#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS18	170692	hgsc.bcm.edu	37	16	77468336	77468336	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr16:77468336C>G	ENST00000282849.5	-	2	575	c.157G>C	c.(157-159)Ggc>Cgc	p.G53R	RP11-449J10.1_ENST00000564358.1_RNA|ADAMTS18_ENST00000567121.1_5'Flank|AC025284.1_ENST00000401312.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	53					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CCGCTGGCGCCGCTGCTGCTG	0.597																																																	0													8.0	9.0	9.0					16																	77468336		2180	4266	6446	SO:0001583	missense	170692			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.157G>C	16.37:g.77468336C>G	ENSP00000282849:p.Gly53Arg	Somatic		WXS	SOLID	Phase_I	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.751087	0.69533	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.59502	0.26;2.82	4.67	2.59	0.31030	.	0.403999	0.25197	N	0.032411	T	0.45296	0.1335	L	0.29908	0.895	0.29984	N	0.81747	P	0.47106	0.89	P	0.46299	0.511	T	0.39143	-0.9628	10	0.21540	T	0.41	.	8.7539	0.34635	0.0:0.7333:0.0:0.2667	.	53	Q8TE60	ATS18_HUMAN	R	53	ENSP00000282849:G53R;ENSP00000392540:G53R	ENSP00000282849:G53R	G	-	1	0	ADAMTS18	76025837	1.000000	0.71417	0.945000	0.38365	0.991000	0.79684	1.811000	0.38942	0.868000	0.35678	0.462000	0.41574	GGC		0.597	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			
ALOX5	240	hgsc.bcm.edu	37	10	45935953	45935953	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr10:45935953A>T	ENST00000374391.2	+	8	1110	c.1057A>T	c.(1057-1059)Atc>Ttc	p.I353F	ALOX5_ENST00000542434.1_Missense_Mutation_p.I353F	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	353	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	TTTGGCCAAAATCTGGGTGCG	0.502																																																	0													98.0	85.0	90.0					10																	45935953		2203	4300	6503	SO:0001583	missense	240			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1057A>T	10.37:g.45935953A>T	ENSP00000363512:p.Ile353Phe	Somatic		WXS	SOLID	Phase_I	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.311247	0.81358	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.77358	-1.09;-1.09	5.96	5.96	0.96718	Lipoxygenase, C-terminal (4);	0.204255	0.51477	D	0.000084	T	0.81211	0.4775	L	0.53617	1.68	0.80722	D	1	D;P;D	0.63046	0.992;0.849;0.988	P;P;P	0.59288	0.855;0.624;0.771	T	0.79969	-0.1579	10	0.35671	T	0.21	-39.8169	9.6476	0.39877	0.8446:0.0:0.0:0.1553	.	353;353;353	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	F	353	ENSP00000437634:I353F;ENSP00000363512:I353F	ENSP00000363512:I353F	I	+	1	0	ALOX5	45255959	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.285000	0.76669	0.528000	0.53228	ATC		0.502	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1			
SOWAHA	134548	hgsc.bcm.edu;ucsc.edu	37	5	132150878	132150878	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr5:132150878G>C	ENST00000378693.2	+	1	1846	c.1565G>C	c.(1564-1566)gGt>gCt	p.G522A	AC004775.5_ENST00000607389.1_lincRNA	NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	522																	ATCCGCGGTGGTCTGCCAGCC	0.572																																																	0													33.0	39.0	37.0					5																	132150878		2203	4298	6501	SO:0001583	missense	0			AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.1565G>C	5.37:g.132150878G>C	ENSP00000367965:p.Gly522Ala	Somatic		WXS	SOLID	Phase_I	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273983	0.59649	.	.	ENSG00000198944	ENST00000378693	T	0.20332	2.08	6.15	-1.63	0.08345	.	1.479250	0.04456	N	0.373586	T	0.19485	0.0468	N	0.21448	0.665	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.40156	-0.9578	10	0.38643	T	0.18	-5.6533	19.2419	0.93887	0.0:0.6512:0.2535:0.0953	.	522	Q2M3V2	ANR43_HUMAN	A	522	ENSP00000367965:G522A	ENSP00000367965:G522A	G	+	2	0	ANKRD43	132178777	0.000000	0.05858	0.000000	0.03702	0.741000	0.42261	-0.001000	0.12947	-0.659000	0.05359	0.643000	0.83706	GGT		0.572	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1		NM_175873	
ARAP3	64411	hgsc.bcm.edu	37	5	141046056	141046056	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr5:141046056G>T	ENST00000239440.4	-	17	2572	c.2507C>A	c.(2506-2508)tCa>tAa	p.S836*	ARAP3_ENST00000508305.1_Nonsense_Mutation_p.S738*|ARAP3_ENST00000513878.1_Nonsense_Mutation_p.S498*|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	836					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.S836*(2)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GCCCGGCGCTGAGCACAGGAA	0.677																																																	2	Substitution - Nonsense(2)	breast(2)											19.0	25.0	23.0					5																	141046056		2201	4292	6493	SO:0001587	stop_gained	64411			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.2507C>A	5.37:g.141046056G>T	ENSP00000239440:p.Ser836*	Somatic		WXS	SOLID	Phase_I	B4DIT1|D3DQE3	Nonsense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	G	40	8.500045	0.98838	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	.	.	.	5.53	5.53	0.82687	.	0.057711	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.0492	0.93036	0.0:0.0:1.0:0.0	.	.	.	.	X	738;836;498	.	ENSP00000239440:S836X	S	-	2	0	ARAP3	141026240	1.000000	0.71417	0.992000	0.48379	0.309000	0.27889	8.156000	0.89645	2.593000	0.87608	0.655000	0.94253	TCA		0.677	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1		NM_022481	
ATF7IP2	80063	hgsc.bcm.edu;ucsc.edu	37	16	10525097	10525097	+	Nonsense_Mutation	SNP	C	C	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr16:10525097C>G	ENST00000396560.2	+	3	847	c.620C>G	c.(619-621)tCa>tGa	p.S207*	ATF7IP2_ENST00000324570.5_Nonsense_Mutation_p.S207*|ATF7IP2_ENST00000356427.2_Nonsense_Mutation_p.S207*|ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000396559.1_Nonsense_Mutation_p.S207*	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						AACTCCAATTCAGAATCACAT	0.393																																																	0													121.0	115.0	117.0					16																	10525097		2197	4300	6497	SO:0001587	stop_gained	80063			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.620C>G	16.37:g.10525097C>G	ENSP00000379808:p.Ser207*	Somatic		WXS	SOLID	Phase_I	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Nonsense_Mutation	SNP	ENST00000396560.2	37	CCDS10540.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733262	0.69189	.	.	ENSG00000166669	ENST00000396559;ENST00000396560;ENST00000535850;ENST00000356427;ENST00000324570	.	.	.	5.43	2.41	0.29592	.	0.839135	0.09990	N	0.729790	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.6038	7.765	0.28974	0.0:0.7304:0.0:0.2696	.	.	.	.	X	207	.	ENSP00000322811:S207X	S	+	2	0	ATF7IP2	10432598	0.003000	0.15002	0.001000	0.08648	0.030000	0.12068	-0.001000	0.12947	0.678000	0.31325	0.491000	0.48974	TCA		0.393	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1		NM_024997	
