	35	5.498252	0.96355	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000374383;ENST00000543827;ENST00000374378	T;T	0.69685	-0.42;-0.42	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.82921	0.5142	M	0.81497	2.545	0.80722	D	1	D	0.67145	0.996	D	0.64595	0.927	D	0.83912	0.0296	10	0.72032	D	0.01	.	20.2822	0.98520	0.0:1.0:0.0:0.0	.	1060	B3KXF2	.	T	1585;1763;49;1060;49	ENSP00000259335:A1763T;ENSP00000363499:A49T	ENSP00000259335:A1763T	A	-	1	0	KIAA0368	113172851	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.460000	0.66691	2.806000	0.96561	0.655000	0.94253	GCC		0.393	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2		NM_014686	
KANSL3	55683	hgsc.bcm.edu;ucsc.edu	37	2	97278654	97278654	+	Silent	SNP	A	A	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr2:97278654A>G	ENST00000431828.1	-	7	889	c.813T>C	c.(811-813)tcT>tcC	p.S271S	KANSL3_ENST00000440133.1_Silent_p.S65S|KANSL3_ENST00000441706.2_Silent_p.S184S|KANSL3_ENST00000599854.1_Silent_p.S184S|KANSL3_ENST00000487070.1_5'UTR			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	271					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GAATCAGCGGAGAGCCAGGGA	0.522																																																	0													29.0	37.0	35.0					2																	97278654		2002	4151	6153	SO:0001819	synonymous_variant	0			BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.813T>C	2.37:g.97278654A>G		Somatic		WXS	SOLID	Phase_I	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Silent	SNP	ENST00000431828.1	37	CCDS46361.1																																																																																				0.522	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2		NM_017991	
KSR2	283455	hgsc.bcm.edu	37	12	118105409	118105409	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr12:118105409G>T	ENST00000339824.5	-	5	1768	c.1041C>A	c.(1039-1041)agC>agA	p.S347R	KSR2_ENST00000425217.1_Missense_Mutation_p.S318R|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000302438.5_Missense_Mutation_p.S44R			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	347					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.S379R(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGTTCTCGCAGCTGCCTACGC	0.552																																																	1	Substitution - Missense(1)	lung(1)											53.0	57.0	56.0					12																	118105409		1978	4161	6139	SO:0001583	missense	283455			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1041C>A	12.37:g.118105409G>T	ENSP00000339952:p.Ser347Arg	Somatic		WXS	SOLID	Phase_I	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37		.	.	.	.	.	.	.	.	.	.	G	9.539	1.112879	0.20795	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;T	0.51071	0.72;0.72;0.72	4.9	4.01	0.46588	.	0.110642	0.64402	D	0.000012	T	0.48447	0.1500	L	0.36672	1.1	0.50813	D	0.999895	D	0.61697	0.99	D	0.69142	0.962	T	0.50915	-0.8771	10	0.05620	T	0.96	.	8.8477	0.35181	0.1751:0.0:0.8249:0.0	.	347	Q6VAB6	KSR2_HUMAN	R	318;347;44;19	ENSP00000389715:S318R;ENSP00000339952:S347R;ENSP00000305466:S44R	ENSP00000305466:S44R	S	-	3	2	KSR2	116589792	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.391000	0.73208	1.190000	0.43042	0.563000	0.77884	AGC		0.552	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2		NM_173598	
KTN1	3895	hgsc.bcm.edu;ucsc.edu	37	14	56137506	56137506	+	Silent	SNP	T	T	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr14:56137506T>A	ENST00000395314.3	+	35	3395	c.3327T>A	c.(3325-3327)acT>acA	p.T1109T	KTN1_ENST00000395311.1_Silent_p.T1086T|KTN1_ENST00000413890.2_Silent_p.T1086T|KTN1_ENST00000554507.1_Silent_p.T375T|KTN1_ENST00000416613.1_Silent_p.T1109T|KTN1_ENST00000395308.1_Silent_p.T1086T|KTN1_ENST00000395309.3_Silent_p.T1109T|KTN1_ENST00000438792.2_Silent_p.T1080T|KTN1_ENST00000555573.1_Silent_p.T114T	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	1109					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						TGGCTGGAACTTCAGGGTCAG	0.333			T	RET	papillary thryoid																																			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													92.0	92.0	92.0					14																	56137506		2203	4300	6503	SO:0001819	synonymous_variant	3895				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.3327T>A	14.37:g.56137506T>A		Somatic		WXS	SOLID	Phase_I	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Silent	SNP	ENST00000395314.3	37	CCDS41957.1																																																																																				0.333	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2			
L1CAM	3897	hgsc.bcm.edu	37	X	153131183	153131183	+	Silent	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chrX:153131183G>A	ENST00000370060.1	-	20	2712	c.2523C>T	c.(2521-2523)gtC>gtT	p.V841V	L1CAM_ENST00000370055.1_Silent_p.V836V|L1CAM_ENST00000543994.1_Silent_p.V843V|L1CAM_ENST00000361981.3_Silent_p.V836V|L1CAM_ENST00000361699.4_Silent_p.V841V|L1CAM_ENST00000370057.3_Silent_p.V841V|L1CAM_ENST00000538883.1_Silent_p.V843V	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	841	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.V841V(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGTGGCCCTTGACCTGGGCCA	0.602																																																	1	Substitution - coding silent(1)	ovary(1)											91.0	95.0	94.0					X																	153131183		2203	4300	6503	SO:0001819	synonymous_variant	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2523C>T	X.37:g.153131183G>A		Somatic		WXS	SOLID	Phase_I	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	CCDS14733.1																																																																																				0.602	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2		NM_024003	
LAMA1	284217	hgsc.bcm.edu;ucsc.edu	37	18	7008502	7008502	+	Silent	SNP	C	C	T	rs374423781		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr18:7008502C>T	ENST00000389658.3	-	28	4200	c.4107G>A	c.(4105-4107)gtG>gtA	p.V1369V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1369	Laminin EGF-like 14; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATGAGAATCCCACAGTGCCAG	0.453																																																	0													103.0	91.0	95.0					18																	7008502		2203	4300	6503	SO:0001819	synonymous_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4107G>A	18.37:g.7008502C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.453	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1		NM_005559	
LARP6	55323	hgsc.bcm.edu	37	15	71125110	71125110	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr15:71125110C>G	ENST00000299213.8	-	3	827	c.757G>C	c.(757-759)Gtg>Ctg	p.V253L	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	253	RRM.				regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						TGGGTCCCCACTTGGCTGTAG	0.552																																																	0													50.0	47.0	48.0					15																	71125110		2199	4297	6496	SO:0001583	missense	55323			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.757G>C	15.37:g.71125110C>G	ENSP00000299213:p.Val253Leu	Somatic		WXS	SOLID	Phase_I	Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	ENST00000299213.8	37	CCDS32281.1	.	.	.	.	.	.	.	.	.	.	C	2.632	-0.286149	0.05605	.	.	ENSG00000166173	ENST00000299213	T	0.35973	1.28	4.48	3.56	0.40772	Nucleotide-binding, alpha-beta plait (1);	0.142052	0.48767	D	0.000180	T	0.10809	0.0264	N	0.01352	-0.895	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22661	-1.0210	10	0.02654	T	1	-20.6395	10.0411	0.42158	0.0:0.9014:0.0:0.0986	.	253	Q9BRS8	LARP6_HUMAN	L	253	ENSP00000299213:V253L	ENSP00000299213:V253L	V	-	1	0	LARP6	68912164	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.360000	0.44151	1.110000	0.41699	0.555000	0.69702	GTG		0.552	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2		NM_018357	
