#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM23	8745	hgsc.bcm.edu	37	2	207424812	207424812	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr2:207424812A>T	ENST00000264377.3	+	11	1467	c.1139A>T	c.(1138-1140)aAg>aTg	p.K380M	ADAM23_ENST00000374415.3_Missense_Mutation_p.K380M|ADAM23_ENST00000374416.1_Missense_Mutation_p.K380M	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	380	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CAGCGCATTAAGCAGCATGCT	0.473																																					Melanoma(194;1127 2130 19620 24042 27855)												0													116.0	91.0	99.0					2																	207424812		2203	4300	6503	SO:0001583	missense	8745			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1139A>T	2.37:g.207424812A>T	ENSP00000264377:p.Lys380Met	Somatic		WXS	SOLID	Phase_I	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.762270	0.49468	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.09255	3.0;3.0;3.0	5.64	3.15	0.36227	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.189972	0.36134	N	0.002764	T	0.25494	0.0620	L	0.60455	1.87	0.43536	D	0.99582	D	0.57899	0.981	D	0.64321	0.924	T	0.00127	-1.2019	10	0.87932	D	0	.	12.0194	0.53333	0.8639:0.0:0.1361:0.0	.	380	O75077	ADA23_HUMAN	M	380;380;274;380	ENSP00000264377:K380M;ENSP00000363537:K380M;ENSP00000363536:K380M	ENSP00000264377:K380M	K	+	2	0	ADAM23	207133057	1.000000	0.71417	0.988000	0.46212	0.716000	0.41182	4.139000	0.58024	0.052000	0.16007	-1.447000	0.01057	AAG		0.473	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2		NM_003812	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128956323	128956323	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr5:128956323C>A	ENST00000274487.4	+	9	1618	c.1473C>A	c.(1471-1473)aaC>aaA	p.N491K	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	491	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGGGCATTAACCATGACAATG	0.338																																																	0													106.0	96.0	100.0					5																	128956323		2203	4300	6503	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1473C>A	5.37:g.128956323C>A	ENSP00000274487:p.Asn491Lys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634563	0.47049	.	.	ENSG00000145808	ENST00000274487	T	0.62364	0.03	4.51	0.914	0.19360	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.063726	0.64402	D	0.000014	T	0.62036	0.2395	L	0.31578	0.945	0.48236	D	0.99961	D	0.63880	0.993	D	0.69654	0.965	T	0.55736	-0.8094	9	.	.	.	.	8.7657	0.34702	0.0:0.4112:0.0:0.5888	.	491	Q8TE59	ATS19_HUMAN	K	491	ENSP00000274487:N491K	.	N	+	3	2	ADAMTS19	128984222	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.717000	0.25851	0.150000	0.19136	-0.302000	0.09304	AAC		0.338	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2		NM_133638	
ADAMTSL4	54507	hgsc.bcm.edu;ucsc.edu	37	1	150531786	150531786	+	Silent	SNP	C	C	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:150531786C>A	ENST00000369038.2	+	15	2988	c.2787C>A	c.(2785-2787)ggC>ggA	p.G929G	ADAMTSL4_ENST00000271643.4_Silent_p.G929G|ADAMTSL4_ENST00000369039.5_Silent_p.G952G|RP11-54A4.2_ENST00000442435.2_RNA			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	929	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GTGGCTCTGGCACACAGCGTA	0.597											OREG0013787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													95.0	74.0	81.0					1																	150531786		2203	4300	6503	SO:0001819	synonymous_variant	54507			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2787C>A	1.37:g.150531786C>A		Somatic	1733	WXS	SOLID	Phase_I	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Silent	SNP	ENST00000369038.2	37	CCDS955.1																																																																																				0.597	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4		NM_019032	
AP2B1	163	hgsc.bcm.edu	37	17	33951514	33951514	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:33951514G>A	ENST00000262325.7	+	6	1177	c.624G>A	c.(622-624)ctG>ctA	p.L208L	AP2B1_ENST00000312678.8_Silent_p.L208L|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000538556.1_Silent_p.L151L|AP2B1_ENST00000537622.2_Silent_p.L208L|AP2B1_ENST00000592545.1_Silent_p.L170L|AP2B1_ENST00000589344.1_Silent_p.L208L	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	208					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ATAAGCTGCTGACAGCCCTGA	0.473																																																	0													107.0	92.0	97.0					17																	33951514		2203	4300	6503	SO:0001819	synonymous_variant	163			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.624G>A	17.37:g.33951514G>A		Somatic		WXS	SOLID	Phase_I	A6NJP3|P21851|Q7Z451|Q96J19	Silent	SNP	ENST00000262325.7	37	CCDS32622.1																																																																																				0.473	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1			
ARHGEF5	7984	hgsc.bcm.edu	37	7	144061222	144061222	+	Missense_Mutation	SNP	A	A	G	rs1209412		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:144061222A>G	ENST00000056217.5	+	2	1634	c.1460A>G	c.(1459-1461)gAa>gGa	p.E487G	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	487				E -> G (in Ref. 2; BAD18708). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E487G(5)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CAGCAAGAGGAATCCAGGCTG	0.537																																																	5	Substitution - Missense(5)	kidney(5)											33.0	30.0	31.0					7																	144061222		1051	1888	2939	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.1460A>G	7.37:g.144061222A>G	ENSP00000056217:p.Glu487Gly	Somatic		WXS	SOLID	Phase_I	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.380873	0.01204	.	.	ENSG00000050327	ENST00000056217	T	0.74842	-0.88	3.96	-1.85	0.07784	.	0.740232	0.11016	N	0.608952	T	0.38054	0.1026	N	0.01168	-0.975	0.36950	P	0.10716800000000004	B	0.02656	0.0	B	0.01281	0.0	T	0.33624	-0.9861	8	.	.	.	-1.3111	5.374	0.16154	0.5924:0.1606:0.247:0.0	.	487	Q12774	ARHG5_HUMAN	G	487	ENSP00000056217:E487G	.	E	+	2	0	ARHGEF5	143692155	0.000000	0.05858	0.017000	0.16124	0.097000	0.18754	-1.265000	0.02844	-0.559000	0.06110	-1.294000	0.01345	GAA		0.537	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1		NM_005435	
ARHGEF5	7984	hgsc.bcm.edu;ucsc.edu	37	7	144070338	144070338	+	Silent	SNP	A	A	G	rs547539170	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:144070338A>G	ENST00000056217.5	+	10	4275	c.4101A>G	c.(4099-4101)gaA>gaG	p.E1367E	ARHGEF5_ENST00000471847.2_Silent_p.E289E	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1367					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GGACAGAGGAACTAATCTACC	0.522													G|||	36	0.0071885	0.0144	0.0014	5008	,	,		18804	0.0129		0.001	False		,,,				2504	0.002																0													155.0	140.0	145.0					7																	144070338		1993	4003	5996	SO:0001819	synonymous_variant	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.4101A>G	7.37:g.144070338A>G		Somatic		WXS	SOLID	Phase_I	A6NNJ2|Q6ZML7	Silent	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	3.868	-0.028589	0.07589	.	.	ENSG00000050327	ENST00000474817	.	.	.	4.54	0.331	0.15933	.	.	.	.	.	T	0.48059	0.1479	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	T	0.55036	-0.8203	3	.	.	.	-12.8845	9.8626	0.41123	0.3826:0.0:0.6174:0.0	.	.	.	.	S	621	.	.	N	+	2	0	ARHGEF5	143701271	0.999000	0.42202	0.988000	0.46212	0.452000	0.32318	0.526000	0.22971	-0.052000	0.13311	-0.716000	0.03619	AAC		0.522	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1		NM_005435	
ARMC4	55130	hgsc.bcm.edu	37	10	28257853	28257853	+	Splice_Site	SNP	G	G	C	rs57067036	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr10:28257853G>C	ENST00000305242.5	-	9	1329	c.1237C>G	c.(1237-1239)Cgg>Ggg	p.R413G	ARMC4_ENST00000239715.3_Splice_Site_p.R270G|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000545014.1_Intron|ARMC4_ENST00000537576.1_Splice_Site_p.R105G	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	413					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.R413G(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						GAAACATACCGAAGTAATTGT	0.453													G|||	402	0.0802716	0.1082	0.1037	5008	,	,		17999	0.0099		0.0845	False		,,,				2504	0.0941																1	Substitution - Missense(1)	large_intestine(1)											4.0	3.0	3.0					10																	28257853		1476	3114	4590	SO:0001630	splice_region_variant	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1238+1C>G	10.37:g.28257853G>C		Somatic		WXS	SOLID	Phase_I	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	.	.	.	.	.	.	.	.	.	.	G	1.710	-0.499285	0.04291	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000537573;ENST00000434029;ENST00000239715	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	3.89	2.01	0.26516	.	1.074070	0.07060	N	0.833582	T	0.32645	0.0836	L	0.54323	1.7	0.09310	N	1	B	0.23650	0.089	B	0.20184	0.028	T	0.29761	-1.0001	10	0.42905	T	0.14	-2.5181	5.8125	0.18473	0.1073:0.1956:0.6971:0.0	.	413	Q5T2S8	ARMC4_HUMAN	G	105;413;105;307;270	ENSP00000443208:R105G;ENSP00000306410:R413G;ENSP00000398155:R307G;ENSP00000239715:R270G	ENSP00000239715:R270G	R	-	1	2	ARMC4	28297859	0.264000	0.24093	0.040000	0.18447	0.005000	0.04900	0.581000	0.23819	0.598000	0.29829	-0.232000	0.12228	CGG		0.453	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1		NM_018076	Missense_Mutation
ASXL3	80816	hgsc.bcm.edu;ucsc.edu	37	18	31319454	31319454	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr18:31319454T>G	ENST00000269197.5	+	11	2086	c.2086T>G	c.(2086-2088)Tcc>Gcc	p.S696A		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	696	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ATCTCTTATGTCCAACTTACC	0.373																																																	0													182.0	175.0	177.0					18																	31319454		1917	4134	6051	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2086T>G	18.37:g.31319454T>G	ENSP00000269197:p.Ser696Ala	Somatic		WXS	SOLID	Phase_I	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.495153	0.64186	.	.	ENSG00000141431	ENST00000269197	T	0.22134	1.97	5.91	5.91	0.95273	.	0.949808	0.08876	N	0.880841	T	0.49830	0.1580	M	0.71036	2.16	0.42590	D	0.993241	D	0.64830	0.994	D	0.72625	0.978	T	0.10428	-1.0630	10	0.45353	T	0.12	.	16.3432	0.83101	0.0:0.0:0.0:1.0	.	696	Q9C0F0	ASXL3_HUMAN	A	696	ENSP00000269197:S696A	ENSP00000269197:S696A	S	+	1	0	ASXL3	29573452	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.252000	0.65445	2.263000	0.75096	0.377000	0.23210	TCC		0.373	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			
ATP2A1	487	hgsc.bcm.edu	37	16	28913193	28913193	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr16:28913193G>T	ENST00000357084.3	+	16	2377	c.2110G>T	c.(2110-2112)Ggc>Tgc	p.G704C	ATP2A1_ENST00000536376.1_Missense_Mutation_p.G579C|ATP2A1_ENST00000395503.4_Missense_Mutation_p.G704C	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	704					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)	p.G704C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GACAGGTGATGGCGTCAATGA	0.537																																																	1	Substitution - Missense(1)	ovary(1)											47.0	40.0	43.0					16																	28913193		2197	4300	6497	SO:0001583	missense	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2110G>T	16.37:g.28913193G>T	ENSP00000349595:p.Gly704Cys	Somatic		WXS	SOLID	Phase_I	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994955	0.54041	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.99515	-6.06;-6.06;-6.06	5.27	4.31	0.51392	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.99783	4.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96743	0.9548	10	0.87932	D	0	.	12.9867	0.58596	0.0803:0.0:0.9197:0.0	.	579;704;704	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	C	704;704;741;579	ENSP00000349595:G704C;ENSP00000378879:G704C;ENSP00000443101:G579C	ENSP00000349595:G704C	G	+	1	0	ATP2A1	28820694	1.000000	0.71417	0.709000	0.30452	0.348000	0.29142	9.761000	0.98940	1.216000	0.43427	0.561000	0.74099	GGC		0.537	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2		NM_004320	
BDP1	55814	hgsc.bcm.edu;ucsc.edu	37	5	70855948	70855948	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr5:70855948G>A	ENST00000358731.4	+	37	7643	c.7380G>A	c.(7378-7380)gtG>gtA	p.V2460V	BDP1_ENST00000380675.2_3'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2460					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ACAAGAATGTGCCTCAGTTAC	0.438																																																	0													131.0	120.0	124.0					5																	70855948		1963	4164	6127	SO:0001819	synonymous_variant	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.7380G>A	5.37:g.70855948G>A		Somatic		WXS	SOLID	Phase_I	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	ENST00000358731.4	37	CCDS43328.1																																																																																				0.438	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2		NM_018429	
C10orf2	56652	hgsc.bcm.edu	37	10	102748452	102748452	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr10:102748452T>G	ENST00000311916.2	+	1	670	c.485T>G	c.(484-486)aTa>aGa	p.I162R	C10orf2_ENST00000370228.1_Missense_Mutation_p.I162R|MRPL43_ENST00000370241.3_5'Flank|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000370236.1_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|MRPL43_ENST00000342071.1_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000299179.5_5'Flank|MRPL43_ENST00000318325.2_5'Flank|MRPL43_ENST00000493646.1_5'Flank	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	162					cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AACCGAGCAATACCTCTCTGG	0.562																																																	0													148.0	167.0	161.0					10																	102748452		2203	4300	6503	SO:0001583	missense	56652			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.485T>G	10.37:g.102748452T>G	ENSP00000309595:p.Ile162Arg	Somatic		WXS	SOLID	Phase_I	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	ENST00000311916.2	37	CCDS7506.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.682383	0.29872	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	D;D	0.95103	-3.28;-3.61	5.71	5.71	0.89125	.	0.569631	0.18005	N	0.154764	D	0.88735	0.6517	N	0.22421	0.69	0.40583	D	0.981418	B;P	0.35923	0.374;0.528	B;B	0.31614	0.132;0.133	D	0.87407	0.2373	10	0.20519	T	0.43	-14.6287	14.8057	0.69952	0.0:0.0:0.0:1.0	.	162;162	Q96RR1-2;Q96RR1	.;PEO1_HUMAN	R	162	ENSP00000309595:I162R;ENSP00000359248:I162R	ENSP00000309595:I162R	I	+	2	0	C10orf2	102738442	1.000000	0.71417	0.867000	0.34043	0.617000	0.37484	4.713000	0.61895	2.180000	0.69256	0.379000	0.24179	ATA		0.562	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049886.1		NM_021830	
C1orf52	148423	hgsc.bcm.edu;ucsc.edu	37	1	85718361	85718361	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:85718361G>T	ENST00000471115.1	-	3	508	c.500C>A	c.(499-501)tCt>tAt	p.S167Y	C1orf52_ENST00000294661.4_5'UTR	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	167							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		GCGCTTTTTAGAAGTATGCTC	0.318																																																	0													133.0	119.0	124.0					1																	85718361		2202	4297	6499	SO:0001583	missense	148423			BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.500C>A	1.37:g.85718361G>T	ENSP00000419417:p.Ser167Tyr	Somatic		WXS	SOLID	Phase_I	B3KX89|Q8TDK5|Q8TDK6	Missense_Mutation	SNP	ENST00000471115.1	37	CCDS703.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783138	0.70222	.	.	ENSG00000162642	ENST00000471115	.	.	.	5.82	5.82	0.92795	.	0.411817	0.26967	N	0.021592	T	0.53465	0.1798	L	0.36672	1.1	0.80722	D	1	P	0.49559	0.925	P	0.54100	0.742	T	0.58086	-0.7698	9	0.87932	D	0	-11.9558	15.5931	0.76554	0.0:0.0:1.0:0.0	.	167	Q8N6N3	CA052_HUMAN	Y	167	.	ENSP00000419417:S167Y	S	-	2	0	C1orf52	85490949	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.856000	0.55964	2.756000	0.94617	0.561000	0.74099	TCT		0.318	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027616.2		NM_198077	
BPIFA3	128861	hgsc.bcm.edu;ucsc.edu	37	20	31815351	31815351	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr20:31815351G>A	ENST00000375454.3	+	7	903	c.693G>A	c.(691-693)gaG>gaA	p.E231E	BPIFA3_ENST00000490499.1_3'UTR|BPIFA3_ENST00000375452.3_Silent_p.E195E	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	231						extracellular region (GO:0005576)	lipid binding (GO:0008289)										CAGAACAGGAGGCTGCTCATG	0.557																																																	0													96.0	107.0	103.0					20																	31815351		2057	4198	6255	SO:0001819	synonymous_variant	0				CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.693G>A	20.37:g.31815351G>A		Somatic		WXS	SOLID	Phase_I	Q5JWG8|Q6NZ38	Silent	SNP	ENST00000375454.3	37	CCDS13216.2																																																																																				0.557	BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1		NM_178466	
CNPPD1	27013	hgsc.bcm.edu	37	2	220038162	220038162	+	Silent	SNP	T	T	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr2:220038162T>A	ENST00000409789.1	-	8	1027	c.600A>T	c.(598-600)cgA>cgT	p.R200R	CNPPD1_ENST00000360507.5_Silent_p.R200R			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	200					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						TGTACCAGCCTCGCCACCGTC	0.622																																																	0													44.0	43.0	44.0					2																	220038162		2203	4300	6503	SO:0001819	synonymous_variant	0			AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.600A>T	2.37:g.220038162T>A		Somatic		WXS	SOLID	Phase_I	B2RC77|O75548|Q9H4N0|Q9UQN0	Silent	SNP	ENST00000409789.1	37	CCDS2433.1																																																																																				0.622	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1		NM_015680	
C4orf27	54969	hgsc.bcm.edu;ucsc.edu	37	4	170671701	170671701	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:170671701G>A	ENST00000393381.2	-	3	459	c.384C>T	c.(382-384)caC>caT	p.H128H		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	128						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		AATACCCCATGTGGTACTGAG	0.393																																																	0													102.0	105.0	104.0					4																	170671701		2203	4300	6503	SO:0001819	synonymous_variant	54969			BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.384C>T	4.37:g.170671701G>A		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000393381.2	37	CCDS3813.1																																																																																				0.393	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363140.1		NM_017867	