ATP2A2	488	hgsc.bcm.edu	37	12	110778549	110778549	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr12:110778549C>T	ENST00000539276.2	+	14	1956	c.1847C>T	c.(1846-1848)gCa>gTa	p.A616V	ATP2A2_ENST00000395494.2_Missense_Mutation_p.A589V|ATP2A2_ENST00000308664.6_Missense_Mutation_p.A616V			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	616					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TGCCGGCAAGCAGGCATCCGG	0.582																																																	0													95.0	92.0	93.0					12																	110778549		2203	4300	6503	SO:0001583	missense	488				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1847C>T	12.37:g.110778549C>T	ENSP00000440045:p.Ala616Val	Somatic		WXS	SOLID	Phase_I	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	C	36	5.924784	0.97110	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	D;D;D	0.96992	-4.2;-4.2;-4.2	6.07	6.07	0.98685	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.98833	4.345	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.79784	0.993;0.951;0.971	D	0.98732	1.0713	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	589;616;616	P16615-4;P16615-2;P16615	.;.;AT2A2_HUMAN	V	616;589;616	ENSP00000311186:A616V;ENSP00000378872:A589V;ENSP00000440045:A616V	ENSP00000311186:A616V	A	+	2	0	ATP2A2	109262932	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	GCA		0.582	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1		NM_001681	
BLM	641	hgsc.bcm.edu	37	15	91306293	91306293	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr15:91306293T>A	ENST00000355112.3	+	8	2098	c.1980T>A	c.(1978-1980)caT>caA	p.H660Q	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Missense_Mutation_p.H660Q	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	660					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AGATTTTTCATAAAAAATTTG	0.373			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													75.0	81.0	79.0					15																	91306293		2198	4298	6496	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1980T>A	15.37:g.91306293T>A	ENSP00000347232:p.His660Gln	Somatic		WXS	SOLID	Phase_I	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.417277	0.42918	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.75704	-0.96	5.15	-0.187	0.13268	.	0.155036	0.56097	D	0.000026	T	0.64527	0.2606	L	0.59436	1.845	0.45330	D	0.998322	B;B;B	0.18863	0.031;0.018;0.031	B;B;B	0.14578	0.011;0.011;0.011	T	0.54523	-0.8281	10	0.36615	T	0.2	-0.0773	8.2381	0.31638	0.0:0.5608:0.0:0.4392	.	660;285;660	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	Q	660;313	ENSP00000347232:H660Q	ENSP00000347232:H660Q	H	+	3	2	BLM	89107297	0.998000	0.40836	0.999000	0.59377	0.998000	0.95712	0.561000	0.23515	0.075000	0.16796	0.482000	0.46254	CAT		0.373	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			
SIMC1	375484	hgsc.bcm.edu	37	5	175740819	175740819	+	Silent	SNP	T	T	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr5:175740819T>G	ENST00000443967.1	+	7	2210	c.1803T>G	c.(1801-1803)ctT>ctG	p.L601L	SIMC1_ENST00000332772.4_Silent_p.L62L|SIMC1_ENST00000430704.2_Silent_p.L186L|SIMC1_ENST00000341199.6_Silent_p.L186L			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	601							SUMO polymer binding (GO:0032184)										ACATGGTGCTTTCCTGTGACA	0.532																																																	0													102.0	96.0	98.0					5																	175740819		2203	4300	6503	SO:0001819	synonymous_variant	0			BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.1803T>G	5.37:g.175740819T>G		Somatic		WXS	SOLID	Phase_I	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Silent	SNP	ENST00000443967.1	37																																																																																					0.532	SIMC1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253155.2		NM_198567	
CLK1	1195	hgsc.bcm.edu	37	2	201718657	201718657	+	Missense_Mutation	SNP	C	C	G	rs200718703		TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr2:201718657C>G	ENST00000321356.4	-	12	1415	c.1280G>C	c.(1279-1281)aGa>aCa	p.R427T	CLK1_ENST00000434813.2_Missense_Mutation_p.R469T|CLK1_ENST00000409769.2_Missense_Mutation_p.R250T	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	427	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TGAAACATATCTGCCGGCAGA	0.383																																																	0													122.0	117.0	119.0					2																	201718657		2203	4300	6503	SO:0001583	missense	1195			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.1280G>C	2.37:g.201718657C>G	ENSP00000326830:p.Arg427Thr	Somatic		WXS	SOLID	Phase_I	B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	ENST00000321356.4	37	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181797	0.57800	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000409769;ENST00000434813	T;T;T	0.20069	2.1;2.1;2.1	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	L	0.45285	1.41	0.53688	D	0.999974	D;D;D;D	0.55385	0.971;0.971;0.971;0.968	D;D;D;P	0.68765	0.96;0.96;0.96;0.811	T	0.09773	-1.0659	10	0.87932	D	0	.	16.2271	0.82306	0.0:0.8672:0.1328:0.0	.	469;397;427;250	B4DFW7;E9PH13;P49759;B8ZZR0	.;.;CLK1_HUMAN;.	T	427;397;250;469	ENSP00000326830:R427T;ENSP00000386358:R250T;ENSP00000394734:R469T	ENSP00000326830:R427T	R	-	2	0	CLK1	201426902	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	4.049000	0.57397	2.619000	0.88677	0.462000	0.41574	AGA		0.383	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2			
DHX30	22907	hgsc.bcm.edu;ucsc.edu	37	3	47891146	47891146	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr3:47891146G>A	ENST00000445061.1	+	21	3625	c.3218G>A	c.(3217-3219)tGg>tAg	p.W1073*	DHX30_ENST00000348968.4_Nonsense_Mutation_p.W1045*|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Nonsense_Mutation_p.W1101*|DHX30_ENST00000446256.2_Nonsense_Mutation_p.W1034*	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	1073						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CGGAGCCGATGGCTGACGTAT	0.627																																																	0													85.0	77.0	80.0					3																	47891146		2203	4300	6503	SO:0001587	stop_gained	22907			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.3218G>A	3.37:g.47891146G>A	ENSP00000405620:p.Trp1073*	Somatic		WXS	SOLID	Phase_I	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Nonsense_Mutation	SNP	ENST00000445061.1	37	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	43	9.887651	0.99288	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.3489	0.87317	0.0:0.0:1.0:0.0	.	.	.	.	X	1034;1073;1045;1101	.	ENSP00000343442:W1045X	W	+	2	0	DHX30	47866150	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.353000	0.73032	2.315000	0.78130	0.561000	0.74099	TGG		0.627	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2		NM_138615	
DHX37	57647	hgsc.bcm.edu	37	12	125448980	125448980	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr12:125448980C>T	ENST00000308736.2	-	15	2103	c.2005G>A	c.(2005-2007)Gcg>Acg	p.A669T	DHX37_ENST00000544745.1_Missense_Mutation_p.A456T	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	669	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCTCTGCCCGCTCGCTGGTCA	0.637																																																	0													89.0	81.0	84.0					12																	125448980		2203	4300	6503	SO:0001583	missense	57647			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2005G>A	12.37:g.125448980C>T	ENSP00000311135:p.Ala669Thr	Somatic		WXS	SOLID	Phase_I	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.835511	0.91117	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.76578	-1.03;-1.03	5.17	5.17	0.71159	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88477	0.6447	M	0.76938	2.355	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89621	0.3848	10	0.66056	D	0.02	-13.2301	18.2623	0.90039	0.0:1.0:0.0:0.0	.	669	Q8IY37	DHX37_HUMAN	T	669;456	ENSP00000311135:A669T;ENSP00000439009:A456T	ENSP00000311135:A669T	A	-	1	0	DHX37	124014933	1.000000	0.71417	0.998000	0.56505	0.357000	0.29423	7.501000	0.81600	2.419000	0.82065	0.462000	0.41574	GCG		0.637	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_032656	
