#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACTR3B	57180	hgsc.bcm.edu	37	7	152522195	152522195	+	Silent	SNP	C	C	T	rs200914813	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:152522195C>T	ENST00000256001.8	+	9	1073	c.939C>T	c.(937-939)cgC>cgT	p.R313R	ACTR3B_ENST00000377776.3_Silent_p.R313R|ACTR3B_ENST00000537264.1_Silent_p.R225R|ACTR3B_ENST00000397282.2_Silent_p.R225R	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	313						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		ATGTGCGGCGCCCGCTGTATA	0.413																																																	0													85.0	79.0	81.0					7																	152522195		2203	4300	6503	SO:0001819	synonymous_variant	57180				CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.939C>T	7.37:g.152522195C>T		Somatic		WXS	SOLID	Phase_I	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Silent	SNP	ENST00000256001.8	37	CCDS5934.1																																																																																				0.413	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1		NM_020445	
ACTRT1	139741	hgsc.bcm.edu	37	X	127185630	127185630	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:127185630T>A	ENST00000371124.3	-	1	752	c.556A>T	c.(556-558)Agg>Tgg	p.R186W		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	186						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						GTGATGTCCCTCCCTGCCATA	0.532																																																	0													86.0	78.0	81.0					X																	127185630		2203	4300	6503	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.556A>T	X.37:g.127185630T>A	ENSP00000360165:p.Arg186Trp	Somatic		WXS	SOLID	Phase_I	Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	CCDS14611.1	.	.	.	.	.	.	.	.	.	.	T	17.24	3.340184	0.60963	.	.	ENSG00000123165	ENST00000371124	D	0.94862	-3.54	3.48	3.48	0.39840	.	0.285022	0.28706	N	0.014418	D	0.97111	0.9056	M	0.92077	3.27	0.32987	D	0.524476	D	0.76494	0.999	D	0.79784	0.993	D	0.96788	0.9580	10	0.87932	D	0	.	6.1582	0.20350	0.0:0.0:0.2589:0.7411	.	186	Q8TDG2	ACTT1_HUMAN	W	186	ENSP00000360165:R186W	ENSP00000360165:R186W	R	-	1	2	ACTRT1	127013311	0.001000	0.12720	0.267000	0.24556	0.969000	0.65631	0.751000	0.26348	1.604000	0.50143	0.441000	0.28932	AGG		0.532	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1		NM_138289	
ALPI	248	hgsc.bcm.edu	37	2	233322958	233322958	+	Silent	SNP	T	T	C	rs41265121	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr2:233322958T>C	ENST00000295463.3	+	9	1100	c.1023T>C	c.(1021-1023)ggT>ggC	p.G341G		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	341					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		ATCATGAGGGTGTGGCTTACC	0.662													T|||	490	0.0978435	0.1089	0.0764	5008	,	,		16877	0.1012		0.1093	False		,,,				2504	0.0828																0								T		471,3935	221.7+/-238.7	29,413,1761	77.0	73.0	75.0		1023	0.2	0.0	2	dbSNP_127	75	740,7860	178.9+/-228.2	31,678,3591	no	coding-synonymous	ALPI	NM_001631.3		60,1091,5352	CC,CT,TT		8.6047,10.69,9.3111		341/529	233322958	1211,11795	2203	4300	6503	SO:0001819	synonymous_variant	248			M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1023T>C	2.37:g.233322958T>C		Somatic		WXS	SOLID	Phase_I	B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Silent	SNP	ENST00000295463.3	37	CCDS2492.1																																																																																				0.662	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257035.2		NM_001631	
ANKRD35	148741	hgsc.bcm.edu	37	1	145566760	145566760	+	Silent	SNP	T	T	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr1:145566760T>C	ENST00000355594.4	+	11	2949	c.2862T>C	c.(2860-2862)ctT>ctC	p.L954L		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	954										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATGCTCGCCTTGCCCTGCAGC	0.498																																					Melanoma(9;127 754 22988 51047)												0													90.0	86.0	87.0					1																	145566760		2203	4300	6503	SO:0001819	synonymous_variant	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2862T>C	1.37:g.145566760T>C		Somatic		WXS	SOLID	Phase_I	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	37	CCDS919.1																																																																																				0.498	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1		NM_144698	
APOOL	139322	hgsc.bcm.edu;ucsc.edu	37	X	84310894	84310894	+	Silent	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:84310894A>G	ENST00000373173.2	+	5	444	c.357A>G	c.(355-357)acA>acG	p.T119T		NM_198450.5	NP_940852.3	Q6UXV4	MIC27_HUMAN	apolipoprotein O-like	119						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAGTTATTACAGTTTCAGGAT	0.343																																																	0													54.0	46.0	48.0					X																	84310894		1796	4058	5854	SO:0001819	synonymous_variant	139322			AK130506	CCDS48138.1	Xq21.1	2007-01-17	2007-01-17	2007-01-17	ENSG00000155008	ENSG00000155008			24009	protein-coding gene	gene with protein product			"""chromosome X open reading frame 33"", ""family with sequence similarity 121A"""	CXorf33, FAM121A		12975309	Standard	NM_198450		Approved	UNQ8193, AAIR8193	uc004eem.3	Q6UXV4	OTTHUMG00000021930	ENST00000373173.2:c.357A>G	X.37:g.84310894A>G		Somatic		WXS	SOLID	Phase_I	Q3KNU7|Q5H9D1	Silent	SNP	ENST00000373173.2	37	CCDS48138.1																																																																																				0.343	APOOL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057385.2		NM_198450	
ATAD3C	219293	hgsc.bcm.edu	37	1	1391244	1391244	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr1:1391244G>C	ENST00000378785.2	+	6	1507	c.512G>C	c.(511-513)aGg>aCg	p.R171T		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	171							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGCCTGTACAGGCACATCCTG	0.627																																																	0													90.0	100.0	97.0					1																	1391244		692	1591	2283	SO:0001583	missense	219293			AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.512G>C	1.37:g.1391244G>C	ENSP00000368062:p.Arg171Thr	Somatic		WXS	SOLID	Phase_I	Q8N1Z5	Missense_Mutation	SNP	ENST00000378785.2	37	CCDS44039.1	.	.	.	.	.	.	.	.	.	.	.	4.651	0.121094	0.08881	.	.	ENSG00000215915	ENST00000378785	T	0.79352	-1.26	2.52	2.52	0.30459	ATPase, AAA+ type, core (1);	0.049403	0.85682	D	0.000000	D	0.88522	0.6459	M	0.91406	3.205	0.58432	D	0.999997	D	0.76494	0.999	D	0.66716	0.946	D	0.90447	0.4436	10	0.87932	D	0	.	12.0152	0.53309	0.0:0.0:1.0:0.0	.	171	Q5T2N8	ATD3C_HUMAN	T	171	ENSP00000368062:R171T	ENSP00000368062:R171T	R	+	2	0	ATAD3C	1381107	1.000000	0.71417	0.003000	0.11579	0.001000	0.01503	9.043000	0.93799	1.229000	0.43630	0.205000	0.17691	AGG		0.627	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001279.3		NM_001039211	
ATP13A5	344905	hgsc.bcm.edu;ucsc.edu	37	3	193036861	193036861	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr3:193036861G>A	ENST00000342358.4	-	17	2069	c.1952C>T	c.(1951-1953)aCg>aTg	p.T651M		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	651						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCCTTGCACCGTGTAACTCCT	0.473																																																	0													154.0	156.0	155.0					3																	193036861		2203	4300	6503	SO:0001583	missense	344905			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1952C>T	3.37:g.193036861G>A	ENSP00000341942:p.Thr651Met	Somatic		WXS	SOLID	Phase_I	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716744	0.68844	.	.	ENSG00000187527	ENST00000342358	T	0.70631	-0.5	5.89	5.89	0.94794	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.64402	D	0.000001	D	0.88926	0.6570	M	0.94142	3.5	0.47511	D	0.999447	D	0.89917	1.0	D	0.91635	0.999	D	0.91295	0.5062	10	0.87932	D	0	-14.8043	17.7418	0.88409	0.0:0.0:1.0:0.0	.	651	Q4VNC0	AT135_HUMAN	M	651	ENSP00000341942:T651M	ENSP00000341942:T651M	T	-	2	0	ATP13A5	194519555	1.000000	0.71417	1.000000	0.80357	0.397000	0.30659	7.714000	0.84703	2.790000	0.95986	0.655000	0.94253	ACG		0.473	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1		NM_198505	
ATP4A	495	hgsc.bcm.edu	37	19	36049926	36049927	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr19:36049926_36049927delGA	ENST00000262623.3	-	8	1251_1252	c.1223_1224delTC	c.(1222-1224)atcfs	p.I408fs		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	408					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CAGCTGTGTGGATGTGGTTGTC	0.584																																																	0																																										SO:0001589	frameshift_variant	495				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1223_1224delTC	19.37:g.36049926_36049927delGA	ENSP00000262623:p.Ile408fs	Somatic		WXS	SOLID	Phase_I	O00738	Frame_Shift_Del	DEL	ENST00000262623.3	37	CCDS12467.1																																																																																				0.584	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2		NM_000704	
CPED1	79974	hgsc.bcm.edu;ucsc.edu	37	7	120907350	120907350	+	Silent	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:120907350A>G	ENST00000310396.5	+	21	3182	c.2715A>G	c.(2713-2715)ttA>ttG	p.L905L		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	905						endoplasmic reticulum (GO:0005783)											tacatttcttaacacaggtaa	0.373																																																	0													69.0	65.0	67.0					7																	120907350		2193	4288	6481	SO:0001819	synonymous_variant	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2715A>G	7.37:g.120907350A>G		Somatic		WXS	SOLID	Phase_I	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	37	CCDS34739.1																																																																																				0.373	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1		NM_024913	
CAAP1	79886	hgsc.bcm.edu;ucsc.edu	37	9	26861129	26861129	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr9:26861129A>C	ENST00000333916.5	-	5	762	c.674T>G	c.(673-675)aTc>aGc	p.I225S	CAAP1_ENST00000535437.1_Missense_Mutation_p.I80S|CAAP1_ENST00000495958.1_5'UTR|CAAP1_ENST00000520187.1_Intron	NM_001167575.1|NM_024828.3	NP_001161047.1|NP_079104.3	Q9H8G2	CAAP1_HUMAN	caspase activity and apoptosis inhibitor 1	225					apoptotic process (GO:0006915)												ATCTATACAGATGTCTTGCCT	0.333																																																	0													94.0	102.0	99.0					9																	26861129		2203	4300	6503	SO:0001583	missense	0			BC014658	CCDS6516.1	9p21.2	2012-04-20	2012-04-20	2012-04-20	ENSG00000120159	ENSG00000120159			25834	protein-coding gene	gene with protein product	"""conserved anti-apoptotic protein"""		"""chromosome 9 open reading frame 82"""	C9orf82		21980415	Standard	NM_024828		Approved	FLJ13657, CAAP	uc003zqc.3	Q9H8G2	OTTHUMG00000019706	ENST00000333916.5:c.674T>G	9.37:g.26861129A>C	ENSP00000369431:p.Ile225Ser	Somatic		WXS	SOLID	Phase_I	B4DWT4|D3DRK4|Q5VY32|Q6IPE6|Q96C59	Missense_Mutation	SNP	ENST00000333916.5	37	CCDS6516.1	.	.	.	.	.	.	.	.	.	.	A	5.398	0.258576	0.10239	.	.	ENSG00000120159	ENST00000333916;ENST00000535437	T;T	0.41065	1.01;1.07	5.71	-3.52	0.04682	.	0.489534	0.22272	N	0.062241	T	0.10594	0.0259	N	0.03608	-0.345	0.22581	N	0.998967	B	0.02656	0.0	B	0.04013	0.001	T	0.25537	-1.0129	10	0.05351	T	0.99	2.1984	1.708	0.02886	0.1761:0.2608:0.379:0.1841	.	225	Q9H8G2	CI082_HUMAN	S	225;80	ENSP00000369431:I225S;ENSP00000444885:I80S	ENSP00000369431:I225S	I	-	2	0	C9orf82	26851129	0.084000	0.21492	0.524000	0.27887	0.981000	0.71138	0.031000	0.13710	-0.384000	0.07845	0.377000	0.23210	ATC		0.333	CAAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051954.1		NM_024828	