CCL2	6347	hgsc.bcm.edu	37	17	32583304	32583304	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:32583304G>C	ENST00000225831.4	+	2	205	c.140G>C	c.(139-141)aGg>aCg	p.R47T	AC005549.3_ENST00000601918.1_5'Flank|CCL2_ENST00000580907.1_Missense_Mutation_p.R47T	NM_002982.3	NP_002973.1	P13500	CCL2_HUMAN	chemokine (C-C motif) ligand 2	47		Involved in GAG binding and receptor binding.			activation of signaling protein activity involved in unfolded protein response (GO:0006987)|aging (GO:0007568)|angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeleton organization (GO:0007010)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|helper T cell extravasation (GO:0035684)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|maternal process involved in parturition (GO:0060137)|monocyte chemotaxis (GO:0002548)|negative regulation of angiogenesis (GO:0016525)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of natural killer cell chemotaxis (GO:2000502)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|organ regeneration (GO:0031100)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of calcium ion import (GO:0090280)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of T cell activation (GO:0050870)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of vascular endothelial growth factor production (GO:0010574)|response to activity (GO:0014823)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to vitamin B3 (GO:0033552)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	CCR2 chemokine receptor binding (GO:0031727)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			kidney(1)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	6	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Danazol(DB01406)|Mimosine(DB01055)	TCAGTGCAGAGGCTCGCGAGC	0.453																																																	0													85.0	87.0	86.0					17																	32583304		2203	4300	6503	SO:0001583	missense	6347			BC009716	CCDS11277.1	17q11.2-q21.1	2013-02-25	2002-08-22	2002-08-23	ENSG00000108691	ENSG00000108691		"""Chemokine ligands"", ""Endogenous ligands"""	10618	protein-coding gene	gene with protein product	"""monocyte chemotactic protein 1, homologous to mouse Sig-je"", ""monocyte chemoattractant protein-1"", ""monocyte chemotactic and activating factor"", ""monocyte secretory protein JE"", ""small inducible cytokine subfamily A (Cys-Cys), member 2"""	158105	"""small inducible cytokine A2 (monocyte chemotactic protein 1, homologous to mouse Sig-je)"""	SCYA2		2004761	Standard	NM_002982		Approved	MCP1, MCP-1, MCAF, SMC-CF, GDCF-2, HC11, MGC9434	uc002hhy.3	P13500	OTTHUMG00000132887	ENST00000225831.4:c.140G>C	17.37:g.32583304G>C	ENSP00000225831:p.Arg47Thr	Somatic		WXS	SOLID	Phase_I	B2R4V3|Q9UDF3	Missense_Mutation	SNP	ENST00000225831.4	37	CCDS11277.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281191	0.59758	.	.	ENSG00000108691	ENST00000225831	T	0.04917	3.53	4.61	-1.17	0.09648	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.611961	0.15402	N	0.264231	T	0.12689	0.0308	.	.	.	0.20821	N	0.999843	D	0.57571	0.98	P	0.62740	0.906	T	0.10314	-1.0635	9	0.54805	T	0.06	.	3.4349	0.07442	0.397:0.0:0.4272:0.1758	.	47	P13500	CCL2_HUMAN	T	47	ENSP00000225831:R47T	ENSP00000225831:R47T	R	+	2	0	CCL2	29607417	0.723000	0.28027	0.134000	0.22075	0.395000	0.30598	0.015000	0.13355	0.034000	0.15491	0.491000	0.48974	AGG		0.453	CCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256384.2		NM_002982	
CCRN4L	25819	hgsc.bcm.edu;ucsc.edu	37	4	139965861	139965861	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:139965861T>C	ENST00000280614.2	+	3	722	c.529T>C	c.(529-531)Tgt>Cgt	p.C177R	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	177					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					AGAAAGGAAATGTCTCATCCT	0.463																																					Ovarian(144;566 1842 19130 21379 22209)												0													92.0	87.0	89.0					4																	139965861		2203	4300	6503	SO:0001583	missense	25819			AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.529T>C	4.37:g.139965861T>C	ENSP00000280614:p.Cys177Arg	Somatic		WXS	SOLID	Phase_I	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Missense_Mutation	SNP	ENST00000280614.2	37	CCDS3743.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.429813	0.25726	.	.	ENSG00000151014	ENST00000280614	T	0.26660	1.72	5.14	5.14	0.70334	Endonuclease/exonuclease/phosphatase (2);	0.060985	0.85682	D	0.000000	T	0.07683	0.0193	N	0.00419	-1.52	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.26985	-1.0087	9	.	.	.	-13.4123	14.9463	0.71035	0.0:0.0:0.0:1.0	.	177	Q9UK39	NOCT_HUMAN	R	177	ENSP00000280614:C177R	.	C	+	1	0	CCRN4L	140185311	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.030000	0.64128	1.938000	0.56188	0.454000	0.30748	TGT		0.463	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3		NM_012118	
CHFR	55743	hgsc.bcm.edu	37	12	133454224	133454224	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr12:133454224G>C	ENST00000432561.2	-	3	223	c.150C>G	c.(148-150)ttC>ttG	p.F50L	CHFR_ENST00000450056.2_Missense_Mutation_p.F50L|CHFR_ENST00000266880.7_Missense_Mutation_p.F50L|CHFR_ENST00000315585.7_Missense_Mutation_p.F50L|CHFR_ENST00000443047.2_Missense_Mutation_p.F50L|CHFR_ENST00000541837.2_5'UTR			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	50	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TATTGCTGGGGAAGGAAAGGT	0.448																																																	0													111.0	100.0	104.0					12																	133454224		2203	4300	6503	SO:0001583	missense	55743			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.150C>G	12.37:g.133454224G>C	ENSP00000392395:p.Phe50Leu	Somatic		WXS	SOLID	Phase_I	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163506	0.57476	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000432561;ENST00000540963	D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.27	-1.03	0.10102	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.111524	0.64402	D	0.000008	T	0.57946	0.2088	N	0.02916	-0.46	0.50467	D	0.999872	B;P;P;P;B	0.49696	0.354;0.91;0.927;0.91;0.04	B;B;B;B;B	0.42827	0.057;0.278;0.399;0.278;0.019	T	0.54576	-0.8273	10	0.36615	T	0.2	-19.7452	6.3548	0.21395	0.3888:0.0:0.502:0.1092	.	50;50;50;50;50	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	L	50	ENSP00000320557:F50L;ENSP00000416431:F50L;ENSP00000398735:F50L;ENSP00000266880:F50L;ENSP00000392395:F50L;ENSP00000441837:F50L	ENSP00000266880:F50L	F	-	3	2	CHFR	131964297	0.947000	0.32204	0.356000	0.25785	0.885000	0.51271	0.015000	0.13355	-0.231000	0.09825	0.558000	0.71614	TTC		0.448	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2			
CIDEC	63924	hgsc.bcm.edu	37	3	9908860	9908860	+	Silent	SNP	C	C	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr3:9908860C>T	ENST00000336832.2	-	6	814	c.675G>A	c.(673-675)aaG>aaA	p.K225K	CIDEC_ENST00000423850.1_Silent_p.K151K|CIDEC_ENST00000430427.1_Silent_p.K235K|CIDEC_ENST00000383817.1_Missense_Mutation_p.G110S|CIDEC_ENST00000455015.1_Silent_p.K151K|CIDEC_ENST00000443115.1_Missense_Mutation_p.G110S	NM_001199552.1|NM_001199623.1|NM_022094.3	NP_001186481.1|NP_001186552.1|NP_071377.2	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	225					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|lipid particle organization (GO:0034389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	8	Medulloblastoma(99;0.227)					GGGATGAGGCCTTGCCCTTGG	0.587																																																	0													109.0	107.0	108.0					3																	9908860		2203	4300	6503	SO:0001819	synonymous_variant	63924				CCDS2587.1, CCDS56239.1, CCDS74897.1	3p25	2004-07-26			ENSG00000187288	ENSG00000187288			24229	protein-coding gene	gene with protein product		612120				12429024	Standard	NM_001199623		Approved	CIDE-3, FLJ20871, Fsp27	uc021wsw.1	Q96AQ7	OTTHUMG00000128522	ENST00000336832.2:c.675G>A	3.37:g.9908860C>T		Somatic		WXS	SOLID	Phase_I	C9JMN7|Q67DW9|Q9GZY9	Silent	SNP	ENST00000336832.2	37	CCDS2587.1	.	.	.	.	.	.	.	.	.	.	c	9.217	1.032363	0.19590	.	.	ENSG00000187288	ENST00000383817;ENST00000443115	.	.	.	5.04	-0.228	0.13098	.	.	.	.	.	T	0.29126	0.0724	.	.	.	0.09310	N	1	B	0.14805	0.011	B	0.17098	0.017	T	0.30387	-0.9980	7	0.87932	D	0	-7.4783	5.9144	0.19048	0.0:0.4658:0.2745:0.2597	.	110	Q96AQ7-3	.	S	110	.	ENSP00000373328:G110S	G	-	1	0	CIDEC	9883860	0.000000	0.05858	0.118000	0.21660	0.616000	0.37450	-0.156000	0.10100	0.044000	0.15775	-0.253000	0.11424	GGC		0.587	CIDEC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250334.1		NM_022094	
COL25A1	84570	hgsc.bcm.edu;ucsc.edu	37	4	109790280	109790280	+	Silent	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:109790280T>C	ENST00000399132.1	-	20	1577	c.1047A>G	c.(1045-1047)caA>caG	p.Q349Q	COL25A1_ENST00000399127.1_Silent_p.Q345Q|COL25A1_ENST00000399126.1_Silent_p.Q349Q	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CTGGTTCTCCTTGAGGACCAA	0.323																																																	0													80.0	80.0	80.0					4																	109790280		1823	4071	5894	SO:0001819	synonymous_variant	84570			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1047A>G	4.37:g.109790280T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000399132.1	37	CCDS43258.1																																																																																				0.323	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2		NM_032518	
CYP4A22	284541	hgsc.bcm.edu;ucsc.edu	37	1	47610117	47610117	+	Silent	SNP	C	C	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:47610117C>T	ENST00000371891.3	+	7	910	c.879C>T	c.(877-879)gaC>gaT	p.D293D	CYP4A22_ENST00000294337.3_Silent_p.D293D|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.H242Y|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	293						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATTTTCTGGACATCCTCCTCT	0.507																																					Pancreas(88;1240 1470 2099 14214 37557)												0													162.0	152.0	156.0					1																	47610117		2203	4300	6503	SO:0001819	synonymous_variant	284541				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.879C>T	1.37:g.47610117C>T		Somatic		WXS	SOLID	Phase_I	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Silent	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	c	11.57	1.677342	0.29783	.	.	ENSG00000162365	ENST00000371890	T	0.73047	-0.71	1.51	1.51	0.23008	.	.	.	.	.	T	0.55752	0.1940	.	.	.	0.80722	D	1	B	0.29988	0.264	B	0.33690	0.168	T	0.45644	-0.9247	8	0.28530	T	0.3	.	4.9477	0.13999	0.0:0.6861:0.0:0.3139	.	242	Q5TCH5	.	Y	242	ENSP00000360957:H242Y	ENSP00000360957:H242Y	H	+	1	0	CYP4A22	47382704	0.991000	0.36638	0.996000	0.52242	0.350000	0.29205	0.279000	0.18771	0.842000	0.35045	0.194000	0.17425	CAT		0.507	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1		XM_208213	
DACT1	51339	hgsc.bcm.edu	37	14	59113726	59113726	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr14:59113726G>A	ENST00000335867.4	+	4	2409	c.2385G>A	c.(2383-2385)acG>acA	p.T795T	DACT1_ENST00000541264.2_Silent_p.T514T|DACT1_ENST00000556859.1_Silent_p.T514T|DACT1_ENST00000395153.3_Silent_p.T758T			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	795					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CCATTCAAACGGTAACGGCCC	0.537																																																	0													99.0	103.0	102.0					14																	59113726		2203	4300	6503	SO:0001819	synonymous_variant	51339			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2385G>A	14.37:g.59113726G>A		Somatic		WXS	SOLID	Phase_I	A8MYJ2|Q86TY0	Silent	SNP	ENST00000335867.4	37	CCDS9736.1																																																																																				0.537	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1		NM_016651	
DFNB31	25861	hgsc.bcm.edu	37	9	117168640	117168640	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr9:117168640G>A	ENST00000362057.3	-	9	2399	c.2231C>T	c.(2230-2232)aCg>aTg	p.T744M	DFNB31_ENST00000265134.6_Missense_Mutation_p.T361M|DFNB31_ENST00000374059.3_Missense_Mutation_p.T393M	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	744					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCACTGCGCGTCTGGGGCAG	0.612																																																	0													84.0	76.0	79.0					9																	117168640		2203	4300	6503	SO:0001583	missense	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2231C>T	9.37:g.117168640G>A	ENSP00000354623:p.Thr744Met	Somatic		WXS	SOLID	Phase_I	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975643	0.34848	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.08282	3.98;3.97;3.11	5.29	4.4	0.53042	.	0.249383	0.40064	N	0.001193	T	0.12646	0.0307	L	0.60455	1.87	0.80722	D	1	D;B;P	0.54207	0.965;0.447;0.863	B;B;B	0.44224	0.444;0.058;0.232	T	0.02444	-1.1158	10	0.51188	T	0.08	-9.5537	14.1903	0.65635	0.0721:0.0:0.9278:0.0	.	744;744;393	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	M	361;393;744	ENSP00000265134:T361M;ENSP00000363172:T393M;ENSP00000354623:T744M	ENSP00000265134:T361M	T	-	2	0	DFNB31	116208461	0.997000	0.39634	0.776000	0.31678	0.418000	0.31294	6.028000	0.70889	1.252000	0.44001	-0.133000	0.14855	ACG		0.612	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2		NM_015404	
DMBT1	1755	hgsc.bcm.edu	37	10	124340398	124340398	+	Silent	SNP	G	G	T	rs113864071		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr10:124340398G>T	ENST00000338354.3	+	11	1126	c.1020G>T	c.(1018-1020)ccG>ccT	p.P340P	DMBT1_ENST00000368956.2_Silent_p.P340P|DMBT1_ENST00000359586.6_Silent_p.P208P|DMBT1_ENST00000368909.3_Silent_p.P340P|DMBT1_ENST00000330163.4_Silent_p.P340P|DMBT1_ENST00000368955.3_Silent_p.P340P|DMBT1_ENST00000344338.3_Silent_p.P340P			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	340					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.P340P(4)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AGTCCCGGCCGACACCCAGCC	0.537																																					Ovarian(182;93 2026 18125 22222 38972)												4	Substitution - coding silent(4)	endometrium(3)|central_nervous_system(1)											447.0	388.0	406.0					10																	124340398		1908	4111	6019	SO:0001819	synonymous_variant	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.1020G>T	10.37:g.124340398G>T		Somatic		WXS	SOLID	Phase_I	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																					0.537	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2		NM_004406	
DNAJC14	85406	hgsc.bcm.edu	37	12	56221621	56221621	+	Silent	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr12:56221621A>G	ENST00000357606.3	-	3	1111	c.822T>C	c.(820-822)taT>taC	p.Y274Y	RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317269.3_Silent_p.Y274Y|TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317287.5_Silent_p.Y274Y			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	274					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						GCCTGCAGGCATAGATGAGAT	0.517																																																	0													96.0	80.0	85.0					12																	56221621		2203	4300	6503	SO:0001819	synonymous_variant	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.822T>C	12.37:g.56221621A>G		Somatic		WXS	SOLID	Phase_I	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Silent	SNP	ENST00000357606.3	37	CCDS8894.1																																																																																				0.517	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1		NM_032364	
EFCAB6	64800	hgsc.bcm.edu;ucsc.edu	37	22	43950853	43950853	+	Missense_Mutation	SNP	T	T	C	rs34955597	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr22:43950853T>C	ENST00000262726.7	-	27	3797	c.3544A>G	c.(3544-3546)Acc>Gcc	p.T1182A	EFCAB6_ENST00000461800.1_5'UTR|EFCAB6_ENST00000396231.2_Missense_Mutation_p.T1030A	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1182	EF-hand 13. {ECO:0000255|PROSITE- ProRule:PRU00448}.			T -> P (in Ref. 2; BAF85187). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				AACTCCTGGGTGATGGCATGG	0.542																																																	0													138.0	127.0	131.0					22																	43950853		2203	4300	6503	SO:0001583	missense	64800			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3544A>G	22.37:g.43950853T>C	ENSP00000262726:p.Thr1182Ala	Somatic		WXS	SOLID	Phase_I	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	T	0.498	-0.872203	0.02570	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.07567	3.18;3.18	4.88	-3.03	0.05429	EF-hand-like domain (1);	0.725543	0.12492	N	0.464137	T	0.01287	0.0042	N	0.00197	-1.87	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47328	-0.9126	10	0.07813	T	0.8	-3.6692	5.3657	0.16113	0.0:0.4491:0.1366:0.4143	.	1030;1182	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	A	1030;1182	ENSP00000379533:T1030A;ENSP00000262726:T1182A	ENSP00000262726:T1182A	T	-	1	0	EFCAB6	42282186	0.190000	0.23276	0.336000	0.25522	0.878000	0.50629	-0.291000	0.08343	-0.191000	0.10448	-0.959000	0.02639	ACC		0.542	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1		NM_022785	
ELMO1	9844	hgsc.bcm.edu;ucsc.edu	37	7	37311449	37311449	+	Silent	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:37311449T>C	ENST00000310758.4	-	5	878	c.231A>G	c.(229-231)ttA>ttG	p.L77L	ELMO1_ENST00000442504.1_Silent_p.L77L|ELMO1_ENST00000448602.1_Silent_p.L77L	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	77					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GAGATGTGGTTAATCGAAGGA	0.353																																																	0													145.0	148.0	147.0					7																	37311449		2203	4300	6503	SO:0001819	synonymous_variant	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.231A>G	7.37:g.37311449T>C		Somatic		WXS	SOLID	Phase_I	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	CCDS5449.1																																																																																				0.353	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4		NM_130442	
ESYT1	23344	hgsc.bcm.edu	37	12	56524688	56524688	+	Silent	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr12:56524688A>T	ENST00000394048.5	+	3	810	c.546A>T	c.(544-546)acA>acT	p.T182T	RP11-603J24.5_ENST00000549438.1_RNA|ESYT1_ENST00000541590.1_Silent_p.T182T|ESYT1_ENST00000267113.4_Silent_p.T182T|RP11-603J24.5_ENST00000550947.1_RNA	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	182	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						TTACATTTACACGAGTGGAAC	0.532																																																	0													55.0	58.0	57.0					12																	56524688		2203	4300	6503	SO:0001819	synonymous_variant	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.546A>T	12.37:g.56524688A>T		Somatic		WXS	SOLID	Phase_I	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1																																																																																				0.532	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1		NM_015292	