DNMT1	1786	hgsc.bcm.edu	37	19	10244940	10244940	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr19:10244940A>G	ENST00000340748.4	-	39	5004	c.4769T>C	c.(4768-4770)tTg>tCg	p.L1590S	DNMT1_ENST00000359526.4_Missense_Mutation_p.L1606S|DNMT1_ENST00000540357.1_Missense_Mutation_p.L1593S			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1590	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CTTGATCTCCAAGCCAATGGC	0.642																																																	0													66.0	58.0	60.0					19																	10244940		2203	4300	6503	SO:0001583	missense	1786			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.4769T>C	19.37:g.10244940A>G	ENSP00000345739:p.Leu1590Ser	Somatic		WXS	SOLID	Phase_I	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.956279	0.53293	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.83837	-1.77;-1.77;-1.77	4.74	3.69	0.42338	.	0.165270	0.41294	D	0.000905	T	0.79179	0.4402	L	0.39692	1.235	0.51012	D	0.999909	P;P;P	0.36733	0.511;0.511;0.567	B;B;P	0.46419	0.288;0.381;0.516	T	0.74490	-0.3648	10	0.42905	T	0.14	-13.9443	5.5285	0.16970	0.7333:0.1768:0.0899:0.0	.	1593;1606;1590	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	S	1606;1593;1590;1458	ENSP00000352516:L1606S;ENSP00000440457:L1593S;ENSP00000345739:L1590S	ENSP00000345739:L1590S	L	-	2	0	DNMT1	10105940	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	5.571000	0.67404	0.804000	0.34136	0.454000	0.30748	TTG		0.642	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1		NM_001379	
FAM167B	84734	hgsc.bcm.edu	37	1	32713083	32713083	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:32713083G>A	ENST00000373582.3	+	1	250	c.61G>A	c.(61-63)Ggg>Agg	p.G21R		NM_032648.2	NP_116037.2	Q9BTA0	F167B_HUMAN	family with sequence similarity 167, member B	21								p.G21W(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(2)	5						GGATGAGGAGGGGGAGAGCCT	0.617																																																	1	Substitution - Missense(1)	ovary(1)											53.0	65.0	61.0					1																	32713083		2077	4204	6281	SO:0001583	missense	84734			BC004269	CCDS358.2	1p35.1	2010-08-27	2008-06-11	2008-06-11	ENSG00000183615	ENSG00000183615			28133	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 90"""	C1orf90		12477932	Standard	NM_032648		Approved	MGC10820	uc001buw.3	Q9BTA0	OTTHUMG00000007462	ENST00000373582.3:c.61G>A	1.37:g.32713083G>A	ENSP00000362684:p.Gly21Arg	Somatic		WXS	SOLID	Phase_I	Q5TDH6	Missense_Mutation	SNP	ENST00000373582.3	37	CCDS358.2	.	.	.	.	.	.	.	.	.	.	g	11.94	1.787437	0.31593	.	.	ENSG00000183615	ENST00000373582	T	0.28454	1.61	5.02	2.11	0.27256	.	0.540328	0.15603	U	0.253791	T	0.14485	0.0350	N	0.08118	0	0.23168	N	0.998182	B	0.02656	0.0	B	0.01281	0.0	T	0.23261	-1.0193	10	0.31617	T	0.26	.	8.08	0.30739	0.1464:0.1312:0.7224:0.0	.	21	Q9BTA0	F167B_HUMAN	R	21	ENSP00000362684:G21R	ENSP00000362684:G21R	G	+	1	0	FAM167B	32485670	1.000000	0.71417	0.262000	0.24481	0.875000	0.50365	4.347000	0.59373	0.254000	0.21573	-0.136000	0.14681	GGG		0.617	FAM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019615.2		NM_032648	
FAM78B	149297	hgsc.bcm.edu	37	1	166135418	166135418	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:166135418A>G	ENST00000338353.3	-	2	657	c.68T>C	c.(67-69)gTg>gCg	p.V23A	RP11-9L18.3_ENST00000451784.1_RNA|FAM78B_ENST00000354422.3_Missense_Mutation_p.V23A			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	23										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					GGTGGCGCACACATCGTACAC	0.667																																																	0													77.0	53.0	61.0					1																	166135418		2202	4299	6501	SO:0001583	missense	149297			AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.68T>C	1.37:g.166135418A>G	ENSP00000339681:p.Val23Ala	Somatic		WXS	SOLID	Phase_I	B7Z693	Missense_Mutation	SNP	ENST00000338353.3	37	CCDS30931.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153412	0.57259	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	4.29	4.29	0.51040	.	0.066607	0.64402	D	0.000014	T	0.39358	0.1075	L	0.59436	1.845	0.41782	D	0.989828	B	0.25809	0.135	B	0.27796	0.083	T	0.51725	-0.8669	8	0.72032	D	0.01	-3.0919	11.4309	0.50041	1.0:0.0:0.0:0.0	.	23	Q5VT40	FA78B_HUMAN	A	23	.	ENSP00000339681:V23A	V	-	2	0	FAM78B	164402042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.491000	0.90468	1.789000	0.52484	0.383000	0.25322	GTG		0.667	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343108.1		NM_001017961	
GALNT7	51809	hgsc.bcm.edu	37	4	174223217	174223217	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr4:174223217G>C	ENST00000265000.4	+	7	1251	c.1168G>C	c.(1168-1170)Gga>Cga	p.G390R		NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	390	Catalytic subdomain B.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.G390R(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		CATGGCTGGGGGATTATTTGC	0.438																																																	1	Substitution - Missense(1)	central_nervous_system(1)											222.0	228.0	226.0					4																	174223217		2203	4300	6503	SO:0001583	missense	51809			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1168G>C	4.37:g.174223217G>C	ENSP00000265000:p.Gly390Arg	Somatic		WXS	SOLID	Phase_I	B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	ENST00000265000.4	37	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	G	31	5.081035	0.94050	.	.	ENSG00000109586	ENST00000265000;ENST00000458613	D	0.90844	-2.74	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.97136	0.9064	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97483	1.0048	10	0.87932	D	0	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	167;390	B4DIB4;Q86SF2	.;GALT7_HUMAN	R	390;167	ENSP00000265000:G390R	ENSP00000265000:G390R	G	+	1	0	GALNT7	174459792	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	9.869000	0.99810	2.828000	0.97474	0.655000	0.94253	GGA		0.438	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2		NM_017423	
GLYAT	10249	hgsc.bcm.edu	37	11	58482866	58482866	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr11:58482866C>T	ENST00000344743.3	-	3	253	c.112G>A	c.(112-114)Gga>Aga	p.G38R	GLYAT_ENST00000529732.1_Missense_Mutation_p.G38R|GLYAT_ENST00000278400.3_Missense_Mutation_p.G38R	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	38					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	AATGGATTTCCATGGTTTATG	0.398																																																	0													101.0	87.0	92.0					11																	58482866		2201	4295	6496	SO:0001583	missense	10249			AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.112G>A	11.37:g.58482866C>T	ENSP00000340200:p.Gly38Arg	Somatic		WXS	SOLID	Phase_I	O14833|Q96QK7	Missense_Mutation	SNP	ENST00000344743.3	37	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883462	0.33255	.	.	ENSG00000149124	ENST00000344743;ENST00000529732;ENST00000278400	T;T;T	0.19669	2.13;2.13;2.13	5.55	3.65	0.41850	Glycine N-acyltransferase, N-terminal (1);	0.157274	0.42053	D	0.000772	T	0.48624	0.1510	M	0.89785	3.06	0.29298	N	0.868857	D;D	0.69078	0.996;0.997	D;D	0.72075	0.969;0.976	T	0.51772	-0.8663	10	0.87932	D	0	-13.513	8.4595	0.32919	0.0:0.822:0.0:0.178	.	38;38	Q6IB77-2;Q6IB77	.;GLYAT_HUMAN	R	38	ENSP00000340200:G38R;ENSP00000431688:G38R;ENSP00000278400:G38R	ENSP00000278400:G38R	G	-	1	0	GLYAT	58239442	0.947000	0.32204	0.920000	0.36463	0.010000	0.07245	2.002000	0.40835	1.586000	0.49944	0.585000	0.79938	GGA		0.398	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1			