LRIT1	26103	hgsc.bcm.edu	37	10	85992243	85992243	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr10:85992243C>A	ENST00000372105.3	-	4	1333	c.1312G>T	c.(1312-1314)Ggg>Tgg	p.G438W		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	438	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						TAAGTGTCCCCCACCACCTTC	0.592																																																	0													108.0	83.0	91.0					10																	85992243		2203	4300	6503	SO:0001583	missense	26103			AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1312G>T	10.37:g.85992243C>A	ENSP00000361177:p.Gly438Trp	Somatic		WXS	SOLID	Phase_I	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227034	0.79576	.	.	ENSG00000148602	ENST00000372105	T	0.58358	0.34	5.72	5.72	0.89469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.75631	-0.3251	10	0.72032	D	0.01	.	18.6519	0.91433	0.0:1.0:0.0:0.0	.	438	Q9P2V4	LRIT1_HUMAN	W	438	ENSP00000361177:G438W	ENSP00000361177:G438W	G	-	1	0	LRIT1	85982223	0.998000	0.40836	1.000000	0.80357	0.676000	0.39594	3.763000	0.55257	2.704000	0.92352	0.655000	0.94253	GGG		0.592	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1		NM_015613	
LRRC15	131578	hgsc.bcm.edu	37	3	194080112	194080112	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:194080112G>A	ENST00000347624.3	-	2	1746	c.1661C>T	c.(1660-1662)tCc>tTc	p.S554F	LRRC15_ENST00000428839.1_Missense_Mutation_p.S560F|LRRC15_ENST00000439944.2_Missense_Mutation_p.S560F	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	554					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.S554C(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GGCAGCCAGGGAGCAGGCCAG	0.597																																																	1	Substitution - Missense(1)	ovary(1)											62.0	62.0	62.0					3																	194080112		2203	4300	6503	SO:0001583	missense	131578			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1661C>T	3.37:g.194080112G>A	ENSP00000306276:p.Ser554Phe	Somatic		WXS	SOLID	Phase_I	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	CCDS3306.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575140	0.65878	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.56776	0.44;0.47;0.47	5.48	5.48	0.80851	.	0.511250	0.18877	N	0.128694	T	0.59770	0.2218	N	0.24115	0.695	0.39836	D	0.973044	D;D	0.67145	0.994;0.996	P;D	0.65010	0.854;0.931	T	0.62086	-0.6928	10	0.51188	T	0.08	.	17.9172	0.88955	0.0:0.0:1.0:0.0	.	554;560	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	F	554;560;560	ENSP00000306276:S554F;ENSP00000389128:S560F;ENSP00000413707:S560F	ENSP00000306276:S554F	S	-	2	0	LRRC15	195561407	1.000000	0.71417	0.988000	0.46212	0.936000	0.57629	6.013000	0.70776	2.758000	0.94735	0.563000	0.77884	TCC		0.597	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2			
MMP2	4313	hgsc.bcm.edu;ucsc.edu	37	16	55519658	55519658	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr16:55519658G>C	ENST00000219070.4	+	5	1310	c.801G>C	c.(799-801)aaG>aaC	p.K267N	MMP2_ENST00000437642.2_Missense_Mutation_p.K217N|MMP2_ENST00000543485.1_Missense_Mutation_p.K191N|MMP2_ENST00000570308.1_Missense_Mutation_p.K191N	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	267	Collagen-binding.|Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	ACTTTGAGAAGGATGGCAAGT	0.567																																																	0													133.0	117.0	123.0					16																	55519658		2198	4300	6498	SO:0001583	missense	4313				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.801G>C	16.37:g.55519658G>C	ENSP00000219070:p.Lys267Asn	Somatic		WXS	SOLID	Phase_I	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749764	0.30955	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.52295	0.67;0.67;0.67	5.06	1.42	0.22433	Peptidase M10, metallopeptidase (1);Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);Peptidase, metallopeptidase (1);	0.627412	0.17946	N	0.156691	T	0.31796	0.0808	L	0.41824	1.3	0.43267	D	0.995211	B;B	0.14438	0.004;0.01	B;B	0.16722	0.016;0.008	T	0.20338	-1.0278	10	0.39692	T	0.17	.	2.8726	0.05621	0.1042:0.1322:0.3923:0.3713	.	217;267	E9PE45;P08253	.;MMP2_HUMAN	N	267;191;217	ENSP00000219070:K267N;ENSP00000444143:K191N;ENSP00000394237:K217N	ENSP00000219070:K267N	K	+	3	2	MMP2	54077159	0.938000	0.31826	0.998000	0.56505	0.954000	0.61252	0.233000	0.17911	1.108000	0.41662	0.442000	0.29010	AAG		0.567	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			
NDST1	3340	hgsc.bcm.edu	37	5	149921139	149921139	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr5:149921139G>T	ENST00000261797.6	+	9	2259	c.1757G>T	c.(1756-1758)tGc>tTc	p.C586F	NDST1_ENST00000523767.1_Missense_Mutation_p.C586F|snoU13_ENST00000459561.1_RNA	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	586	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TAGGACCCCTGCGAGGACAAA	0.562																																																	0													97.0	82.0	87.0					5																	149921139		2203	4300	6503	SO:0001583	missense	3340			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1757G>T	5.37:g.149921139G>T	ENSP00000261797:p.Cys586Phe	Somatic		WXS	SOLID	Phase_I	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992382	0.54041	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.55052	0.54;0.54	5.02	4.15	0.48705	.	0.088634	0.85682	D	0.000000	T	0.74061	0.3667	M	0.88704	2.975	0.80722	D	1	D;D	0.64830	0.988;0.994	D;P	0.64687	0.928;0.882	T	0.79897	-0.1609	10	0.87932	D	0	.	13.2951	0.60292	0.0778:0.0:0.9222:0.0	.	586;586	E7EVJ3;P52848	.;NDST1_HUMAN	F	586	ENSP00000428604:C586F;ENSP00000261797:C586F	ENSP00000261797:C586F	C	+	2	0	NDST1	149901332	1.000000	0.71417	0.976000	0.42696	0.036000	0.12997	9.751000	0.98889	1.251000	0.43983	0.655000	0.94253	TGC		0.562	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2		NM_001543	
NF1	4763	hgsc.bcm.edu;ucsc.edu	37	17	29665755	29665755	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:29665755T>C	ENST00000358273.4	+	46	7236	c.6853T>C	c.(6853-6855)Tac>Cac	p.Y2285H	NF1_ENST00000444181.2_Missense_Mutation_p.Y78H|NF1_ENST00000417592.2_Intron|NF1_ENST00000356175.3_Missense_Mutation_p.Y2264H	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2285					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.Y2285fs*5(6)|p.?(3)|p.Y2285fs*16(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACCTGACACTTACAACAGTCA	0.313			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	18	Whole gene deletion(8)|Deletion - Frameshift(7)|Unknown(3)	soft_tissue(8)|central_nervous_system(6)|autonomic_ganglia(2)|lung(1)|haematopoietic_and_lymphoid_tissue(1)	GRCh37	CI972654	NF1	I							86.0	85.0	85.0					17																	29665755		2203	4296	6499	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6853T>C	17.37:g.29665755T>C	ENSP00000351015:p.Tyr2285His	Somatic		WXS	SOLID	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	18.95	3.732650	0.69189	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181	T;T;T;T	0.64991	3.21;3.36;3.06;-0.13	5.91	5.91	0.95273	Armadillo-type fold (2);	0.056060	0.85682	D	0.000000	T	0.46405	0.1391	N	0.22421	0.69	0.80722	D	1	B;P	0.44344	0.126;0.833	B;B	0.40534	0.191;0.332	T	0.41342	-0.9514	10	0.16420	T	0.52	.	12.1987	0.54313	0.0:0.0681:0.0:0.9319	.	2264;2285	P21359-2;P21359	.;NF1_HUMAN	H	2285;2264;1930;78	ENSP00000351015:Y2285H;ENSP00000348498:Y2264H;ENSP00000389907:Y1930H;ENSP00000396481:Y78H	ENSP00000348498:Y2264H	Y	+	1	0	NF1	26689881	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.418000	0.80167	2.270000	0.75569	0.528000	0.53228	TAC		0.313	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2		NM_000267	
NFU1	27247	hgsc.bcm.edu	37	2	69650833	69650833	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr2:69650833A>C	ENST00000410022.2	-	3	388	c.183T>G	c.(181-183)atT>atG	p.I61M	NFU1_ENST00000394305.1_Intron|NFU1_ENST00000471185.1_Intron|NFU1_ENST00000303698.3_Missense_Mutation_p.I37M	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	61					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						CTTGTGTTTGAATAAACATGT	0.353																																																	0													67.0	66.0	66.0					2																	69650833		2203	4300	6503	SO:0001583	missense	27247			AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.183T>G	2.37:g.69650833A>C	ENSP00000387219:p.Ile61Met	Somatic		WXS	SOLID	Phase_I	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Missense_Mutation	SNP	ENST00000410022.2	37	CCDS33217.1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.170047	0.57584	.	.	ENSG00000169599	ENST00000410022;ENST00000303698	T;T	0.76060	-0.99;-0.89	5.18	4.01	0.46588	NIF system FeS cluster assembly, NifU-like scaffold, N-terminal (4);	0.054281	0.85682	D	0.000000	D	0.90466	0.7014	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.91337	0.5094	10	0.87932	D	0	5.0E-4	10.2974	0.43631	0.9217:0.0:0.0783:0.0	.	37;61	Q9UMS0-3;Q9UMS0	.;NFU1_HUMAN	M	61;37	ENSP00000387219:I61M;ENSP00000306965:I37M	ENSP00000306965:I37M	I	-	3	3	NFU1	69504337	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.589000	0.53972	0.809000	0.34255	0.481000	0.45027	ATT		0.353	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3		NM_015700	