FAM135A	57579	hgsc.bcm.edu;ucsc.edu	37	6	71235353	71235353	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr6:71235353A>T	ENST00000418814.2	+	15	3180	c.2566A>T	c.(2566-2568)Aag>Tag	p.K856*	FAM135A_ENST00000361499.3_Nonsense_Mutation_p.K660*|FAM135A_ENST00000457062.2_Nonsense_Mutation_p.K643*|FAM135A_ENST00000505868.1_Nonsense_Mutation_p.K856*|FAM135A_ENST00000370479.3_Nonsense_Mutation_p.K643*|FAM135A_ENST00000505769.1_Intron	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	856										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						TGAAAATTCTAAGAAATCTGT	0.353																																																	0													48.0	48.0	48.0					6																	71235353		2201	4294	6495	SO:0001587	stop_gained	57579			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.2566A>T	6.37:g.71235353A>T	ENSP00000410768:p.Lys856*	Somatic		WXS	SOLID	Phase_I	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Nonsense_Mutation	SNP	ENST00000418814.2	37	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	A	40	8.125103	0.98665	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000457062;ENST00000361499;ENST00000505868	.	.	.	5.98	5.98	0.97165	.	0.063077	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4696	0.84102	1.0:0.0:0.0:0.0	.	.	.	.	X	856;643;643;660;856	.	ENSP00000354913:K660X	K	+	1	0	FAM135A	71292074	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.599000	0.67592	2.289000	0.77006	0.482000	0.46254	AAG		0.353	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2		NM_020819	
FAM50A	9130	hgsc.bcm.edu	37	X	153674014	153674014	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chrX:153674014T>C	ENST00000393600.3	+	2	255	c.145T>C	c.(145-147)Ttc>Ctc	p.F49L		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	49					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGACAAGAAGTTCTCTGCGCA	0.617																																																	0													89.0	67.0	74.0					X																	153674014		2203	4300	6503	SO:0001583	missense	9130			BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.145T>C	X.37:g.153674014T>C	ENSP00000377225:p.Phe49Leu	Somatic		WXS	SOLID	Phase_I	A8KAQ4|B2R997|Q5HY37|Q6PJH5	Missense_Mutation	SNP	ENST00000393600.3	37	CCDS14751.1	.	.	.	.	.	.	.	.	.	.	T	32	5.119068	0.94385	.	.	ENSG00000071859	ENST00000393600;ENST00000158526	.	.	.	5.03	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.83774	2.66	0.58432	D	0.999993	D	0.89917	1.0	D	0.85130	0.997	T	0.80074	-0.1534	9	0.87932	D	0	-21.6671	9.3102	0.37900	0.0:0.0912:0.0:0.9088	.	49	Q14320	FA50A_HUMAN	L	49;9	.	ENSP00000158526:F9L	F	+	1	0	FAM50A	153327208	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.839000	0.69395	1.658000	0.50742	0.430000	0.28490	TTC		0.617	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081643.2		NM_004699	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90537892	90537892	+	RNA	SNP	G	G	C	rs147621256	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr9:90537892G>C	ENST00000602681.1	+	0	1927							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCAATTTTTTGAGACGATTTT	0.438													.|||	2692	0.53754	0.6974	0.4107	5008	,	,		10529	0.6429		0.2823	False		,,,				2504	0.5654																0													63.0	69.0	68.0					9																	90537892		274	1149	1423			0			AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90537892G>C		Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000602681.1	37																																																																																					0.438	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1		NM_001145124	
FBP1	2203	hgsc.bcm.edu	37	9	97365720	97365720	+	Silent	SNP	T	T	C	rs1769257	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr9:97365720T>C	ENST00000375326.4	-	7	1156	c.960A>G	c.(958-960)ggA>ggG	p.G320G	FBP1_ENST00000415431.1_Silent_p.G320G	NM_000507.3	NP_000498.2	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	320					carbohydrate metabolic process (GO:0005975)|cellular response to drug (GO:0035690)|cellular response to magnesium ion (GO:0071286)|dephosphorylation (GO:0016311)|fructose 6-phosphate metabolic process (GO:0006002)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|negative regulation of cell growth (GO:0030308)|negative regulation of glycolytic process (GO:0045820)|negative regulation of Ras protein signal transduction (GO:0046580)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	AMP binding (GO:0016208)|fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|monosaccharide binding (GO:0048029)			kidney(1)|liver(1)|lung(1)	3		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	CGTCGGGGGATCCCAAGATCA	0.597											OREG0019330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	4543	0.907149	0.9826	0.9222	5008	,	,		18086	0.9563		0.8489	False		,,,				2504	0.8037				Ovarian(142;590 2466 25593 44496)												0			GRCh37	CI951932	FBP1	I	rs1769257	C	,	4243,163	108.6+/-147.0	2043,157,3	66.0	60.0	62.0		960,960	1.1	0.9	9	dbSNP_89	62	7271,1329	261.4+/-283.8	3060,1151,89	no	coding-synonymous,coding-synonymous	FBP1	NM_000507.3,NM_001127628.1	,	5103,1308,92	CC,CT,TT		15.4535,3.6995,11.4716	,	320/339,320/339	97365720	11514,1492	2203	4300	6503	SO:0001819	synonymous_variant	2203			M19922	CCDS6712.1	9q22.3	2012-08-13			ENSG00000165140	ENSG00000165140	3.1.3.11		3606	protein-coding gene	gene with protein product		611570		FBP		8387495	Standard	NM_000507		Approved		uc004auw.4	P09467	OTTHUMG00000020268	ENST00000375326.4:c.960A>G	9.37:g.97365720T>C		Somatic	1327	WXS	SOLID	Phase_I	O75571|Q53F94|Q96E46	Silent	SNP	ENST00000375326.4	37	CCDS6712.1																																																																																				0.597	FBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053187.1		NM_000507	
FBXO7	25793	hgsc.bcm.edu;ucsc.edu	37	22	32894289	32894290	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr22:32894289_32894290delAT	ENST00000266087.7	+	9	1668_1669	c.1341_1342delAT	c.(1339-1344)gaatatfs	p.Y448fs	FBXO7_ENST00000397426.1_Frame_Shift_Del_p.Y334fs|FBXO7_ENST00000382058.3_Frame_Shift_Del_p.Y369fs	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	448	Important for interaction with CDK6.|Pro-rich.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCGGGGGTGAATATGACCAAAG	0.54																																																	0																																										SO:0001589	frameshift_variant	25793			AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.1341_1342delAT	22.37:g.32894291_32894292delAT	ENSP00000266087:p.Tyr448fs	Somatic		WXS	SOLID	Phase_I	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Frame_Shift_Del	DEL	ENST00000266087.7	37	CCDS13907.1																																																																																				0.540	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1			
FLG	2312	hgsc.bcm.edu	37	1	152281097	152281097	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:152281097A>T	ENST00000368799.1	-	3	6300	c.6265T>A	c.(6265-6267)Tct>Act	p.S2089T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2089	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGAGGAAAGACCCTGAACGT	0.567									Ichthyosis																																								0													311.0	241.0	265.0					1																	152281097		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6265T>A	1.37:g.152281097A>T	ENSP00000357789:p.Ser2089Thr	Somatic		WXS	SOLID	Phase_I	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	a	4.967	0.179580	0.09443	.	.	ENSG00000143631	ENST00000368799	T	0.01685	4.69	2.47	-4.95	0.03048	.	.	.	.	.	T	0.00552	0.0018	M	0.76574	2.34	0.09310	N	1	B	0.28350	0.208	B	0.19148	0.024	T	0.45659	-0.9246	9	0.12103	T	0.63	.	4.5984	0.12341	0.3137:0.3399:0.3464:0.0	.	2089	P20930	FILA_HUMAN	T	2089	ENSP00000357789:S2089T	ENSP00000357789:S2089T	S	-	1	0	FLG	150547721	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.318000	0.01121	-1.441000	0.01958	-0.611000	0.04053	TCT		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1		NM_002016	
FCRL4	83417	hgsc.bcm.edu;ucsc.edu	37	1	157557715	157557715	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:157557715T>C	ENST00000271532.1	-	4	637	c.502A>G	c.(502-504)Att>Gtt	p.I168V	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	168	Ig-like C2-type 2.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CCATATCCAATGCATCGATAA	0.303																																																	0													57.0	55.0	56.0					1																	157557715		2203	4300	6503	SO:0001583	missense	83417			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.502A>G	1.37:g.157557715T>C	ENSP00000271532:p.Ile168Val	Somatic		WXS	SOLID	Phase_I	Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.621029	0.00820	.	.	ENSG00000163518	ENST00000271532	T	0.11604	2.76	3.97	-3.65	0.04502	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.606230	0.01788	N	0.032142	T	0.02929	0.0087	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.16722	0.016	T	0.40831	-0.9542	10	0.30078	T	0.28	.	4.7254	0.12938	0.4139:0.0915:0.0:0.4946	.	168	Q96PJ5	FCRL4_HUMAN	V	168	ENSP00000271532:I168V	ENSP00000271532:I168V	I	-	1	0	FCRL4	155824339	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.691000	0.05133	-0.883000	0.03982	-1.973000	0.00462	ATT		0.303	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1		NM_031282	
GAPVD1	26130	hgsc.bcm.edu	37	9	128086083	128086083	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr9:128086083C>A	ENST00000495955.1	+	11	2029	c.1739C>A	c.(1738-1740)tCa>tAa	p.S580*	GAPVD1_ENST00000394083.2_Nonsense_Mutation_p.S559*|GAPVD1_ENST00000394105.2_Nonsense_Mutation_p.S580*|GAPVD1_ENST00000297933.6_Nonsense_Mutation_p.S580*|GAPVD1_ENST00000265956.4_Nonsense_Mutation_p.S580*|GAPVD1_ENST00000470056.1_Nonsense_Mutation_p.S580*|GAPVD1_ENST00000312123.9_Nonsense_Mutation_p.S559*|GAPVD1_ENST00000394104.2_Nonsense_Mutation_p.S580*			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	580					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTAGGTCCTTCAAATCGCTCC	0.418																																																	0													88.0	77.0	81.0					9																	128086083		2203	4300	6503	SO:0001587	stop_gained	26130				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.1739C>A	9.37:g.128086083C>A	ENSP00000419063:p.Ser580*	Somatic		WXS	SOLID	Phase_I	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Nonsense_Mutation	SNP	ENST00000495955.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	41|41|41	8.573983|8.573983|8.573983	0.98868|0.98868|0.98868	.|.|.	.|.|.	ENSG00000165219|ENSG00000165219|ENSG00000165219	ENST00000436712|ENST00000431329|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|.|.	.|.|.	.|.|.	4.87|4.87|4.87	4.87|4.87|4.87	0.63330|0.63330|0.63330	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|.	0.43634|0.43634|.	0.1256|0.1256|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.40997|0.40997|.	-0.9533|-0.9533|.	3|3|.	.|.|0.02654	.|.|T	.|.|1	.|.|.	16.9822|16.9822|16.9822	0.86331|0.86331|0.86331	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	L|K|X	416|443|580;580;580;580;559;580;580;580;559	.|.|.	.|.|ENSP00000265956:S580X	F|Q|S	+|+|+	3|1|2	2|0|0	GAPVD1|GAPVD1|GAPVD1	127125904|127125904|127125904	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.988000|0.988000|0.988000	0.76386|0.76386|0.76386	7.412000|7.412000|7.412000	0.80091|0.80091|0.80091	2.270000|2.270000|2.270000	0.75569|0.75569|0.75569	0.484000|0.484000|0.484000	0.47621|0.47621|0.47621	TTC|CAA|TCA		0.418	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1			
GATAD2A	54815	hgsc.bcm.edu	37	19	19616156	19616156	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr19:19616156G>T	ENST00000360315.3	+	12	2087	c.1775G>T	c.(1774-1776)gGg>gTg	p.G592V	GATAD2A_ENST00000358713.3_Missense_Mutation_p.G592V|GATAD2A_ENST00000429563.2_Missense_Mutation_p.G395V|GATAD2A_ENST00000537887.1_Missense_Mutation_p.G221V|GATAD2A_ENST00000252577.5_Missense_Mutation_p.G567V|GATAD2A_ENST00000404158.1_Missense_Mutation_p.G593V	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	592					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GTTGCAGGCGGGACCCTTGCG	0.652																																																	0													89.0	90.0	89.0					19																	19616156		2203	4300	6503	SO:0001583	missense	54815			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1775G>T	19.37:g.19616156G>T	ENSP00000353463:p.Gly592Val	Somatic		WXS	SOLID	Phase_I	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	37	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	G	10.05	1.244059	0.22796	.	.	ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000537887;ENST00000404158;ENST00000358713;ENST00000429563	T;T;T;T	0.38077	1.9;1.74;1.9;1.16	5.48	4.41	0.53225	.	0.106561	0.64402	D	0.000006	T	0.23846	0.0577	L	0.41824	1.3	0.80722	D	1	P;B;P	0.43519	0.489;0.391;0.809	B;B;B	0.35039	0.068;0.194;0.101	T	0.08391	-1.0724	10	0.05833	T	0.94	-15.2519	14.7676	0.69651	0.0:0.1455:0.8545:0.0	.	395;612;592	B4DKZ7;B5MC40;Q86YP4	.;.;P66A_HUMAN	V	592;567;221;612;592;395	ENSP00000353463:G592V;ENSP00000252577:G567V;ENSP00000351552:G592V;ENSP00000388416:G395V	ENSP00000252577:G567V	G	+	2	0	GATAD2A	19477156	1.000000	0.71417	0.545000	0.28153	0.619000	0.37552	4.034000	0.57289	1.275000	0.44379	0.558000	0.71614	GGG		0.652	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4		NM_017660	
GMFB	2764	hgsc.bcm.edu;ucsc.edu	37	14	54948885	54948885	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr14:54948885C>T	ENST00000358056.3	-	3	404	c.136G>A	c.(136-138)Gat>Aat	p.D46N	GMFB_ENST00000554908.1_Intron|GMFB_ENST00000553566.1_5'UTR	NM_004124.2	NP_004115.1	P60983	GMFB_HUMAN	glia maturation factor, beta	46	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of protein kinase activity (GO:0006469)|nervous system development (GO:0007399)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)	8						AGCTCCTCATCCAGTACCACC	0.338																																																	0													98.0	98.0	98.0					14																	54948885		2203	4300	6503	SO:0001583	missense	2764			M86492	CCDS9718.1	14q22.2	2010-07-06			ENSG00000197045	ENSG00000197045			4373	protein-coding gene	gene with protein product		601713				1712830	Standard	NM_004124		Approved	GMF	uc021rtf.1	P60983	OTTHUMG00000140307	ENST00000358056.3:c.136G>A	14.37:g.54948885C>T	ENSP00000350757:p.Asp46Asn	Somatic		WXS	SOLID	Phase_I	B2R499|P17774|Q9BS35	Missense_Mutation	SNP	ENST00000358056.3	37	CCDS9718.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915517	0.73098	.	.	ENSG00000197045	ENST00000358056;ENST00000354747;ENST00000553333	T;T	0.36520	1.25;1.25	5.12	5.12	0.69794	Actin-binding, cofilin/tropomyosin type (3);	0.051150	0.85682	D	0.000000	T	0.58509	0.2127	M	0.79258	2.445	0.58432	D	0.999996	B	0.23185	0.081	P	0.46144	0.505	T	0.62431	-0.6856	10	0.72032	D	0.01	.	17.1054	0.86662	0.0:1.0:0.0:0.0	.	46	P60983	GMFB_HUMAN	N	46;46;58	ENSP00000350757:D46N;ENSP00000451920:D58N	ENSP00000346789:D46N	D	-	1	0	GMFB	54018635	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.327000	0.72910	2.534000	0.85438	0.585000	0.79938	GAT		0.338	GMFB-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276903.2		NM_004124	
GP6	51206	hgsc.bcm.edu	37	19	55539049	55539049	+	Silent	SNP	C	C	T	rs5030705	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr19:55539049C>T	ENST00000417454.1	-	4	534	c.507G>A	c.(505-507)acG>acA	p.T169T	CTC-550B14.6_ENST00000585492.1_RNA|GP6_ENST00000333884.2_Silent_p.T169T|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Silent_p.T169T|CTC-550B14.7_ENST00000586961.1_RNA|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	169	Ig-like C2-type 2.				blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CGGCGGTCACCGTGATGATGG	0.587													C|||	430	0.0858626	0.0151	0.1354	5008	,	,		15104	0.0308		0.2376	False		,,,				2504	0.047																0								C	,	168,3808		6,156,1826	60.0	66.0	64.0		507,507	-8.0	0.0	19	dbSNP_113	64	1697,6651		179,1339,2656	no	coding-synonymous,coding-synonymous	GP6	NM_001083899.1,NM_016363.4	,	185,1495,4482	TT,TC,CC		20.3282,4.2254,15.1331	,	169/621,169/340	55539049	1865,10459	1988	4174	6162	SO:0001819	synonymous_variant	51206			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.507G>A	19.37:g.55539049C>T		Somatic		WXS	SOLID	Phase_I	Q9HCN7|Q9UIF2	Silent	SNP	ENST00000417454.1	37	CCDS46184.1																																																																																				0.587	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1			
GPR174	84636	hgsc.bcm.edu;ucsc.edu	37	X	78426650	78426650	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chrX:78426650A>C	ENST00000276077.1	+	1	182	c.146A>C	c.(145-147)aAa>aCa	p.K49T		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						GGTTATATGAAAGAAACAAAA	0.363										HNSCC(63;0.18)																																							0													93.0	75.0	81.0					X																	78426650		2203	4300	6503	SO:0001583	missense	84636			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.146A>C	X.37:g.78426650A>C	ENSP00000276077:p.Lys49Thr	Somatic		WXS	SOLID	Phase_I	Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	a	10.09	1.255552	0.22965	.	.	ENSG00000147138	ENST00000276077	T	0.73681	-0.77	5.2	1.51	0.23008	GPCR, rhodopsin-like superfamily (1);	0.263003	0.37437	N	0.002087	T	0.74145	0.3678	M	0.84156	2.68	0.38155	D	0.938846	P	0.48294	0.908	P	0.46208	0.507	T	0.72623	-0.4237	10	0.62326	D	0.03	.	4.3403	0.11106	0.6818:0.0:0.1683:0.1499	.	49	Q9BXC1	GP174_HUMAN	T	49	ENSP00000276077:K49T	ENSP00000276077:K49T	K	+	2	0	GPR174	78313306	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	2.941000	0.49011	0.180000	0.19960	-0.407000	0.06327	AAA		0.363	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1		NM_032553	
GRHL2	79977	hgsc.bcm.edu;ucsc.edu	37	8	102586051	102586051	+	Splice_Site	SNP	G	G	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr8:102586051G>C	ENST00000251808.3	+	6	1228	c.890G>C	c.(889-891)aGg>aCg	p.R297T	GRHL2_ENST00000395927.1_Splice_Site_p.R281T	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	297					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			AGCAAAGTCAGGGTAGGGGCC	0.478																																																	0													64.0	57.0	59.0					8																	102586051		2203	4300	6503	SO:0001630	splice_region_variant	79977			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.891+1G>C	8.37:g.102586051G>C		Somatic		WXS	SOLID	Phase_I	A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	ENST00000251808.3	37	CCDS34931.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644145	0.87859	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.22945	1.93;1.93	5.7	5.7	0.88788	CP2 transcription factor (1);	0.085474	0.85682	D	0.000000	T	0.54743	0.1877	M	0.74881	2.28	0.80722	D	1	D;P	0.89917	1.0;0.616	D;B	0.87578	0.998;0.444	T	0.54912	-0.8222	10	0.62326	D	0.03	-36.5595	19.8232	0.96605	0.0:0.0:1.0:0.0	.	297;297	B4DL28;Q6ISB3	.;GRHL2_HUMAN	T	297;281;297	ENSP00000251808:R297T;ENSP00000379260:R281T	ENSP00000251808:R297T	R	+	2	0	GRHL2	102655227	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.835000	0.99442	2.684000	0.91462	0.650000	0.86243	AGG		0.478	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1		NM_024915	Missense_Mutation