GRXCR1	389207	hgsc.bcm.edu;ucsc.edu	37	4	42895568	42895568	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr4:42895568A>T	ENST00000399770.2	+	1	285	c.285A>T	c.(283-285)agA>agT	p.R95S	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	95					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						TTGGTACAAGAAGAGTCAACA	0.438																																																	0													126.0	130.0	129.0					4																	42895568		1986	4176	6162	SO:0001583	missense	389207				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.285A>T	4.37:g.42895568A>T	ENSP00000382670:p.Arg95Ser	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000399770.2	37	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057189	0.36277	.	.	ENSG00000215203	ENST00000399770	T	0.36157	1.27	5.87	0.422	0.16457	.	0.068097	0.56097	U	0.000032	T	0.20740	0.0499	L	0.36672	1.1	0.31906	N	0.615355	B	0.19331	0.035	B	0.19946	0.027	T	0.19321	-1.0309	10	0.14252	T	0.57	-0.9729	4.9052	0.13795	0.5583:0.0:0.3097:0.132	.	95	A8MXD5	GRCR1_HUMAN	S	95	ENSP00000382670:R95S	ENSP00000382670:R95S	R	+	3	2	GRXCR1	42590325	1.000000	0.71417	0.981000	0.43875	0.611000	0.37282	2.158000	0.42329	0.140000	0.18849	-0.297000	0.09499	AGA		0.438	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1		NM_001080476	
HEPHL1	341208	hgsc.bcm.edu	37	11	93754553	93754553	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr11:93754553G>T	ENST00000315765.9	+	1	27	c.19G>T	c.(19-21)Gct>Tct	p.A7S		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	7					copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GAAGCAGCCAGCTGGCTGCAT	0.542																																																	0													105.0	106.0	106.0					11																	93754553		1925	4125	6050	SO:0001583	missense	341208			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.19G>T	11.37:g.93754553G>T	ENSP00000313699:p.Ala7Ser	Somatic		WXS	SOLID	Phase_I	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886900	0.33348	.	.	ENSG00000181333	ENST00000315765	D	0.99232	-5.6	5.87	1.79	0.24919	.	0.892845	0.09742	N	0.761788	D	0.96166	0.8750	N	0.22421	0.69	0.09310	N	1	B	0.15930	0.015	B	0.15870	0.014	D	0.92040	0.5640	10	0.09843	T	0.71	.	7.1531	0.25622	0.2069:0.2105:0.5826:0.0	.	7	Q6MZM0	HPHL1_HUMAN	S	7	ENSP00000313699:A7S	ENSP00000313699:A7S	A	+	1	0	HEPHL1	93394201	0.167000	0.22975	0.897000	0.35233	0.944000	0.59088	0.426000	0.21363	0.952000	0.37798	-0.137000	0.14449	GCT		0.542	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2		XM_291947	
HLA-C	3107	hgsc.bcm.edu	37	6	31237786	31237786	+	Silent	SNP	A	A	T	rs41556617	byFrequency	TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr6:31237786A>T	ENST00000376228.5	-	5	986	c.972T>A	c.(970-972)ctT>ctA	p.L324L	HLA-C_ENST00000383329.3_Silent_p.L324L	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	330					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CCACAGCTCCAAGGACAGCTA	0.577																																																	0								T		3008,1352		1348,312,520	42.0	46.0	45.0		972	-4.9	0.0	6	dbSNP_127	45	4845,3673		1931,983,1345	no	coding-synonymous	HLA-C	NM_002117.5		3279,1295,1865	TT,TA,AA		43.1205,31.0092,39.02		324/367	31237786	7853,5025	2180	4259	6439	SO:0001819	synonymous_variant	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.972T>A	6.37:g.31237786A>T		Somatic		WXS	SOLID	Phase_I	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1																																																																																				0.577	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3		NM_002117	
IFT140	9742	hgsc.bcm.edu	37	16	1636198	1636198	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr16:1636198G>A	ENST00000426508.2	-	10	1451	c.1088C>T	c.(1087-1089)gCa>gTa	p.A363V	IFT140_ENST00000439987.2_5'UTR|LA16c-395F10.2_ENST00000563162.1_RNA	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	363					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CTTGCCCTCTGCCCCGGGGCT	0.582																																																	0													124.0	109.0	114.0					16																	1636198		2199	4300	6499	SO:0001583	missense	9742			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1088C>T	16.37:g.1636198G>A	ENSP00000406012:p.Ala363Val	Somatic		WXS	SOLID	Phase_I	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	G	3.799	-0.042014	0.07452	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.58652	0.32	5.13	-7.12	0.01537	WD40/YVTN repeat-like-containing domain (1);	2.390590	0.01081	N	0.004999	T	0.42698	0.1214	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24476	-1.0159	10	0.21014	T	0.42	.	13.07	0.59055	0.2453:0.1088:0.6459:0.0	.	363	Q96RY7	IF140_HUMAN	V	363	ENSP00000406012:A363V	ENSP00000380562:A363V	A	-	2	0	IFT140	1576199	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	-1.025000	0.03600	-1.625000	0.01554	-0.282000	0.10007	GCA		0.582	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2		NM_014714	
KIF1B	23095	hgsc.bcm.edu;ucsc.edu	37	1	10397234	10397234	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:10397234G>A	ENST00000377086.1	+	30	3434	c.3232G>A	c.(3232-3234)Gaa>Aaa	p.E1078K	KIF1B_ENST00000377081.1_Missense_Mutation_p.E1078K|KIF1B_ENST00000263934.6_Missense_Mutation_p.E1032K			O60333	KIF1B_HUMAN	kinesin family member 1B	1078					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CACTCCTCCAGAAGAAATCAG	0.438																																																	0													178.0	174.0	175.0					1																	10397234		2203	4300	6503	SO:0001583	missense	23095			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3232G>A	1.37:g.10397234G>A	ENSP00000366290:p.Glu1078Lys	Somatic		WXS	SOLID	Phase_I	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	20.3	3.961745	0.74016	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.73258	-0.73;-0.73;-0.73	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77412	0.4126	L	0.39245	1.2	0.58432	D	0.999997	P;B;P;P;B;D	0.56035	0.615;0.304;0.862;0.773;0.276;0.974	B;B;B;B;B;D	0.70487	0.2;0.072;0.278;0.41;0.121;0.969	T	0.74297	-0.3711	10	0.35671	T	0.21	.	14.5329	0.67939	0.0713:0.0:0.9286:0.0	.	1064;1038;1078;1052;1078;1032	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	K	1078;1032;1078;1078	ENSP00000263934:E1032K;ENSP00000366290:E1078K;ENSP00000366284:E1078K	ENSP00000263934:E1032K	E	+	1	0	KIF1B	10319821	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.447000	0.97595	2.824000	0.97209	0.655000	0.94253	GAA		0.438	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			
LSS	4047	hgsc.bcm.edu	37	21	47642638	47642638	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr21:47642638A>T	ENST00000397728.3	-	4	412	c.334T>A	c.(334-336)Tgc>Agc	p.C112S	LSS_ENST00000522411.1_Missense_Mutation_p.C112S|LSS_ENST00000464357.1_5'UTR|LSS_ENST00000457828.2_Missense_Mutation_p.C32S|AP001469.5_ENST00000418029.1_RNA|LSS_ENST00000356396.4_Missense_Mutation_p.C112S	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	112					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					GCCACGTGGCAAGTGATCAGG	0.607																																					Pancreas(114;955 2313 34923 50507)												0													100.0	81.0	87.0					21																	47642638		2203	4300	6503	SO:0001583	missense	4047			U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.334T>A	21.37:g.47642638A>T	ENSP00000380837:p.Cys112Ser	Somatic		WXS	SOLID	Phase_I	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	37	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453131	0.43531	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411;ENST00000450351	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.17	3.99	0.46301	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.050281	0.85682	N	0.000000	T	0.28001	0.0690	L	0.42581	1.335	0.58432	D	0.999998	D;D	0.59357	0.985;0.975	P;B	0.49477	0.612;0.408	T	0.01393	-1.1366	10	0.32370	T	0.25	.	11.1115	0.48235	0.8612:0.0:0.0:0.1388	.	112;112	E9PEI9;P48449	.;ERG7_HUMAN	S	112;32;112;112;113	ENSP00000348762:C112S;ENSP00000409191:C32S;ENSP00000380837:C112S;ENSP00000429133:C112S;ENSP00000391368:C113S	ENSP00000348762:C112S	C	-	1	0	LSS	46467066	1.000000	0.71417	0.060000	0.19600	0.813000	0.45954	7.043000	0.76572	0.872000	0.35775	0.496000	0.49642	TGC		0.607	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2			