CBWD3	445571	hgsc.bcm.edu	37	9	70863777	70863777	+	Missense_Mutation	SNP	G	G	T	rs62548542	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr9:70863777G>T	ENST00000360171.6	+	4	945	c.394G>T	c.(394-396)Gac>Tac	p.D132Y	CBWD3_ENST00000377342.5_Missense_Mutation_p.D132Y	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	132				D -> Y (in Ref. 1; AAQ76870). {ECO:0000305}.			ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		GAAATTTGATGACATACTGTT	0.323													.|||	3371	0.673123	0.7284	0.7363	5008	,	,		17800	0.4623		0.7883	False		,,,				2504	0.6524																0													3.0	2.0	2.0					9																	70863777		1004	1993	2997	SO:0001583	missense	445571			BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.394G>T	9.37:g.70863777G>T	ENSP00000353295:p.Asp132Tyr	Somatic		WXS	SOLID	Phase_I	B4DNG9|Q6VB91	Missense_Mutation	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.403851	0.01165	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344;ENST00000377342	T;T	0.39229	1.09;1.09	3.51	2.34	0.29019	Cobalamin (vitamin B12) biosynthesis CobW-like (1);	0.000000	0.85682	N	0.000000	T	0.03783	0.0107	N	0.00002	-3.625	0.50632	P	1.1399999999994748E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.34030	-0.9845	9	0.02654	T	1	-0.5034	5.5703	0.17192	0.0:0.0982:0.1728:0.7291	.	132	Q5JTY5	CBWD3_HUMAN	Y	132;132;132;132;96;132	ENSP00000353295:D132Y;ENSP00000366559:D132Y	ENSP00000353295:D132Y	D	+	1	0	CBWD3	70053597	1.000000	0.71417	0.995000	0.50966	0.722000	0.41435	5.539000	0.67199	-0.013000	0.14199	-1.433000	0.01084	GAC		0.323	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1		NM_201453	
CDC42EP3	10602	hgsc.bcm.edu;ucsc.edu	37	2	37873389	37873389	+	Silent	SNP	T	T	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr2:37873389T>A	ENST00000295324.3	-	2	1342	c.342A>T	c.(340-342)ggA>ggT	p.G114G	AC006369.2_ENST00000419425.1_RNA	NM_001270436.1|NM_001270437.1|NM_001270438.1|NM_006449.4	NP_001257365.1|NP_001257366.1|NP_001257367.1|NP_006440.2	Q9UKI2	BORG2_HUMAN	CDC42 effector protein (Rho GTPase binding) 3	114					regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	cytoskeletal regulatory protein binding (GO:0005519)			endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	11		all_hematologic(82;0.172)				GAGCTTGGGATCCTCCAATGG	0.547																																																	0													74.0	75.0	75.0					2																	37873389		2203	4300	6503	SO:0001819	synonymous_variant	10602			AF094521	CCDS1791.1	2p21	2008-05-21			ENSG00000163171	ENSG00000163171			16943	protein-coding gene	gene with protein product		606133				9535835, 11035016	Standard	NM_001270436		Approved	CEP3, UB1, BORG2	uc031rnz.1	Q9UKI2	OTTHUMG00000100971	ENST00000295324.3:c.342A>T	2.37:g.37873389T>A		Somatic		WXS	SOLID	Phase_I	B2R8S0|O95353|Q9UQJ0	Silent	SNP	ENST00000295324.3	37	CCDS1791.1																																																																																				0.547	CDC42EP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218581.3		NM_006449	
CH25H	9023	hgsc.bcm.edu;ucsc.edu	37	10	90966472	90966472	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr10:90966472A>T	ENST00000371852.2	-	1	599	c.578T>A	c.(577-579)cTc>cAc	p.L193H		NM_003956.3	NP_003947.1	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	193					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholesterol 25-hydroxylase activity (GO:0001567)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			kidney(1)|large_intestine(2)|lung(3)|stomach(1)	7		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		GTGGCACCCGAGCAGTGTGAC	0.567																																																	0													156.0	150.0	152.0					10																	90966472		2203	4300	6503	SO:0001583	missense	9023			AF059212	CCDS7400.1	10q23	2013-03-04			ENSG00000138135	ENSG00000138135	1.14.99.38	"""Fatty acid hydroxylase domain containing"""	1907	protein-coding gene	gene with protein product		604551				9852097	Standard	NM_003956		Approved		uc001kfz.3	O95992	OTTHUMG00000018705	ENST00000371852.2:c.578T>A	10.37:g.90966472A>T	ENSP00000360918:p.Leu193His	Somatic		WXS	SOLID	Phase_I	B2RBY3	Missense_Mutation	SNP	ENST00000371852.2	37	CCDS7400.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.525267	0.85600	.	.	ENSG00000138135	ENST00000371852	D	0.85556	-2.0	4.99	4.99	0.66335	Fatty acid hydroxylase (1);	0.069987	0.56097	D	0.000025	D	0.93452	0.7911	M	0.91612	3.225	0.53688	D	0.999972	D	0.89917	1.0	D	0.81914	0.995	D	0.94266	0.7506	10	0.52906	T	0.07	-52.109	14.5742	0.68235	1.0:0.0:0.0:0.0	.	193	O95992	CH25H_HUMAN	H	193	ENSP00000360918:L193H	ENSP00000360918:L193H	L	-	2	0	CH25H	90956452	1.000000	0.71417	0.849000	0.33467	0.988000	0.76386	9.104000	0.94239	2.179000	0.69175	0.460000	0.39030	CTC		0.567	CH25H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049291.1		NM_003956	
DEF8	54849	hgsc.bcm.edu	37	16	90025607	90025607	+	Intron	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr16:90025607A>G	ENST00000268676.7	+	6	786				DEF8_ENST00000570182.1_Intron|DEF8_ENST00000563848.1_Intron|DEF8_ENST00000563795.1_Intron|DEF8_ENST00000418391.2_Silent_p.Q186Q|DEF8_ENST00000567874.1_Intron|DEF8_ENST00000569453.1_Intron|DEF8_ENST00000563594.1_Intron	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)						intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		agagagaccaaagttcctgcc	0.512																																																	0													45.0	48.0	47.0					16																	90025607		2198	4300	6498	SO:0001627	intron_variant	54849			AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.697+44A>G	16.37:g.90025607A>G		Somatic		WXS	SOLID	Phase_I	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Silent	SNP	ENST00000268676.7	37	CCDS10989.1																																																																																				0.512	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1		NM_207514	
DOCK11	139818	hgsc.bcm.edu	37	X	117707902	117707902	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:117707902G>T	ENST00000276202.7	+	12	1373	c.1310G>T	c.(1309-1311)aGt>aTt	p.S437I	DOCK11_ENST00000276204.6_Missense_Mutation_p.S437I	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	437					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CAACTGGCCAGTGACGGTAGC	0.458																																																	0													96.0	88.0	91.0					X																	117707902		2203	4300	6503	SO:0001583	missense	139818			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.1310G>T	X.37:g.117707902G>T	ENSP00000276202:p.Ser437Ile	Somatic		WXS	SOLID	Phase_I	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338643	0.24253	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.41758	0.99;0.99	6.02	-0.732	0.11147	.	1.409310	0.03730	N	0.253290	T	0.24661	0.0598	N	0.08118	0	0.09310	N	1	B;B	0.26744	0.158;0.019	B;B	0.32149	0.141;0.028	T	0.22417	-1.0217	10	0.33141	T	0.24	-13.7539	5.2522	0.15529	0.4692:0.266:0.2647:0.0	.	437;437	A6NIW2;Q5JSL3	.;DOC11_HUMAN	I	437	ENSP00000276204:S437I;ENSP00000276202:S437I	ENSP00000276202:S437I	S	+	2	0	DOCK11	117591930	0.000000	0.05858	0.000000	0.03702	0.406000	0.30931	0.214000	0.17541	-0.086000	0.12550	0.600000	0.82982	AGT		0.458	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1		NM_144658	
DOCK3	1795	hgsc.bcm.edu	37	3	51400103	51400103	+	Missense_Mutation	SNP	G	G	A	rs375984390		TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr3:51400103G>A	ENST00000266037.9	+	49	5314	c.5291G>A	c.(5290-5292)cGa>cAa	p.R1764Q		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1764	Ser-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R1764Q(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCCAGTGCCCGAGGTAAGGAT	0.562																																																	1	Substitution - Missense(1)	ovary(1)											45.0	46.0	46.0					3																	51400103		2033	4194	6227	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5291G>A	3.37:g.51400103G>A	ENSP00000266037:p.Arg1764Gln	Somatic		WXS	SOLID	Phase_I	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	33	5.281009	0.95489	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.22134	1.97	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.44808	0.1311	M	0.72118	2.19	0.58432	D	0.999997	D	0.89917	1.0	D	0.79108	0.992	T	0.23868	-1.0176	10	0.11794	T	0.64	.	19.2304	0.93836	0.0:0.0:1.0:0.0	.	1764	Q8IZD9	DOCK3_HUMAN	Q	1764;560	ENSP00000266037:R1764Q	ENSP00000266037:R1764Q	R	+	2	0	DOCK3	51375143	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.395000	0.97266	2.605000	0.88082	0.563000	0.77884	CGA		0.562	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5		NM_004947	
DUOX1	53905	hgsc.bcm.edu	37	15	45440634	45440634	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr15:45440634T>A	ENST00000321429.4	+	22	3214	c.2807T>A	c.(2806-2808)cTc>cAc	p.L936H	DUOX1_ENST00000389037.3_Missense_Mutation_p.L936H|DUOX1_ENST00000561166.1_Missense_Mutation_p.L582H	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	936					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		TTCACGCAGCTCTGTGTCAAA	0.517																																																	0													67.0	64.0	65.0					15																	45440634		2198	4298	6496	SO:0001583	missense	53905			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2807T>A	15.37:g.45440634T>A	ENSP00000317997:p.Leu936His	Somatic		WXS	SOLID	Phase_I	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279024	0.80692	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.73469	-0.75;-0.75	4.9	4.9	0.64082	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83820	0.5337	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	D	0.85435	0.1151	10	0.72032	D	0.01	-45.9378	12.7942	0.57551	0.0:0.0:0.0:1.0	.	69;936	Q9NT13;Q9NRD9	.;DUOX1_HUMAN	H	936	ENSP00000317997:L936H;ENSP00000373689:L936H	ENSP00000317997:L936H	L	+	2	0	DUOX1	43227926	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.841000	0.86834	2.189000	0.69895	0.459000	0.35465	CTC		0.517	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1		NM_017434	
EZH2	2146	hgsc.bcm.edu;ucsc.edu	37	7	148506483	148506483	+	Splice_Site	SNP	C	C	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:148506483C>T	ENST00000460911.1	-	18	2103		c.e18-1		EZH2_ENST00000320356.2_Splice_Site|EZH2_ENST00000541220.1_Splice_Site|EZH2_ENST00000350995.2_Splice_Site|EZH2_ENST00000483967.1_Splice_Site|EZH2_ENST00000478654.1_Splice_Site|EZH2_ENST00000476773.1_Splice_Site			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit						cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ACCACAAAATCTAAAAAGAAA	0.363			Mis		DLBCL																																			Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0													76.0	79.0	78.0					7																	148506483		2203	4300	6503	SO:0001630	splice_region_variant	2146				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.2015-1G>A	7.37:g.148506483C>T		Somatic		WXS	SOLID	Phase_I	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Splice_Site	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298651	0.81025	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5938	0.91223	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EZH2	148137416	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	7.574000	0.82434	2.375000	0.81037	0.655000	0.94253	.		0.363	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1		NM_004456	Intron