HBB	3043	hgsc.bcm.edu	37	11	5247865	5247865	+	Missense_Mutation	SNP	A	A	C	rs35693898		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:5247865A>C	ENST00000335295.4	-	2	306	c.257T>G	c.(256-258)tTt>tGt	p.F86C	CoTC_ribozyme_ENST00000408104.1_RNA	NM_000518.4	NP_000509.1	P68871	HBB_HUMAN	hemoglobin, beta	86					bicarbonate transport (GO:0015701)|blood coagulation (GO:0007596)|hydrogen peroxide catabolic process (GO:0042744)|nitric oxide transport (GO:0030185)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|platelet aggregation (GO:0070527)|positive regulation of cell death (GO:0010942)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein heterooligomerization (GO:0051291)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|renal absorption (GO:0070293)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|hemoglobin binding (GO:0030492)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)	15		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	CAGTGTGGCAAAGGTGCCCTT	0.522									Sickle Cell Trait																																								0			GRCh37	CM034661	HBB	M	rs35693898						137.0	115.0	123.0					11																	5247865		2201	4298	6499	SO:0001583	missense	3043	Familial Cancer Database		J00173	CCDS7753.1	11p15.5	2014-05-19			ENSG00000244734	ENSG00000244734			4827	protein-coding gene	gene with protein product		141900				2649166	Standard	NM_000518		Approved	CD113t-C, HBD, beta-globin	uc001mae.1	P68871	OTTHUMG00000066678	ENST00000335295.4:c.257T>G	11.37:g.5247865A>C	ENSP00000333994:p.Phe86Cys	Somatic		WXS	SOLID	Phase_I	A4GX73|B2ZUE0|P02023|Q13852|Q14481|Q14510|Q45KT0|Q549N7|Q6FI08|Q6R7N2|Q8IZI1|Q9BX96|Q9UCD6|Q9UCP8|Q9UCP9	Missense_Mutation	SNP	ENST00000335295.4	37	CCDS7753.1	.	.	.	.	.	.	.	.	.	.	a	16.08	3.021462	0.54576	.	.	ENSG00000244734	ENST00000335295;ENST00000380315	D;D	0.93076	-3.16;-3.16	5.24	-2.04	0.07343	Globin-like (1);Globin, structural domain (1);	.	.	.	.	D	0.96027	0.8706	M	0.86864	2.845	0.39098	D	0.961229	D	0.53619	0.961	D	0.66602	0.945	D	0.95497	0.8574	9	0.87932	D	0	-0.9634	12.0533	0.53520	0.3821:0.0:0.0:0.6179	.	86	P68871	HBB_HUMAN	C	86	ENSP00000333994:F86C;ENSP00000369671:F86C	ENSP00000333994:F86C	F	-	2	0	HBB	5204441	0.372000	0.25064	0.990000	0.47175	0.432000	0.31715	0.808000	0.27154	-0.109000	0.12044	0.528000	0.53228	TTT		0.522	HBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142977.2		NM_000518	
HMBOX1	79618	hgsc.bcm.edu;ucsc.edu	37	8	28827803	28827803	+	Silent	SNP	C	C	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr8:28827803C>T	ENST00000397358.3	+	4	971	c.267C>T	c.(265-267)tcC>tcT	p.S89S	HMBOX1_ENST00000444075.1_Silent_p.S89S|HMBOX1_ENST00000558662.1_Silent_p.S89S|HMBOX1_ENST00000523613.1_Silent_p.S89S|HMBOX1_ENST00000519047.1_Silent_p.S89S|HMBOX1_ENST00000355231.5_Silent_p.S89S|HMBOX1_ENST00000403668.2_Silent_p.S89S|HMBOX1_ENST00000524238.1_Silent_p.S89S|HMBOX1_ENST00000287701.10_Silent_p.S89S	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1	89					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CTACAGCTTCCACACAGACGC	0.468																																																	0													116.0	95.0	102.0					8																	28827803		2203	4300	6503	SO:0001819	synonymous_variant	79618			AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.267C>T	8.37:g.28827803C>T		Somatic		WXS	SOLID	Phase_I	A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Silent	SNP	ENST00000397358.3	37	CCDS6071.1																																																																																				0.468	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255267.4		NM_024567	
HPSE2	60495	hgsc.bcm.edu;ucsc.edu	37	10	100503663	100503663	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr10:100503663T>C	ENST00000370552.3	-	4	820	c.761A>G	c.(760-762)aAc>aGc	p.N254S	HPSE2_ENST00000404542.1_Intron|HPSE2_ENST00000370546.1_Missense_Mutation_p.N254S|HPSE2_ENST00000370549.1_Intron	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	254					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CCAAGAAATGTTGTACTTTTT	0.408																																																	0													133.0	127.0	129.0					10																	100503663		2203	4300	6503	SO:0001583	missense	60495			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.761A>G	10.37:g.100503663T>C	ENSP00000359583:p.Asn254Ser	Somatic		WXS	SOLID	Phase_I	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.287494	0.80803	.	.	ENSG00000172987	ENST00000370552;ENST00000370546	T;T	0.33865	1.39;1.39	5.68	5.68	0.88126	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	M	0.67397	2.05	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.77004	0.98;0.989	T	0.51403	-0.8710	10	0.19590	T	0.45	-14.1413	16.2237	0.82280	0.0:0.0:0.0:1.0	.	254;254	Q8WWQ2-2;Q8WWQ2	.;HPSE2_HUMAN	S	254	ENSP00000359583:N254S;ENSP00000359577:N254S	ENSP00000359577:N254S	N	-	2	0	HPSE2	100493653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.583000	0.82559	2.289000	0.77006	0.482000	0.46254	AAC		0.408	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1		NM_021828	
HPSE2	60495	hgsc.bcm.edu	37	10	100992144	100992144	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr10:100992144C>G	ENST00000370552.3	-	2	468	c.409G>C	c.(409-411)Ggc>Cgc	p.G137R	HPSE2_ENST00000370546.1_Missense_Mutation_p.G137R|HPSE2_ENST00000404542.1_Missense_Mutation_p.G137R|HPSE2_ENST00000370549.1_Missense_Mutation_p.G137R	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	137					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		gggcccgggcccccgcggcTT	0.572																																																	0													9.0	10.0	10.0					10																	100992144		2000	3885	5885	SO:0001583	missense	60495			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.409G>C	10.37:g.100992144C>G	ENSP00000359583:p.Gly137Arg	Somatic		WXS	SOLID	Phase_I	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368129	0.42003	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.06	5.06	0.68205	Glycoside hydrolase, superfamily (1);	0.095726	0.43747	D	0.000531	T	0.52613	0.1745	L	0.54323	1.7	0.36302	D	0.857128	P;D;D;D	0.89917	0.835;0.996;1.0;0.994	P;D;D;P	0.97110	0.628;0.936;1.0;0.864	T	0.51663	-0.8677	10	0.10111	T	0.7	.	17.1956	0.86891	0.0:1.0:0.0:0.0	.	137;137;137;137	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	R	137	ENSP00000359583:G137R;ENSP00000359580:G137R;ENSP00000359577:G137R;ENSP00000384384:G137R	ENSP00000359577:G137R	G	-	1	0	HPSE2	100982134	1.000000	0.71417	0.998000	0.56505	0.157000	0.22087	6.793000	0.75130	2.357000	0.79964	0.655000	0.94253	GGC		0.572	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1		NM_021828	
HS1BP3	64342	hgsc.bcm.edu	37	2	20838372	20838372	+	Silent	SNP	A	A	G	rs113332675		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr2:20838372A>G	ENST00000304031.3	-	4	472	c.447T>C	c.(445-447)gaT>gaC	p.D149D	HS1BP3_ENST00000402541.1_Silent_p.D149D	NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	149							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGACAGAGGAATCTCTGCTGG	0.562																																																	0													101.0	96.0	97.0					2																	20838372		2203	4300	6503	SO:0001819	synonymous_variant	64342				CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.447T>C	2.37:g.20838372A>G		Somatic		WXS	SOLID	Phase_I	B2RAW2|D6W529|Q86VC2|Q8N367	Silent	SNP	ENST00000304031.3	37	CCDS1700.1																																																																																				0.562	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1		NM_022460	
IL1RAP	3556	hgsc.bcm.edu;ucsc.edu	37	3	190322001	190322001	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr3:190322001T>G	ENST00000412504.2	+	3	401	c.149T>G	c.(148-150)tTt>tGt	p.F50C	IL1RAP_ENST00000422485.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000434491.1_Intron|IL1RAP_ENST00000072516.3_Missense_Mutation_p.F50C|IL1RAP_ENST00000422940.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000443369.2_Missense_Mutation_p.F50C|IL1RAP_ENST00000317757.3_Missense_Mutation_p.F50C|IL1RAP_ENST00000439062.1_Missense_Mutation_p.F50C|IL1RAP_ENST00000447382.1_Missense_Mutation_p.F50C			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	50	Ig-like C2-type 1.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TGCCCACTCTTTGAACACTTC	0.483																																																	0													110.0	99.0	103.0					3																	190322001		2203	4300	6503	SO:0001583	missense	3556			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.149T>G	3.37:g.190322001T>G	ENSP00000412053:p.Phe50Cys	Somatic		WXS	SOLID	Phase_I	B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	ENST00000412504.2	37	CCDS3298.1	.	.	.	.	.	.	.	.	.	.	T	18.62	3.663279	0.67700	.	.	ENSG00000196083	ENST00000072516;ENST00000443369;ENST00000412504;ENST00000439062;ENST00000447382;ENST00000422625;ENST00000422485;ENST00000422940;ENST00000317757;ENST00000453359	T;T;T;T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.46	5.46	0.80206	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85831	0.5788	L	0.58428	1.81	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.991;0.997	D	0.87242	0.2267	10	0.87932	D	0	.	15.0142	0.71570	0.0:0.0:0.0:1.0	.	50;50;50	Q9NPH3-5;Q9NPH3;Q9NPH3-2	.;IL1AP_HUMAN;.	C	50	ENSP00000072516:F50C;ENSP00000408893:F50C;ENSP00000412053:F50C;ENSP00000401132:F50C;ENSP00000390541:F50C;ENSP00000389149:F50C;ENSP00000409352:F50C;ENSP00000387371:F50C;ENSP00000314807:F50C;ENSP00000412008:F50C	ENSP00000072516:F50C	F	+	2	0	IL1RAP	191804695	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.366000	0.79548	2.206000	0.71126	0.533000	0.62120	TTT		0.483	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343497.1			
INO80	54617	hgsc.bcm.edu	37	15	41280146	41280146	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr15:41280146G>T	ENST00000361937.3	-	30	4021	c.3597C>A	c.(3595-3597)aaC>aaA	p.N1199K	INO80_ENST00000401393.3_Missense_Mutation_p.N1199K|INO80_ENST00000561244.1_5'UTR			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1199	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCACAGTGGGGTTCCAGTCGC	0.498																																																	0													119.0	120.0	119.0					15																	41280146		2203	4300	6503	SO:0001583	missense	54617			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3597C>A	15.37:g.41280146G>T	ENSP00000355205:p.Asn1199Lys	Somatic		WXS	SOLID	Phase_I	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.330843	0.81690	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	T;T	0.80393	-1.37;-1.37	5.23	5.23	0.72850	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93671	0.7978	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95287	0.8391	10	0.87932	D	0	.	13.3063	0.60355	0.0753:0.0:0.9247:0.0	.	1199	Q9ULG1	INO80_HUMAN	K	1199	ENSP00000355205:N1199K;ENSP00000384686:N1199K	ENSP00000355205:N1199K	N	-	3	2	INO80	39067438	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.136000	0.50554	2.725000	0.93324	0.460000	0.39030	AAC		0.498	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2		NM_017553	
INTS3	65123	hgsc.bcm.edu	37	1	153701140	153701140	+	Silent	SNP	A	A	C	rs146230825		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:153701140A>C	ENST00000318967.2	+	1	598	c.30A>C	c.(28-30)gcA>gcC	p.A10A	Y_RNA_ENST00000362695.1_RNA|INTS3_ENST00000435409.2_Silent_p.A10A|INTS3_ENST00000456435.1_5'UTR	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	0	Ala/Gly-rich.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGGGGCGGCAGCAGCAGCAG	0.622																																																	0													30.0	40.0	37.0					1																	153701140		2183	4262	6445	SO:0001819	synonymous_variant	65123			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.30A>C	1.37:g.153701140A>C		Somatic		WXS	SOLID	Phase_I	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Silent	SNP	ENST00000318967.2	37	CCDS1052.1																																																																																				0.622	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2		NM_023015	
IPO7	10527	hgsc.bcm.edu;ucsc.edu	37	11	9424852	9424852	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:9424852A>C	ENST00000379719.3	+	2	242	c.100A>C	c.(100-102)Aat>Cat	p.N34H	IPO7_ENST00000533680.1_3'UTR	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	34	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CAAGTCTCTGAATTTTGTCTC	0.348																																																	0													111.0	100.0	104.0					11																	9424852		2201	4296	6497	SO:0001583	missense	10527			AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.100A>C	11.37:g.9424852A>C	ENSP00000369042:p.Asn34His	Somatic		WXS	SOLID	Phase_I	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	37	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	A	13.89	2.370726	0.42003	.	.	ENSG00000205339	ENST00000379719	T	0.68181	-0.31	4.97	4.97	0.65823	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.130758	0.64402	D	0.000002	T	0.55257	0.1909	L	0.34521	1.04	0.39245	D	0.963934	B	0.06786	0.001	B	0.15870	0.014	T	0.57676	-0.7770	10	0.66056	D	0.02	.	11.0147	0.47682	0.8441:0.1559:0.0:0.0	.	34	O95373	IPO7_HUMAN	H	34	ENSP00000369042:N34H	ENSP00000369042:N34H	N	+	1	0	IPO7	9381428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.658000	0.68003	1.984000	0.57885	0.477000	0.44152	AAT		0.348	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1		NM_006391	
KCNA10	3744	hgsc.bcm.edu;ucsc.edu	37	1	111060345	111060345	+	Silent	SNP	C	C	T	rs566195238	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:111060345C>T	ENST00000369771.2	-	1	1452	c.1065G>A	c.(1063-1065)tcG>tcA	p.S355S		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	355					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)	p.S355S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	TGGAGTGGCGCGAGAGCTTGA	0.572													C|||	4	0.000798722	0.003	0.0	5008	,	,		20447	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	endometrium(1)											114.0	110.0	111.0					1																	111060345		2203	4300	6503	SO:0001819	synonymous_variant	3744			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.1065G>A	1.37:g.111060345C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000369771.2	37	CCDS826.1																																																																																				0.572	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1		NM_005549	
KIAA0100	9703	hgsc.bcm.edu;ucsc.edu	37	17	26966630	26966630	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:26966630C>T	ENST00000528896.2	-	10	1120	c.1046G>A	c.(1045-1047)cGc>cAc	p.R349H	KIAA0100_ENST00000544884.1_Missense_Mutation_p.R206H|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R206H	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	349						extracellular region (GO:0005576)		p.R349H(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GCAGACAATGCGTTGGCGACT	0.493																																																	1	Substitution - Missense(1)	endometrium(1)											144.0	126.0	132.0					17																	26966630		2203	4300	6503	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1046G>A	17.37:g.26966630C>T	ENSP00000436773:p.Arg349His	Somatic		WXS	SOLID	Phase_I	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	34	5.370112	0.95900	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.33865	1.66;1.39	5.78	5.78	0.91487	FMP27, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.50659	-0.8802	10	0.56958	D	0.05	.	20.0119	0.97458	0.0:1.0:0.0:0.0	.	349;349	F6XS94;Q14667	.;K0100_HUMAN	H	349;349;349;206	ENSP00000436773:R349H;ENSP00000446443:R206H	ENSP00000005905:R349H	R	-	2	0	KIAA0100	23990757	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.181000	0.77682	2.733000	0.93635	0.591000	0.81541	CGC		0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3		NM_014680	
KLHL8	57563	hgsc.bcm.edu;ucsc.edu	37	4	88099693	88099693	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:88099693G>A	ENST00000273963.5	-	5	1373	c.1032C>T	c.(1030-1032)aaC>aaT	p.N344N	KLHL8_ENST00000498875.2_Silent_p.N268N|KLHL8_ENST00000512111.1_Silent_p.N344N|KLHL8_ENST00000545252.1_5'UTR|KLHL8_ENST00000425278.2_Silent_p.N161N	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	344					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		AGAACCAACTGTTTTTGTTGA	0.433																																																	0													156.0	144.0	148.0					4																	88099693		2203	4300	6503	SO:0001819	synonymous_variant	57563			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1032C>T	4.37:g.88099693G>A		Somatic		WXS	SOLID	Phase_I	Q53XA3|Q6N018	Silent	SNP	ENST00000273963.5	37	CCDS3617.1																																																																																				0.433	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1			
KRTAP5-1	387264	hgsc.bcm.edu	37	11	1606129	1606129	+	Silent	SNP	A	A	C	rs76191756	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:1606129A>C	ENST00000382171.2	-	1	384	c.351T>G	c.(349-351)ggT>ggG	p.G117G	KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	117	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AACCACAGCCACCCTTGGATC	0.652													-|||	2697	0.538538	0.59	0.5173	5008	,	,		5828	0.4732		0.5626	False		,,,				2504	0.5266																0													38.0	53.0	48.0					11																	1606129		2072	4041	6113	SO:0001819	synonymous_variant	387264			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.351T>G	11.37:g.1606129A>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000382171.2	37	CCDS31330.1																																																																																				0.652	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1		NM_001005922	
LRIT3	345193	hgsc.bcm.edu	37	4	110791088	110791090	+	In_Frame_Del	DEL	TCT	TCT	-	rs147608421	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:110791088_110791090delTCT	ENST00000594814.1	+	4	1183_1185	c.1183_1185delTCT	c.(1183-1185)tctdel	p.S396del	LRIT3_ENST00000379920.3_In_Frame_Del_p.S351del|LRIT3_ENST00000327908.3_In_Frame_Del_p.S213del|LRIT3_ENST00000409621.2_In_Frame_Del_p.S213del	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	396	Ser-rich.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		ctcccccacatcttctttttctg	0.468														51	0.0101837	0.0008	0.0144	5008	,	,		20485	0.0		0.0358	False		,,,				2504	0.0041																0										44,4218		0,44,2087						-0.7	0.0		dbSNP_134	191	335,7909		12,311,3799	no	coding	LRIT3	NM_198506.2		12,355,5886	A1A1,A1R,RR		4.0636,1.0324,3.0305				379,12127				SO:0001651	inframe_deletion	345193			AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1183_1185delTCT	4.37:g.110791091_110791093delTCT	ENSP00000469759:p.Ser396del	Somatic		WXS	SOLID	Phase_I	C9J1C2|Q6ZTG1	In_Frame_Del	DEL	ENST00000594814.1	37	CCDS3688.3																																																																																				0.468	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2		NM_198506	