MACF1	23499	hgsc.bcm.edu	37	1	39900149	39900149	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:39900149G>A	ENST00000372915.3	+	67	17404	c.17317G>A	c.(17317-17319)Gcc>Acc	p.A5773T	MACF1_ENST00000361689.2_Missense_Mutation_p.A3815T|MACF1_ENST00000539005.1_Missense_Mutation_p.A3685T|MACF1_ENST00000564288.1_Missense_Mutation_p.A5877T|MACF1_ENST00000289893.4_Missense_Mutation_p.A4317T|MACF1_ENST00000317713.7_Missense_Mutation_p.A3815T|MACF1_ENST00000545844.1_Missense_Mutation_p.A3815T|MACF1_ENST00000567887.1_Missense_Mutation_p.A5914T			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5773					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGCGTTATGCCCGCCTAGA	0.423																																																	0													56.0	61.0	59.0					1																	39900149		2203	4300	6503	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17317G>A	1.37:g.39900149G>A	ENSP00000362006:p.Ala5773Thr	Somatic		WXS	SOLID	Phase_I	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.26|12.26	1.883291|1.883291	0.33255|0.33255	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.52057|.	0.68;1.34;0.68;0.68;0.68;0.68|.	6.03|6.03	5.09|5.09	0.68999|0.68999	.|.	0.092722|.	0.47093|.	N|.	0.000247|.	T|T	0.68072|0.68072	0.2961|0.2961	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B;B;B|.	0.18610|.	0.02;0.029;0.002|.	B;B;B|.	0.20577|.	0.027;0.03;0.008|.	T|T	0.66404|0.66404	-0.5932|-0.5932	10|5	0.25106|.	T|.	0.35|.	.|.	14.4743|14.4743	0.67537|0.67537	0.0725:0.0:0.9275:0.0|0.0725:0.0:0.9275:0.0	.|.	5773;3815;3759|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	T|Y	3815;5773;3815;3815;3685;4317|2818	ENSP00000439537:A3815T;ENSP00000362006:A5773T;ENSP00000354573:A3815T;ENSP00000313438:A3815T;ENSP00000444364:A3685T;ENSP00000289893:A4317T|.	ENSP00000289893:A4317T|.	A|C	+|+	1|2	0|0	MACF1|MACF1	39672736|39672736	0.249000|0.249000	0.23941|0.23941	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.794000|1.794000	0.38774|0.38774	1.492000|1.492000	0.48499|0.48499	0.655000|0.655000	0.94253|0.94253	GCC|TGC		0.423	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1		NM_033044	
MUC4	4585	hgsc.bcm.edu	37	3	195506704	195506704	+	Missense_Mutation	SNP	T	T	C	rs201760283	byFrequency	TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr3:195506704T>C	ENST00000463781.3	-	2	12206	c.11747A>G	c.(11746-11748)gAt>gGt	p.D3916G	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3916G	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTGGTGTCATCTGTGGAAGC	0.587													.|||	22	0.00439297	0.0045	0.0029	5008	,	,		10246	0.0079		0.002	False		,,,				2504	0.0041																0													27.0	26.0	26.0					3																	195506704		541	1106	1647	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11747A>G	3.37:g.195506704T>C	ENSP00000417498:p.Asp3916Gly	Somatic		WXS	SOLID	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.034	0.561270	0.13498	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34072	1.48;1.38	.	.	.	.	.	.	.	.	T	0.11750	0.0286	N	0.08118	0	0.20074	N	0.999938	.	.	.	.	.	.	T	0.17471	-1.0368	4	.	.	.	.	.	.	.	.	3788	E7ESK3	.	G	3916	ENSP00000417498:D3916G;ENSP00000420243:D3916G	.	D	-	2	0	MUC4	196991483	.	.	0.004000	0.12327	0.004000	0.04260	.	.	-2.094000	0.00854	-2.075000	0.00382	GAT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NFATC3	4775	hgsc.bcm.edu	37	16	68225473	68225473	+	Silent	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr16:68225473C>T	ENST00000346183.3	+	9	2925	c.2901C>T	c.(2899-2901)acC>acT	p.T967T	NFATC3_ENST00000329524.4_Silent_p.T967T|NFATC3_ENST00000349223.5_Silent_p.T967T|SNORA48_ENST00000391143.1_RNA|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Silent_p.T967T	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	967					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CTCCAGCCACCAGAATGCATT	0.522																																																	0													119.0	115.0	117.0					16																	68225473		2198	4300	6498	SO:0001819	synonymous_variant	4775			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2901C>T	16.37:g.68225473C>T		Somatic		WXS	SOLID	Phase_I	O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	CCDS10860.1																																																																																				0.522	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2		NM_004555	
NWD1	284434	hgsc.bcm.edu;ucsc.edu	37	19	16875873	16875873	+	Silent	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr19:16875873C>T	ENST00000552788.1	+	8	2280	c.2280C>T	c.(2278-2280)ggC>ggT	p.G760G	NWD1_ENST00000523826.1_Silent_p.G554G|NWD1_ENST00000339803.6_Silent_p.G625G|NWD1_ENST00000524140.2_Silent_p.G760G|NWD1_ENST00000379808.3_Silent_p.G760G|NWD1_ENST00000549814.1_Silent_p.G760G			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	760							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCTGCCGGGGCATCTCTGGGG	0.607																																																	0													93.0	88.0	90.0					19																	16875873		2203	4300	6503	SO:0001819	synonymous_variant	284434			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2280C>T	19.37:g.16875873C>T		Somatic		WXS	SOLID	Phase_I	C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37																																																																																					0.607	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1		NM_001007525	
PITPNM3	83394	hgsc.bcm.edu	37	17	6367535	6367535	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr17:6367535G>C	ENST00000262483.8	-	16	2198	c.2111C>G	c.(2110-2112)cCc>cGc	p.P704R	PITPNM3_ENST00000421306.3_Missense_Mutation_p.P668R|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	704					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CAGGCGCCGGGGCCGCGGCAC	0.572																																																	0													75.0	75.0	75.0					17																	6367535		2203	4300	6503	SO:0001583	missense	83394			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2111C>G	17.37:g.6367535G>C	ENSP00000262483:p.Pro704Arg	Somatic		WXS	SOLID	Phase_I	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	G	9.889	1.203782	0.22121	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.41065	1.01;1.01	4.65	4.65	0.58169	.	0.278251	0.40554	N	0.001066	T	0.30198	0.0757	N	0.22421	0.69	0.27806	N	0.942323	B;B	0.28605	0.217;0.183	B;B	0.31946	0.138;0.054	T	0.24512	-1.0158	10	0.48119	T	0.1	.	10.6135	0.45436	0.0:0.0:0.8077:0.1923	.	668;704	F8WEW5;Q9BZ71	.;PITM3_HUMAN	R	704;668	ENSP00000262483:P704R;ENSP00000407882:P668R	ENSP00000262483:P704R	P	-	2	0	PITPNM3	6308259	0.990000	0.36364	1.000000	0.80357	0.754000	0.42855	2.254000	0.43214	2.288000	0.76882	0.511000	0.50034	CCC		0.572	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2		NM_031220	