ESYT2	57488	hgsc.bcm.edu	37	7	158529819	158529819	+	Silent	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:158529819A>G	ENST00000251527.5	-	19	2465	c.2400T>C	c.(2398-2400)taT>taC	p.Y800Y	ESYT2_ENST00000435514.2_Silent_p.Y235Y	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	828	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						CTGGTAATAAATACATGCGGA	0.428																																																	0													159.0	141.0	147.0					7																	158529819		2203	4300	6503	SO:0001819	synonymous_variant	57488			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2400T>C	7.37:g.158529819A>G		Somatic		WXS	SOLID	Phase_I	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	ENST00000251527.5	37	CCDS34791.1																																																																																				0.428	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1		NM_020728	
FAM129A	116496	hgsc.bcm.edu	37	1	184859343	184859343	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr1:184859343C>A	ENST00000367511.3	-	4	525	c.332G>T	c.(331-333)gGa>gTa	p.G111V		NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	111					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						AGGAGCAGCTCCTCTCTGATA	0.433																																																	0													71.0	72.0	72.0					1																	184859343		2203	4300	6503	SO:0001583	missense	116496			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.332G>T	1.37:g.184859343C>A	ENSP00000356481:p.Gly111Val	Somatic		WXS	SOLID	Phase_I	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316925	0.60524	.	.	ENSG00000135842	ENST00000367511	T	0.15256	2.44	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.28554	-1.0040	10	0.72032	D	0.01	-23.069	15.358	0.74443	0.0:1.0:0.0:0.0	.	111	Q9BZQ8	NIBAN_HUMAN	V	111	ENSP00000356481:G111V	ENSP00000356481:G111V	G	-	2	0	FAM129A	183125966	1.000000	0.71417	0.988000	0.46212	0.434000	0.31775	4.572000	0.60886	2.687000	0.91594	0.655000	0.94253	GGA		0.433	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1			
FKBP9	11328	hgsc.bcm.edu	37	7	33039811	33039811	+	Silent	SNP	C	C	T	rs201284807		TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:33039811C>T	ENST00000242209.4	+	8	1480	c.1311C>T	c.(1309-1311)tgC>tgT	p.C437C	FKBP9_ENST00000538443.1_Silent_p.C299C|FKBP9_ENST00000490776.2_Silent_p.C205C|FKBP9_ENST00000538336.1_Silent_p.C490C|RNU6-388P_ENST00000517012.1_RNA|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	437	PPIase FKBP-type 4. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GAGAGATGTGCGTTGGCGAGA	0.512																																																	0													109.0	102.0	104.0					7																	33039811		2203	4297	6500	SO:0001819	synonymous_variant	11328			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1311C>T	7.37:g.33039811C>T		Somatic		WXS	SOLID	Phase_I	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	ENST00000242209.4	37	CCDS5439.1																																																																																				0.512	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1		NM_007270	
GPR50	9248	hgsc.bcm.edu	37	X	150349562	150349562	+	Frame_Shift_Del	DEL	A	A	-	rs377556761|rs68058591		TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:150349562delA	ENST00000218316.3	+	2	1576	c.1507delA	c.(1507-1509)actfs	p.T503fs	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	503	Pro-rich.		Missing (lower fasting circulating triglyceride levels). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8647286, ECO:0000269|Ref.2}.		cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.T502_H505delTTGH(1)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TAAACCCACCACTGGCCACAT	0.602																																																	1	Deletion - In frame(1)	ovary(1)											68.0	80.0	77.0					X																	150349562		1875	3867	5742	SO:0001589	frameshift_variant	9248			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1507delA	X.37:g.150349562delA	ENSP00000218316:p.Thr503fs	Somatic		WXS	SOLID	Phase_I	Q0VGG3|Q3ZAR0	Frame_Shift_Del	DEL	ENST00000218316.3	37	CCDS44012.1																																																																																				0.602	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1		NM_004224	
GTF2I	2969	hgsc.bcm.edu;ucsc.edu	37	7	74129238	74129238	+	Splice_Site	SNP	T	T	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:74129238T>C	ENST00000324896.4	+	10	1212		c.e10+2		AC083884.8_ENST00000434256.1_RNA|GTF2I_ENST00000416070.1_Intron|AC083884.8_ENST00000450426.2_RNA|GTF2I_ENST00000346152.4_Splice_Site|GTF2I_ENST00000443166.1_Intron|GTF2I_ENST00000353920.4_Intron|AC083884.8_ENST00000594967.1_RNA	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi						negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						CTTTGCAAGGTATAATCTTTT	0.358																																																	0													128.0	124.0	125.0					7																	74129238		2203	4300	6503	SO:0001630	splice_region_variant	2969			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.823+2T>C	7.37:g.74129238T>C		Somatic		WXS	SOLID	Phase_I	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Splice_Site	SNP	ENST00000324896.4	37	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	T	10.52	1.373508	0.24857	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000346152	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7509	0.51847	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GTF2I	73767174	1.000000	0.71417	0.996000	0.52242	0.161000	0.22273	3.650000	0.54424	2.258000	0.74832	0.533000	0.62120	.		0.358	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1		NM_032999	Intron
IFNL3	282617	hgsc.bcm.edu	37	19	39734352	39734352	+	Missense_Mutation	SNP	C	C	T	rs62120527	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr19:39734352C>T	ENST00000413851.2	-	5	549	c.511G>A	c.(511-513)Gag>Aag	p.E171K		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	171					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											ACAGAGGCCTCGAGGCAGCCA	0.632													C|||	37	0.00738818	0.0008	0.0072	5008	,	,		15084	0.0		0.0169	False		,,,				2504	0.0143																0								C	LYS/GLU	10,4394		0,10,2192	26.0	26.0	26.0		511	1.6	1.0	19	dbSNP_129	26	127,8455		0,127,4164	no	missense	IL28B	NM_172139.2	56	0,137,6356	TT,TC,CC		1.4798,0.2271,1.055	possibly-damaging	171/197	39734352	137,12849	2202	4291	6493	SO:0001583	missense	0			AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.511G>A	19.37:g.39734352C>T	ENSP00000409000:p.Glu171Lys	Somatic		WXS	SOLID	Phase_I	A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Missense_Mutation	SNP	ENST00000413851.2	37	CCDS12530.1	20	0.009157509157509158	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	16	0.021108179419525065	C	15.48	2.845804	0.51164	0.002271	0.014798	ENSG00000197110	ENST00000413851	T	0.50001	0.76	3.95	1.63	0.23807	.	0.507495	0.19303	N	0.117588	T	0.46908	0.1417	M	0.80982	2.52	0.35618	D	0.809164	D	0.89917	1.0	P	0.61003	0.882	T	0.65994	-0.6033	10	0.52906	T	0.07	-4.7819	10.3207	0.43764	0.0:0.6532:0.3468:0.0	rs62120527	171	Q8IZI9	IL28B_HUMAN	K	171	ENSP00000409000:E171K	ENSP00000409000:E171K	E	-	1	0	IL28B	44426192	0.000000	0.05858	0.961000	0.40146	0.428000	0.31595	-0.017000	0.12590	0.229000	0.21039	0.205000	0.17691	GAG		0.632	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1		NM_172139	
IRF2BP2	359948	hgsc.bcm.edu;ucsc.edu	37	1	234743339	234743339	+	Silent	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr1:234743339C>A	ENST00000366609.3	-	2	1338	c.1308G>T	c.(1306-1308)ggG>ggT	p.G436G	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Silent_p.G420G|IRF2BP2_ENST00000491430.1_5'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CATGACTGCCCCCTGCATTGT	0.577																																																	0													127.0	127.0	127.0					1																	234743339		2203	4300	6503	SO:0001819	synonymous_variant	359948			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1308G>T	1.37:g.234743339C>A		Somatic		WXS	SOLID	Phase_I	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																				0.577	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1		NM_182972	
JAKMIP1	152789	hgsc.bcm.edu	37	4	6087193	6087193	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr4:6087193T>C	ENST00000282924.5	-	4	1273	c.788A>G	c.(787-789)gAg>gGg	p.E263G	JAKMIP1_ENST00000410077.2_Missense_Mutation_p.E98G|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.E263G|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.E263G|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.E98G|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	263	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGGCGGGAGCTCTCTCTTTGG	0.627																																																	0													59.0	61.0	60.0					4																	6087193		2203	4300	6503	SO:0001583	missense	152789			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.788A>G	4.37:g.6087193T>C	ENSP00000282924:p.Glu263Gly	Somatic		WXS	SOLID	Phase_I	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805936	0.70682	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	4.29	4.29	0.51040	.	0.000000	0.56097	D	0.000022	T	0.59770	0.2218	M	0.79258	2.445	0.50467	D	0.99987	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.83275	0.996;0.991;0.991;0.991;0.996	T	0.65586	-0.6132	10	0.87932	D	0	.	12.7897	0.57526	0.0:0.0:0.0:1.0	.	98;263;98;263;263	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	G	263;98;263;263;155;263;263;98	ENSP00000386711:E263G;ENSP00000387042:E98G;ENSP00000282924:E263G;ENSP00000386925:E263G;ENSP00000386745:E98G	ENSP00000282924:E263G	E	-	2	0	JAKMIP1	6138094	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	7.400000	0.79949	1.818000	0.53035	0.533000	0.62120	GAG		0.627	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2		NM_144720	
KCTD10	83892	hgsc.bcm.edu	37	12	109907503	109907503	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr12:109907503A>T	ENST00000228495.6	-	2	315	c.34T>A	c.(34-36)Tca>Aca	p.S12T	KCTD10_ENST00000424763.2_5'UTR|KCTD10_ENST00000540411.1_Missense_Mutation_p.S9T	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	12					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						GGCACCGCTGAGCTCACCACA	0.557																																																	0													67.0	60.0	63.0					12																	109907503		2203	4300	6503	SO:0001583	missense	83892			BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.34T>A	12.37:g.109907503A>T	ENSP00000228495:p.Ser12Thr	Somatic		WXS	SOLID	Phase_I	Q53HN2|Q59FV1|Q6PL47|Q96SU0	Missense_Mutation	SNP	ENST00000228495.6	37	CCDS9128.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.367326	0.61513	.	.	ENSG00000110906	ENST00000228495;ENST00000540411;ENST00000542262;ENST00000542858	T;T;T;T	0.46063	0.88;0.93;0.91;0.92	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000001	T	0.41190	0.1148	N	0.14661	0.345	0.80722	D	1	B;P;B	0.52577	0.452;0.954;0.323	P;D;P	0.63597	0.68;0.916;0.481	T	0.15896	-1.0421	10	0.07990	T	0.79	-4.2984	14.3043	0.66375	1.0:0.0:0.0:0.0	.	9;12;12	F5GWA4;Q9H3F6-2;Q9H3F6	.;.;BACD3_HUMAN	T	12;9;12;12	ENSP00000228495:S12T;ENSP00000441672:S9T;ENSP00000437348:S12T;ENSP00000445129:S12T	ENSP00000228495:S12T	S	-	1	0	KCTD10	108391886	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.252000	0.89840	2.157000	0.67596	0.533000	0.62120	TCA		0.557	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403099.1		NM_031954	