MAP3K12	7786	hgsc.bcm.edu	37	12	53878111	53878111	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr12:53878111A>G	ENST00000267079.2	-	8	1304	c.1079T>C	c.(1078-1080)aTc>aCc	p.I360T	MAP3K12_ENST00000547488.1_Missense_Mutation_p.I393T|MAP3K12_ENST00000547035.1_Missense_Mutation_p.I393T|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	360	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						ATGCAGCAGGATCTGTCGGAA	0.483																																																	0													172.0	117.0	136.0					12																	53878111		2203	4300	6503	SO:0001583	missense	7786			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1079T>C	12.37:g.53878111A>G	ENSP00000267079:p.Ile360Thr	Somatic		WXS	SOLID	Phase_I	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	A	18.18	3.567490	0.65651	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	D;D;D	0.91124	-2.79;-2.79;-2.79	5.14	5.14	0.70334	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42821	D	0.000653	D	0.94205	0.8140	M	0.91249	3.19	0.80722	D	1	P;P	0.41597	0.712;0.756	P;P	0.48654	0.45;0.585	D	0.94462	0.7677	10	0.46703	T	0.11	.	14.2494	0.66009	1.0:0.0:0.0:0.0	.	393;360	G3V1Y2;Q12852	.;M3K12_HUMAN	T	360;393;393	ENSP00000267079:I360T;ENSP00000449038:I393T;ENSP00000448689:I393T	ENSP00000267079:I360T	I	-	2	0	MAP3K12	52164378	0.997000	0.39634	1.000000	0.80357	0.894000	0.52154	2.179000	0.42528	2.089000	0.63090	0.379000	0.24179	ATC		0.483	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1		NM_006301	
MAPK1	5594	hgsc.bcm.edu;ucsc.edu	37	22	22142570	22142570	+	Silent	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr22:22142570G>A	ENST00000215832.6	-	6	1020	c.832C>T	c.(832-834)Ctg>Ttg	p.L278L	MAPK1_ENST00000398822.3_Silent_p.L278L|MAPK1_ENST00000544786.1_Intron	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	TTTGGGAACAGCCTGTTCCAT	0.363																																																	0													111.0	104.0	106.0					22																	22142570		2203	4300	6503	SO:0001819	synonymous_variant	5594			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.832C>T	22.37:g.22142570G>A		Somatic		WXS	SOLID	Phase_I	A8CZ64	Silent	SNP	ENST00000215832.6	37	CCDS13795.1																																																																																				0.363	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2			
MASP2	10747	hgsc.bcm.edu;ucsc.edu	37	1	11087333	11087333	+	Missense_Mutation	SNP	T	T	A	rs373806675		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:11087333T>A	ENST00000400897.3	-	11	1685	c.1670A>T	c.(1669-1671)gAa>gTa	p.E557V	RP4-635E18.8_ENST00000607145.1_RNA	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	557	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		GGATTCAGCTTCTTTTCTTGG	0.383																																					GBM(35;611 746 20780 22741 36496)												0													145.0	144.0	144.0					1																	11087333		2203	4300	6503	SO:0001583	missense	10747			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.1670A>T	1.37:g.11087333T>A	ENSP00000383690:p.Glu557Val	Somatic		WXS	SOLID	Phase_I	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	ENST00000400897.3	37	CCDS123.1	.	.	.	.	.	.	.	.	.	.	T	11.23	1.576224	0.28092	.	.	ENSG00000009724	ENST00000400897	D	0.89270	-2.49	5.06	-5.46	0.02608	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.714038	0.13301	N	0.398225	D	0.82453	0.5040	L	0.41824	1.3	0.09310	N	1	B	0.24368	0.102	B	0.26310	0.068	T	0.66027	-0.6025	10	0.62326	D	0.03	.	13.6119	0.62083	0.0:0.066:0.6622:0.2717	.	557	O00187	MASP2_HUMAN	V	557	ENSP00000383690:E557V	ENSP00000383690:E557V	E	-	2	0	MASP2	11009920	0.012000	0.17670	0.000000	0.03702	0.734000	0.41952	0.152000	0.16302	-1.423000	0.02002	-0.460000	0.05396	GAA		0.383	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1		NM_006610	
MED27	9442	hgsc.bcm.edu	37	9	134889741	134889741	+	Silent	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr9:134889741A>G	ENST00000292035.5	-	3	525	c.462T>C	c.(460-462)acT>acC	p.T154T	MED27_ENST00000357028.2_Silent_p.T154T	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	154					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		GTAGGACAAGAGTTGTGGGCT	0.418																																					Colon(41;784 923 6932 42329 52483)												0													148.0	127.0	134.0					9																	134889741		2203	4300	6503	SO:0001819	synonymous_variant	9442			AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.462T>C	9.37:g.134889741A>G		Somatic		WXS	SOLID	Phase_I	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Silent	SNP	ENST00000292035.5	37	CCDS6945.1																																																																																				0.418	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2		NM_004269	
METTL2A	339175	hgsc.bcm.edu	37	17	60501288	60501288	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:60501288G>T	ENST00000311506.5	+	1	61	c.25G>T	c.(25-27)Gca>Tca	p.A9S		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	9					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			CCCTGAAGGTGCACCTGCAGT	0.592											OREG0024635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													58.0	67.0	65.0					17																	60501288		692	1591	2283	SO:0001583	missense	339175			AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.25G>T	17.37:g.60501288G>T	ENSP00000309610:p.Ala9Ser	Somatic	1046	WXS	SOLID	Phase_I	A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Missense_Mutation	SNP	ENST00000311506.5	37	CCDS45752.1	.	.	.	.	.	.	.	.	.	.	G	9.444	1.088760	0.20390	.	.	ENSG00000087995	ENST00000311506;ENST00000333483	T	0.11821	2.74	5.18	1.94	0.25998	.	1.732920	0.03290	N	0.187404	T	0.08223	0.0205	N	0.17474	0.49	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32375	-0.9909	10	0.09338	T	0.73	-3.5118	4.4506	0.11619	0.0846:0.154:0.6018:0.1595	.	9	Q96IZ6	MTL2A_HUMAN	S	9	ENSP00000309610:A9S	ENSP00000309610:A9S	A	+	1	0	METTL2A	57855020	0.036000	0.19791	0.000000	0.03702	0.007000	0.05969	1.392000	0.34486	0.155000	0.19261	0.555000	0.69702	GCA		0.592	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445130.1		NM_181725	
CPE	1363	hgsc.bcm.edu	37	4	166307408	166307408	+	Intron	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:166307408A>G	ENST00000402744.4	+	1	587				MIR578_ENST00000384828.1_RNA	NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E						cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAATCTATAGACAAAATACAA	0.318																																																	0													49.0	50.0	50.0					4																	166307408		1568	3579	5147	SO:0001627	intron_variant	693163			X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.307+6728A>G	4.37:g.166307408A>G		Somatic		WXS	SOLID	Phase_I	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	RNA	SNP	ENST00000402744.4	37	CCDS3810.1																																																																																				0.318	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2		NM_001873	
MYH4	4622	hgsc.bcm.edu;ucsc.edu	37	17	10353952	10353952	+	Silent	SNP	C	C	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:10353952C>T	ENST00000255381.2	-	30	4109	c.3999G>A	c.(3997-3999)ctG>ctA	p.L1333L	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1333					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GGGCATGGGCCAGAGTGCTCT	0.488																																																	0													84.0	73.0	77.0					17																	10353952		2203	4300	6503	SO:0001819	synonymous_variant	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3999G>A	17.37:g.10353952C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000255381.2	37	CCDS11154.1																																																																																				0.488	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1		NM_017533	
MPO	4353	hgsc.bcm.edu	37	17	56351014	56351014	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:56351014T>C	ENST00000225275.3	-	9	1558	c.1382A>G	c.(1381-1383)gAc>gGc	p.D461G	MPO_ENST00000340482.3_Missense_Mutation_p.D493G|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	461					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GGGCAGGTAGTCCCGGTAAGT	0.582																																																	0													178.0	144.0	155.0					17																	56351014		2203	4300	6503	SO:0001583	missense	4353				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1382A>G	17.37:g.56351014T>C	ENSP00000225275:p.Asp461Gly	Somatic		WXS	SOLID	Phase_I	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.369087	0.82463	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.74106	-0.81;-0.81	4.38	4.38	0.52667	.	0.165679	0.52532	D	0.000075	D	0.88713	0.6511	M	0.93638	3.44	0.58432	D	0.999999	D	0.76494	0.999	D	0.81914	0.995	D	0.91373	0.5121	10	0.87932	D	0	-38.4701	12.9585	0.58444	0.0:0.0:0.0:1.0	.	461	P05164	PERM_HUMAN	G	493;461	ENSP00000344419:D493G;ENSP00000225275:D461G	ENSP00000225275:D461G	D	-	2	0	MPO	53706013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.847000	0.86896	1.850000	0.53721	0.459000	0.35465	GAC		0.582	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1			
NOX4	50507	hgsc.bcm.edu	37	11	89059930	89059930	+	Missense_Mutation	SNP	G	G	C	rs202068631		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:89059930G>C	ENST00000263317.4	-	18	1969	c.1731C>G	c.(1729-1731)ttC>ttG	p.F577L	NOX4_ENST00000527956.1_Missense_Mutation_p.F553L|NOX4_ENST00000375979.3_Missense_Mutation_p.F270L|NOX4_ENST00000534731.1_Missense_Mutation_p.F537L|NOX4_ENST00000424319.1_Missense_Mutation_p.F553L|NOX4_ENST00000531342.1_Missense_Mutation_p.F230L|NOX4_ENST00000542487.1_Missense_Mutation_p.F553L|NOX4_ENST00000535633.1_Missense_Mutation_p.F553L|NOX4_ENST00000532825.1_Missense_Mutation_p.F513L|NOX4_ENST00000528341.1_Missense_Mutation_p.F552L|NOX4_ENST00000527626.1_Missense_Mutation_p.F390L|NOX4_ENST00000525196.1_Missense_Mutation_p.F341L|NOX4_ENST00000413594.2_Missense_Mutation_p.F598L|NOX4_ENST00000343727.5_Missense_Mutation_p.F553L			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	577					bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				GTTTTCAGCTGAAAGACTCTT	0.378																																																	0													90.0	91.0	91.0					11																	89059930		2201	4299	6500	SO:0001583	missense	50507			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1731C>G	11.37:g.89059930G>C	ENSP00000263317:p.Phe577Leu	Somatic		WXS	SOLID	Phase_I	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697344	0.48202	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99186	-5.32;-5.32;-5.32;-5.51;-5.27;-5.31;-5.53;-5.32;-5.32;-5.04;-5.33;-5.48;-4.66;-4.35	3.93	3.93	0.45458	.	0.000000	0.85682	U	0.000000	D	0.99444	0.9803	M	0.93594	3.435	0.42659	D	0.993479	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.974;1.0;1.0;0.99	D;D;D;D;D;D;D;D	0.97110	0.997;0.998;0.997;0.996;0.953;0.999;1.0;0.92	D	0.98374	1.0555	9	.	.	.	-9.6418	16.3115	0.82873	0.0:0.0:1.0:0.0	.	513;390;552;341;230;270;537;577	E9PMY6;E9PR43;E9PPP2;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;.;NOX4_HUMAN	L	553;553;553;537;341;577;513;553;553;390;552;598;230;270	ENSP00000412446:F553L;ENSP00000440172:F553L;ENSP00000344747:F553L;ENSP00000436892:F537L;ENSP00000436716:F341L;ENSP00000263317:F577L;ENSP00000434924:F513L;ENSP00000433797:F553L;ENSP00000439373:F553L;ENSP00000436093:F390L;ENSP00000436970:F552L;ENSP00000405705:F598L;ENSP00000435039:F230L;ENSP00000365146:F270L	.	F	-	3	2	NOX4	88699578	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	5.144000	0.64832	1.880000	0.54463	0.467000	0.42956	TTC		0.378	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1		NM_016931	
NUMB	8650	hgsc.bcm.edu;ucsc.edu	37	14	73822411	73822411	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr14:73822411G>C	ENST00000355058.3	-	4	327	c.49C>G	c.(49-51)Cca>Gca	p.P17A	NUMB_ENST00000544991.3_Missense_Mutation_p.P17A|NUMB_ENST00000557597.1_Missense_Mutation_p.P17A|NUMB_ENST00000454166.4_Missense_Mutation_p.P17A|NUMB_ENST00000555738.2_Missense_Mutation_p.P17A|NUMB_ENST00000555394.1_Missense_Mutation_p.P17A|NUMB_ENST00000554546.1_Missense_Mutation_p.P17A|NUMB_ENST00000560335.1_Missense_Mutation_p.P17A|NUMB_ENST00000555238.1_Missense_Mutation_p.P17A|NUMB_ENST00000356296.4_Missense_Mutation_p.P17A|NUMB_ENST00000554521.2_Missense_Mutation_p.P17A|NUMB_ENST00000359560.3_Missense_Mutation_p.P17A|NUMB_ENST00000559312.1_Missense_Mutation_p.P17A|NUMB_ENST00000535282.1_Missense_Mutation_p.P17A			P49757	NUMB_HUMAN	numb homolog (Drosophila)	17					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		CTGGCCTCTGGAACATAAACA	0.383																																																	0													106.0	102.0	103.0					14																	73822411		2203	4300	6503	SO:0001583	missense	8650			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.49C>G	14.37:g.73822411G>C	ENSP00000347169:p.Pro17Ala	Somatic		WXS	SOLID	Phase_I	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	ENST00000355058.3	37	CCDS32116.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513700	0.85389	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000544991;ENST00000454166;ENST00000555738;ENST00000554521;ENST00000535282;ENST00000326018;ENST00000555859;ENST00000555307;ENST00000554394;ENST00000555987;ENST00000554818	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.62105	0.05;2.44;0.59;2.44;2.44;0.59;2.44;2.44;2.44;0.44;0.33;0.59;2.44;2.44;2.44;2.44;2.44	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.79381	0.4436	M	0.69823	2.125	0.80722	D	1	B;D;P;P;P;P;B;D;D;B;P	0.89917	0.23;0.999;0.768;0.533;0.911;0.768;0.434;1.0;0.998;0.383;0.897	B;D;P;B;P;B;B;D;D;B;P	0.91635	0.168;0.994;0.517;0.206;0.646;0.347;0.417;0.999;0.959;0.348;0.764	T	0.78481	-0.2187	10	0.49607	T	0.09	-7.9348	19.4279	0.94751	0.0:0.0:1.0:0.0	.	17;17;17;17;17;17;17;17;17;17;17	B1P2N6;B1P2N5;B1P2N8;B1P2N7;G3V3R1;Q86SW5;B2RCI6;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;.;.;.;.;NUMB_HUMAN	A	17	ENSP00000452416:P17A;ENSP00000348644:P17A;ENSP00000451117:P17A;ENSP00000451300:P17A;ENSP00000347169:P17A;ENSP00000352563:P17A;ENSP00000451625:P17A;ENSP00000446001:P17A;ENSP00000394025:P17A;ENSP00000452069:P17A;ENSP00000450817:P17A;ENSP00000441258:P17A;ENSP00000451326:P17A;ENSP00000452357:P17A;ENSP00000451374:P17A;ENSP00000451559:P17A;ENSP00000451959:P17A	ENSP00000315193:P17A	P	-	1	0	NUMB	72892164	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.581000	0.98210	2.824000	0.97209	0.655000	0.94253	CCA		0.383	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1			
PATZ1	23598	hgsc.bcm.edu	37	22	31741483	31741483	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr22:31741483T>A	ENST00000266269.5	-	1	735	c.106A>T	c.(106-108)Aac>Tac	p.N36Y	PATZ1_ENST00000405309.3_Missense_Mutation_p.N36Y|PATZ1_ENST00000351933.4_Missense_Mutation_p.N36Y|PATZ1_ENST00000215919.3_Missense_Mutation_p.N36Y|AC005003.1_ENST00000504184.2_5'Flank	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	36					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						CGCCCGCCGTTTTTGCGCTGC	0.647																																																	0													43.0	38.0	40.0					22																	31741483		2203	4299	6502	SO:0001583	missense	23598			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.106A>T	22.37:g.31741483T>A	ENSP00000266269:p.Asn36Tyr	Somatic		WXS	SOLID	Phase_I	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	ENST00000266269.5	37	CCDS13894.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846860	0.51164	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	4.09	4.09	0.47781	BTB/POZ (1);BTB/POZ fold (2);	0.296803	0.32802	N	0.005628	T	0.38268	0.1034	M	0.65975	2.015	0.40331	D	0.978927	P;P;D;P	0.56287	0.921;0.804;0.975;0.804	P;B;P;B	0.52217	0.693;0.26;0.686;0.26	T	0.40701	-0.9549	10	0.72032	D	0.01	-20.0611	12.2522	0.54605	0.0:0.0:0.0:1.0	.	36;36;36;36	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	Y	36	ENSP00000266269:N36Y;ENSP00000384173:N36Y;ENSP00000337520:N36Y;ENSP00000215919:N36Y	ENSP00000215919:N36Y	N	-	1	0	PATZ1	30071483	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.347000	0.52200	1.624000	0.50355	0.397000	0.26171	AAC		0.647	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1		NM_032052	
PDS5B	23047	hgsc.bcm.edu	37	13	33281137	33281137	+	Silent	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr13:33281137A>T	ENST00000315596.10	+	18	2109	c.1923A>T	c.(1921-1923)ccA>ccT	p.P641P		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	641					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AGGGTGTTCCAACTGATCAAG	0.313																																																	0													110.0	107.0	108.0					13																	33281137		1882	4111	5993	SO:0001819	synonymous_variant	23047			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1923A>T	13.37:g.33281137A>T		Somatic		WXS	SOLID	Phase_I	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Silent	SNP	ENST00000315596.10	37	CCDS41878.1																																																																																				0.313	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3		NM_015032	
PEX3	8504	hgsc.bcm.edu;ucsc.edu	37	6	143792575	143792575	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr6:143792575T>A	ENST00000367591.4	+	6	575	c.512T>A	c.(511-513)cTa>cAa	p.L171Q		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	171					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		ATTCAGCACCTACTTGGAGAT	0.299																																																	0													99.0	101.0	101.0					6																	143792575		2203	4297	6500	SO:0001583	missense	8504			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.512T>A	6.37:g.143792575T>A	ENSP00000356563:p.Leu171Gln	Somatic		WXS	SOLID	Phase_I	Q6FGP5	Missense_Mutation	SNP	ENST00000367591.4	37	CCDS5199.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.659171	0.67586	.	.	ENSG00000034693	ENST00000344281;ENST00000367592;ENST00000367591	T;T	0.67865	-0.29;-0.29	5.54	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.75882	0.3910	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	T	0.80248	-0.1461	10	0.87932	D	0	-7.2569	13.0049	0.58699	0.0:0.0:0.1349:0.8651	.	171;171	B4DV31;P56589	.;PEX3_HUMAN	Q	127;127;171	ENSP00000356564:L127Q;ENSP00000356563:L171Q	ENSP00000344195:L127Q	L	+	2	0	PEX3	143834268	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.295000	0.78780	1.008000	0.39264	0.482000	0.46254	CTA		0.299	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1			