PLEKHM3	389072	hgsc.bcm.edu	37	2	208795801	208795801	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr2:208795801C>A	ENST00000427836.2	-	5	2224	c.1735G>T	c.(1735-1737)Gag>Tag	p.E579*	PLEKHM3_ENST00000389247.4_Nonsense_Mutation_p.E579*|PLEKHM3_ENST00000457206.1_Nonsense_Mutation_p.E579*	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	579					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATGAGCGGCTCTTCGTACACG	0.617																																																	0													77.0	82.0	80.0					2																	208795801		2046	4213	6259	SO:0001587	stop_gained	389072			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1735G>T	2.37:g.208795801C>A	ENSP00000417003:p.Glu579*	Somatic		WXS	SOLID	Phase_I	B9EKV2|Q8WW68	Nonsense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.434148|10.434148	0.99404|0.99404	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206|ENST00000447645	.|.	.|.	.|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80082	.|0.4558	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77718	.|-0.2483	.|3	0.42905|.	T|.	0.14|.	.|.	20.0292|20.0292	0.97532|0.97532	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	579|330	.|.	ENSP00000373899:E579X|.	E|R	-|-	1|2	0|0	PLEKHM3|PLEKHM3	208504046|208504046	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.765000|0.765000	0.43378|0.43378	7.773000|7.773000	0.85462|0.85462	2.740000|2.740000	0.93945|0.93945	0.460000|0.460000	0.39030|0.39030	GAG|AGA		0.617	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1		NM_001080475	
PRAMEF12	390999	hgsc.bcm.edu	37	1	12835193	12835193	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:12835193C>A	ENST00000357726.4	+	1	210	c.183C>A	c.(181-183)ttC>ttA	p.F61L		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	61					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGGCCCTTCACCTGCCTTC	0.572																																																	0													79.0	83.0	82.0					1																	12835193		2203	4300	6503	SO:0001583	missense	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.183C>A	1.37:g.12835193C>A	ENSP00000350358:p.Phe61Leu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000357726.4	37	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	15.98	2.993596	0.54041	.	.	ENSG00000116726	ENST00000357726	T	0.13089	2.62	2.68	-2.52	0.06346	.	0.361997	0.27181	N	0.020555	T	0.31104	0.0786	M	0.83312	2.635	0.18873	N	0.999983	D	0.76494	0.999	D	0.80764	0.994	T	0.05131	-1.0904	10	0.49607	T	0.09	.	7.8437	0.29414	0.0:0.4529:0.0:0.5471	.	61	O95522	PRA12_HUMAN	L	61	ENSP00000350358:F61L	ENSP00000350358:F61L	F	+	3	2	PRAMEF12	12757780	0.000000	0.05858	0.036000	0.18154	0.329000	0.28539	-2.353000	0.01090	-0.579000	0.05952	0.195000	0.17529	TTC		0.572	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1		XM_372760	
PTCH1	5727	hgsc.bcm.edu	37	9	98239880	98239880	+	Silent	SNP	T	T	C			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr9:98239880T>C	ENST00000331920.6	-	10	1751	c.1452A>G	c.(1450-1452)ggA>ggG	p.G484G	PTCH1_ENST00000548379.1_5'Flank|PTCH1_ENST00000375274.2_Silent_p.G483G|PTCH1_ENST00000418258.1_Silent_p.G333G|PTCH1_ENST00000430669.2_Silent_p.G418G|PTCH1_ENST00000421141.1_Silent_p.G333G|PTCH1_ENST00000437951.1_Silent_p.G418G|PTCH1_ENST00000429896.2_Silent_p.G333G	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	484	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				ACAGGCCCAGTCCTGCAGCCA	0.572																																																	0													52.0	54.0	53.0					9																	98239880		2203	4300	6503	SO:0001819	synonymous_variant	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1452A>G	9.37:g.98239880T>C		Somatic		WXS	SOLID	Phase_I	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																				0.572	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2		NM_000264	
RAPGEF6	51735	hgsc.bcm.edu;ucsc.edu	37	5	130788816	130788816	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr5:130788816G>T	ENST00000509018.1	-	21	3336	c.3131C>A	c.(3130-3132)tCc>tAc	p.S1044Y	RAPGEF6_ENST00000308008.6_Missense_Mutation_p.S1044Y|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.S1094Y|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.S1044Y|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.S759Y|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.S1049Y|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.S1044Y	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1044	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GATTTCCTTGGAAATCATTCT	0.328																																					Melanoma(168;435 1955 13113 13877 23213)												0													93.0	93.0	93.0					5																	130788816		2203	4300	6503	SO:0001583	missense	51735			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3131C>A	5.37:g.130788816G>T	ENSP00000421684:p.Ser1044Tyr	Somatic		WXS	SOLID	Phase_I	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922019	0.73213	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000514667	T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61	4.94	4.94	0.65067	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.107165	0.64402	D	0.000006	T	0.32406	0.0828	N	0.21240	0.645	0.80722	D	1	B;B;B;B;B;B;B	0.31949	0.236;0.0;0.325;0.035;0.236;0.348;0.129	B;B;B;B;B;B;B	0.42030	0.206;0.006;0.3;0.044;0.206;0.373;0.372	T	0.30650	-0.9971	10	0.87932	D	0	.	18.5281	0.90980	0.0:0.0:1.0:0.0	.	1044;1044;1044;759;1094;1049;1044	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	Y	1044;1049;1044;1044;1049;759;1044;1094	ENSP00000421684:S1044Y;ENSP00000309298:S1049Y;ENSP00000426081:S1044Y;ENSP00000296859:S1044Y;ENSP00000426910:S759Y;ENSP00000311419:S1044Y;ENSP00000426948:S1094Y	ENSP00000426948:S1094Y	S	-	2	0	RAPGEF6;FNIP1	130816715	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.832000	0.99423	2.460000	0.83146	0.467000	0.42956	TCC		0.328	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1		NM_016340	
SCN10A	6336	hgsc.bcm.edu;ucsc.edu	37	3	38798643	38798643	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr3:38798643G>A	ENST00000449082.2	-	8	957	c.958C>T	c.(958-960)Cct>Tct	p.P320S		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	320					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TAACCATCAGGGCAGTGGCTG	0.483																																																	0													89.0	92.0	91.0					3																	38798643		2203	4300	6503	SO:0001583	missense	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.958C>T	3.37:g.38798643G>A	ENSP00000390600:p.Pro320Ser	Somatic		WXS	SOLID	Phase_I	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477336	0.84640	.	.	ENSG00000185313	ENST00000449082	D	0.97303	-4.33	4.93	4.93	0.64822	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	M	0.82193	2.58	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	D	0.99379	1.0922	10	0.87932	D	0	.	18.7053	0.91635	0.0:0.0:1.0:0.0	.	320	Q9Y5Y9	SCNAA_HUMAN	S	320	ENSP00000390600:P320S	ENSP00000390600:P320S	P	-	1	0	SCN10A	38773647	1.000000	0.71417	0.988000	0.46212	0.974000	0.67602	7.816000	0.86201	2.728000	0.93425	0.655000	0.94253	CCT		0.483	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3		NM_006514	
SEMA4D	10507	hgsc.bcm.edu	37	9	92017852	92017852	+	Silent	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr9:92017852C>T	ENST00000450295.1	-	4	962	c.186G>A	c.(184-186)ttG>ttA	p.L62L	SEMA4D_ENST00000356444.2_Silent_p.L62L|SEMA4D_ENST00000455551.2_Silent_p.L62L|SEMA4D_ENST00000420987.1_Silent_p.L62L|SEMA4D_ENST00000438547.2_Silent_p.L62L|SEMA4D_ENST00000343780.4_Silent_p.L62L|SEMA4D_ENST00000339861.4_Silent_p.L62L|SEMA4D_ENST00000422704.2_Silent_p.L62L			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	62	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						CACCTATGTACAAGGTGTCCT	0.577																																																	0													123.0	96.0	105.0					9																	92017852		2203	4300	6503	SO:0001819	synonymous_variant	10507			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.186G>A	9.37:g.92017852C>T		Somatic		WXS	SOLID	Phase_I	B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	ENST00000450295.1	37	CCDS6685.1																																																																																				0.577	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1		NM_006378	