NLE1	54475	hgsc.bcm.edu	37	17	33463419	33463419	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:33463419G>C	ENST00000442241.4	-	8	965	c.926C>G	c.(925-927)gCt>gGt	p.A309G	NLE1_ENST00000586869.1_Missense_Mutation_p.A17G|NLE1_ENST00000593176.1_5'Flank|NLE1_ENST00000360831.5_Missense_Mutation_p.A267G	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	309					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				TGAGGCCTCAGCAGGTTCAAA	0.582																																																	0													146.0	159.0	155.0					17																	33463419		2203	4300	6503	SO:0001583	missense	54475				CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.926C>G	17.37:g.33463419G>C	ENSP00000413572:p.Ala309Gly	Somatic		WXS	SOLID	Phase_I	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	37	CCDS11291.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.90|12.90	2.075831|2.075831	0.36662|0.36662	.|.	.|.	ENSG00000073536|ENSG00000073536	ENST00000442241;ENST00000360831;ENST00000537697|ENST00000436188	T|.	0.58940|.	0.3|.	5.44|5.44	5.44|5.44	0.79542|0.79542	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61198|0.61198	0.2328|0.2328	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	B;P|.	0.45634|.	0.009;0.863|.	B;P|.	0.45538|.	0.022;0.484|.	T|T	0.54761|0.54761	-0.8245|-0.8245	10|5	0.44086|.	T|.	0.13|.	-13.5415|-13.5415	16.8112|16.8112	0.85720|0.85720	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	285;309|.	B4E074;Q9NVX2|.	.;NLE1_HUMAN|.	G|V	309;17;285|89	ENSP00000413572:A309G|.	ENSP00000354075:A17G|.	A|L	-|-	2|1	0|2	NLE1|NLE1	30487532|30487532	1.000000|1.000000	0.71417|0.71417	0.926000|0.926000	0.36857|0.36857	0.997000|0.997000	0.91878|0.91878	8.897000|8.897000	0.92532|0.92532	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GCT|CTG		0.582	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2		NM_018096	
NOL6	65083	hgsc.bcm.edu	37	9	33463856	33463856	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:33463856C>T	ENST00000379471.2	-	23	3054	c.2967G>A	c.(2965-2967)atG>atA	p.M989I	NOL6_ENST00000455041.2_Missense_Mutation_p.M937I|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	989					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CCCGGGGATCCATGAGCTGCT	0.572																																																	0													73.0	71.0	72.0					9																	33463856		2203	4300	6503	SO:0001583	missense	65083			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2967G>A	9.37:g.33463856C>T	ENSP00000368784:p.Met989Ile	Somatic		WXS	SOLID	Phase_I	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37		.	.	.	.	.	.	.	.	.	.	C	14.37	2.515584	0.44763	.	.	ENSG00000165271	ENST00000379470;ENST00000297990;ENST00000379471;ENST00000541373;ENST00000325914;ENST00000455041	T;T;T;T	0.39056	1.1;1.1;1.59;1.1	5.81	3.97	0.46021	.	0.115163	0.85682	N	0.000000	T	0.30070	0.0753	L	0.31752	0.955	0.58432	D	0.999999	B;B;B;B	0.26041	0.14;0.056;0.095;0.069	B;B;B;B	0.29353	0.09;0.061;0.061;0.101	T	0.03993	-1.0986	10	0.13853	T	0.58	.	12.0433	0.53464	0.0:0.8598:0.0:0.1402	.	937;986;989;989	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4	.;.;.;NOL6_HUMAN	I	43;989;989;545;989;937	ENSP00000368783:M43I;ENSP00000297990:M989I;ENSP00000368784:M989I;ENSP00000395915:M937I	ENSP00000297990:M989I	M	-	3	0	NOL6	33453856	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.677000	0.54619	0.798000	0.33994	0.655000	0.94253	ATG		0.572	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2		NM_022917	
PABPC3	5042	hgsc.bcm.edu	37	13	25670907	25670907	+	Missense_Mutation	SNP	C	C	A	rs76264750	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr13:25670907C>A	ENST00000281589.3	+	1	608	c.571C>A	c.(571-573)Ccc>Acc	p.P191T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	191	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AAAAGAGTTCCCCAATGTTTA	0.428																																																	0													100.0	93.0	95.0					13																	25670907		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.571C>A	13.37:g.25670907C>A	ENSP00000281589:p.Pro191Thr	Somatic		WXS	SOLID	Phase_I	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.725491	0.00694	.	.	ENSG00000151846	ENST00000281589	D	0.85411	-1.98	1.27	-2.55	0.06288	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.127499	0.32769	N	0.005664	T	0.42245	0.1194	N	0.00170	-1.935	0.25196	N	0.99009	B	0.02656	0.0	B	0.01281	0.0	T	0.58896	-0.7555	10	0.02654	T	1	.	6.4602	0.21952	0.5046:0.4954:0.0:0.0	.	191	Q9H361	PABP3_HUMAN	T	191	ENSP00000281589:P191T	ENSP00000281589:P191T	P	+	1	0	PABPC3	24568907	1.000000	0.71417	0.927000	0.36925	0.792000	0.44763	4.521000	0.60532	-0.661000	0.05345	-0.738000	0.03535	CCC		0.428	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PLA2G6	8398	hgsc.bcm.edu;ucsc.edu	37	22	38509556	38509556	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr22:38509556G>A	ENST00000332509.3	-	15	2323	c.2140C>T	c.(2140-2142)Ccc>Tcc	p.P714S	BAIAP2L2_ENST00000332536.5_5'Flank|PLA2G6_ENST00000402064.1_Missense_Mutation_p.P660S|BAIAP2L2_ENST00000381669.3_5'Flank|PLA2G6_ENST00000335539.3_Missense_Mutation_p.P660S	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	714					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	AGCTCCCAGGGGTTGCTGGGA	0.607																																																	0													117.0	102.0	107.0					22																	38509556		2203	4300	6503	SO:0001583	missense	8398			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.2140C>T	22.37:g.38509556G>A	ENSP00000333142:p.Pro714Ser	Somatic		WXS	SOLID	Phase_I	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	ENST00000332509.3	37	CCDS13967.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892887	0.91889	.	.	ENSG00000184381	ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064	T;T;T	0.76316	-1.01;-1.01;-1.01	4.54	4.54	0.55810	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.117768	0.64402	D	0.000014	D	0.85230	0.5649	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.87578	0.998;0.852	D	0.86989	0.2109	10	0.66056	D	0.02	-21.4165	17.3155	0.87222	0.0:0.0:1.0:0.0	.	660;714	O60733-2;O60733	.;PA2G6_HUMAN	S	714;575;660;660	ENSP00000333142:P714S;ENSP00000335149:P660S;ENSP00000386100:P660S	ENSP00000333142:P714S	P	-	1	0	PLA2G6	36839502	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.310000	0.96267	2.070000	0.61991	0.561000	0.74099	CCC		0.607	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1		NM_001004426	
PLB1	151056	hgsc.bcm.edu;ucsc.edu	37	2	28812901	28812901	+	Silent	SNP	T	T	C	rs570808296		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr2:28812901T>C	ENST00000327757.5	+	29	2090	c.2046T>C	c.(2044-2046)cgT>cgC	p.R682R	PLB1_ENST00000329020.6_Silent_p.R370R|PLB1_ENST00000422425.2_Silent_p.R671R	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	682	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					AGACGACTCGTCATAAGTTTG	0.522													T|||	1	0.000199681	0.0	0.0	5008	,	,		17003	0.0		0.0	False		,,,				2504	0.001																0													147.0	144.0	145.0					2																	28812901		2203	4300	6503	SO:0001819	synonymous_variant	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2046T>C	2.37:g.28812901T>C		Somatic		WXS	SOLID	Phase_I	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Silent	SNP	ENST00000327757.5	37	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	T	5.210	0.224222	0.09863	.	.	ENSG00000163803	ENST00000404858	.	.	.	5.61	-3.54	0.04653	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27571	-1.0070	4	.	.	.	1.0146	2.0878	0.03650	0.1816:0.1151:0.1815:0.5218	.	.	.	.	A	670	.	.	V	+	2	0	PLB1	28666405	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.150000	0.10189	-0.457000	0.07033	-1.236000	0.01555	GTC		0.522	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			