PKM	5315	hgsc.bcm.edu	37	15	72495427	72495427	+	Intron	SNP	C	C	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr15:72495427C>G	ENST00000335181.5	-	9	1244				PKM_ENST00000319622.6_Missense_Mutation_p.G415R|PKM_ENST00000568883.1_Missense_Mutation_p.G250R|PKM_ENST00000568459.1_Missense_Mutation_p.G415R|PKM_ENST00000565184.1_Missense_Mutation_p.G415R|PKM_ENST00000565154.1_Missense_Mutation_p.G415R|PKM_ENST00000449901.2_Intron|PKM_ENST00000389093.3_Missense_Mutation_p.G415R	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	TCCACGCTGCCCATGGCCATG	0.532																																																	0													80.0	76.0	78.0					15																	72495427		2199	4297	6496	SO:0001627	intron_variant	0			M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.1141-466G>C	15.37:g.72495427C>G		Somatic		WXS	SOLID	Phase_I	A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Missense_Mutation	SNP	ENST00000335181.5	37	CCDS32284.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013271	0.93346	.	.	ENSG00000067225	ENST00000319622;ENST00000327974;ENST00000389093	D;D	0.99023	-5.34;-5.34	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.99521	0.9829	M	0.93420	3.415	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;0.996;0.987;0.995	D	0.98421	1.0577	10	0.87932	D	0	-20.8517	19.9421	0.97168	0.0:1.0:0.0:0.0	.	395;395;415;250;250	B4DRT3;E7EUQ8;P14618-2;Q504U3;E7EUJ4	.;.;.;.;.	R	415;250;415	ENSP00000320171:G415R;ENSP00000373745:G415R	ENSP00000320171:G415R	G	-	1	0	PKM2	70282481	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.714000	0.92807	0.561000	0.74099	GGC		0.532	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420056.1			
PMS2	5395	hgsc.bcm.edu	37	7	6042131	6042131	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:6042131A>C	ENST00000265849.7	-	5	595	c.490T>G	c.(490-492)Tcc>Gcc	p.S164A	Y_RNA_ENST00000365120.1_RNA|PMS2_ENST00000382321.4_Missense_Mutation_p.S164A|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Missense_Mutation_p.S164A|PMS2_ENST00000441476.2_Missense_Mutation_p.S58A	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	164					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GGTAGTGTGGAAAATAACTGC	0.438			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													72.0	83.0	79.0					7																	6042131		2203	4300	6503	SO:0001583	missense	5395	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.490T>G	7.37:g.6042131A>C	ENSP00000265849:p.Ser164Ala	Somatic		WXS	SOLID	Phase_I	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	A	2.215	-0.379763	0.05000	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000382321;ENST00000441476;ENST00000406569	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	5.4	5.4	0.78164	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.415239	0.26919	N	0.021838	T	0.64294	0.2585	L	0.39566	1.225	0.24408	N	0.994671	B;B;B;B	0.13594	0.001;0.005;0.002;0.008	B;B;B;B	0.27796	0.008;0.014;0.021;0.083	T	0.50415	-0.8831	10	0.15066	T	0.55	-10.54	9.7596	0.40524	0.8772:0.0:0.1228:0.0	.	164;164;164;58	P54278-3;P54278-2;P54278;C9J167	.;.;PMS2_HUMAN;.	A	164;117;164;58;164	ENSP00000265849:S164A;ENSP00000371758:S164A;ENSP00000392843:S58A;ENSP00000384308:S164A	ENSP00000265849:S164A	S	-	1	0	PMS2	6008657	1.000000	0.71417	0.031000	0.17742	0.062000	0.15995	3.498000	0.53302	2.056000	0.61249	0.455000	0.32223	TCC		0.438	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3		NM_000535	
POGZ	23126	hgsc.bcm.edu	37	1	151377553	151377553	+	Missense_Mutation	SNP	G	G	T	rs527918314		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:151377553G>T	ENST00000271715.2	-	19	4272	c.3958C>A	c.(3958-3960)Cag>Aag	p.Q1320K	POGZ_ENST00000409503.1_Missense_Mutation_p.Q1311K|POGZ_ENST00000361398.3_Missense_Mutation_p.Q1267K|POGZ_ENST00000491586.1_Missense_Mutation_p.Q1276K|POGZ_ENST00000540984.1_Missense_Mutation_p.Q682K|POGZ_ENST00000368863.2_Missense_Mutation_p.Q1225K|POGZ_ENST00000392723.1_Missense_Mutation_p.Q1267K|POGZ_ENST00000531094.1_Missense_Mutation_p.Q1258K	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	1320	DDE.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AAGGAGCGCTGAACTAGCTCT	0.527											OREG0003905	type=REGULATORY REGION|Gene=POGZ|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													108.0	102.0	104.0					1																	151377553		2203	4300	6503	SO:0001583	missense	23126			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.3958C>A	1.37:g.151377553G>T	ENSP00000271715:p.Gln1320Lys	Somatic	1739	WXS	SOLID	Phase_I	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.588331	0.66105	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.22539	5.9;5.93;5.9;5.88;5.92;5.91;1.95;5.4	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000004	T	0.26702	0.0653	L	0.29908	0.895	0.44373	D	0.99727	P;P;P;P;P;P	0.48911	0.634;0.634;0.917;0.917;0.811;0.634	B;B;D;D;P;B	0.63488	0.168;0.231;0.915;0.915;0.879;0.298	T	0.00747	-1.1583	10	0.46703	T	0.11	-14.7913	19.0415	0.93002	0.0:0.0:1.0:0.0	.	1258;1311;1225;1276;1267;1320	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	K	1267;1320;1267;1225;1311;1258;682;1276	ENSP00000376484:Q1267K;ENSP00000271715:Q1320K;ENSP00000354467:Q1267K;ENSP00000357856:Q1225K;ENSP00000386836:Q1311K;ENSP00000431259:Q1258K;ENSP00000443547:Q682K;ENSP00000418408:Q1276K	ENSP00000271715:Q1320K	Q	-	1	0	POGZ	149644177	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.095000	0.71439	2.840000	0.97914	0.655000	0.94253	CAG		0.527	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2		NM_207171	
PROX1	5629	hgsc.bcm.edu	37	1	214170552	214170552	+	Missense_Mutation	SNP	T	T	A	rs146788962		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:214170552T>A	ENST00000366958.4	+	2	1282	c.674T>A	c.(673-675)gTt>gAt	p.V225D	PROX1_ENST00000261454.4_Missense_Mutation_p.V225D|PROX1_ENST00000435016.1_Missense_Mutation_p.V225D|PROX1_ENST00000498508.2_Missense_Mutation_p.V225D	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	225					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CAGCAGCTGGTTTCAGCCCGA	0.542																																																	0													34.0	39.0	38.0					1																	214170552		2203	4300	6503	SO:0001583	missense	5629			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.674T>A	1.37:g.214170552T>A	ENSP00000355925:p.Val225Asp	Somatic		WXS	SOLID	Phase_I	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907367	0.52333	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.93	4.81	0.61882	.	0.113131	0.64402	D	0.000012	T	0.43433	0.1247	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.19095	-1.0316	10	0.41790	T	0.15	-2.9286	11.6533	0.51301	0.0:0.0697:0.0:0.9303	.	225	Q92786	PROX1_HUMAN	D	225	ENSP00000420283:V225D;ENSP00000355925:V225D;ENSP00000400694:V225D;ENSP00000261454:V225D	ENSP00000261454:V225D	V	+	2	0	PROX1	212237175	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.276000	0.72601	1.069000	0.40788	0.533000	0.62120	GTT		0.542	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6		NM_002763	
PRSS22	64063	hgsc.bcm.edu	37	16	2905796	2905796	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr16:2905796T>G	ENST00000161006.3	-	4	403	c.338A>C	c.(337-339)aAc>aCc	p.N113T	PRSS22_ENST00000574768.1_5'UTR|LA16c-325D7.1_ENST00000577140.1_RNA|PRSS22_ENST00000571228.1_Intron	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	113	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						AGAGCCAGGGTTCCCCAGCTG	0.617																																																	0													37.0	39.0	39.0					16																	2905796		2198	4300	6498	SO:0001583	missense	64063			AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.338A>C	16.37:g.2905796T>G	ENSP00000161006:p.Asn113Thr	Somatic		WXS	SOLID	Phase_I	O43342|Q6UXE0	Missense_Mutation	SNP	ENST00000161006.3	37	CCDS10481.1	.	.	.	.	.	.	.	.	.	.	t	0.150	-1.092519	0.01858	.	.	ENSG00000005001	ENST00000161006	D	0.88664	-2.41	4.62	-4.24	0.03777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.877553	0.09845	N	0.748328	T	0.73830	0.3637	N	0.17564	0.495	0.37158	D	0.902489	B	0.14012	0.009	B	0.17722	0.019	T	0.55736	-0.8094	10	0.15952	T	0.53	.	5.3188	0.15870	0.0:0.3579:0.2964:0.3457	.	113	Q9GZN4	BSSP4_HUMAN	T	113	ENSP00000161006:N113T	ENSP00000161006:N113T	N	-	2	0	PRSS22	2845797	0.104000	0.21937	0.518000	0.27811	0.906000	0.53458	0.333000	0.19768	-0.548000	0.06199	-0.451000	0.05528	AAC		0.617	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1		NM_022119	
RAMP3	10268	hgsc.bcm.edu	37	7	45222989	45222989	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:45222989A>C	ENST00000242249.4	+	3	463	c.425A>C	c.(424-426)aAa>aCa	p.K142T	RAMP3_ENST00000496212.1_Missense_Mutation_p.K142T|RAMP3_ENST00000481345.1_Missense_Mutation_p.K142T	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	142					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	TGGCGCAGCAAACGCACCGAC	0.627																																																	0													105.0	97.0	100.0					7																	45222989		2203	4300	6503	SO:0001583	missense	10268			AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.425A>C	7.37:g.45222989A>C	ENSP00000242249:p.Lys142Thr	Somatic		WXS	SOLID	Phase_I	Q7Z2Y1	Missense_Mutation	SNP	ENST00000242249.4	37	CCDS5503.1	.	.	.	.	.	.	.	.	.	.	A	14.74	2.624360	0.46840	.	.	ENSG00000122679	ENST00000242249;ENST00000481345;ENST00000496212	T;T;T	0.55588	0.51;0.51;0.51	4.37	3.21	0.36854	.	0.105792	0.64402	D	0.000007	T	0.72455	0.3462	M	0.89095	3.005	0.48040	D	0.999573	D	0.76494	0.999	D	0.77004	0.989	T	0.72887	-0.4156	10	0.87932	D	0	-19.4188	7.8908	0.29677	0.8978:0.0:0.1022:0.0	.	142	O60896	RAMP3_HUMAN	T	142	ENSP00000242249:K142T;ENSP00000419012:K142T;ENSP00000418460:K142T	ENSP00000242249:K142T	K	+	2	0	RAMP3	45189514	1.000000	0.71417	0.492000	0.27490	0.116000	0.19942	3.313000	0.51935	0.533000	0.28675	0.533000	0.62120	AAA		0.627	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1		NM_005856	
RBM39	9584	hgsc.bcm.edu	37	20	34292616	34292616	+	Missense_Mutation	SNP	T	T	C	rs199587566	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr20:34292616T>C	ENST00000253363.6	-	16	1489	c.1466A>G	c.(1465-1467)aAt>aGt	p.N489S	RBM39_ENST00000407261.4_Missense_Mutation_p.N332S|RBM39_ENST00000528062.3_Missense_Mutation_p.N467S|RBM39_ENST00000361162.6_Missense_Mutation_p.N483S			Q14498	RBM39_HUMAN	RNA binding motif protein 39	489	Interaction with NCOA6. {ECO:0000250}.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					ATGCAATGCATTGACAGCAGC	0.373													T|||	4	0.000798722	0.0008	0.0	5008	,	,		20234	0.0		0.0	False		,,,				2504	0.0031																0													120.0	119.0	119.0					20																	34292616		2203	4300	6503	SO:0001583	missense	9584			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1466A>G	20.37:g.34292616T>C	ENSP00000253363:p.Asn489Ser	Somatic		WXS	SOLID	Phase_I	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Missense_Mutation	SNP	ENST00000253363.6	37	CCDS13266.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	11.70	1.716255	0.30413	.	.	ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000407261	T;T;T;T	0.05580	3.42;3.42;3.42;3.42	4.82	4.82	0.62117	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.044478	0.85682	D	0.000000	T	0.05868	0.0153	L	0.33753	1.03	0.58432	D	0.999999	B;B;B;B;B	0.24882	0.113;0.113;0.016;0.043;0.02	B;B;B;B;B	0.21708	0.014;0.036;0.004;0.014;0.007	T	0.33163	-0.9879	10	0.10902	T	0.67	.	14.8355	0.70180	0.0:0.0:0.0:1.0	.	461;467;483;489;465	B4DRA0;A2RRD3;Q14498-2;Q14498;B3KWX7	.;.;.;RBM39_HUMAN;.	S	489;483;467;332	ENSP00000253363:N489S;ENSP00000354437:N483S;ENSP00000436747:N467S;ENSP00000384541:N332S	ENSP00000253363:N489S	N	-	2	0	RBM39	33756030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.644000	0.61397	2.154000	0.67381	0.528000	0.53228	AAT		0.373	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2		NM_184237	
REPIN1	29803	hgsc.bcm.edu;ucsc.edu	37	7	150066808	150066808	+	5'UTR	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:150066808T>C	ENST00000397281.2	+	0	201				REPIN1_ENST00000482680.1_Missense_Mutation_p.I3T|REPIN1_ENST00000425389.2_5'Flank|REPIN1_ENST00000444957.1_Intron|REPIN1_ENST00000479668.1_Missense_Mutation_p.I3T|REPIN1_ENST00000540729.1_5'UTR|REPIN1_ENST00000518462.1_Intron|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000489432.2_Missense_Mutation_p.I3T|REPIN1_ENST00000518514.1_Intron|REPIN1_ENST00000466559.1_Intron	NM_013400.3	NP_037532.2	Q9BWE0	REPI1_HUMAN	replication initiator 1						DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GCCATGGGGATAGGGGTGTCT	0.577																																																	0													59.0	65.0	63.0					7																	150066808		1936	4134	6070	SO:0001623	5_prime_UTR_variant	29803			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000397281.2:c.-289T>C	7.37:g.150066808T>C		Somatic		WXS	SOLID	Phase_I	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	ENST00000397281.2	37	CCDS43677.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.682139	0.47991	.	.	ENSG00000214022	ENST00000479668;ENST00000489432;ENST00000482680;ENST00000461637	T	0.08720	3.06	3.93	3.93	0.45458	.	.	.	.	.	T	0.04770	0.0129	N	0.08118	0	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.31998	-0.9923	9	0.72032	D	0.01	.	9.4703	0.38837	0.0:0.0:0.0:1.0	.	3	C9J3L7	.	T	3	ENSP00000417291:I3T	ENSP00000417756:I3T	I	+	2	0	REPIN1	149697741	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.767000	0.38501	2.021000	0.59480	0.482000	0.46254	ATA		0.577	REPIN1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			NM_014374	
RFX1	5989	hgsc.bcm.edu	37	19	14104647	14104647	+	Silent	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr19:14104647T>C	ENST00000254325.4	-	2	243	c.9A>G	c.(7-9)acA>acG	p.T3T		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	3					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			TATACGCCTGTGTTGCCATGC	0.557																																																	0													39.0	48.0	45.0					19																	14104647		1926	4122	6048	SO:0001819	synonymous_variant	5989				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.9A>G	19.37:g.14104647T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000254325.4	37	CCDS12301.1																																																																																				0.557	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1		NM_002918	
RNF19A	25897	hgsc.bcm.edu;ucsc.edu	37	8	101271242	101271242	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr8:101271242T>C	ENST00000519449.1	-	11	2375	c.2059A>G	c.(2059-2061)Aat>Gat	p.N687D	RNF19A_ENST00000341084.2_Missense_Mutation_p.N687D|RNF19A_ENST00000523255.1_5'Flank	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	687	Interaction with CASR.				microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CTCGTCTCATTTATCTTCATG	0.433											OREG0018897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													291.0	253.0	266.0					8																	101271242		2203	4300	6503	SO:0001583	missense	25897			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.2059A>G	8.37:g.101271242T>C	ENSP00000428968:p.Asn687Asp	Somatic	1357	WXS	SOLID	Phase_I	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	T	15.11	2.736107	0.49045	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.84660	-1.88;-1.88	5.89	5.89	0.94794	.	0.044787	0.85682	D	0.000000	D	0.82884	0.5134	L	0.56769	1.78	0.80722	D	1	B	0.26635	0.155	B	0.23716	0.048	T	0.79140	-0.1926	10	0.31617	T	0.26	.	15.9805	0.80105	0.0:0.0:0.0:1.0	.	687	Q9NV58	RN19A_HUMAN	D	687	ENSP00000428968:N687D;ENSP00000342667:N687D	ENSP00000342667:N687D	N	-	1	0	RNF19A	101340418	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.841000	0.86834	2.250000	0.74265	0.477000	0.44152	AAT		0.433	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1		NM_015435	
SAA1	6288	hgsc.bcm.edu;ucsc.edu	37	11	18288477	18288477	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:18288477G>A	ENST00000405158.2	+	2	227	c.43G>A	c.(43-45)Ggt>Agt	p.G15S	SAA1_ENST00000356524.4_Missense_Mutation_p.G15S|RNA5SP334_ENST00000364825.1_RNA|SAA1_ENST00000532858.1_Missense_Mutation_p.G15S	NM_000331.4	NP_000322	P0DJI8	SAA1_HUMAN	serum amyloid A1	15			G -> S (in dbSNP:rs712021).		acute-phase response (GO:0006953)|innate immune response (GO:0045087)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of inflammatory response (GO:0050728)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of interleukin-1 secretion (GO:0050716)|regulation of protein secretion (GO:0050708)	endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)			endometrium(1)|large_intestine(3)|lung(2)|stomach(3)	9					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CTTGGTCCTGGGTGTCAGCAG	0.522																																																	0													147.0	131.0	137.0					11																	18288477		2198	4291	6489	SO:0001583	missense	6288			M10906	CCDS7835.1	11p15.1	2014-01-30			ENSG00000173432	ENSG00000173432		"""Endogenous ligands"""	10513	protein-coding gene	gene with protein product		104750		SAA		2595451, 9305847	Standard	NM_199161		Approved	PIG4, TP53I4	uc021qeo.1	P0DJI8	OTTHUMG00000166147	ENST00000405158.2:c.43G>A	11.37:g.18288477G>A	ENSP00000384906:p.Gly15Ser	Somatic		WXS	SOLID	Phase_I	P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Missense_Mutation	SNP	ENST00000405158.2	37	CCDS7835.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595633	0.28445	.	.	ENSG00000173432	ENST00000356524;ENST00000532858;ENST00000405158	T;T;T	0.09350	2.99;2.99;2.99	3.67	1.72	0.24424	.	0.327305	0.27951	N	0.017200	T	0.15176	0.0366	M	0.89095	3.005	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.20240	-1.0281	10	0.42905	T	0.14	.	4.5268	0.11985	0.1163:0.0:0.6669:0.2169	.	15	P02735	SAA_HUMAN	S	15	ENSP00000348918:G15S;ENSP00000436866:G15S;ENSP00000384906:G15S	ENSP00000348918:G15S	G	+	1	0	SAA1	18245053	0.511000	0.26179	0.005000	0.12908	0.034000	0.12701	0.969000	0.29370	0.512000	0.28257	-0.366000	0.07423	GGT		0.522	SAA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395864.1		NM_199161	