LRP4	4038	hgsc.bcm.edu	37	11	46914588	46914588	+	Missense_Mutation	SNP	G	G	A	rs371763360		TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr11:46914588G>A	ENST00000378623.1	-	13	1875	c.1633C>T	c.(1633-1635)Cgg>Tgg	p.R545W		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	545					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		AACACTTTCCGGTGGGCCCCA	0.582																																																	0								G	TRP/ARG	1,4401	2.1+/-5.4	0,1,2200	46.0	42.0	44.0		1633	1.5	1.0	11		44	0,8598		0,0,4299	no	missense	LRP4	NM_002334.3	101	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	545/1906	46914588	1,12999	2201	4299	6500	SO:0001583	missense	4038			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.1633C>T	11.37:g.46914588G>A	ENSP00000367888:p.Arg545Trp	Somatic		WXS	SOLID	Phase_I	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010275	0.75046	2.27E-4	0.0	ENSG00000134569	ENST00000378623	D	0.97665	-4.48	5.73	1.5	0.22942	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.99146	0.9705	H	0.99211	4.47	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.99243	1.0885	10	0.72032	D	0.01	.	16.6463	0.85178	0.0:0.0:0.3395:0.6605	.	545	O75096	LRP4_HUMAN	W	545	ENSP00000367888:R545W	ENSP00000367888:R545W	R	-	1	2	LRP4	46871164	1.000000	0.71417	0.996000	0.52242	0.912000	0.54170	2.263000	0.43293	0.013000	0.14918	-0.314000	0.08810	CGG		0.582	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1		NM_002334	
LRRK1	79705	hgsc.bcm.edu	37	15	101593136	101593136	+	Silent	SNP	G	G	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr15:101593136G>T	ENST00000388948.3	+	25	4058	c.3699G>T	c.(3697-3699)ctG>ctT	p.L1233L	LRRK1_ENST00000284395.5_Silent_p.L1230L|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGCTCTTCCTGGAGAACAGCA	0.692																																																	0													21.0	30.0	27.0					15																	101593136		2179	4275	6454	SO:0001819	synonymous_variant	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3699G>T	15.37:g.101593136G>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																				0.692	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2		NM_024652	
NIM1K	167359	hgsc.bcm.edu	37	5	43280310	43280310	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr5:43280310A>G	ENST00000512796.1	+	4	2289	c.790A>G	c.(790-792)Atg>Gtg	p.M264V	NIM1_ENST00000326035.2_Missense_Mutation_p.M264V			Q8IY84	NIM1_HUMAN		264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)										TTTGTACTTCATGGTGACTGG	0.562																																																	0													88.0	77.0	80.0					5																	43280310		2203	4300	6503	SO:0001583	missense	0																														ENST00000512796.1:c.790A>G	5.37:g.43280310A>G	ENSP00000420849:p.Met264Val	Somatic		WXS	SOLID	Phase_I	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013899	0.75161	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.27256	1.68;1.68	5.73	4.55	0.56014	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042426	0.85682	D	0.000000	T	0.52108	0.1714	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.57260	-0.7842	10	0.87932	D	0	.	12.9724	0.58520	0.8648:0.1352:0.0:0.0	.	264	Q8IY84	NIM1_HUMAN	V	264	ENSP00000313572:M264V;ENSP00000420849:M264V	ENSP00000313572:M264V	M	+	1	0	AC114947.1	43316067	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.520000	0.81821	0.987000	0.38709	0.533000	0.62120	ATG		0.562	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1			
MOCS1	4337	hgsc.bcm.edu	37	6	39893450	39893450	+	Silent	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr6:39893450A>T	ENST00000340692.5	-	3	393	c.390T>A	c.(388-390)ctT>ctA	p.L130L	MOCS1_ENST00000425303.2_Silent_p.L130L|MOCS1_ENST00000373188.2_Silent_p.L130L|MOCS1_ENST00000373195.3_Silent_p.L43L|MOCS1_ENST00000308559.7_Silent_p.L130L|MOCS1_ENST00000432280.2_Silent_p.L101L|MOCS1_ENST00000373186.4_Silent_p.L130L|MOCS1_ENST00000373175.4_Silent_p.L101L			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	130	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					CCGGCCGGATAAGCGGCTCTC	0.592																																					NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)												0													61.0	55.0	57.0					6																	39893450		2203	4293	6496	SO:0001819	synonymous_variant	4337			AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.390T>A	6.37:g.39893450A>T		Somatic		WXS	SOLID	Phase_I	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Silent	SNP	ENST00000340692.5	37																																																																																					0.592	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000040476.2		NM_005943	
NKAIN2	154215	hgsc.bcm.edu;ucsc.edu	37	6	124979433	124979433	+	Silent	SNP	C	C	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr6:124979433C>T	ENST00000368417.1	+	4	435	c.375C>T	c.(373-375)gaC>gaT	p.D125D	NKAIN2_ENST00000368416.1_Silent_p.D125D|NKAIN2_ENST00000546092.1_Intron|NKAIN2_ENST00000545433.1_Silent_p.D110D	NM_001040214.1	NP_001035304.1	Q5VXU1	NKAI2_HUMAN	Na+/K+ transporting ATPase interacting 2	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|large_intestine(3)|lung(12)|skin(2)	19				GBM - Glioblastoma multiforme(226;0.104)		CTGCCCCAGACTGGGCCCCAG	0.507																																																	0													158.0	128.0	138.0					6																	124979433		2203	4300	6503	SO:0001819	synonymous_variant	154215			AB070452	CCDS34526.1	6q21	2008-02-05	2007-10-04	2007-10-04	ENSG00000188580	ENSG00000188580		"""Na+/K+ transporting ATPase interacting"""	16443	protein-coding gene	gene with protein product		609758	"""T-cell lymphoma breakpoint associated target 1"""	TCBA1		17606467	Standard	XM_005266833		Approved	FAM77B	uc003pzo.3	Q5VXU1	OTTHUMG00000015500	ENST00000368417.1:c.375C>T	6.37:g.124979433C>T		Somatic		WXS	SOLID	Phase_I	Q8IYR4|Q8TF67	Silent	SNP	ENST00000368417.1	37	CCDS34526.1																																																																																				0.507	NKAIN2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042057.1		NM_001040214	
NOMO2	283820	hgsc.bcm.edu	37	16	18528574	18528574	+	Silent	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr16:18528574A>G	ENST00000381474.3	-	23	2759	c.2694T>C	c.(2692-2694)agT>agC	p.S898S	NOMO2_ENST00000330537.6_Silent_p.S898S|NOMO2_ENST00000543392.1_Silent_p.S731S	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	898						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						ACAGGCCACCACTCAGGGATA	0.507																																																	0																																										SO:0001819	synonymous_variant	283820			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.2694T>C	16.37:g.18528574A>G		Somatic		WXS	SOLID	Phase_I	Q4G177	Silent	SNP	ENST00000381474.3	37	CCDS32394.1																																																																																				0.507	NOMO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435858.1		NM_001004060	
NRG1	3084	hgsc.bcm.edu	37	8	32621790	32621790	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr8:32621790G>C	ENST00000405005.3	+	12	1793	c.1793G>C	c.(1792-1794)aGt>aCt	p.S598T	NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000519301.1_Missense_Mutation_p.S548T|NRG1_ENST00000287845.5_Missense_Mutation_p.S569T|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000356819.4_Missense_Mutation_p.S603T|NRG1_ENST00000287842.3_Missense_Mutation_p.S595T|NRG1_ENST00000338921.4_Missense_Mutation_p.S606T|NRG1_ENST00000539990.1_Missense_Mutation_p.S441T			Q02297	NRG1_HUMAN	neuregulin 1	598					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTGGCAGCCAGTCTTGAGGCA	0.542																																																	0													56.0	62.0	60.0					8																	32621790		2203	4300	6503	SO:0001583	missense	3084			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1793G>C	8.37:g.32621790G>C	ENSP00000384620:p.Ser598Thr	Somatic		WXS	SOLID	Phase_I	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087141	0.36855	.	.	ENSG00000157168	ENST00000519301;ENST00000523534;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000539990	T;T;T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12	5.95	5.08	0.68730	Neuregulin 1-related, C-terminal (1);	0.242622	0.48286	D	0.000188	T	0.56529	0.1991	L	0.40543	1.245	0.09310	N	0.999999	P;B;B;B;P;P;B	0.41450	0.583;0.246;0.29;0.013;0.75;0.453;0.246	B;B;P;B;P;P;B	0.48114	0.401;0.354;0.555;0.022;0.474;0.567;0.419	T	0.50750	-0.8791	9	.	.	.	-0.0746	12.3887	0.55347	0.1353:0.0:0.8647:0.0	.	441;569;603;606;595;598;603	B7Z1E3;F8W9E3;Q7RTW4;Q02297-2;Q02297-7;Q02297;Q02297-6	.;.;.;.;.;NRG1_HUMAN;.	T	548;671;606;603;598;569;595;598;441	ENSP00000429582:S548T;ENSP00000429067:S671T;ENSP00000343395:S606T;ENSP00000349275:S603T;ENSP00000287840:S598T;ENSP00000287845:S569T;ENSP00000287842:S595T;ENSP00000384620:S598T;ENSP00000439276:S441T	.	S	+	2	0	NRG1	32741332	0.984000	0.35163	0.444000	0.26895	0.969000	0.65631	1.988000	0.40697	1.532000	0.49169	0.563000	0.77884	AGT		0.542	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			
NXPH4	11247	hgsc.bcm.edu	37	12	57619000	57619000	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr12:57619000A>T	ENST00000349394.5	+	2	572	c.397A>T	c.(397-399)Aac>Tac	p.N133Y	NXPH4_ENST00000555154.1_3'UTR|Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	133	III.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						GGACCATGTGAACGGTACCTT	0.582																																																	0													79.0	62.0	67.0					12																	57619000		2203	4300	6503	SO:0001583	missense	11247			AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.397A>T	12.37:g.57619000A>T	ENSP00000333593:p.Asn133Tyr	Somatic		WXS	SOLID	Phase_I	A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	ENST00000349394.5	37	CCDS8933.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138000	0.77775	.	.	ENSG00000182379	ENST00000349394	.	.	.	3.97	3.97	0.46021	.	0.000000	0.53938	D	0.000060	T	0.76227	0.3958	M	0.71036	2.16	0.48185	D	0.999608	D	0.89917	1.0	D	0.91635	0.999	T	0.79329	-0.1848	9	0.87932	D	0	-12.8347	12.2539	0.54613	1.0:0.0:0.0:0.0	.	133	O95158	NXPH4_HUMAN	Y	133	.	ENSP00000333593:N133Y	N	+	1	0	NXPH4	55905267	1.000000	0.71417	0.997000	0.53966	0.899000	0.52679	8.761000	0.91691	1.794000	0.52575	0.379000	0.24179	AAC		0.582	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1		NM_007224	