POLDIP3	84271	hgsc.bcm.edu;ucsc.edu	37	22	42992326	42992326	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr22:42992326G>C	ENST00000252115.5	-	5	783	c.679C>G	c.(679-681)Ctc>Gtc	p.L227V	POLDIP3_ENST00000491021.1_5'UTR|POLDIP3_ENST00000348657.2_Missense_Mutation_p.L198V|POLDIP3_ENST00000451060.2_Missense_Mutation_p.L71V|POLDIP3_ENST00000339677.6_Intron	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	227					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						ACTTTGGTGAGAGGGAGGGCC	0.488																																					Ovarian(52;967 1128 5875 19997 42537)												0													115.0	106.0	109.0					22																	42992326		2203	4300	6503	SO:0001583	missense	84271				CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.679C>G	22.37:g.42992326G>C	ENSP00000252115:p.Leu227Val	Somatic		WXS	SOLID	Phase_I	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Missense_Mutation	SNP	ENST00000252115.5	37	CCDS14038.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959349	0.53400	.	.	ENSG00000100227	ENST00000348657;ENST00000252115;ENST00000415122;ENST00000451060	.	.	.	5.82	5.82	0.92795	.	0.118518	0.64402	D	0.000017	T	0.48696	0.1514	M	0.61703	1.905	0.36836	D	0.887157	P;P;P;P	0.49090	0.867;0.75;0.919;0.75	B;B;B;B	0.38264	0.261;0.2;0.269;0.2	T	0.62067	-0.6932	9	0.52906	T	0.07	-20.3284	13.3228	0.60442	0.0719:0.0:0.9281:0.0	.	244;223;198;227	B4E0L0;Q96DI9;Q9BY77-2;Q9BY77	.;.;.;PDIP3_HUMAN	V	198;227;198;71	.	ENSP00000252115:L227V	L	-	1	0	POLDIP3	41322270	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.962000	0.63687	2.756000	0.94617	0.563000	0.77884	CTC		0.488	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1		NM_032311	
PLXNB2	23654	hgsc.bcm.edu	37	22	50722134	50722134	+	Missense_Mutation	SNP	T	T	C	rs11547731	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr22:50722134T>C	ENST00000449103.1	-	15	2607	c.2467A>G	c.(2467-2469)Atc>Gtc	p.I823V	PLXNB2_ENST00000359337.4_Missense_Mutation_p.I823V|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	823	IPT/TIG 1.		I -> V (in dbSNP:rs11547731).		brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GACCCCAGGATGGTGATGCGG	0.642													T|||	3277	0.654353	0.7602	0.5548	5008	,	,		10260	0.5813		0.6392	False		,,,				2504	0.6728																0								T	VAL/ILE	2977,931		1140,697,117	30.0	35.0	33.0		2467	4.2	1.0	22	dbSNP_120	33	5334,2918		1745,1844,537	yes	missense	PLXNB2	NM_012401.3	29	2885,2541,654	CC,CT,TT		35.3611,23.8229,31.653	probably-damaging	823/1839	50722134	8311,3849	1954	4126	6080	SO:0001583	missense	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2467A>G	22.37:g.50722134T>C	ENSP00000409171:p.Ile823Val	Somatic		WXS	SOLID	Phase_I	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	1382	0.6327838827838828	374	0.7601626016260162	214	0.5911602209944752	306	0.534965034965035	488	0.6437994722955145	T	16.26	3.074368	0.55646	0.761771	0.646389	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.64260	-0.09;-0.09	4.22	4.22	0.49857	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.237648	0.28736	N	0.014301	T	0.00012	0.0000	M	0.75264	2.295	0.23620	P	0.99727114	D	0.76494	0.999	D	0.87578	0.998	T	0.42899	-0.9424	9	0.46703	T	0.11	.	11.3529	0.49598	0.0:0.0:0.0:1.0	rs11547731;rs60209269	823	O15031	PLXB2_HUMAN	V	823	ENSP00000409171:I823V;ENSP00000352288:I823V	ENSP00000352288:I823V	I	-	1	0	PLXNB2	49064261	1.000000	0.71417	0.995000	0.50966	0.380000	0.30137	2.064000	0.41432	1.780000	0.52325	0.397000	0.26171	ATC		0.642	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3		NM_012401	
PROX1	5629	hgsc.bcm.edu	37	1	214170552	214170552	+	Missense_Mutation	SNP	T	T	A	rs146788962		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr1:214170552T>A	ENST00000366958.4	+	2	1282	c.674T>A	c.(673-675)gTt>gAt	p.V225D	PROX1_ENST00000435016.1_Missense_Mutation_p.V225D|PROX1_ENST00000261454.4_Missense_Mutation_p.V225D|PROX1_ENST00000498508.2_Missense_Mutation_p.V225D	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	225					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CAGCAGCTGGTTTCAGCCCGA	0.542																																																	0													34.0	39.0	38.0					1																	214170552		2203	4300	6503	SO:0001583	missense	5629			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.674T>A	1.37:g.214170552T>A	ENSP00000355925:p.Val225Asp	Somatic		WXS	SOLID	Phase_I	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907367	0.52333	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.93	4.81	0.61882	.	0.113131	0.64402	D	0.000012	T	0.43433	0.1247	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.19095	-1.0316	10	0.41790	T	0.15	-2.9286	11.6533	0.51301	0.0:0.0697:0.0:0.9303	.	225	Q92786	PROX1_HUMAN	D	225	ENSP00000420283:V225D;ENSP00000355925:V225D;ENSP00000400694:V225D;ENSP00000261454:V225D	ENSP00000261454:V225D	V	+	2	0	PROX1	212237175	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.276000	0.72601	1.069000	0.40788	0.533000	0.62120	GTT		0.542	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6		NM_002763	
PRPH2	5961	hgsc.bcm.edu	37	6	42690020	42690020	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr6:42690020T>C	ENST00000230381.5	-	1	292	c.53A>G	c.(52-54)cAa>cGa	p.Q18R		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	18					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			CCAGAGCCCTTGGGCCAACTT	0.542																																																	0													79.0	76.0	77.0					6																	42690020		2203	4300	6503	SO:0001583	missense	5961				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.53A>G	6.37:g.42690020T>C	ENSP00000230381:p.Gln18Arg	Somatic		WXS	SOLID	Phase_I	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.404224	0.83230	.	.	ENSG00000112619	ENST00000230381	T	0.03212	4.01	5.48	5.48	0.80851	.	0.105519	0.64402	N	0.000003	T	0.06280	0.0162	M	0.86953	2.85	0.58432	D	0.999999	P	0.37207	0.587	B	0.43052	0.406	T	0.09840	-1.0656	10	0.29301	T	0.29	.	15.56	0.76237	0.0:0.0:0.0:1.0	.	18	P23942	PRPH2_HUMAN	R	18	ENSP00000230381:Q18R	ENSP00000230381:Q18R	Q	-	2	0	PRPH2	42797998	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	7.665000	0.83852	2.072000	0.62099	0.460000	0.39030	CAA		0.542	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1		NM_000322	
PTEN	5728	hgsc.bcm.edu	37	10	89692884	89692884	+	Missense_Mutation	SNP	A	A	T	rs121909222		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr10:89692884A>T	ENST00000371953.3	+	5	1725	c.368A>T	c.(367-369)cAc>cTc	p.H123L		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	123	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		H -> R (in CWS1). {ECO:0000269|PubMed:10234502, ECO:0000269|PubMed:9259288}.|H -> Y (in endometrial cancer; loss of protein phosphatase activity).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.I122fs*2(3)|p.Y27fs*1(2)|p.A121_F145del(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GCAGCAATTCACTGTAAAGCT	0.403		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	54	Whole gene deletion(37)|Deletion - Frameshift(11)|Unknown(5)|Deletion - In frame(1)	prostate(16)|central_nervous_system(14)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|breast(3)|ovary(3)|soft_tissue(1)|endometrium(1)|urinary_tract(1)	GRCh37	CM971270	PTEN	M	rs121909222						139.0	128.0	132.0					10																	89692884		2203	4300	6503	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.368A>T	10.37:g.89692884A>T	ENSP00000361021:p.His123Leu	Somatic		WXS	SOLID	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889397	0.91889	.	.	ENSG00000171862	ENST00000371953	D	0.99905	-7.7	5.22	5.22	0.72569	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99943	0.9975	H	0.99143	4.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95880	0.8898	9	.	.	.	-8.7537	15.1019	0.72284	1.0:0.0:0.0:0.0	.	123	P60484	PTEN_HUMAN	L	123	ENSP00000361021:H123L	.	H	+	2	0	PTEN	89682864	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.918000	0.92759	1.953000	0.56701	0.533000	0.62120	CAC		0.403	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1		NM_000314	