RTN3	10313	hgsc.bcm.edu;ucsc.edu	37	11	63486909	63486909	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:63486909G>A	ENST00000377819.5	+	3	1089	c.935G>A	c.(934-936)aGt>aAt	p.S312N	RTN3_ENST00000354497.4_Intron|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000540798.1_Missense_Mutation_p.S200N|RTN3_ENST00000339997.4_Missense_Mutation_p.S293N|RTN3_ENST00000356000.3_Intron|RTN3_ENST00000341307.2_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	312					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						GCATTGCTCAGTAGGCAGTTT	0.413																																																	0													89.0	89.0	89.0					11																	63486909		2201	4298	6499	SO:0001583	missense	10313			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.935G>A	11.37:g.63486909G>A	ENSP00000367050:p.Ser312Asn	Somatic		WXS	SOLID	Phase_I	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	ENST00000377819.5	37	CCDS58141.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771269	0.31320	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.18502	2.21;2.21;2.21	5.98	1.6	0.23607	.	0.984266	0.08288	N	0.968838	T	0.08802	0.0218	N	0.14661	0.345	0.09310	N	0.999993	B;B;B	0.32467	0.372;0.255;0.372	B;B;B	0.24394	0.053;0.024;0.053	T	0.36915	-0.9728	10	0.14656	T	0.56	0.5334	9.686	0.40098	0.1766:0.3948:0.4286:0.0	.	200;312;293	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	N	312;293;200	ENSP00000367050:S312N;ENSP00000344106:S293N;ENSP00000442733:S200N	ENSP00000344106:S293N	S	+	2	0	RTN3	63243485	0.010000	0.17322	0.077000	0.20336	0.967000	0.64934	-0.079000	0.11357	0.017000	0.15025	-0.469000	0.05056	AGT		0.413	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1		NM_006054	
SERPINB7	8710	hgsc.bcm.edu	37	18	61471602	61471602	+	Silent	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr18:61471602A>G	ENST00000398019.2	+	8	1201	c.876A>G	c.(874-876)agA>agG	p.R292R	SERPINB7_ENST00000336429.2_Silent_p.R292R|SERPINB7_ENST00000540675.1_Silent_p.R275R|SERPINB7_ENST00000546027.1_Silent_p.R292R	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	292					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				AATATTTGAGAGCCCTAGGGC	0.398																																																	0													50.0	53.0	52.0					18																	61471602		2203	4300	6503	SO:0001819	synonymous_variant	8710			AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.876A>G	18.37:g.61471602A>G		Somatic		WXS	SOLID	Phase_I	B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Silent	SNP	ENST00000398019.2	37	CCDS11988.1																																																																																				0.398	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1		NM_003784	
SETDB1	9869	hgsc.bcm.edu	37	1	150923098	150923098	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:150923098G>A	ENST00000271640.5	+	13	1935	c.1745G>A	c.(1744-1746)tGt>tAt	p.C582Y	SETDB1_ENST00000368969.4_Missense_Mutation_p.C582Y|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	582					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGCTATACCTGTCTGTCTCGA	0.572																																																	0													99.0	97.0	98.0					1																	150923098		2203	4300	6503	SO:0001583	missense	9869			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1745G>A	1.37:g.150923098G>A	ENSP00000271640:p.Cys582Tyr	Somatic		WXS	SOLID	Phase_I	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281188	0.80692	.	.	ENSG00000143379	ENST00000271640;ENST00000534805;ENST00000368969;ENST00000498193	D;T;D;T	0.97811	-4.55;-0.8;-4.54;-0.97	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.97420	0.9156	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.997;0.995	D;D;D;D	0.85130	0.996;0.997;0.994;0.986	D	0.99509	1.0955	10	0.87932	D	0	.	17.7942	0.88565	0.0:0.0:1.0:0.0	.	582;583;582;582	E9PRF4;E9PQM8;Q15047-3;Q15047	.;.;.;SETB1_HUMAN	Y	582;583;582;582	ENSP00000271640:C582Y;ENSP00000436148:C583Y;ENSP00000357965:C582Y;ENSP00000432348:C582Y	ENSP00000271640:C582Y	C	+	2	0	SETDB1	149189722	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.486000	0.97944	2.540000	0.85666	0.655000	0.94253	TGT		0.572	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2			
SEZ6L	23544	hgsc.bcm.edu	37	22	26688760	26688760	+	Silent	SNP	G	G	T	rs569976807		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr22:26688760G>T	ENST00000248933.6	+	2	578	c.483G>T	c.(481-483)acG>acT	p.T161T	SEZ6L_ENST00000529632.2_Silent_p.T161T|SEZ6L_ENST00000404234.3_Silent_p.T161T|SEZ6L_ENST00000343706.4_Silent_p.T161T|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000360929.3_Silent_p.T161T|SEZ6L_ENST00000402979.1_5'UTR			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	161	O-glycosylated at one site.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCTCCTCCACGGAGAAGCCTG	0.672																																																	0													42.0	41.0	42.0					22																	26688760		2203	4300	6503	SO:0001819	synonymous_variant	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.483G>T	22.37:g.26688760G>T		Somatic		WXS	SOLID	Phase_I	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	37	CCDS13833.1																																																																																				0.672	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			
SFI1	9814	hgsc.bcm.edu	37	22	31998685	31998685	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr22:31998685A>C	ENST00000400288.2	+	17	1824	c.1719A>C	c.(1717-1719)caA>caC	p.Q573H	SFI1_ENST00000400289.1_Missense_Mutation_p.Q491H|SFI1_ENST00000540643.1_Missense_Mutation_p.Q518H|SFI1_ENST00000443326.1_Missense_Mutation_p.Q491H|SFI1_ENST00000414585.1_Missense_Mutation_p.Q420H|SFI1_ENST00000432498.1_Missense_Mutation_p.Q542H|SFI1_ENST00000443011.1_Missense_Mutation_p.Q420H	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	573					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						AGGAGTGGCAAACAGTGGCCT	0.597																																																	0													56.0	63.0	61.0					22																	31998685		2149	4241	6390	SO:0001583	missense	9814			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.1719A>C	22.37:g.31998685A>C	ENSP00000383145:p.Gln573His	Somatic		WXS	SOLID	Phase_I	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	A	8.879	0.951197	0.18431	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	5.95	-0.464	0.12160	.	0.542750	0.18740	N	0.132484	T	0.30634	0.0771	N	0.08118	0	0.09310	N	1	B;B;D;B;B;P	0.71674	0.151;0.013;0.998;0.035;0.013;0.48	B;B;D;B;B;B	0.80764	0.066;0.016;0.994;0.033;0.016;0.204	T	0.12426	-1.0548	10	0.51188	T	0.08	.	5.0559	0.14533	0.5315:0.0:0.3332:0.1354	.	518;491;491;542;573;549	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3;A8K8P3-5	.;.;.;.;SFI1_HUMAN;.	H	542;518;491;549;420;420;491;573;188	ENSP00000402679:Q542H;ENSP00000443025:Q518H;ENSP00000416469:Q491H;ENSP00000397148:Q420H;ENSP00000401199:Q420H;ENSP00000383146:Q491H;ENSP00000383145:Q573H;ENSP00000398871:Q188H	ENSP00000383145:Q573H	Q	+	3	2	SFI1	30328685	0.198000	0.23374	0.145000	0.22337	0.136000	0.21042	0.702000	0.25631	-0.074000	0.12820	0.533000	0.62120	CAA		0.597	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3		NM_014775	
SKIV2L2	23517	hgsc.bcm.edu;ucsc.edu	37	5	54645468	54645468	+	Silent	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr5:54645468A>G	ENST00000230640.5	+	12	1562	c.1308A>G	c.(1306-1308)aaA>aaG	p.K436K	SKIV2L2_ENST00000545714.1_Silent_p.K335K	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	436	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				ATGAAGATAAAAAACTCCCTC	0.308																																					Melanoma(2;92 134 23744 29976 33782)												0													62.0	67.0	66.0					5																	54645468		2203	4299	6502	SO:0001819	synonymous_variant	23517			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1308A>G	5.37:g.54645468A>G		Somatic		WXS	SOLID	Phase_I	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	37	CCDS3967.1																																																																																				0.308	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			
SNX3	8724	hgsc.bcm.edu	37	6	108533446	108533446	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr6:108533446A>T	ENST00000230085.8	-	4	734	c.396T>A	c.(394-396)caT>caA	p.H132Q	SNX3_ENST00000349379.5_Missense_Mutation_p.H110Q|SNX3_ENST00000426155.2_Missense_Mutation_p.H100Q	NM_003795.4	NP_003786.1	O60493	SNX3_HUMAN	sorting nexin 3	132	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				hemoglobin biosynthetic process (GO:0042541)|intracellular protein transport (GO:0006886)|intralumenal vesicle formation (GO:0070676)|membrane invagination (GO:0010324)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein transport (GO:0051224)|negative regulation of viral entry into host cell (GO:0046597)|regulation of cellular protein metabolic process (GO:0032268)|regulation of intracellular protein transport (GO:0033157)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein phosphatase binding (GO:0019903)			large_intestine(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		GTGCCAGAGGATGACCAGCGA	0.333																																																	0													68.0	63.0	65.0					6																	108533446		2203	4300	6503	SO:0001583	missense	8724			AF034546	CCDS5064.1, CCDS5065.1, CCDS75501.1	6q21	2010-08-05			ENSG00000112335	ENSG00000112335		"""Sorting nexins"""	11174	protein-coding gene	gene with protein product		605930				9819414	Standard	XM_005267192		Approved	Grd19	uc003psh.3	O60493	OTTHUMG00000015323	ENST00000230085.8:c.396T>A	6.37:g.108533446A>T	ENSP00000230085:p.His132Gln	Somatic		WXS	SOLID	Phase_I	A8K0B1|E1P5E4|E1P5E5|O60718|Q4TT29|Q4TT31|Q5JXJ7|Q5JXJ8|Q96AP9|Q9C0J5|Q9NU45	Missense_Mutation	SNP	ENST00000230085.8	37	CCDS5064.1	.	.	.	.	.	.	.	.	.	.	A	17.25	3.341944	0.61073	.	.	ENSG00000112335	ENST00000230085;ENST00000426155;ENST00000349379	T;T;T	0.43688	0.94;0.94;0.94	6.08	2.03	0.26663	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.61763	0.2373	H	0.95260	3.645	0.80722	D	1	D;D	0.71674	0.977;0.998	P;D	0.72625	0.907;0.978	T	0.68164	-0.5481	10	0.87932	D	0	-23.5158	8.4895	0.33091	0.6732:0.0:0.3268:0.0	.	100;132	O60493-2;O60493	.;SNX3_HUMAN	Q	132;100;110	ENSP00000230085:H132Q;ENSP00000401779:H100Q;ENSP00000296991:H110Q	ENSP00000230085:H132Q	H	-	3	2	SNX3	108640139	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	0.744000	0.26245	0.540000	0.28808	0.533000	0.62120	CAT		0.333	SNX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041717.1			
SSPO	23145	hgsc.bcm.edu	37	7	149480201	149480201	+	RNA	SNP	G	G	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:149480201G>T	ENST00000378016.2	+	0	2083							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCAGGTGCAGGGTCTGTGTGG	0.597																																																	0													83.0	89.0	87.0					7																	149480201		2174	4270	6444			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149480201G>T		Somatic		WXS	SOLID	Phase_I	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																					0.597	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				
STXBP3	6814	hgsc.bcm.edu	37	1	109325070	109325070	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:109325070A>G	ENST00000370008.3	+	10	886	c.836A>G	c.(835-837)gAg>gGg	p.E279G		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	279					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AAAGAAAAGGAGGCCATCCTT	0.333																																																	0													100.0	98.0	99.0					1																	109325070		2203	4300	6503	SO:0001583	missense	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.836A>G	1.37:g.109325070A>G	ENSP00000359025:p.Glu279Gly	Somatic		WXS	SOLID	Phase_I	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	A	31	5.091938	0.94149	.	.	ENSG00000116266	ENST00000370008	T	0.79141	-1.24	5.56	5.56	0.83823	.	0.103414	0.64402	N	0.000004	D	0.86016	0.5832	M	0.85373	2.75	0.80722	D	1	D	0.69078	0.997	D	0.63793	0.918	D	0.88776	0.3267	10	0.87932	D	0	-22.3667	15.3769	0.74615	1.0:0.0:0.0:0.0	.	279	O00186	STXB3_HUMAN	G	279	ENSP00000359025:E279G	ENSP00000359025:E279G	E	+	2	0	STXBP3	109126593	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.138000	0.77305	2.100000	0.63781	0.528000	0.53228	GAG		0.333	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1		NM_007269	
TADA1	117143	hgsc.bcm.edu;ucsc.edu	37	1	166839078	166839078	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:166839078G>C	ENST00000367874.4	-	2	181	c.88C>G	c.(88-90)Cta>Gta	p.L30V		NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	30					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						CACAGCTTTAGGTTAGCCCAG	0.388																																																	0													107.0	108.0	108.0					1																	166839078		2203	4300	6503	SO:0001583	missense	117143			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.88C>G	1.37:g.166839078G>C	ENSP00000356848:p.Leu30Val	Somatic		WXS	SOLID	Phase_I	A8K4J9	Missense_Mutation	SNP	ENST00000367874.4	37	CCDS1255.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.172771	0.57584	.	.	ENSG00000152382	ENST00000367874	T	0.59083	0.29	5.44	-6.41	0.01938	.	0.000000	0.64402	D	0.000003	T	0.41026	0.1141	L	0.38175	1.15	0.43819	D	0.996380	D;P	0.55605	0.972;0.889	P;P	0.51615	0.675;0.581	T	0.59653	-0.7414	9	0.66056	D	0.02	-16.7824	18.1714	0.89746	0.1852:0.0:0.8148:0.0	.	30;30	A8K4J9;Q96BN2	.;TADA1_HUMAN	V	30	ENSP00000356848:L30V	ENSP00000356848:L30V	L	-	1	2	TADA1	165105702	0.988000	0.35896	0.026000	0.17262	0.944000	0.59088	0.166000	0.16583	-1.160000	0.02804	-0.345000	0.07892	CTA		0.388	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082881.1		NM_053053	
TBX6	6911	hgsc.bcm.edu;ucsc.edu	37	16	30097589	30097589	+	Missense_Mutation	SNP	G	G	T	rs201930048		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr16:30097589G>T	ENST00000395224.2	-	9	1327	c.1268C>A	c.(1267-1269)gCg>gAg	p.A423E	TBX6_ENST00000279386.2_Missense_Mutation_p.A423E	NM_004608.3	NP_004599.2	O95947	TBX6_HUMAN	T-box 6	423					anatomical structure morphogenesis (GO:0009653)|cell fate specification (GO:0001708)|mesoderm development (GO:0007498)|mesoderm formation (GO:0001707)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	9						GCCCCCAGGCGCGGTGTATGG	0.672																																																	0													40.0	46.0	44.0					16																	30097589		2197	4300	6497	SO:0001583	missense	6911			AJ007989	CCDS10670.1	16p11.2	2008-02-05			ENSG00000149922	ENSG00000149922		"""T-boxes"""	11605	protein-coding gene	gene with protein product		602427				9888994, 9933572	Standard	NM_004608		Approved		uc010veh.2	O95947	OTTHUMG00000132115	ENST00000395224.2:c.1268C>A	16.37:g.30097589G>T	ENSP00000378650:p.Ala423Glu	Somatic		WXS	SOLID	Phase_I	Q8TAS4|Q9HA44	Missense_Mutation	SNP	ENST00000395224.2	37	CCDS10670.1	.	.	.	.	.	.	.	.	.	.	G	5.877	0.345911	0.11126	.	.	ENSG00000149922	ENST00000395224;ENST00000279386	D;D	0.86627	-2.15;-2.15	4.69	1.43	0.22495	.	1.793530	0.03144	N	0.167025	T	0.78407	0.4278	N	0.14661	0.345	0.09310	N	1	B	0.26975	0.165	B	0.21546	0.035	T	0.66528	-0.5901	10	0.44086	T	0.13	.	9.3975	0.38412	0.1386:0.5569:0.3046:0.0	.	423	O95947	TBX6_HUMAN	E	423	ENSP00000378650:A423E;ENSP00000279386:A423E	ENSP00000279386:A423E	A	-	2	0	TBX6	30005090	0.026000	0.19158	0.682000	0.30024	0.092000	0.18411	0.782000	0.26788	0.595000	0.29777	-1.295000	0.01343	GCG		0.672	TBX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255157.2		NM_004608, NM_080758	
TCP10L2	401285	hgsc.bcm.edu	37	6	167595371	167595371	+	Silent	SNP	T	T	C	rs202096111	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr6:167595371T>C	ENST00000366832.2	+	8	1160	c.1029T>C	c.(1027-1029)caT>caC	p.H343H		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	343										endometrium(1)|kidney(2)|lung(3)	6						GAGCTCTGCATGCCGCTCCCT	0.517													t|||	1572	0.313898	0.2784	0.3501	5008	,	,		7829	0.2867		0.3579	False		,,,				2504	0.319																0													63.0	45.0	50.0					6																	167595371		546	1228	1774	SO:0001819	synonymous_variant	401285				CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.1029T>C	6.37:g.167595371T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000366832.2	37	CCDS47514.1																																																																																				0.517	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5		XR_040749	
TDG	6996	hgsc.bcm.edu	37	12	104376700	104376700	+	Missense_Mutation	SNP	A	A	C	rs61937630		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr12:104376700A>C	ENST00000392872.3	+	5	836	c.602A>C	c.(601-603)aAa>aCa	p.K201T	TDG_ENST00000544861.1_Missense_Mutation_p.K58T|TDG_ENST00000542036.1_Missense_Mutation_p.K25Q|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000266775.9_Missense_Mutation_p.K197T	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	201					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)	p.K201T(1)		large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		CCCGGCAGCAAAGATCTCTCC	0.458								Base excision repair (BER), DNA glycosylases																																									1	Substitution - Missense(1)	skin(1)											81.0	78.0	79.0					12																	104376700		2203	4300	6503	SO:0001583	missense	6996			U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.602A>C	12.37:g.104376700A>C	ENSP00000376611:p.Lys201Thr	Somatic		WXS	SOLID	Phase_I	Q8IUZ6|Q8IZM3	Missense_Mutation	SNP	ENST00000392872.3	37	CCDS9095.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.68|17.68	3.450099|3.450099	0.63290|0.63290	.|.	.|.	ENSG00000139372|ENSG00000139372	ENST00000542036|ENST00000392872;ENST00000266775;ENST00000544861;ENST00000537100	T|T;T;T;T	0.22539|0.45276	1.95|0.9;0.9;0.9;0.9	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Uracil-DNA glycosylase-like (3);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.47116|0.47116	0.1428|0.1428	L|L	0.36672|0.36672	1.1|1.1	0.29181|0.29181	N|N	0.876493|0.876493	B|P;P	0.22346|0.42692	0.068|0.787;0.787	B|P;P	0.12837|0.52159	0.008|0.691;0.581	T|T	0.42699|0.42699	-0.9436|-0.9436	10|10	0.87932|0.31617	D|T	0|0.26	-25.7328|-25.7328	15.4266|15.4266	0.75055|0.75055	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	rs61937630|rs61937630	25|201;201	B4DI29|B2R848;Q13569	.|.;TDG_HUMAN	Q|T	25|201;197;58;194	ENSP00000439054:K25Q|ENSP00000376611:K201T;ENSP00000266775:K197T;ENSP00000445899:K58T;ENSP00000439825:K194T	ENSP00000439054:K25Q|ENSP00000266775:K197T	K|K	+|+	1|2	0|0	TDG|TDG	102900830|102900830	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.736000|0.736000	0.42039|0.42039	9.271000|9.271000	0.95698|0.95698	2.037000|2.037000	0.60232|0.60232	0.460000|0.460000	0.39030|0.39030	AAG|AAA		0.458	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2			