SLC38A10	124565	hgsc.bcm.edu	37	17	79268692	79268692	+	Silent	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr17:79268692C>T	ENST00000374759.3	-	1	413	c.30G>A	c.(28-30)ggG>ggA	p.G10G	SLC38A10_ENST00000288439.5_Silent_p.G10G	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	10					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCGTGATCAGCCCCCAGTTGG	0.672																																																	0													63.0	58.0	60.0					17																	79268692		2203	4300	6503	SO:0001819	synonymous_variant	124565			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.30G>A	17.37:g.79268692C>T		Somatic		WXS	SOLID	Phase_I	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	37	CCDS42397.1																																																																																				0.672	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1		NM_138570	
SPAG1	6674	hgsc.bcm.edu	37	8	101196265	101196265	+	Silent	SNP	A	A	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr8:101196265A>G	ENST00000388798.2	+	6	761	c.570A>G	c.(568-570)aaA>aaG	p.K190K	Y_RNA_ENST00000362797.1_RNA|SPAG1_ENST00000251809.3_Silent_p.K190K|SPAG1_ENST00000520643.1_Silent_p.K190K|SPAG1_ENST00000520508.1_Silent_p.K190K	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	190					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		ACTTGTCTAAAATTGAGACAA	0.269																																																	0													49.0	49.0	49.0					8																	101196265		2202	4290	6492	SO:0001819	synonymous_variant	6674			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.570A>G	8.37:g.101196265A>G		Somatic		WXS	SOLID	Phase_I	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Silent	SNP	ENST00000388798.2	37	CCDS34930.1																																																																																				0.269	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2		NM_172218	
SPESP1	246777	hgsc.bcm.edu	37	15	69237966	69237966	+	Silent	SNP	A	A	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr15:69237966A>G	ENST00000310673.3	+	2	247	c.93A>G	c.(91-93)caA>caG	p.Q31Q	NOX5_ENST00000448182.3_Intron|NOX5_ENST00000455873.3_Intron|RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000260364.5_Intron|SPESP1_ENST00000560188.1_3'UTR	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	31					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						ATGAAGAGCAAAACTTGAATC	0.343																																																	0													51.0	54.0	53.0					15																	69237966		2200	4298	6498	SO:0001819	synonymous_variant	246777			AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.93A>G	15.37:g.69237966A>G		Somatic		WXS	SOLID	Phase_I	Q8NG22|Q8WVH8	Silent	SNP	ENST00000310673.3	37	CCDS10230.1																																																																																				0.343	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1		NM_145658	
SRSF4	6429	hgsc.bcm.edu	37	1	29475160	29475160	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:29475160T>A	ENST00000373795.4	-	6	1481	c.1247A>T	c.(1246-1248)gAa>gTa	p.E416V	SRSF4_ENST00000546138.1_3'UTR|SRSF4_ENST00000466448.1_5'Flank|RP11-242O24.3_ENST00000413004.1_lincRNA	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	416	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						CTTGGCATGTTCCCGCTCCTT	0.562																																																	0													198.0	206.0	204.0					1																	29475160		2203	4300	6503	SO:0001583	missense	6429			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.1247A>T	1.37:g.29475160T>A	ENSP00000362900:p.Glu416Val	Somatic		WXS	SOLID	Phase_I	Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700063	0.48307	.	.	ENSG00000116350	ENST00000373795	T	0.13420	2.59	5.72	5.72	0.89469	.	1.240360	0.05072	N	0.481937	T	0.31606	0.0802	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	P	0.56278	0.795	T	0.00161	-1.1972	10	0.72032	D	0.01	.	15.2015	0.73142	0.0:0.0:0.0:1.0	.	416	Q08170	SRSF4_HUMAN	V	416	ENSP00000362900:E416V	ENSP00000362900:E416V	E	-	2	0	SRSF4	29347747	1.000000	0.71417	0.400000	0.26346	0.747000	0.42532	7.318000	0.79029	2.174000	0.68829	0.533000	0.62120	GAA		0.562	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1		NM_005626	
SST	6750	hgsc.bcm.edu	37	3	187388007	187388007	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr3:187388007C>T	ENST00000287641.3	-	1	180	c.73G>A	c.(73-75)Gct>Act	p.A25T		NM_001048.3	NP_001039.1	P61278	SMS_HUMAN	somatostatin	25					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hyperosmotic response (GO:0006972)|negative regulation of cell proliferation (GO:0008285)|regulation of cell migration (GO:0030334)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to heat (GO:0009408)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)	p.A25T(1)		kidney(1)|large_intestine(1)|lung(6)|pancreas(1)	9	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Cysteamine(DB00847)	TCCGAGGGAGCGCCGGTGACA	0.677																																																	1	Substitution - Missense(1)	pancreas(1)											22.0	22.0	22.0					3																	187388007		2200	4296	6496	SO:0001583	missense	6750				CCDS3288.1	3q28	2013-02-28			ENSG00000157005	ENSG00000157005		"""Endogenous ligands"""	11329	protein-coding gene	gene with protein product	"""somatostatin-14"", ""somatostatin-28"", ""prepro-somatostatin"""	182450				6126875, 6142531	Standard	NM_001048		Approved	SMST	uc003frn.3	P61278	OTTHUMG00000156462	ENST00000287641.3:c.73G>A	3.37:g.187388007C>T	ENSP00000287641:p.Ala25Thr	Somatic		WXS	SOLID	Phase_I	B2R5G3|P01166	Missense_Mutation	SNP	ENST00000287641.3	37	CCDS3288.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636072	0.67130	.	.	ENSG00000157005	ENST00000287641	T	0.34275	1.37	5.48	5.48	0.80851	.	0.210763	0.47852	D	0.000207	T	0.39091	0.1065	M	0.78049	2.395	0.54753	D	0.999982	P	0.36874	0.572	B	0.21546	0.035	T	0.46555	-0.9183	10	0.54805	T	0.06	-3.1289	17.9406	0.89025	0.0:1.0:0.0:0.0	.	25	P61278	SMS_HUMAN	T	25	ENSP00000287641:A25T	ENSP00000287641:A25T	A	-	1	0	SST	188870701	1.000000	0.71417	0.982000	0.44146	0.853000	0.48598	6.073000	0.71245	2.560000	0.86352	0.563000	0.77884	GCT		0.677	SST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344278.1		NM_001048	
TGM6	343641	hgsc.bcm.edu	37	20	2375966	2375966	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr20:2375966G>T	ENST00000202625.2	+	3	369	c.308G>T	c.(307-309)aGc>aTc	p.S103I	TGM6_ENST00000477505.1_Intron|TGM6_ENST00000381423.1_Missense_Mutation_p.S103I	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	103					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	AGTCTCGCCAGCCCTCCCAGT	0.587																																																	0													75.0	63.0	67.0					20																	2375966		2203	4300	6503	SO:0001583	missense	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.308G>T	20.37:g.2375966G>T	ENSP00000202625:p.Ser103Ile	Somatic		WXS	SOLID	Phase_I	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127137	0.37533	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.82433	-1.61;-1.61	4.64	3.68	0.42216	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.350897	0.33092	N	0.005298	D	0.88206	0.6374	M	0.77406	2.37	0.33928	D	0.641672	D;D	0.55800	0.966;0.973	P;P	0.58721	0.758;0.844	D	0.91963	0.5580	10	0.87932	D	0	-30.0151	10.8784	0.46925	0.0931:0.0:0.9069:0.0	.	103;103	O95932-2;O95932	.;TGM3L_HUMAN	I	103	ENSP00000202625:S103I;ENSP00000370831:S103I	ENSP00000202625:S103I	S	+	2	0	TGM6	2323966	1.000000	0.71417	0.998000	0.56505	0.181000	0.23173	3.807000	0.55591	1.160000	0.42584	0.655000	0.94253	AGC		0.587	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2		NM_198994	