IFT22	64792	hgsc.bcm.edu	37	7	100959746	100959746	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr7:100959746T>G	ENST00000315322.4	-	4	377	c.284A>C	c.(283-285)cAc>cCc	p.H95P	RABL5_ENST00000498704.2_Missense_Mutation_p.H18P|RABL5_ENST00000437644.2_Missense_Mutation_p.H65P|RABL5_ENST00000495166.1_5'UTR|RABL5_ENST00000517481.1_Missense_Mutation_p.H18P	NM_022777.2	NP_073614.1	Q9H7X7	IFT22_HUMAN		95					small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.215)					TTCCTTCCGGTGGCTTGGGAT	0.517																																																	0													184.0	158.0	167.0					7																	100959746		2203	4300	6503	SO:0001583	missense	64792																														ENST00000315322.4:c.284A>C	7.37:g.100959746T>G	ENSP00000320359:p.His95Pro	Somatic		WXS	SOLID	Phase_I	Q49AG1|Q69YV5|Q9BSW4	Missense_Mutation	SNP	ENST00000315322.4	37	CCDS5719.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.500020	0.64298	.	.	ENSG00000128581	ENST00000517481;ENST00000315322;ENST00000498704;ENST00000437644	T;T	0.79454	-1.01;-1.27	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.84647	0.5518	M	0.77486	2.375	0.80722	D	1	P;B;B	0.36647	0.563;0.414;0.045	P;B;B	0.48677	0.586;0.134;0.111	D	0.84928	0.0858	10	0.52906	T	0.07	-29.3881	14.595	0.68397	0.0:0.0:0.0:1.0	.	95;65;95	B7Z2E8;Q9H7X7-2;Q9H7X7	.;.;RABL5_HUMAN	P	18;95;18;65	ENSP00000320359:H95P;ENSP00000390770:H65P	ENSP00000320359:H95P	H	-	2	0	RABL5	100746466	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.881000	0.87252	2.330000	0.79161	0.533000	0.62120	CAC		0.517	RABL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347565.1			
RARRES2	5919	hgsc.bcm.edu	37	7	150037576	150037576	+	Silent	SNP	C	C	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr7:150037576C>A	ENST00000466675.1	-	1	1156	c.123G>T	c.(121-123)ccG>ccT	p.P41P	RP4-584D14.7_ENST00000563946.1_RNA|RARRES2_ENST00000482669.1_Silent_p.P41P|RARRES2_ENST00000223271.3_Silent_p.P41P			Q99969	RARR2_HUMAN	retinoic acid receptor responder (tazarotene induced) 2	41					brown fat cell differentiation (GO:0050873)|chemotaxis (GO:0006935)|embryonic digestive tract development (GO:0048566)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|positive regulation of chemotaxis (GO:0050921)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of protein phosphorylation (GO:0001934)|regulation of lipid catabolic process (GO:0050994)|retinoid metabolic process (GO:0001523)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.P41P(1)		endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			ACTGCACGGGCGGGTGCTTGT	0.706																																																	1	Substitution - coding silent(1)	pancreas(1)											27.0	25.0	26.0					7																	150037576		2202	4300	6502	SO:0001819	synonymous_variant	5919			U77594	CCDS5902.1	7q36.1	2013-02-25			ENSG00000106538	ENSG00000106538		"""Endogenous ligands"""	9868	protein-coding gene	gene with protein product	"""chemerin"""	601973				9270552, 17767914	Standard	NM_002889		Approved	TIG2, HP10433	uc003wha.3	Q99969	OTTHUMG00000158325	ENST00000466675.1:c.123G>T	7.37:g.150037576C>A		Somatic		WXS	SOLID	Phase_I	Q7LE02	Silent	SNP	ENST00000466675.1	37	CCDS5902.1																																																																																				0.706	RARRES2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350693.1			
RCC2	55920	hgsc.bcm.edu	37	1	17743003	17743003	+	Silent	SNP	T	T	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr1:17743003T>A	ENST00000375436.4	-	8	1186	c.999A>T	c.(997-999)cgA>cgT	p.R333R	AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Silent_p.R333R	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	333					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)			breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		AGGCCACGTCTCGTACAACCA	0.527																																																	0													111.0	88.0	96.0					1																	17743003		2203	4300	6503	SO:0001819	synonymous_variant	55920				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.999A>T	1.37:g.17743003T>A		Somatic		WXS	SOLID	Phase_I	Q8IVL9|Q9BSN6|Q9NPV8	Silent	SNP	ENST00000375436.4	37	CCDS181.1																																																																																				0.527	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1		NM_018715	
RNASE1	6035	hgsc.bcm.edu	37	14	21270037	21270037	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr14:21270037G>A	ENST00000397967.4	-	2	697	c.191C>T	c.(190-192)aCa>aTa	p.T64I	RNASE1_ENST00000340900.3_Missense_Mutation_p.T64I|RNASE1_ENST00000397970.4_Missense_Mutation_p.T64I|RNASE1_ENST00000412779.2_Missense_Mutation_p.T64I|RNASE1_ENST00000555698.1_Missense_Mutation_p.T24I	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	64					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	CCGCCCCTGTGTCATATTCCG	0.552																																																	0													120.0	110.0	113.0					14																	21270037		2203	4300	6503	SO:0001583	missense	6035			BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.191C>T	14.37:g.21270037G>A	ENSP00000381057:p.Thr64Ile	Somatic		WXS	SOLID	Phase_I	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Missense_Mutation	SNP	ENST00000397967.4	37	CCDS9559.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884338	0.51908	.	.	ENSG00000129538	ENST00000397967;ENST00000340900;ENST00000412779;ENST00000555698;ENST00000397970	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.02	5.02	0.67125	Ribonuclease A, domain (4);	0.137331	0.48767	D	0.000162	T	0.76147	0.3947	H	0.94847	3.59	0.43693	D	0.996144	D	0.89917	1.0	D	0.87578	0.998	T	0.82255	-0.0548	10	0.66056	D	0.02	-29.5264	13.7093	0.62659	0.0:0.0:1.0:0.0	.	64	P07998	RNAS1_HUMAN	I	64;64;64;24;64	ENSP00000381057:T64I;ENSP00000344193:T64I;ENSP00000399493:T64I;ENSP00000451058:T24I;ENSP00000381060:T64I	ENSP00000344193:T64I	T	-	2	0	RNASE1	20339877	0.980000	0.34600	0.945000	0.38365	0.013000	0.08279	1.959000	0.40412	2.620000	0.88729	0.561000	0.74099	ACA		0.552	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3			
SEC23A	10484	hgsc.bcm.edu;ucsc.edu	37	14	39555078	39555078	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr14:39555078T>C	ENST00000307712.6	-	7	1233	c.716A>G	c.(715-717)aAt>aGt	p.N239S	SEC23A_ENST00000537403.1_Missense_Mutation_p.N37S|SEC23A_ENST00000545328.2_Missense_Mutation_p.N210S|SEC23A_ENST00000536508.1_Missense_Mutation_p.N113S	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	239					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		ATCTGTGAGATTCATGTCTAT	0.408																																																	0													135.0	142.0	140.0					14																	39555078		2203	4300	6503	SO:0001583	missense	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.716A>G	14.37:g.39555078T>C	ENSP00000306881:p.Asn239Ser	Somatic		WXS	SOLID	Phase_I	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	T	9.815	1.184210	0.21870	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25	5.67	5.67	0.87782	Sec23/Sec24, trunk domain (1);	0.046444	0.85682	D	0.000000	T	0.56337	0.1978	N	0.04018	-0.295	0.58432	D	0.999998	B;B;B;B	0.11235	0.004;0.001;0.001;0.0	B;B;B;B	0.11329	0.003;0.004;0.004;0.006	T	0.56353	-0.7993	10	0.07325	T	0.83	-24.5988	15.9046	0.79412	0.0:0.0:0.0:1.0	.	127;210;113;239	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	S	37;239;113;210;127	ENSP00000444193:N37S;ENSP00000306881:N239S;ENSP00000437715:N113S;ENSP00000445393:N210S	ENSP00000306881:N239S	N	-	2	0	SEC23A	38624829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.253000	0.72453	2.164000	0.68074	0.460000	0.39030	AAT		0.408	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			
SETX	23064	hgsc.bcm.edu;ucsc.edu	37	9	135203821	135203821	+	Missense_Mutation	SNP	C	C	T	rs576141809	byFrequency	TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:135203821C>T	ENST00000224140.5	-	10	3346	c.3164G>A	c.(3163-3165)aGt>aAt	p.S1055N	SETX_ENST00000393220.1_Missense_Mutation_p.S1055N|SETX_ENST00000372169.2_Missense_Mutation_p.S1055N	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1055					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTCCTCCTTACTATTAACTGT	0.378																																																	0													135.0	137.0	136.0					9																	135203821		2203	4300	6503	SO:0001583	missense	23064			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3164G>A	9.37:g.135203821C>T	ENSP00000224140:p.Ser1055Asn	Somatic		WXS	SOLID	Phase_I	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	5.175	0.217857	0.09810	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.86865	-2.09;-2.18;-1.79	4.58	-3.58	0.04597	.	2.721470	0.00812	N	0.001515	T	0.74635	0.3742	N	0.14661	0.345	0.09310	N	1	B;B;B	0.17268	0.021;0.002;0.021	B;B;B	0.11329	0.006;0.003;0.006	T	0.61540	-0.7042	10	0.26408	T	0.33	.	5.8593	0.18736	0.1974:0.4975:0.2172:0.0878	.	1055;1055;1055	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	N	1055	ENSP00000224140:S1055N;ENSP00000361242:S1055N;ENSP00000376913:S1055N	ENSP00000224140:S1055N	S	-	2	0	SETX	134193642	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.363000	0.02592	-0.840000	0.04206	0.644000	0.83932	AGT		0.378	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3		NM_015046	