OR10A3	26496	hgsc.bcm.edu;ucsc.edu	37	11	7960851	7960851	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr11:7960851A>C	ENST00000360759.3	-	1	290	c.217T>G	c.(217-219)Ttc>Gtc	p.F73V		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	73					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACTGCACTGAAACTCACCTCC	0.453																																																	0													133.0	119.0	123.0					11																	7960851		2201	4296	6497	SO:0001583	missense	26496			BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.217T>G	11.37:g.7960851A>C	ENSP00000353988:p.Phe73Val	Somatic		WXS	SOLID	Phase_I	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	37	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	A	10.77	1.442821	0.25987	.	.	ENSG00000170683	ENST00000360759	T	0.00380	7.64	4.95	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.163850	0.28093	U	0.016628	T	0.00300	0.0009	L	0.48935	1.535	0.19300	N	0.999978	B	0.25105	0.118	B	0.21546	0.035	T	0.43065	-0.9414	10	0.87932	D	0	.	9.5207	0.39133	0.842:0.0:0.0:0.1579	.	73	P58181	O10A3_HUMAN	V	73	ENSP00000353988:F73V	ENSP00000353988:F73V	F	-	1	0	OR10A3	7917427	0.001000	0.12720	0.998000	0.56505	0.496000	0.33645	1.610000	0.36869	1.006000	0.39211	0.528000	0.53228	TTC		0.453	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1		NM_001003745	
OR4F4	26682	hgsc.bcm.edu	37	15	102463219	102463219	+	Missense_Mutation	SNP	T	T	C	rs201977833	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr15:102463219T>C	ENST00000326183.3	-	1	79	c.44A>G	c.(43-45)gAa>gGa	p.E15G		NM_001004195.2	NP_001004195.2	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F, member 4	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GGTCTGGAGTTCCTGAGAATC	0.393																																																	0													2.0	2.0	2.0					15																	102463219		806	2287	3093	SO:0001583	missense	26682				CCDS32343.1	15q26.3	2012-08-09			ENSG00000177693	ENSG00000177693		"""GPCR / Class A : Olfactory receptors"""	8301	protein-coding gene	gene with protein product							Standard	NM_001004195		Approved	OR4F18	uc002cdf.1	Q96R69		ENST00000326183.3:c.44A>G	15.37:g.102463219T>C	ENSP00000317482:p.Glu15Gly	Somatic		WXS	SOLID	Phase_I	B2RNI5|Q6IFN9	Missense_Mutation	SNP	ENST00000326183.3	37	CCDS32343.1	.	.	.	.	.	.	.	.	.	.	.	9.547	1.114859	0.20795	.	.	ENSG00000177693	ENST00000326183	T	0.00444	7.4	2.97	1.79	0.24919	.	0.481469	0.15411	N	0.263780	T	0.00384	0.0012	M	0.67517	2.055	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36648	-0.9739	9	.	.	.	.	7.6019	0.28081	0.0:0.0:0.2171:0.7829	.	15	Q96R69	OR4F4_HUMAN	G	15	ENSP00000317482:E15G	.	E	-	2	0	OR4F4	100280742	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.479000	0.22228	0.500000	0.27991	0.392000	0.25879	GAA		0.393	OR4F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417599.1		NM_001004195	
PAN2	9924	hgsc.bcm.edu	37	12	56720445	56720445	+	Silent	SNP	T	T	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr12:56720445T>C	ENST00000425394.2	-	7	1594	c.1218A>G	c.(1216-1218)acA>acG	p.T406T	PAN2_ENST00000440411.3_Silent_p.T406T|PAN2_ENST00000257931.5_Silent_p.T406T|PAN2_ENST00000548043.1_Silent_p.T406T	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CAGAGAGAAGTGTGTCAGTGG	0.587																																																	0													60.0	53.0	55.0					12																	56720445		2203	4299	6502	SO:0001819	synonymous_variant	9924			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1218A>G	12.37:g.56720445T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000425394.2	37	CCDS44922.1																																																																																				0.587	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1		NM_014871	
PCIF1	63935	hgsc.bcm.edu	37	20	44572023	44572023	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr20:44572023T>A	ENST00000372409.3	+	9	1230	c.866T>A	c.(865-867)tTt>tAt	p.F289Y		NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	289					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						CGCCTGCTCTTTAAATATGCG	0.552																																																	0													39.0	44.0	42.0					20																	44572023		2203	4300	6503	SO:0001583	missense	63935			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.866T>A	20.37:g.44572023T>A	ENSP00000361486:p.Phe289Tyr	Somatic		WXS	SOLID	Phase_I	E1P5P1|Q54AB9|Q9NT85	Missense_Mutation	SNP	ENST00000372409.3	37	CCDS13388.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.745704	0.89663	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	T	0.43294	0.95	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	L	0.54323	1.7	0.58432	D	0.999998	D	0.65815	0.995	P	0.55615	0.78	T	0.44742	-0.9308	10	0.05620	T	0.96	-13.192	14.0642	0.64819	0.0:0.0:0.0:1.0	.	289	Q9H4Z3	PCIF1_HUMAN	Y	289	ENSP00000361486:F289Y	ENSP00000361486:F289Y	F	+	2	0	PCIF1	44005430	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.868000	0.87116	2.107000	0.64212	0.533000	0.62120	TTT		0.552	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1		NM_022104	
PDPR	55066	hgsc.bcm.edu	37	16	70154480	70154480	+	Missense_Mutation	SNP	A	A	G	rs587776506|rs200469748	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr16:70154480A>G	ENST00000288050.4	+	3	1042	c.85A>G	c.(85-87)Acg>Gcg	p.T29A	PDPR_ENST00000568530.1_Missense_Mutation_p.T29A|PDPR_ENST00000398122.3_Intron	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	29				T -> A (in Ref. 3; CAH10555). {ECO:0000305}.	cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.T29A(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		AAGAAACAGCACGTCAGCTGC	0.572																																																	1	Substitution - Missense(1)	central_nervous_system(1)											51.0	53.0	52.0					16																	70154480		2117	4237	6354	SO:0001583	missense	55066				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.85A>G	16.37:g.70154480A>G	ENSP00000288050:p.Thr29Ala	Somatic		WXS	SOLID	Phase_I	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	G	1.592	-0.528814	0.04112	.	.	ENSG00000090857	ENST00000288050	T	0.69435	-0.4	4.13	-5.16	0.02857	.	1.037440	0.07658	N	0.933150	T	0.37320	0.0999	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.34378	-0.9831	10	0.06494	T	0.89	.	5.1635	0.15073	0.443:0.0:0.2448:0.3121	.	29	Q8NCN5	PDPR_HUMAN	A	29	ENSP00000288050:T29A	ENSP00000288050:T29A	T	+	1	0	PDPR	68711981	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.944000	0.03913	-0.959000	0.03618	-0.318000	0.08688	ACG		0.572	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1		NM_017990	
PDPR	55066	hgsc.bcm.edu	37	16	70172890	70172890	+	Missense_Mutation	SNP	C	C	T	rs112617700		TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr16:70172890C>T	ENST00000288050.4	+	11	2236	c.1279C>T	c.(1279-1281)Cgc>Tgc	p.R427C	PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000568530.1_Missense_Mutation_p.R427C|PDPR_ENST00000398122.3_Missense_Mutation_p.R327C	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	427					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.R427C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCAGAGCAGCCGCACCTTTCT	0.512																																																	1	Substitution - Missense(1)	stomach(1)											20.0	21.0	21.0					16																	70172890		1801	4043	5844	SO:0001583	missense	55066				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1279C>T	16.37:g.70172890C>T	ENSP00000288050:p.Arg427Cys	Somatic		WXS	SOLID	Phase_I	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	CCDS45520.1	287	0.13141025641025642	69	0.1402439024390244	43	0.11878453038674033	51	0.08916083916083917	124	0.16358839050131926	C	29.1	4.978510	0.92982	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055	D;D	0.85773	-2.03;-2.03	4.42	4.42	0.53409	.	0.119515	0.64402	D	0.000017	T	0.03136	0.0092	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	1.0;0.998	P;P	0.56216	0.794;0.676	T	0.26087	-1.0113	10	0.72032	D	0.01	.	16.0044	0.80349	0.0:1.0:0.0:0.0	.	155;427	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	C	427;327;155	ENSP00000288050:R427C;ENSP00000381190:R327C	ENSP00000205055:R155C	R	+	1	0	PDPR	68730391	1.000000	0.71417	0.996000	0.52242	0.954000	0.61252	7.645000	0.83430	1.985000	0.57927	0.455000	0.32223	CGC		0.512	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1		NM_017990	
PLA2G4B	100137049	hgsc.bcm.edu;ucsc.edu	37	15	42133008	42133008	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr15:42133008G>A	ENST00000452633.1	+	5	608	c.256G>A	c.(256-258)Gtg>Atg	p.V86M	JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.V317M|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.V317M|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.V317M|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.V86M			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	86	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		CCAGGACCTGGTGACCGGAGA	0.592																																																	0													112.0	101.0	105.0					15																	42133008		2203	4300	6503	SO:0001583	missense	100137049			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.256G>A	15.37:g.42133008G>A	ENSP00000396045:p.Val86Met	Somatic		WXS	SOLID	Phase_I	B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000452633.1	37	CCDS45241.1	.	.	.	.	.	.	.	.	.	.	.	7.424	0.637270	0.14386	.	.	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.10382	2.88;2.88;2.88;2.88	5.04	-10.1	0.00402	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.832329	0.10229	N	0.699938	T	0.07863	0.0197	L	0.60904	1.88	0.09310	N	1	B;B;B	0.26363	0.147;0.001;0.001	B;B;B	0.30105	0.111;0.002;0.002	T	0.30327	-0.9982	10	0.66056	D	0.02	-15.3008	1.8476	0.03162	0.2148:0.1015:0.2376:0.4461	.	86;317;317	P0C869;P0C869-7;P0C869-6	PA24B_HUMAN;.;.	M	317;317;86;86	ENSP00000371886:V317M;ENSP00000342785:V317M;ENSP00000416610:V86M;ENSP00000396045:V86M	ENSP00000342785:V317M	V	+	1	0	JMJD7-PLA2G4B;PLA2G4B	39920300	0.000000	0.05858	0.196000	0.23383	0.055000	0.15305	-3.278000	0.00529	-2.048000	0.00907	-1.053000	0.02334	GTG		0.592	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345969.1		NM_001114633	
POTED	317754	hgsc.bcm.edu	37	21	14987721	14987721	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr21:14987721A>G	ENST00000299443.5	+	3	692	c.640A>G	c.(640-642)Ata>Gta	p.I214V		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	214						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						CTGACAGGCCATACAATGCCA	0.368																																																	0													0.0	0.0	0.0					21																	14987721		0	0	0	SO:0001583	missense	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.640A>G	21.37:g.14987721A>G	ENSP00000299443:p.Ile214Val	Somatic		WXS	SOLID	Phase_I	C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	a	0.007	-1.941151	0.00479	.	.	ENSG00000166351	ENST00000299443	T	0.61980	0.06	1.4	-0.257	0.12979	Ankyrin repeat-containing domain (4);	0.710225	0.12028	N	0.506284	T	0.25901	0.0631	N	0.02379	-0.575	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.24835	-1.0149	10	0.02654	T	1	.	4.8079	0.13329	0.5201:0.0:0.4799:0.0	rs2606005;rs4816795	214	Q86YR6	POTED_HUMAN	V	214	ENSP00000299443:I214V	ENSP00000299443:I214V	I	+	1	0	POTED	13909592	0.070000	0.21116	0.053000	0.19242	0.176000	0.22953	0.073000	0.14640	-0.544000	0.06232	-1.160000	0.01791	ATA		0.368	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1		NM_174981	