TRIM45	80263	hgsc.bcm.edu	37	1	117660996	117660996	+	Silent	SNP	C	C	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr1:117660996C>T	ENST00000256649.4	-	2	1408	c.882G>A	c.(880-882)aaG>aaA	p.K294K	TRIM45_ENST00000369464.3_Silent_p.K294K|TRIM45_ENST00000369461.3_Silent_p.K237K	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	294					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		GCTTCAGCAGCTTGTCCCGAT	0.557																																																	0													78.0	76.0	77.0					1																	117660996		2203	4300	6503	SO:0001819	synonymous_variant	80263				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.882G>A	1.37:g.117660996C>T		Somatic		WXS	SOLID	Phase_I	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Silent	SNP	ENST00000256649.4	37	CCDS893.1																																																																																				0.557	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1		NM_025188	
USP32	84669	hgsc.bcm.edu;ucsc.edu	37	17	58343414	58343414	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr17:58343414G>A	ENST00000300896.4	-	8	1044	c.850C>T	c.(850-852)Ctc>Ttc	p.L284F	USP32_ENST00000393003.3_Missense_Mutation_p.L284F	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	284	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			ACCCTGGAGAGAACTCCATCA	0.368																																																	0													125.0	118.0	121.0					17																	58343414		2203	4300	6503	SO:0001583	missense	84669			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.850C>T	17.37:g.58343414G>A	ENSP00000300896:p.Leu284Phe	Somatic		WXS	SOLID	Phase_I	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.074578	0.55646	.	.	ENSG00000170832	ENST00000300896;ENST00000393003	T;T	0.54675	0.56;0.56	5.6	5.6	0.85130	EF-hand-like domain (1);	0.063999	0.64402	D	0.000004	T	0.71316	0.3325	M	0.76170	2.325	0.80722	D	1	D;B	0.76494	0.999;0.293	D;B	0.83275	0.996;0.212	T	0.72975	-0.4128	10	0.56958	D	0.05	.	13.531	0.61621	0.0755:0.0:0.9245:0.0	.	284;284	Q7Z5T3;Q8NFA0	.;UBP32_HUMAN	F	284	ENSP00000300896:L284F;ENSP00000376727:L284F	ENSP00000300896:L284F	L	-	1	0	USP32	55698196	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.517000	0.53443	2.643000	0.89663	0.591000	0.81541	CTC		0.368	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2		NM_032582	
VHL	7428	hgsc.bcm.edu;ucsc.edu	37	3	10191470	10191470	+	Splice_Site	SNP	G	G	A	rs5030817		TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr3:10191470G>A	ENST00000256474.2	+	3	1303		c.e3-1		VHL_ENST00000345392.2_Splice_Site|VHL_ENST00000477538.1_Splice_Site	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase						cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(23)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGCCCTTCCAGTGTATACTCT	0.493		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	23	Unknown(23)	kidney(21)|soft_tissue(2)	GRCh37	CS071276|CS941547|CS961706	VHL	S	rs5030817						88.0	80.0	83.0					3																	10191470		2203	4300	6503	SO:0001630	splice_region_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.464-1G>A	3.37:g.10191470G>A		Somatic		WXS	SOLID	Phase_I	B2RE45|Q13599|Q6PDA9	Splice_Site	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983329	0.35036	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2774	0.73753	0.0:0.0:1.0:0.0	rs5030817	.	.	.	.	-1	.	.	.	+	.	.	VHL	10166470	1.000000	0.71417	1.000000	0.80357	0.419000	0.31324	7.062000	0.76706	2.535000	0.85469	0.655000	0.94253	.		0.493	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	Intron
YWHAE	7531	hgsc.bcm.edu	37	17	1257623	1257623	+	Silent	SNP	A	A	G			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr17:1257623A>G	ENST00000264335.8	-	5	864	c.597T>C	c.(595-597)ttT>ttC	p.F199F	YWHAE_ENST00000571732.1_Silent_p.F177F|YWHAE_ENST00000573026.1_Intron|YWHAE_ENST00000575977.1_Intron	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon	199					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		TTGCATCATCAAAAGCTGCTT	0.353			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome																																	Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	0													96.0	77.0	83.0					17																	1257623		2203	4300	6503	SO:0001819	synonymous_variant	7531			U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.597T>C	17.37:g.1257623A>G		Somatic		WXS	SOLID	Phase_I	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Silent	SNP	ENST00000264335.8	37	CCDS11001.1																																																																																				0.353	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259354.3		NM_006761	
ZBTB25	7597	hgsc.bcm.edu	37	14	64953924	64953924	+	Missense_Mutation	SNP	G	G	T	rs142507817		TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr14:64953924G>T	ENST00000608382.1	-	3	1216	c.1025C>A	c.(1024-1026)tCt>tAt	p.S342Y	ZBTB25_ENST00000394715.1_Missense_Mutation_p.S342Y|ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000555424.1_Intron	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	342					gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S342F(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		CCTTGAAAAAGAAAAATTACA	0.403																																																	1	Substitution - Missense(1)	skin(1)											104.0	111.0	108.0					14																	64953924		2203	4300	6503	SO:0001583	missense	7597			X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.1025C>A	14.37:g.64953924G>T	ENSP00000476746:p.Ser342Tyr	Somatic		WXS	SOLID	Phase_I	B3KUX6|Q8IYH9	Missense_Mutation	SNP	ENST00000608382.1	37	CCDS9765.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399506	0.62177	.	.	ENSG00000089775	ENST00000261683;ENST00000394715	T;T	0.24350	1.86;1.86	5.97	5.97	0.96955	.	0.140827	0.49916	D	0.000139	T	0.38799	0.1054	L	0.27053	0.805	0.44380	D	0.99728	D	0.69078	0.997	D	0.63597	0.916	T	0.03175	-1.1064	10	0.39692	T	0.17	-16.2397	20.0492	0.97617	0.0:0.0:1.0:0.0	.	342	P24278	ZBT25_HUMAN	Y	342	ENSP00000261683:S342Y;ENSP00000378204:S342Y	ENSP00000261683:S342Y	S	-	2	0	ZBTB25	64023677	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.191000	0.89716	2.836000	0.97738	0.655000	0.94253	TCT		0.403	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2		NM_006977	
ZNF704	619279	hgsc.bcm.edu;ucsc.edu	37	8	81577134	81577134	+	Silent	SNP	G	G	T			TCGA-B0-4819-01A-01D-1361-10	TCGA-B0-4819-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5df3f4f0-5000-42a2-9e85-c3b0e93eae49	d02a7555-9cad-43ac-883c-031847eba9e2	g.chr8:81577134G>T	ENST00000327835.3	-	6	1074	c.843C>A	c.(841-843)gcC>gcA	p.A281A	ZNF704_ENST00000520336.1_5'Flank	NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	281							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			TCTCCGTTTTGGCACAAGGAG	0.587																																																	0													143.0	126.0	131.0					8																	81577134		2203	4300	6503	SO:0001819	synonymous_variant	619279			AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.843C>A	8.37:g.81577134G>T		Somatic		WXS	SOLID	Phase_I	B2RNE6|B9EGW6	Silent	SNP	ENST00000327835.3	37	CCDS34913.1																																																																																				0.587	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379964.2		NM_001033723	