PEAK1	79834	hgsc.bcm.edu	37	15	77406808	77406808	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr15:77406808C>A	ENST00000560626.2	-	7	5406	c.4931G>T	c.(4930-4932)tGc>tTc	p.C1644F	PEAK1_ENST00000312493.4_Missense_Mutation_p.C1644F			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1644	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										ATTCAGGAGGCAGCTGGCCAG	0.607																																																	0													55.0	59.0	58.0					15																	77406808		1921	4132	6053	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4931G>T	15.37:g.77406808C>A	ENSP00000452796:p.Cys1644Phe	Somatic		WXS	SOLID	Phase_I	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330949	0.60853	.	.	ENSG00000173517	ENST00000312493	T	0.64991	-0.13	5.57	5.57	0.84162	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.218796	0.34046	U	0.004311	T	0.69061	0.3069	L	0.42245	1.32	0.41691	D	0.989347	D	0.60575	0.988	P	0.61477	0.889	T	0.66544	-0.5897	10	0.34782	T	0.22	-14.2532	14.3951	0.67005	0.1477:0.8523:0.0:0.0	.	1644	Q9H792	PEAK1_HUMAN	F	1644	ENSP00000309230:C1644F	ENSP00000309230:C1644F	C	-	2	0	AC087465.1	75193863	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.223000	0.65283	2.629000	0.89072	0.561000	0.74099	TGC		0.607	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3			
SLC12A3	6559	hgsc.bcm.edu;ucsc.edu	37	16	56938335	56938335	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr16:56938335T>G	ENST00000563236.1	+	25	2910	c.2885T>G	c.(2884-2886)aTt>aGt	p.I962S	SLC12A3_ENST00000262502.5_Missense_Mutation_p.I961S|SLC12A3_ENST00000438926.2_Missense_Mutation_p.I971S|SLC12A3_ENST00000566786.1_Missense_Mutation_p.I970S			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	962					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CTGAATGAGATTGTGCTGGAT	0.567																																																	0													160.0	150.0	153.0					16																	56938335		2198	4300	6498	SO:0001583	missense	6559				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2885T>G	16.37:g.56938335T>G	ENSP00000456149:p.Ile962Ser	Somatic		WXS	SOLID	Phase_I	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	CCDS58464.1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.359850	0.41801	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.26	5.26	0.73747	.	0.122510	0.56097	D	0.000026	T	0.73458	0.3589	L	0.54323	1.7	0.45439	D	0.998417	P;P;P	0.43633	0.483;0.716;0.813	P;P;P	0.60012	0.522;0.739;0.867	T	0.76000	-0.3119	9	0.87932	D	0	.	14.0084	0.64481	0.0:0.0:0.0:1.0	.	970;962;971	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	S	970;971	.	ENSP00000262502:I971S	I	+	2	0	SLC12A3	55495836	1.000000	0.71417	0.998000	0.56505	0.065000	0.16274	7.755000	0.85180	1.970000	0.57323	0.460000	0.39030	ATT		0.567	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1			
SLC16A6	9120	hgsc.bcm.edu;ucsc.edu	37	17	66268860	66268860	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:66268860T>A	ENST00000327268.4	-	5	589	c.425A>T	c.(424-426)cAa>cTa	p.Q142L	ARSG_ENST00000448504.2_Intron|SLC16A6_ENST00000580666.1_Missense_Mutation_p.Q142L	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	142					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GCCAAAATATTGTGATAGGAT	0.443																																																	0													171.0	155.0	160.0					17																	66268860		2203	4300	6503	SO:0001583	missense	9120			U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.425A>T	17.37:g.66268860T>A	ENSP00000319991:p.Gln142Leu	Somatic		WXS	SOLID	Phase_I	Q6P1X3	Missense_Mutation	SNP	ENST00000327268.4	37	CCDS11675.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.728076	0.30593	.	.	ENSG00000108932	ENST00000327268	T	0.37584	1.19	5.41	4.27	0.50696	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.123604	0.56097	D	0.000029	T	0.32852	0.0843	L	0.49126	1.545	0.58432	D	0.999999	B	0.14012	0.009	B	0.20384	0.029	T	0.14227	-1.0480	10	0.42905	T	0.14	.	11.4967	0.50413	0.1339:0.0:0.0:0.8661	.	142	O15403	MOT7_HUMAN	L	142	ENSP00000319991:Q142L	ENSP00000319991:Q142L	Q	-	2	0	SLC16A6	63780455	1.000000	0.71417	0.996000	0.52242	0.680000	0.39746	3.727000	0.54984	2.171000	0.68590	0.533000	0.62120	CAA		0.443	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1		NM_004694	
SLC4A8	9498	hgsc.bcm.edu	37	12	51868167	51868167	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr12:51868167T>A	ENST00000453097.2	+	15	2163	c.1946T>A	c.(1945-1947)cTc>cAc	p.L649H	SLC4A8_ENST00000394856.1_Missense_Mutation_p.L596H|SLC4A8_ENST00000514353.3_Missense_Mutation_p.L596H|SLC4A8_ENST00000358657.3_Missense_Mutation_p.L676H|SLC4A8_ENST00000535225.2_Missense_Mutation_p.L596H	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		AATCACACCCTCCAGTACTGG	0.468																																																	0													170.0	127.0	141.0					12																	51868167		2203	4300	6503	SO:0001583	missense	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1946T>A	12.37:g.51868167T>A	ENSP00000405812:p.Leu649His	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.119106	0.77323	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25	4.96	4.96	0.65561	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	M	0.89214	3.015	0.37275	D	0.907576	D;P;D;D;D;D	0.89917	1.0;0.574;1.0;0.994;0.985;0.996	D;P;D;D;D;D	0.91635	0.999;0.769;0.99;0.964;0.919;0.967	D	0.92466	0.5981	10	0.62326	D	0.03	.	14.0579	0.64781	0.0:0.0:0.0:1.0	.	596;676;596;649;649;649	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	H	596;676;649;596;649;596;596	ENSP00000441520:L596H;ENSP00000351483:L676H;ENSP00000405812:L649H;ENSP00000378325:L596H;ENSP00000442561:L596H	ENSP00000315789:L649H	L	+	2	0	SLC4A8	50154434	0.952000	0.32445	0.045000	0.18777	0.988000	0.76386	5.869000	0.69613	2.225000	0.72522	0.533000	0.62120	CTC		0.468	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1		NM_004858	
SLC7A4	6545	hgsc.bcm.edu;ucsc.edu	37	22	21383473	21383473	+	Missense_Mutation	SNP	G	G	T	rs538054806		TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr22:21383473G>T	ENST00000382932.2	-	5	1846	c.1779C>A	c.(1777-1779)aaC>aaA	p.N593K	AC002472.11_ENST00000450652.1_RNA|SLC7A4_ENST00000403586.1_Missense_Mutation_p.N593K	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	593					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GCTCCCGCTGGTTCTCCTTGC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		19996	0.0		0.001	False		,,,				2504	0.0																0													76.0	74.0	75.0					22																	21383473		2203	4300	6503	SO:0001583	missense	6545			AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.1779C>A	22.37:g.21383473G>T	ENSP00000372390:p.Asn593Lys	Somatic		WXS	SOLID	Phase_I	Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Missense_Mutation	SNP	ENST00000382932.2	37	CCDS33608.1	.	.	.	.	.	.	.	.	.	.	G	9.705	1.155561	0.21454	.	.	ENSG00000099960	ENST00000403586;ENST00000382932	D;D	0.85171	-1.95;-1.95	5.32	2.06	0.26882	.	0.153902	0.64402	D	0.000016	T	0.70885	0.3275	N	0.14661	0.345	0.34788	D	0.735477	P	0.42827	0.791	B	0.42593	0.392	T	0.70741	-0.4789	10	0.13470	T	0.59	.	9.7278	0.40342	0.248:0.0:0.752:0.0	.	593	O43246	CTR4_HUMAN	K	593	ENSP00000384278:N593K;ENSP00000372390:N593K	ENSP00000372390:N593K	N	-	3	2	SLC7A4	19713473	0.920000	0.31207	0.988000	0.46212	0.434000	0.31775	1.524000	0.35942	0.731000	0.32448	0.561000	0.74099	AAC		0.617	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320467.1		NM_004173	