PPP4C	5531	hgsc.bcm.edu	37	16	30096007	30096007	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr16:30096007A>G	ENST00000279387.7	+	8	793	c.625A>G	c.(625-627)Agc>Ggc	p.S209G	PPP4C_ENST00000561610.1_Missense_Mutation_p.S209G	NM_002720.1	NP_002711.1	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit	209					dephosphorylation (GO:0016311)|NIK/NF-kappaB signaling (GO:0038061)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase 4 complex (GO:0030289)	metal ion binding (GO:0046872)|NF-kappaB-inducing kinase activity (GO:0004704)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(2)|pancreas(1)|skin(1)|urinary_tract(1)	9						CTGGGGCGTGAGCCCCCGAGG	0.617																																																	0													72.0	78.0	76.0					16																	30096007		2197	4300	6497	SO:0001583	missense	5531				CCDS10669.1	16p11.2	2010-03-17	2010-03-05		ENSG00000149923	ENSG00000149923	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9319	protein-coding gene	gene with protein product	"""protein phosphatase X, catalytic subunit"""	602035	"""protein phosphatase 4 (formerly X), catalytic subunit"""			9177794	Standard	NM_002720		Approved	PP4, PPX	uc002dwf.3	P60510	OTTHUMG00000132113	ENST00000279387.7:c.625A>G	16.37:g.30096007A>G	ENSP00000279387:p.Ser209Gly	Somatic		WXS	SOLID	Phase_I	P33172	Missense_Mutation	SNP	ENST00000279387.7	37	CCDS10669.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.755274	0.69648	.	.	ENSG00000149923	ENST00000279387	T	0.68479	-0.33	5.79	4.71	0.59529	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	0.077757	0.85682	D	0.000000	D	0.89646	0.6775	H	0.99800	4.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91836	0.5479	10	0.87932	D	0	-10.033	11.1182	0.48273	0.9266:0.0:0.0734:0.0	.	209	P60510	PP4C_HUMAN	G	209	ENSP00000279387:S209G	ENSP00000279387:S209G	S	+	1	0	PPP4C	30003508	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	3.748000	0.55142	1.025000	0.39708	-0.375000	0.07067	AGC		0.617	PPP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255155.2		NM_002720	
PRDM4	11108	hgsc.bcm.edu	37	12	108147767	108147767	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr12:108147767T>G	ENST00000228437.5	-	4	724	c.265A>C	c.(265-267)Aac>Cac	p.N89H	RP11-864J10.4_ENST00000546714.1_RNA|PRDM4_ENST00000547268.1_5'Flank	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	89					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						AGGGTGTAGTTTCTTTCAGGT	0.478																																																	0													130.0	117.0	121.0					12																	108147767		2203	4300	6503	SO:0001583	missense	11108			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.265A>C	12.37:g.108147767T>G	ENSP00000228437:p.Asn89His	Somatic		WXS	SOLID	Phase_I	Q9UFA6	Missense_Mutation	SNP	ENST00000228437.5	37	CCDS9115.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.003664	0.93287	.	.	ENSG00000110851	ENST00000228437	T	0.15834	2.39	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.30727	0.0774	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.05716	-1.0868	10	0.87932	D	0	-28.3563	16.192	0.81996	0.0:0.0:0.0:1.0	.	89	Q9UKN5	PRDM4_HUMAN	H	89	ENSP00000228437:N89H	ENSP00000228437:N89H	N	-	1	0	PRDM4	106671897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.795000	0.85887	2.229000	0.72834	0.482000	0.46254	AAC		0.478	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1		NM_012406	
PTPN23	25930	hgsc.bcm.edu	37	3	47449932	47449932	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr3:47449932C>A	ENST00000265562.4	+	15	1359	c.1282C>A	c.(1282-1284)Ctc>Atc	p.L428I	PTPN23_ENST00000431726.1_Missense_Mutation_p.L302I	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	428					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTGCGCGGCTCTCAGCGTCCG	0.577																																																	0													95.0	81.0	85.0					3																	47449932		2203	4300	6503	SO:0001583	missense	25930			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1282C>A	3.37:g.47449932C>A	ENSP00000265562:p.Leu428Ile	Somatic		WXS	SOLID	Phase_I	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981630	0.74474	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.29917	1.55	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	M	0.74647	2.275	0.80722	D	1	B;D	0.71674	0.079;0.998	B;D	0.67548	0.408;0.952	T	0.60571	-0.7237	10	0.66056	D	0.02	-30.3846	15.8363	0.78799	0.0:1.0:0.0:0.0	.	302;428	B4DST5;Q9H3S7	.;PTN23_HUMAN	I	393;428	ENSP00000265562:L428I	ENSP00000265562:L428I	L	+	1	0	PTPN23	47424936	1.000000	0.71417	0.970000	0.41538	0.295000	0.27426	7.567000	0.82357	2.274000	0.75844	0.557000	0.71058	CTC		0.577	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2		NM_015466	
PWWP2A	114825	hgsc.bcm.edu	37	5	159520688	159520688	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr5:159520688A>T	ENST00000307063.7	-	2	1003	c.969T>A	c.(967-969)gaT>gaA	p.D323E	PWWP2A_ENST00000456329.3_Missense_Mutation_p.D323E|PWWP2A_ENST00000523662.1_Missense_Mutation_p.D323E	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	323										kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTTTACATTTATCACACAGAA	0.353																																																	0													123.0	109.0	114.0					5																	159520688		1830	4095	5925	SO:0001583	missense	114825				CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.969T>A	5.37:g.159520688A>T	ENSP00000305151:p.Asp323Glu	Somatic		WXS	SOLID	Phase_I	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	ENST00000307063.7	37	CCDS47332.1	.	.	.	.	.	.	.	.	.	.	A	7.608	0.674192	0.14841	.	.	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.38401	1.14;1.14;1.14	5.27	1.07	0.20283	.	0.098794	0.64402	D	0.000002	T	0.20941	0.0504	N	0.11673	0.155	0.48632	D	0.999682	D;P;P	0.56521	0.976;0.884;0.884	P;B;B	0.49085	0.6;0.292;0.292	T	0.03717	-1.1010	10	0.10636	T	0.68	-14.8781	9.6014	0.39607	0.344:0.0:0.656:0.0	.	323;323;323	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	E	323	ENSP00000390462:D323E;ENSP00000428143:D323E;ENSP00000305151:D323E	ENSP00000305151:D323E	D	-	3	2	PWWP2A	159453266	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	1.281000	0.33214	0.217000	0.20800	-0.371000	0.07208	GAT		0.353	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1			
RGS9	8787	hgsc.bcm.edu	37	17	63221255	63221255	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr17:63221255C>T	ENST00000262406.9	+	18	1610	c.1543C>T	c.(1543-1545)Cgg>Tgg	p.R515W	RGS9_ENST00000449996.3_Missense_Mutation_p.R512W|RGS9_ENST00000443584.3_Missense_Mutation_p.R512W	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	515					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CCGCTTCATCCGGCGACCCAG	0.662																																																	0													92.0	110.0	104.0					17																	63221255		2071	4212	6283	SO:0001583	missense	8787			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1543C>T	17.37:g.63221255C>T	ENSP00000262406:p.Arg515Trp	Somatic		WXS	SOLID	Phase_I	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067180	0.55539	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.32988	1.43;1.43	3.91	-1.38	0.09027	.	0.303719	0.23598	N	0.046463	T	0.29684	0.0741	L	0.51422	1.61	0.22185	N	0.999301	D;D;D	0.63880	0.993;0.983;0.99	P;B;P	0.50352	0.638;0.424;0.627	T	0.16630	-1.0396	10	0.56958	D	0.05	.	6.4721	0.22013	0.522:0.3071:0.1709:0.0	.	515;515;512	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	W	515;512	ENSP00000262406:R515W;ENSP00000396329:R512W	ENSP00000262406:R515W	R	+	1	2	RGS9	60651717	0.017000	0.18338	0.944000	0.38274	0.898000	0.52572	0.020000	0.13466	0.015000	0.14971	0.561000	0.74099	CGG		0.662	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1		NM_003835	
RIMS1	22999	hgsc.bcm.edu	37	6	73000565	73000565	+	Splice_Site	SNP	G	G	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr6:73000565G>A	ENST00000521978.1	+	25	3737		c.e25+1		RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000517960.1_Intron|RIMS1_ENST00000401910.3_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000491071.2_Intron|RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000264839.7_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TTCTGACAAGGTCGCTATTCA	0.537																																																	0													64.0	66.0	65.0					6																	73000565		2132	4242	6374	SO:0001630	splice_region_variant	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3737+1G>A	6.37:g.73000565G>A		Somatic		WXS	SOLID	Phase_I	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Splice_Site	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154260	0.78114	.	.	ENSG00000079841	ENST00000521978	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.403	0.87465	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIMS1	73057286	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.645000	0.74343	2.640000	0.89533	0.563000	0.77884	.		0.537	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			Intron
RLIM	51132	hgsc.bcm.edu	37	X	73811648	73811648	+	Missense_Mutation	SNP	G	G	A	rs200629905		TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:73811648G>A	ENST00000332687.6	-	4	1720	c.1502C>T	c.(1501-1503)tCa>tTa	p.S501L	RLIM_ENST00000349225.2_Missense_Mutation_p.S501L	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	501	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S501L(3)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCTGATGATGAGCTTCCTTC	0.488																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)												3	Substitution - Missense(3)	prostate(2)|ovary(1)											45.0	38.0	40.0					X																	73811648		2203	4300	6503	SO:0001583	missense	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1502C>T	X.37:g.73811648G>A	ENSP00000328059:p.Ser501Leu	Somatic		WXS	SOLID	Phase_I	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	G	7.117	0.577275	0.13686	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.08984	3.03;3.03	5.41	4.55	0.56014	.	0.666655	0.15400	N	0.264373	T	0.10121	0.0248	L	0.49126	1.545	0.38573	D	0.949983	B	0.02656	0.0	B	0.01281	0.0	T	0.08764	-1.0706	10	0.23891	T	0.37	-0.2985	13.4694	0.61273	0.0772:0.0:0.9228:0.0	.	501	Q9NVW2	RNF12_HUMAN	L	501	ENSP00000328059:S501L;ENSP00000253571:S501L	ENSP00000328059:S501L	S	-	2	0	RLIM	73728373	0.997000	0.39634	0.969000	0.41365	0.831000	0.47069	2.664000	0.46783	1.072000	0.40860	-0.192000	0.12808	TCA		0.488	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1		NM_016120	
SAP30	8819	hgsc.bcm.edu	37	4	174292632	174292632	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr4:174292632T>C	ENST00000296504.3	+	1	539	c.299T>C	c.(298-300)aTc>aCc	p.I100T	RP11-798M19.6_ENST00000608794.1_RNA|RP11-798M19.6_ENST00000609153.1_RNA|RP11-798M19.6_ENST00000609900.1_RNA|RP11-798M19.6_ENST00000608892.1_RNA	NM_003864.3	NP_003855.1			Sin3A-associated protein, 30kDa											large_intestine(1)|lung(2)|ovary(1)	4		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		AAGGTGAAGATCGAGCTGGAT	0.672																																																	0													31.0	30.0	30.0					4																	174292632		2188	4276	6464	SO:0001583	missense	8819			AF055993	CCDS3817.1	4q34.1	2008-02-05	2006-02-02		ENSG00000164105	ENSG00000164105			10532	protein-coding gene	gene with protein product		603378	"""sin3A-associated protein, 30kDa"""			9651585	Standard	NM_003864		Approved		uc003itd.3	O75446	OTTHUMG00000160798	ENST00000296504.3:c.299T>C	4.37:g.174292632T>C	ENSP00000296504:p.Ile100Thr	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000296504.3	37	CCDS3817.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431197	0.83776	.	.	ENSG00000164105	ENST00000296504	.	.	.	4.24	3.02	0.34903	.	0.189823	0.35291	N	0.003315	T	0.49047	0.1534	L	0.38175	1.15	0.51233	D	0.999916	P	0.47841	0.901	P	0.49421	0.61	T	0.47935	-0.9078	9	0.87932	D	0	-24.6958	9.5964	0.39576	0.1571:0.0:0.0:0.8429	.	100	O75446	SAP30_HUMAN	T	100	.	ENSP00000296504:I100T	I	+	2	0	SAP30	174529207	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.369000	0.79578	0.479000	0.27511	0.379000	0.24179	ATC		0.672	SAP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362360.1		NM_003864	