TAF3	83860	hgsc.bcm.edu	37	10	8055709	8055709	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr10:8055709G>A	ENST00000344293.5	+	6	2790	c.2584G>A	c.(2584-2586)Ggc>Agc	p.G862S		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	862					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						AGATGAGTGGGGCAATCAGAT	0.488																																																	0													138.0	142.0	141.0					10																	8055709		1979	4158	6137	SO:0001583	missense	83860			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2584G>A	10.37:g.8055709G>A	ENSP00000340271:p.Gly862Ser	Somatic		WXS	SOLID	Phase_I	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	G	36	5.847850	0.97023	.	.	ENSG00000165632	ENST00000344293	D	0.84442	-1.85	5.87	5.87	0.94306	Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000003	D	0.92130	0.7505	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87724	0.2575	10	0.15066	T	0.55	-22.4251	20.5827	0.99408	0.0:0.0:1.0:0.0	.	862	Q5VWG9	TAF3_HUMAN	S	862	ENSP00000340271:G862S	ENSP00000340271:G862S	G	+	1	0	TAF3	8095715	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.797000	0.99108	2.941000	0.99782	0.655000	0.94253	GGC		0.488	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1		NM_031923	
TCERG1	10915	hgsc.bcm.edu	37	5	145862191	145862191	+	Silent	SNP	A	A	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr5:145862191A>G	ENST00000296702.5	+	13	1961	c.1923A>G	c.(1921-1923)gaA>gaG	p.E641E	TCERG1_ENST00000394421.2_Silent_p.E620E	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	641					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGAGAAAGAAGCTGCCATGG	0.393																																																	0													51.0	52.0	51.0					5																	145862191		2203	4300	6503	SO:0001819	synonymous_variant	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1923A>G	5.37:g.145862191A>G		Somatic		WXS	SOLID	Phase_I	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																				0.393	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1		NM_001040006	
THBS3	7059	hgsc.bcm.edu	37	1	155174663	155174663	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr1:155174663T>A	ENST00000368378.3	-	4	649	c.629A>T	c.(628-630)gAg>gTg	p.E210V	THBS3_ENST00000541576.1_5'Flank|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000457183.2_Intron|THBS3_ENST00000486260.1_5'UTR|THBS3_ENST00000541990.1_Intron|RP11-263K19.4_ENST00000430312.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	210					bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGGATGGACTCGTCCCCTTG	0.542																																																	0													175.0	142.0	153.0					1																	155174663		2203	4300	6503	SO:0001583	missense	7059			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.629A>T	1.37:g.155174663T>A	ENSP00000357362:p.Glu210Val	Somatic		WXS	SOLID	Phase_I	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.998347	0.54147	.	.	ENSG00000169231	ENST00000368378	D	0.81739	-1.53	5.13	5.13	0.70059	.	0.409718	0.26421	N	0.024465	T	0.63663	0.2530	L	0.39898	1.24	0.80722	D	1	B;B;B	0.20671	0.047;0.012;0.026	B;B;B	0.25405	0.011;0.06;0.06	T	0.64007	-0.6508	10	0.38643	T	0.18	-22.919	13.1972	0.59745	0.0:0.0:0.0:1.0	.	210;210;210	Q53FK6;Q2HIZ0;P49746	.;.;TSP3_HUMAN	V	210	ENSP00000357362:E210V	ENSP00000357362:E210V	E	-	2	0	THBS3	153441287	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	5.694000	0.68272	2.281000	0.76405	0.523000	0.50628	GAG		0.542	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1		NM_007112	
UQCRC2	7385	hgsc.bcm.edu	37	16	21982911	21982911	+	Silent	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr16:21982911T>C	ENST00000268379.4	+	9	1500	c.736T>C	c.(736-738)Tta>Cta	p.L246L	UQCRC2_ENST00000561553.1_Silent_p.L246L	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	246					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		TGGGCTTGGTTTATCTGGTGC	0.428																																					Colon(123;450 1645 12841 25393 45623)												0													132.0	120.0	124.0					16																	21982911		2198	4300	6498	SO:0001819	synonymous_variant	7385			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.736T>C	16.37:g.21982911T>C		Somatic		WXS	SOLID	Phase_I	B3KSN4|Q9BQ05	Silent	SNP	ENST00000268379.4	37	CCDS10601.1																																																																																				0.428	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254466.1		NM_003366	
VPS25	84313	hgsc.bcm.edu	37	17	40925801	40925801	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:40925801C>G	ENST00000253794.2	+	2	144	c.104C>G	c.(103-105)tCg>tGg	p.S35W		NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)	35					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		GCCTGGTGCTCGCTGGTCCTG	0.607																																																	0													77.0	80.0	79.0					17																	40925801		2203	4300	6503	SO:0001583	missense	84313			AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1		ENST00000253794.2:c.104C>G	17.37:g.40925801C>G	ENSP00000253794:p.Ser35Trp	Somatic		WXS	SOLID	Phase_I	B2R581	Missense_Mutation	SNP	ENST00000253794.2	37	CCDS11438.1	.	.	.	.	.	.	.	.	.	.	C	33	5.266472	0.95399	.	.	ENSG00000131475	ENST00000253794	T	0.48836	0.8	5.64	5.64	0.86602	ESCRT-II complex, Vps25 subunit, N-terminal winged helix (1);	0.056972	0.64402	D	0.000001	T	0.74450	0.3718	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.78396	-0.2220	10	0.72032	D	0.01	-12.6311	19.2976	0.94129	0.0:1.0:0.0:0.0	.	35	Q9BRG1	VPS25_HUMAN	W	35	ENSP00000253794:S35W	ENSP00000253794:S35W	S	+	2	0	VPS25	38179327	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.200000	0.77838	2.664000	0.90586	0.655000	0.94253	TCG		0.607	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452383.1		NM_032353	
WDR5B	54554	hgsc.bcm.edu	37	3	122133767	122133767	+	Silent	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr3:122133767T>C	ENST00000330689.4	-	1	1115	c.609A>G	c.(607-609)aaA>aaG	p.K203K	RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	203										kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		CAACGAGCGTTTTTAAACACT	0.393																																																	0													106.0	108.0	108.0					3																	122133767		2203	4300	6503	SO:0001819	synonymous_variant	54554			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.609A>G	3.37:g.122133767T>C		Somatic		WXS	SOLID	Phase_I	B2RCM9|Q9NUL4	Silent	SNP	ENST00000330689.4	37	CCDS3012.1																																																																																				0.393	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1		NM_019069	
WDR62	284403	hgsc.bcm.edu	37	19	36575625	36575625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr19:36575625G>T	ENST00000270301.7	+	12	1621	c.1621G>T	c.(1621-1623)Gag>Tag	p.E541*	WDR62_ENST00000401500.2_Nonsense_Mutation_p.E541*			O43379	WDR62_HUMAN	WD repeat domain 62	541					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCTGTGCCTGGAGTACTCCAA	0.652																																																	0													97.0	78.0	85.0					19																	36575625		2203	4300	6503	SO:0001587	stop_gained	284403			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1621G>T	19.37:g.36575625G>T	ENSP00000270301:p.Glu541*	Somatic		WXS	SOLID	Phase_I	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Nonsense_Mutation	SNP	ENST00000270301.7	37	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	G	38	6.947420	0.97956	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	.	.	.	5.15	5.15	0.70609	.	0.061187	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-29.0202	16.4688	0.84094	0.0:0.0:1.0:0.0	.	.	.	.	X	541	.	ENSP00000270301:E541X	E	+	1	0	WDR62	41267465	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.156000	0.94705	2.558000	0.86282	0.561000	0.74099	GAG		0.652	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1		NM_015671	