SCG3	29106	hgsc.bcm.edu	37	15	51975597	51975597	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr15:51975597C>A	ENST00000220478.3	+	4	766	c.363C>A	c.(361-363)gaC>gaA	p.D121E	SCG3_ENST00000542355.2_5'UTR	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	121					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		ATGATTATGACTCTACTAAGA	0.333																																																	0													99.0	105.0	102.0					15																	51975597		2194	4292	6486	SO:0001583	missense	29106			AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.363C>A	15.37:g.51975597C>A	ENSP00000220478:p.Asp121Glu	Somatic		WXS	SOLID	Phase_I	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	ENST00000220478.3	37	CCDS10142.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177644	0.78564	.	.	ENSG00000104112	ENST00000220478	T	0.36699	1.24	6.07	-3.47	0.04753	.	0.090654	0.85682	D	0.000000	T	0.33381	0.0861	L	0.34521	1.04	0.80722	D	1	D	0.57571	0.98	P	0.54856	0.762	T	0.17992	-1.0351	10	0.87932	D	0	-9.7195	9.368	0.38237	0.1297:0.5874:0.0:0.2829	.	121	Q8WXD2	SCG3_HUMAN	E	121	ENSP00000220478:D121E	ENSP00000220478:D121E	D	+	3	2	SCG3	49762889	1.000000	0.71417	0.975000	0.42487	0.981000	0.71138	0.881000	0.28173	-0.637000	0.05516	-0.238000	0.12139	GAC		0.333	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2		NM_013243	
PNISR	25957	hgsc.bcm.edu	37	6	99848473	99848473	+	Silent	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr6:99848473A>T	ENST00000369239.5	-	12	2565	c.2361T>A	c.(2359-2361)tcT>tcA	p.S787S	PNISR_ENST00000438806.1_Silent_p.S787S	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	787	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						CAGACCTTTGAGATTTCTCCA	0.398																																																	0													189.0	190.0	190.0					6																	99848473		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.2361T>A	6.37:g.99848473A>T		Somatic		WXS	SOLID	Phase_I	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Silent	SNP	ENST00000369239.5	37	CCDS5043.1																																																																																				0.398	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1		NM_032870	
SHMT2	6472	hgsc.bcm.edu;ucsc.edu	37	12	57625269	57625269	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr12:57625269C>A	ENST00000328923.3	+	3	689	c.237C>A	c.(235-237)ttC>ttA	p.F79L	SHMT2_ENST00000557487.1_Missense_Mutation_p.F79L|SHMT2_ENST00000414700.3_Missense_Mutation_p.F58L|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000553474.1_Missense_Mutation_p.F58L|SHMT2_ENST00000449049.3_Missense_Mutation_p.F58L|SHMT2_ENST00000393827.4_Intron	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	79					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	CCCAGAACTTCTGCAGCCGAG	0.622																																					Esophageal Squamous(150;1369 2416 49071 49364)												0													42.0	43.0	42.0					12																	57625269		2203	4300	6503	SO:0001583	missense	6472			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.237C>A	12.37:g.57625269C>A	ENSP00000333667:p.Phe79Leu	Somatic		WXS	SOLID	Phase_I	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387402	0.82902	.	.	ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000556689;ENST00000414700;ENST00000557703;ENST00000553529;ENST00000554310;ENST00000557427;ENST00000553474;ENST00000555773;ENST00000554975;ENST00000449049;ENST00000556737	T;T;T;T;T;T;T;T;T;T;T;T;T	0.44881	1.45;0.91;0.91;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45	4.49	3.6	0.41247	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	T	0.65335	-0.6193	10	0.72032	D	0.01	.	9.0184	0.36184	0.0:0.8188:0.0:0.1812	.	79;79	Q8N1A5;P34897	.;GLYM_HUMAN	L	79;79;79;58;58;58;58;58;58;58;58;58;58	ENSP00000333667:F79L;ENSP00000452315:F79L;ENSP00000452035:F79L;ENSP00000406881:F58L;ENSP00000450452:F58L;ENSP00000452161:F58L;ENSP00000450893:F58L;ENSP00000452045:F58L;ENSP00000452419:F58L;ENSP00000451968:F58L;ENSP00000452404:F58L;ENSP00000413770:F58L;ENSP00000451495:F58L	ENSP00000333667:F79L	F	+	3	2	SHMT2	55911536	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.956000	0.29202	1.263000	0.44181	0.561000	0.74099	TTC		0.622	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2		NM_005412	
SIAE	54414	hgsc.bcm.edu;ucsc.edu	37	11	124509622	124509622	+	Missense_Mutation	SNP	C	C	A	rs146397917	byFrequency	TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr11:124509622C>A	ENST00000263593.3	-	8	1280	c.1108G>T	c.(1108-1110)Gac>Tac	p.D370Y	SIAE_ENST00000545756.1_Missense_Mutation_p.D335Y			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	370					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		AAAGGCGAGTCTCTATCACAG	0.473																																																	0													180.0	150.0	160.0					11																	124509622		2201	4299	6500	SO:0001583	missense	54414			AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.1108G>T	11.37:g.124509622C>A	ENSP00000263593:p.Asp370Tyr	Somatic		WXS	SOLID	Phase_I	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	ENST00000263593.3	37	CCDS8449.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588355	0.46110	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	D;D	0.94897	-3.55;-3.55	5.92	-1.39	0.08997	Esterase, SGNH hydrolase-type (1);	0.723646	0.13808	N	0.361286	D	0.90573	0.7045	L	0.31120	0.905	0.09310	N	1	P	0.41597	0.756	P	0.45681	0.49	T	0.83334	-0.0011	10	0.37606	T	0.19	-20.9485	11.5006	0.50435	0.0:0.4272:0.0:0.5728	.	370	Q9HAT2	SIAE_HUMAN	Y	370;335	ENSP00000263593:D370Y;ENSP00000437877:D335Y	ENSP00000263593:D370Y	D	-	1	0	SIAE	124014832	0.000000	0.05858	0.002000	0.10522	0.648000	0.38561	-0.186000	0.09670	-0.169000	0.10834	0.650000	0.86243	GAC		0.473	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387070.1		NM_170601	
SMARCA4	6597	hgsc.bcm.edu	37	19	11144113	11144113	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr19:11144113G>T	ENST00000429416.3	+	27	3975	c.3694G>T	c.(3694-3696)Ggc>Tgc	p.G1232C	SMARCA4_ENST00000589677.1_Missense_Mutation_p.G1232C|SMARCA4_ENST00000538456.3_3'UTR|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G1232C|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G1232C|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G1232C|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G1232C|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G1232C|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G1232C|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G1232C	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1232	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G1232S(5)|p.G1232C(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GATCCAGGCCGGCATGTTCGA	0.637			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	7	Substitution - Missense(6)|Unknown(1)	lung(3)|endometrium(2)|central_nervous_system(2)											118.0	114.0	115.0					19																	11144113		2203	4300	6503	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3694G>T	19.37:g.11144113G>T	ENSP00000395654:p.Gly1232Cys	Somatic		WXS	SOLID	Phase_I	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.053424|4.053424	0.75960|0.75960	.|.	.|.	ENSG00000127616|ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806|ENST00000538456	T;T;T;D;D;D;D|.	0.95656|.	-1.08;-1.08;-1.08;-3.77;-3.77;-3.77;-3.77|.	4.74|4.74	4.74|4.74	0.60224|0.60224	Helicase, C-terminal (1);|.	0.120502|.	0.56097|.	D|.	0.000034|.	D|D	0.87497|0.87497	0.6192|0.6192	H|H	0.95850|0.95850	3.73|3.73	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.998;1.0;1.0;0.999|.	D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;0.99;0.998;1.0;0.993|.	D|D	0.91547|0.91547	0.5254|0.5254	10|5	0.87932|.	D|.	0|.	-28.4816|-28.4816	16.7067|16.7067	0.85374|0.85374	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1232;1232;1232;1232;1232;452;1232|.	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532|.	.;.;.;.;.;.;SMCA4_HUMAN|.	C|L	1232;1232;1296;1232;1232;1232;1232;1232|1	ENSP00000395654:G1232C;ENSP00000350720:G1232C;ENSP00000343896:G1232C;ENSP00000445036:G1232C;ENSP00000392837:G1232C;ENSP00000397783:G1232C;ENSP00000414727:G1232C|.	ENSP00000343896:G1232C|.	G|R	+|+	1|2	0|0	SMARCA4|SMARCA4	11005113|11005113	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.976000|0.976000	0.68499|0.68499	9.264000|9.264000	0.95635|0.95635	2.488000|2.488000	0.83962|0.83962	0.558000|0.558000	0.71614|0.71614	GGC|CGG		0.637	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2		NM_003072	
SSFA2	6744	hgsc.bcm.edu	37	2	182765606	182765606	+	Silent	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr2:182765606A>T	ENST00000431877.2	+	7	866	c.687A>T	c.(685-687)gtA>gtT	p.V229V	SSFA2_ENST00000409001.1_Silent_p.V229V|SSFA2_ENST00000428267.2_Silent_p.V76V|SSFA2_ENST00000320370.7_Silent_p.V229V	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	229						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V229V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GGATGGAAGTAGAAAACCCAA	0.303																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											51.0	53.0	52.0					2																	182765606		2203	4298	6501	SO:0001819	synonymous_variant	6744			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.687A>T	2.37:g.182765606A>T		Somatic		WXS	SOLID	Phase_I	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Silent	SNP	ENST00000431877.2	37	CCDS46467.1																																																																																				0.303	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2		NM_006751	
SSPO	23145	hgsc.bcm.edu	37	7	149516805	149516805	+	RNA	SNP	G	G	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr7:149516805G>A	ENST00000378016.2	+	0	12007							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTTTCCCACAGTGCCCGGGGG	0.667																																																	0													10.0	12.0	11.0					7																	149516805		1593	3529	5122			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149516805G>A		Somatic		WXS	SOLID	Phase_I	Q76B61	Splice_Site	SNP	ENST00000378016.2	37																																																																																					0.667	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				
STAT5B	6777	hgsc.bcm.edu	37	17	40375493	40375493	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr17:40375493G>C	ENST00000293328.3	-	5	625	c.457C>G	c.(457-459)Ctg>Gtg	p.L153V		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	153					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TGCGTGACCAGTCGCAGCTCC	0.542																																																	0													101.0	88.0	93.0					17																	40375493		2203	4300	6503	SO:0001583	missense	6777			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.457C>G	17.37:g.40375493G>C	ENSP00000293328:p.Leu153Val	Somatic		WXS	SOLID	Phase_I	Q8WWS8	Missense_Mutation	SNP	ENST00000293328.3	37	CCDS11423.1	.	.	.	.	.	.	.	.	.	.	G	5.222	0.226538	0.09916	.	.	ENSG00000173757	ENST00000293328;ENST00000415845	T;T	0.58652	0.32;1.12	5.15	5.15	0.70609	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.144011	0.48767	D	0.000171	T	0.35856	0.0946	N	0.13043	0.29	0.30377	N	0.782283	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.21109	-1.0255	10	0.19590	T	0.45	-14.6112	8.9005	0.35493	0.078:0.151:0.771:0.0	.	153;153	Q8WW55;P51692	.;STA5B_HUMAN	V	153	ENSP00000293328:L153V;ENSP00000398379:L153V	ENSP00000293328:L153V	L	-	1	2	STAT5B	37629019	0.994000	0.37717	0.996000	0.52242	0.998000	0.95712	2.220000	0.42908	2.667000	0.90743	0.561000	0.74099	CTG		0.542	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1		NM_012448	
TCEAL3	85012	hgsc.bcm.edu;ucsc.edu	37	X	102864442	102864442	+	Silent	SNP	A	A	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:102864442A>G	ENST00000372628.1	+	3	808	c.450A>G	c.(448-450)caA>caG	p.Q150Q	TCEAL3_ENST00000243286.3_Silent_p.Q150Q|TCEAL3_ENST00000477014.1_Intron|TCEAL3_ENST00000372627.5_Silent_p.Q150Q			Q969E4	TCAL3_HUMAN	transcription elongation factor A (SII)-like 3	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q150Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	16						CAAGGGCTCAAGAGGAGCTAA	0.512																																																	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)											293.0	254.0	267.0					X																	102864442		2203	4300	6503	SO:0001819	synonymous_variant	85012			BC008703	CCDS14511.1	Xq22.2	2014-03-21			ENSG00000196507	ENSG00000196507			28247	protein-coding gene	gene with protein product						16221301	Standard	NM_032926		Approved	MGC15737, WEX8	uc004ekr.3	Q969E4	OTTHUMG00000022106	ENST00000372628.1:c.450A>G	X.37:g.102864442A>G		Somatic		WXS	SOLID	Phase_I	D3DXA4	Silent	SNP	ENST00000372628.1	37	CCDS14511.1																																																																																				0.512	TCEAL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057737.1		NM_032926	
UBA2	10054	hgsc.bcm.edu	37	19	34935995	34935995	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr19:34935995C>A	ENST00000246548.4	+	8	810	c.740C>A	c.(739-741)aCt>aAt	p.T247N	UBA2_ENST00000439527.2_Missense_Mutation_p.T151N	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	247					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GCTAAATCAACTGGATATGAT	0.358																																																	0													93.0	92.0	92.0					19																	34935995		2203	4300	6503	SO:0001583	missense	10054			BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.740C>A	19.37:g.34935995C>A	ENSP00000246548:p.Thr247Asn	Somatic		WXS	SOLID	Phase_I	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	37	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866638	0.51588	.	.	ENSG00000126261	ENST00000542624;ENST00000246548;ENST00000439527	T;T	0.58652	0.32;1.5	5.5	5.5	0.81552	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.043912	0.85682	D	0.000000	T	0.47911	0.1471	L	0.29908	0.895	0.58432	D	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.31336	-0.9947	10	0.25106	T	0.35	-22.2949	18.524	0.90965	0.0:1.0:0.0:0.0	.	247	Q9UBT2	SAE2_HUMAN	N	120;247;151	ENSP00000246548:T247N;ENSP00000437484:T151N	ENSP00000246548:T247N	T	+	2	0	UBA2	39627835	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.222000	0.65277	2.736000	0.93811	0.591000	0.81541	ACT		0.358	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3		NM_005499	
WDR13	64743	hgsc.bcm.edu	37	X	48458031	48458031	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chrX:48458031G>T	ENST00000218056.5	+	4	954	c.449G>T	c.(448-450)gGg>gTg	p.G150V	WDR13_ENST00000376729.5_Missense_Mutation_p.G150V|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	150						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GCCATGGCCGGGGACACGTCA	0.612																																																	0													100.0	83.0	89.0					X																	48458031		2203	4300	6503	SO:0001583	missense	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.449G>T	X.37:g.48458031G>T	ENSP00000218056:p.Gly150Val	Somatic		WXS	SOLID	Phase_I	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	ENST00000218056.5	37	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	G	32	5.119260	0.94385	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.72394	-0.65;-0.65	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.79516	0.4459	L	0.58101	1.795	0.80722	D	1	D;P	0.64830	0.994;0.822	P;P	0.60949	0.881;0.534	T	0.79909	-0.1604	10	0.48119	T	0.1	-20.0815	15.6128	0.76740	0.0:0.0:1.0:0.0	.	28;150	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	V	150	ENSP00000365919:G150V;ENSP00000218056:G150V	ENSP00000218056:G150V	G	+	2	0	WDR13	48342975	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	8.609000	0.90898	2.281000	0.76405	0.529000	0.55759	GGG		0.612	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2			
XRN1	54464	hgsc.bcm.edu;ucsc.edu	37	3	142051287	142051287	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr3:142051287T>A	ENST00000264951.4	-	36	4266	c.4149A>T	c.(4147-4149)gaA>gaT	p.E1383D	XRN1_ENST00000392981.2_Missense_Mutation_p.E1384D	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1383					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AAACAGGGATTTCATTAGCAA	0.318																																																	0													129.0	122.0	124.0					3																	142051287		2203	4300	6503	SO:0001583	missense	54464			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4149A>T	3.37:g.142051287T>A	ENSP00000264951:p.Glu1383Asp	Somatic		WXS	SOLID	Phase_I	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	T	9.172	1.021399	0.19433	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.32272	1.46;1.46	5.76	3.36	0.38483	.	0.420734	0.27486	N	0.019146	T	0.15003	0.0362	N	0.14661	0.345	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.003	T	0.09058	-1.0692	10	0.27082	T	0.32	-10.4744	5.1503	0.15005	0.1402:0.1486:0.0:0.7112	.	1384;1383	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	D	1383;1384	ENSP00000264951:E1383D;ENSP00000376707:E1384D	ENSP00000264951:E1383D	E	-	3	2	XRN1	143533977	0.965000	0.33210	0.670000	0.29842	0.340000	0.28889	1.476000	0.35420	0.448000	0.26722	0.459000	0.35465	GAA		0.318	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2		NM_019001	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68251809	68251809	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr14:68251809C>A	ENST00000347230.4	-	19	3628	c.3490G>T	c.(3490-3492)Gca>Tca	p.A1164S	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.A1164S	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1164			A -> E (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGGAGAACTGCAGCAAGGGTG	0.517																																																	0													159.0	167.0	164.0					14																	68251809		2203	4300	6503	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3490G>T	14.37:g.68251809C>A	ENSP00000251119:p.Ala1164Ser	Somatic		WXS	SOLID	Phase_I	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	7.849	0.723526	0.15439	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.24908	1.97;1.83	5.54	1.21	0.21127	.	0.563103	0.19635	N	0.109597	T	0.11580	0.0282	N	0.21448	0.665	0.19575	N	0.999966	B;B	0.19583	0.037;0.006	B;B	0.16289	0.015;0.002	T	0.34527	-0.9825	10	0.06494	T	0.89	-0.4997	5.6463	0.17592	0.1643:0.5817:0.0:0.2539	.	1164;1164	G3V2D8;Q68DK2	.;ZFY26_HUMAN	S	1164;1143;1164	ENSP00000251119:A1164S;ENSP00000450603:A1164S	ENSP00000251119:A1164S	A	-	1	0	ZFYVE26	67321562	0.024000	0.19004	0.246000	0.24233	0.992000	0.81027	0.194000	0.17135	0.287000	0.22375	0.655000	0.94253	GCA		0.517	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2		NM_015346	
ZNF329	79673	hgsc.bcm.edu;ucsc.edu	37	19	58639319	58639319	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr19:58639319T>G	ENST00000598312.1	-	4	1785	c.1552A>C	c.(1552-1554)Aaa>Caa	p.K518Q	ZNF329_ENST00000358067.4_Missense_Mutation_p.K518Q	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TGGAACATTTTTCCACACTGA	0.517																																																	0													181.0	165.0	171.0					19																	58639319		2203	4300	6503	SO:0001583	missense	79673			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.1552A>C	19.37:g.58639319T>G	ENSP00000470008:p.Lys518Gln	Somatic		WXS	SOLID	Phase_I	B3KR32|Q9H9R7	Missense_Mutation	SNP	ENST00000598312.1	37	CCDS12972.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.628134	0.46944	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.60424	0.19;0.19	4.34	4.34	0.51931	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40908	D	0.000987	T	0.73916	0.3648	M	0.78285	2.405	0.33773	D	0.623288	D	0.71674	0.998	D	0.67548	0.952	D	0.83539	0.0095	10	0.87932	D	0	-18.5093	13.4688	0.61271	0.0:0.0:0.0:1.0	.	518	Q86UD4	ZN329_HUMAN	Q	518	ENSP00000350773:K518Q;ENSP00000439527:K518Q	ENSP00000350773:K518Q	K	-	1	0	ZNF329	63331131	1.000000	0.71417	0.913000	0.36048	0.859000	0.49053	4.391000	0.59652	2.194000	0.70268	0.533000	0.62120	AAA		0.517	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1		NM_024620	
ZNF619	285267	hgsc.bcm.edu	37	3	40528385	40528385	+	Silent	SNP	A	A	T			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr3:40528385A>T	ENST00000314686.5	+	6	741	c.336A>T	c.(334-336)ggA>ggT	p.G112G	ZNF619_ENST00000432264.2_Silent_p.G128G|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000456778.1_Silent_p.G84G|ZNF619_ENST00000521353.1_Silent_p.G168G|ZNF619_ENST00000522736.1_Silent_p.G119G|ZNF619_ENST00000429348.2_Silent_p.G128G|ZNF619_ENST00000447116.2_Silent_p.G168G			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TAGTGGAGGGACTGCTGATGG	0.443																																																	0													65.0	66.0	66.0					3																	40528385		2203	4300	6503	SO:0001819	synonymous_variant	285267			AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.336A>T	3.37:g.40528385A>T		Somatic		WXS	SOLID	Phase_I	B4E271|C9JRN5|D4PHA2|E9PCD9	Silent	SNP	ENST00000314686.5	37																																																																																					0.443	ZNF619-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000254180.2		NM_173656	
ZNF780B	163131	hgsc.bcm.edu;ucsc.edu	37	19	40540306	40540306	+	Silent	SNP	G	G	A			TCGA-B0-4817-01A-01D-1361-10	TCGA-B0-4817-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	304941d8-b999-4192-91d7-517f468c4156	27a4c2a2-b90f-4046-b6ca-373e91ba70f3	g.chr19:40540306G>A	ENST00000434248.1	-	5	2525	c.2460C>T	c.(2458-2460)atC>atT	p.I820I	ZNF780B_ENST00000221355.6_Silent_p.I672I	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	820					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I820I(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGTTGCTACTGATGTCTGAAG	0.388																																																	2	Substitution - coding silent(2)	kidney(2)											62.0	67.0	65.0					19																	40540306		2177	4289	6466	SO:0001819	synonymous_variant	163131			AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.2460C>T	19.37:g.40540306G>A		Somatic		WXS	SOLID	Phase_I	B9EH00	Silent	SNP	ENST00000434248.1	37	CCDS46077.1																																																																																				0.388	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1		NM_001005851	