WNK2	65268	hgsc.bcm.edu	37	9	96002138	96002138	+	Silent	SNP	C	C	T			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:96002138C>T	ENST00000297954.4	+	6	1422	c.1422C>T	c.(1420-1422)atC>atT	p.I474I	WNK2_ENST00000349097.3_Silent_p.I86I|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000427277.2_Silent_p.I86I|WNK2_ENST00000395477.2_Silent_p.I474I|WNK2_ENST00000395475.2_Silent_p.I460I	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	474					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AGTCCACCATCGCCCTGAGGC	0.602																																																	0													47.0	37.0	41.0					9																	96002138		2202	4294	6496	SO:0001819	synonymous_variant	65268			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.1422C>T	9.37:g.96002138C>T		Somatic		WXS	SOLID	Phase_I	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.05|10.05	1.245247|1.245247	0.22796|0.22796	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000432730	.|.	.|.	.|.	4.59|4.59	-7.99|-7.99	0.01131|0.01131	.|.	.|.	.|.	.|.	.|.	T|T	0.46698|0.46698	0.1406|0.1406	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51865|0.51865	-0.8651|-0.8651	4|4	.|.	.|.	.|.	.|.	7.4533|7.4533	0.27250|0.27250	0.1088:0.3997:0.0:0.4915|0.1088:0.3997:0.0:0.4915	.|.	.|.	.|.	.|.	C|L	78|470	.|.	.|.	R|S	+|+	1|2	0|0	WNK2|WNK2	95041959|95041959	0.004000|0.004000	0.15560|0.15560	0.827000|0.827000	0.32855|0.32855	0.948000|0.948000	0.59901|0.59901	-1.390000|-1.390000	0.02528|0.02528	-1.864000|-1.864000	0.01148|0.01148	-1.587000|-1.587000	0.00848|0.00848	CGC|TCG		0.602	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1		NM_006648	
XPR1	9213	hgsc.bcm.edu;ucsc.edu	37	1	180651511	180651511	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr1:180651511C>A	ENST00000367590.4	+	2	283	c.85C>A	c.(85-87)Ctg>Atg	p.L29M	XPR1_ENST00000367589.3_Missense_Mutation_p.L29M	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	29	SPX. {ECO:0000255|PROSITE- ProRule:PRU00714}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						CAAGGATATGCTGTATTCAGC	0.328																																																	0													98.0	104.0	102.0					1																	180651511		2203	4299	6502	SO:0001583	missense	9213			AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.85C>A	1.37:g.180651511C>A	ENSP00000356562:p.Leu29Met	Somatic		WXS	SOLID	Phase_I	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	ENST00000367590.4	37	CCDS1340.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203678	0.79127	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T	0.59083	0.29	5.71	5.71	0.89125	SPX, N-terminal (2);	0.260221	0.31542	N	0.007473	T	0.81936	0.4928	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.80764	0.994;0.982	D	0.84885	0.0833	10	0.72032	D	0.01	-0.1513	19.0778	0.93169	0.0:1.0:0.0:0.0	.	29;29	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	M	29	ENSP00000356562:L29M	ENSP00000356561:L29M	L	+	1	2	XPR1	178918134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.784000	0.47774	2.881000	0.98747	0.650000	0.86243	CTG		0.328	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2		NM_004736	
ZMYND15	84225	hgsc.bcm.edu	37	17	4645276	4645276	+	Silent	SNP	T	T	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr17:4645276T>C	ENST00000433935.1	+	4	951	c.894T>C	c.(892-894)ggT>ggC	p.G298G	CXCL16_ENST00000293778.6_5'Flank|ZMYND15_ENST00000269289.6_Silent_p.G298G|ZMYND15_ENST00000592813.1_Silent_p.G298G|CXCL16_ENST00000574412.1_5'Flank|ZMYND15_ENST00000573751.2_Silent_p.G298G	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	298					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						GGACATGGGGTCCCCGGCCAG	0.577																																																	0													79.0	85.0	83.0					17																	4645276		2203	4300	6503	SO:0001819	synonymous_variant	84225			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.894T>C	17.37:g.4645276T>C		Somatic		WXS	SOLID	Phase_I	B4DXY5|I3L296	Silent	SNP	ENST00000433935.1	37	CCDS45584.1																																																																																				0.577	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1		NM_032265	
ZNF250	58500	hgsc.bcm.edu;ucsc.edu	37	8	146107413	146107413	+	Silent	SNP	G	G	A			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr8:146107413G>A	ENST00000292579.7	-	6	1286	c.1170C>T	c.(1168-1170)acC>acT	p.T390T	ZNF250_ENST00000543949.1_Intron|ZNF250_ENST00000342660.6_Intron|ZNF250_ENST00000417550.2_Silent_p.T385T	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	390					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		GCTTCTCCCCGGTGTGCACGT	0.592																																					NSCLC(16;520 556 24096 40084 43446)												0													132.0	110.0	118.0					8																	146107413		2203	4300	6503	SO:0001819	synonymous_variant	58500			AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1170C>T	8.37:g.146107413G>A		Somatic		WXS	SOLID	Phase_I	D3DWP1|Q59HE9|Q8N942|Q96AH9	Silent	SNP	ENST00000292579.7	37	CCDS34972.1																																																																																				0.592	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1		NM_021061	
ZNF483	158399	hgsc.bcm.edu;ucsc.edu	37	9	114305082	114305082	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr9:114305082A>C	ENST00000309235.5	+	6	2025	c.1867A>C	c.(1867-1869)Att>Ctt	p.I623L	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	623					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						TACGTCTGTGATTTATCATCA	0.403																																																	0													65.0	67.0	66.0					9																	114305082		2203	4300	6503	SO:0001583	missense	158399			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1867A>C	9.37:g.114305082A>C	ENSP00000311679:p.Ile623Leu	Somatic		WXS	SOLID	Phase_I	Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	37	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.733128	0.30684	.	.	ENSG00000173258	ENST00000309235	T	0.14766	2.48	3.84	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.283884	0.25535	N	0.030002	T	0.06508	0.0167	N	0.16656	0.425	0.20638	N	0.999879	B	0.06786	0.001	B	0.10450	0.005	T	0.31166	-0.9953	10	0.30854	T	0.27	-9.0295	3.3056	0.06998	0.5702:0.21:0.2197:0.0	.	623	Q8TF39	ZN483_HUMAN	L	623	ENSP00000311679:I623L	ENSP00000311679:I623L	I	+	1	0	ZNF483	113344903	0.000000	0.05858	0.335000	0.25508	0.977000	0.68977	0.802000	0.27069	0.289000	0.22422	0.533000	0.62120	ATT		0.403	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1		XM_088567	
ZNF787	126208	hgsc.bcm.edu;ucsc.edu	37	19	56614566	56614566	+	Silent	SNP	G	G	C			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chr19:56614566G>C	ENST00000270459.3	-	2	139	c.21C>G	c.(19-21)gcC>gcG	p.A7A	ZNF787_ENST00000587279.1_Silent_p.A7A|Y_RNA_ENST00000411128.1_RNA	NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	7					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		CCGGAGACCAGGCTTCTTCCC	0.647																																																	0													41.0	47.0	45.0					19																	56614566		1959	4142	6101	SO:0001819	synonymous_variant	126208			BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.21C>G	19.37:g.56614566G>C		Somatic		WXS	SOLID	Phase_I	O00455	Silent	SNP	ENST00000270459.3	37	CCDS42634.1																																																																																				0.647	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1		NM_001002836	
KDM5C	8242	ucsc.edu	37	X	53240028	53240031	+	Frame_Shift_Del	DEL	GGTA	GGTA	-			TCGA-B0-4694-01A-01D-1361-10	TCGA-B0-4694-11A-01D-1361-10	GGTA	GGTA	GGTA	-	GGTA	GGTA	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	41bb1730-882b-4f39-9152-fbb07c030941	5aa17238-3462-4d47-b59d-459418de9e98	g.chrX:53240028_53240031delGGTA	ENST00000375401.3	-	11	1942_1945	c.1410_1413delTACC	c.(1408-1413)gctaccfs	p.AT470fs	KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000375379.3_Frame_Shift_Del_p.AT470fs|KDM5C_ENST00000452825.3_Frame_Shift_Del_p.AT403fs|KDM5C_ENST00000375383.3_Frame_Shift_Del_p.AT429fs|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000404049.3_Frame_Shift_Del_p.AT469fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	470	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TCCAACCACTGGTAGCATACTCCT	0.461			"""N, F, S"""		clear cell renal carcinoma																																	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										SO:0001589	frameshift_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1410_1413delTACC	X.37:g.53240028_53240031delGGTA	ENSP00000364550:p.Ala470fs	Somatic		WXS	SOLID	.	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Del	DEL	ENST00000375401.3	37	CCDS14351.1																																																																																				0.461	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