TIE1	7075	hgsc.bcm.edu;ucsc.edu	37	1	43777725	43777725	+	Missense_Mutation	SNP	G	G	A	rs141628049		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:43777725G>A	ENST00000372476.3	+	11	1632	c.1553G>A	c.(1552-1554)cGt>cAt	p.R518H	TIE1_ENST00000433781.2_Missense_Mutation_p.R163H	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	518	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TACAGTGTTCGTGTGCAGCTG	0.597																																																	0								G	HIS/ARG	0,4406		0,0,2203	89.0	83.0	85.0		1553	2.3	0.9	1	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	missense	TIE1	NM_005424.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	518/1139	43777725	1,13005	2203	4300	6503	SO:0001583	missense	7075			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.1553G>A	1.37:g.43777725G>A	ENSP00000361554:p.Arg518His	Somatic		WXS	SOLID	Phase_I	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	CCDS482.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.236302	0.39498	0.0	1.16E-4	ENSG00000066056	ENST00000372476;ENST00000433781	T;T	0.60920	0.15;0.15	5.67	2.33	0.28932	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.419874	0.17569	N	0.169544	T	0.56470	0.1987	L	0.50333	1.59	0.09310	N	0.999999	B;B;D;B;B	0.58620	0.001;0.005;0.983;0.001;0.005	B;B;P;B;B	0.54210	0.002;0.007;0.745;0.003;0.007	T	0.44421	-0.9329	10	0.42905	T	0.14	.	4.5919	0.12312	0.0927:0.1213:0.511:0.275	.	163;473;518;163;518	E9PG63;B4DTW8;B5A952;B4DKW0;P35590	.;.;.;.;TIE1_HUMAN	H	518;163	ENSP00000361554:R518H;ENSP00000411728:R163H	ENSP00000361554:R518H	R	+	2	0	TIE1	43550312	0.272000	0.24172	0.874000	0.34290	0.978000	0.69477	1.861000	0.39438	0.709000	0.31976	0.563000	0.77884	CGT		0.597	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1		NM_005424	
DCSTAMP	81501	hgsc.bcm.edu	37	8	105360797	105360797	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr8:105360797C>A	ENST00000297581.2	+	2	66	c.17C>A	c.(16-18)tCa>tAa	p.S6*	DCSTAMP_ENST00000517991.1_Nonsense_Mutation_p.S6*|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	6					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											ATCTGGACCTCAGGCACTGAT	0.458																																																	0													78.0	74.0	75.0					8																	105360797		2203	4300	6503	SO:0001587	stop_gained	0			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.17C>A	8.37:g.105360797C>A	ENSP00000297581:p.Ser6*	Somatic		WXS	SOLID	Phase_I	B7ZVW2|E7ESG0|Q2M2D5	Nonsense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.459061	0.26248	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	.	.	.	5.51	0.42	0.16444	.	1.287490	0.04936	N	0.457717	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-0.2927	9.8908	0.41290	0.0:0.5781:0.0:0.4219	.	.	.	.	X	6	.	ENSP00000297581:S6X	S	+	2	0	TM7SF4	105429973	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	-0.081000	0.11321	-0.217000	0.10033	-1.708000	0.00717	TCA		0.458	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1		NM_030788	
TMPRSS11F	389208	hgsc.bcm.edu	37	4	68930482	68930482	+	Silent	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:68930482A>G	ENST00000356291.2	-	8	995	c.936T>C	c.(934-936)gtT>gtC	p.V312V	UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000499180.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	312	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						CTGGGAGGCAAACTCTCTGGA	0.378																																																	0													66.0	65.0	66.0					4																	68930482		2203	4300	6503	SO:0001819	synonymous_variant	389208			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.936T>C	4.37:g.68930482A>G		Somatic		WXS	SOLID	Phase_I	A8MXX2	Silent	SNP	ENST00000356291.2	37	CCDS3520.1																																																																																				0.378	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1		NM_207407	
TPD52L1	7164	hgsc.bcm.edu;ucsc.edu	37	6	125569531	125569531	+	Splice_Site	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr6:125569531T>C	ENST00000534000.1	+	4	682		c.e4+2		TPD52L1_ENST00000368402.5_Splice_Site|TPD52L1_ENST00000524679.1_Splice_Site|TPD52L1_ENST00000534199.1_Splice_Site|TPD52L1_ENST00000392482.2_Splice_Site|TPD52L1_ENST00000532429.1_Splice_Site|TPD52L1_ENST00000368388.2_Splice_Site|HDDC2_ENST00000608456.1_Intron|TPD52L1_ENST00000528193.1_Splice_Site|TPD52L1_ENST00000527711.1_Splice_Site|TPD52L1_ENST00000304877.13_Splice_Site|TPD52L1_ENST00000530868.1_Splice_Site	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1						G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		AGACATGAGGTACTGTGGGAA	0.473																																																	0													113.0	91.0	99.0					6																	125569531		2203	4300	6503	SO:0001630	splice_region_variant	7164			U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.386+2T>C	6.37:g.125569531T>C		Somatic		WXS	SOLID	Phase_I	A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Splice_Site	SNP	ENST00000534000.1	37	CCDS5130.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.385024	0.82792	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000368402;ENST00000368388;ENST00000527711;ENST00000528193;ENST00000532429;ENST00000534199;ENST00000392482;ENST00000524679;ENST00000392484	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7119	0.77635	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TPD52L1	125611230	1.000000	0.71417	0.988000	0.46212	0.931000	0.56810	6.499000	0.73683	2.243000	0.73865	0.528000	0.53228	.		0.473	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042065.2			Intron
TRIM16	10626	hgsc.bcm.edu	37	17	15539426	15539426	+	Missense_Mutation	SNP	C	C	T	rs200176122		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr17:15539426C>T	ENST00000578237.1	-	8	1628	c.773G>A	c.(772-774)aGg>aAg	p.R258K	TRIM16_ENST00000416464.2_Missense_Mutation_p.R128K|TRIM16_ENST00000577886.1_Missense_Mutation_p.R42K|TRIM16_ENST00000579219.1_Missense_Mutation_p.R42K|RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.R258K|TRIM16_ENST00000336708.7_Missense_Mutation_p.R258K|TRIM16_ENST00000581224.1_5'Flank			O95361	TRI16_HUMAN	tripartite motif containing 16	258					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CTCGGCACTCCTGTACTCCAG	0.597																																																	0													127.0	103.0	111.0					17																	15539426		2188	4298	6486	SO:0001583	missense	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.773G>A	17.37:g.15539426C>T	ENSP00000463188:p.Arg258Lys	Somatic		WXS	SOLID	Phase_I	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	28|28	0.01282051282051282|0.01282051282051282	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	2|2	0.0034965034965034965|0.0034965034965034965	24|24	0.0316622691292876|0.0316622691292876	c|c	11.63|11.63	1.694498|1.694498	0.30052|0.30052	.|.	.|.	ENSG00000251537|ENSG00000221926	ENST00000455584|ENST00000336708;ENST00000416464	.|T;T	.|0.65916	.|0.11;-0.18	3.97|3.97	3.0|3.0	0.34707|0.34707	.|.	.|0.204791	.|0.37053	.|U	.|0.002275	T|T	0.17195|0.17195	0.0413|0.0413	L|L	0.27053|0.27053	0.805|0.805	0.25712|0.25712	N|N	0.985473|0.985473	.|B;B;B	.|0.29805	.|0.257;0.072;0.023	.|B;B;B	.|0.23574	.|0.043;0.047;0.028	T|T	0.02646|0.02646	-1.1129|-1.1129	5|10	.|0.20519	.|T	.|0.43	.|.	5.3947|5.3947	0.16263|0.16263	0.0:0.7753:0.0:0.2247|0.0:0.7753:0.0:0.2247	.|.	.|128;258;272	.|B3KP96;O95361;Q59EB2	.|.;TRI16_HUMAN;.	R|K	273|258;128	.|ENSP00000338989:R258K;ENSP00000399918:R128K	.|ENSP00000338989:R258K	G|R	-|-	1|2	0|0	RP11-385D13.1|TRIM16	15480151|15480151	0.991000|0.991000	0.36638|0.36638	0.941000|0.941000	0.38009|0.38009	0.717000|0.717000	0.41224|0.41224	1.626000|1.626000	0.37039|0.37039	2.230000|2.230000	0.72887|0.72887	0.555000|0.555000	0.69702|0.69702	GGA|AGG		0.597	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2		NM_006470	
TSGA10IP	254187	hgsc.bcm.edu;ucsc.edu	37	11	65715562	65715562	+	RNA	SNP	C	C	G	rs375846484		TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr11:65715562C>G	ENST00000532620.1	+	0	1325				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						TACGATGAAACTTTCGTGTCT	0.562																																																	0													37.0	36.0	36.0					11																	65715562		1948	4130	6078			254187			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65715562C>G		Somatic		WXS	SOLID	Phase_I	Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	ENST00000532620.1	37																																																																																					0.562	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2		NM_152762	
TSHZ3	57616	hgsc.bcm.edu	37	19	31770083	31770083	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr19:31770083A>G	ENST00000240587.4	-	2	943	c.616T>C	c.(616-618)Tcc>Ccc	p.S206P		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	206					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTGAAGATGGAGCCATAGAGC	0.617																																																	0													76.0	71.0	73.0					19																	31770083		2203	4300	6503	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.616T>C	19.37:g.31770083A>G	ENSP00000240587:p.Ser206Pro	Somatic		WXS	SOLID	Phase_I	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	A	18.91	3.723955	0.68959	.	.	ENSG00000121297	ENST00000240587	T	0.15256	2.44	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	L	0.38838	1.175	0.80722	D	1	D	0.58620	0.983	D	0.77557	0.99	T	0.02581	-1.1138	10	0.49607	T	0.09	-26.3406	15.4586	0.75336	1.0:0.0:0.0:0.0	.	206	Q63HK5	TSH3_HUMAN	P	206	ENSP00000240587:S206P	ENSP00000240587:S206P	S	-	1	0	TSHZ3	36461923	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.957000	0.93082	2.030000	0.59900	0.533000	0.62120	TCC		0.617	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2		NM_020856	
TTN	7273	hgsc.bcm.edu	37	2	179648812	179648812	+	Missense_Mutation	SNP	G	G	T	rs138788406	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr2:179648812G>T	ENST00000591111.1	-	16	2984	c.2760C>A	c.(2758-2760)caC>caA	p.H920Q	TTN_ENST00000460472.2_Missense_Mutation_p.H874Q|TTN_ENST00000360870.5_Missense_Mutation_p.H920Q|TTN_ENST00000342175.6_Missense_Mutation_p.H874Q|TTN_ENST00000589042.1_Missense_Mutation_p.H920Q|TTN_ENST00000359218.5_Missense_Mutation_p.H874Q|TTN_ENST00000342992.6_Missense_Mutation_p.H920Q			Q8WZ42	TITIN_HUMAN	titin	33619					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCGCGTCCGTGCAGTACTT	0.532																																																	0													126.0	104.0	111.0					2																	179648812		2203	4300	6503	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2760C>A	2.37:g.179648812G>T	ENSP00000465570:p.His920Gln	Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	10.33	1.320054	0.23994	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.61859	0.07;0.31;0.29;0.3;0.48	5.52	-7.75	0.01236	Ribonuclease H-like (1);	.	.	.	.	T	0.27629	0.0679	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.11235	0.0;0.0;0.0;0.0;0.004	B;B;B;B;B	0.06405	0.0;0.0;0.0;0.0;0.002	T	0.22034	-1.0228	9	0.87932	D	0	.	2.8763	0.05632	0.5216:0.1684:0.176:0.1339	.	874;874;874;920;920	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	Q	920;874;874;874;874;920	ENSP00000343764:H920Q;ENSP00000434586:H874Q;ENSP00000340554:H874Q;ENSP00000352154:H874Q;ENSP00000354117:H920Q	ENSP00000340554:H874Q	H	-	3	2	TTN	179357057	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.637000	0.05459	-1.177000	0.02744	0.655000	0.94253	CAC		0.532	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
UGT2B28	54490	hgsc.bcm.edu	37	4	70160277	70160277	+	Missense_Mutation	SNP	T	T	G	rs6843900	byFrequency	TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:70160277T>G	ENST00000335568.5	+	6	1342	c.1340T>G	c.(1339-1341)aTa>aGa	p.I447R	UGT2B28_ENST00000511240.1_3'UTR	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	447			I -> R (in dbSNP:rs6843900). {ECO:0000269|PubMed:19054851}.		metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.I447R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						AAATTATCAATAATTCAACAT	0.373													N|||	1888	0.376997	0.2678	0.4524	5008	,	,		13055	0.3819		0.4771	False		,,,				2504	0.363																1	Substitution - Missense(1)	stomach(1)						G	,ARG/ILE	1389,2641		443,503,1069	39.0	46.0	44.0		,1340	2.2	0.0	4	dbSNP_116	44	4242,4208		1321,1600,1304	no	utr-3,missense	UGT2B28	NM_001207004.1,NM_053039.1	,97	1764,2103,2373	GG,GT,TT		49.7988,34.4665,45.1202	,benign	,447/530	70160277	5631,6849	2015	4225	6240	SO:0001583	missense	54490			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1340T>G	4.37:g.70160277T>G	ENSP00000334276:p.Ile447Arg	Somatic		WXS	SOLID	Phase_I	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	804	0.36813186813186816	101	0.20528455284552846	146	0.40331491712707185	198	0.34615384615384615	359	0.4736147757255937	-	0	-2.861548	0.00064	0.344665	0.502012	ENSG00000135226	ENST00000335568	T	0.60040	0.22	2.17	2.17	0.27698	.	0.310296	0.24102	N	0.041536	T	0.00012	0.0000	N	0.00504	-1.425	0.09310	P	0.999999892799	B	0.02656	0.0	B	0.01281	0.0	T	0.46148	-0.9212	9	0.02654	T	1	.	7.8253	0.29311	0.0:0.0:0.7495:0.2504	rs6843900;rs52813205	447	Q9BY64	UDB28_HUMAN	R	447	ENSP00000334276:I447R	ENSP00000334276:I447R	I	+	2	0	UGT2B28	70194866	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	0.223000	0.17719	0.254000	0.21573	-1.122000	0.02009	ATA		0.373	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2		NM_053039	
USP34	9736	hgsc.bcm.edu	37	2	61571101	61571101	+	Silent	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr2:61571101T>C	ENST00000398571.2	-	16	2425	c.2349A>G	c.(2347-2349)gcA>gcG	p.A783A		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	783					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTTCTGATTTTGCACTAACCT	0.393																																																	0													111.0	100.0	103.0					2																	61571101		1891	4120	6011	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.2349A>G	2.37:g.61571101T>C		Somatic		WXS	SOLID	Phase_I	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1																																																																																				0.393	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			
USP53	54532	hgsc.bcm.edu;ucsc.edu	37	4	120192821	120192821	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr4:120192821A>C	ENST00000274030.6	+	16	2985	c.1806A>C	c.(1804-1806)aaA>aaC	p.K602N	USP53_ENST00000450251.1_Missense_Mutation_p.K602N	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						AAAGTGAAAAAAGACAGCATA	0.368																																																	0													62.0	59.0	60.0					4																	120192821		1833	4077	5910	SO:0001583	missense	54532			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1806A>C	4.37:g.120192821A>C	ENSP00000274030:p.Lys602Asn	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000274030.6	37	CCDS43265.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759191	0.69763	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.34275	1.37;1.37	5.58	0.502	0.16932	.	0.125792	0.53938	D	0.000058	T	0.40909	0.1136	M	0.70595	2.14	0.26292	N	0.978115	P	0.52577	0.954	P	0.47981	0.563	T	0.39563	-0.9608	10	0.87932	D	0	-23.0851	10.019	0.42031	0.6751:0.0:0.3249:0.0	.	602	Q70EK8	UBP53_HUMAN	N	602	ENSP00000274030:K602N;ENSP00000409906:K602N	ENSP00000274030:K602N	K	+	3	2	USP53	120412269	0.141000	0.22595	1.000000	0.80357	0.976000	0.68499	0.472000	0.22116	0.375000	0.24679	0.460000	0.39030	AAA		0.368	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2		XM_052597	
VPS13D	55187	hgsc.bcm.edu;ucsc.edu	37	1	12401915	12401915	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr1:12401915T>G	ENST00000358136.3	+	41	8835	c.8705T>G	c.(8704-8706)tTt>tGt	p.F2902C	VPS13D_ENST00000356315.4_Missense_Mutation_p.F2877C	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ACTTTGTGGTTTGCCACCCTG	0.547																																																	0													93.0	92.0	92.0					1																	12401915		2203	4300	6503	SO:0001583	missense	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8705T>G	1.37:g.12401915T>G	ENSP00000350854:p.Phe2902Cys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.9|25.9	4.688915|4.688915	0.88735|0.88735	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000356315;ENST00000358136|ENST00000011700	T;T|.	0.49720|.	0.77;0.77|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74053|0.74053	0.3666|0.3666	M|M	0.69523|0.69523	2.12|2.12	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.997|.	D;P|.	0.68192|.	0.956;0.905|.	T|T	0.73814|0.73814	-0.3864|-0.3864	10|5	0.54805|.	T|.	0.06|.	.|.	16.0226|16.0226	0.80509|0.80509	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2877;2901|.	Q5THJ4-2;Q5THJ4|.	.;VP13D_HUMAN|.	C|V	2877;2902|1724	ENSP00000348666:F2877C;ENSP00000350854:F2902C|.	ENSP00000348666:F2877C|.	F|L	+|+	2|1	0|2	VPS13D|VPS13D	12324502|12324502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.698000|7.698000	0.84413|0.84413	2.182000|2.182000	0.69389|0.69389	0.482000|0.482000	0.46254|0.46254	TTT|TTG		0.547	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2		NM_015378	
XPC	7508	hgsc.bcm.edu	37	3	14193901	14193901	+	Silent	SNP	A	A	T			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr3:14193901A>T	ENST00000285021.7	-	11	2263	c.2049T>A	c.(2047-2049)acT>acA	p.T683T	XPC_ENST00000449060.2_Silent_p.T646T	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	683	DNA-binding; preference for heteroduplex DNA.|Interaction with RAD23B.|Minimal sensor domain involved in damage recognition.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGGAATGCAGAGTGTGCACAC	0.582			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	0													95.0	102.0	100.0					3																	14193901		2086	4209	6295	SO:0001819	synonymous_variant	7508	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.2049T>A	3.37:g.14193901A>T		Somatic		WXS	SOLID	Phase_I	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Silent	SNP	ENST00000285021.7	37	CCDS46763.1	.	.	.	.	.	.	.	.	.	.	A	0.131	-1.113627	0.01799	.	.	ENSG00000154767	ENST00000538683	.	.	.	5.05	-1.47	0.08772	.	.	.	.	.	T	0.40670	0.1126	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27400	-1.0075	4	.	.	.	-12.1997	2.3679	0.04324	0.3029:0.295:0.3025:0.0996	.	.	.	.	T	126	.	.	S	-	1	0	XPC	14168902	0.000000	0.05858	0.674000	0.29902	0.026000	0.11368	-2.311000	0.01128	-0.104000	0.12154	-1.247000	0.01520	TCT		0.582	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3		NM_004628	
ZBTB1	22890	hgsc.bcm.edu;ucsc.edu	37	14	64990159	64990159	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr14:64990159A>C	ENST00000554015.1	+	4	2368	c.1937A>C	c.(1936-1938)aAa>aCa	p.K646T	RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Intron|ZBTB1_ENST00000394712.2_Missense_Mutation_p.K646T			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	646					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AACTTCAGAAAACATGACCAT	0.418																																																	0													97.0	90.0	92.0					14																	64990159		2193	4297	6490	SO:0001583	missense	22890			AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1937A>C	14.37:g.64990159A>C	ENSP00000451000:p.Lys646Thr	Somatic		WXS	SOLID	Phase_I	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.766843	0.49574	.	.	ENSG00000126804	ENST00000554015;ENST00000394712	T;T	0.30448	1.53;1.53	5.47	4.3	0.51218	Zinc finger, C2H2-like (1);	2.253660	0.05066	U	0.480806	T	0.39600	0.1084	M	0.71036	2.16	0.50813	D	0.999894	P	0.44627	0.839	B	0.40444	0.329	T	0.11690	-1.0577	9	.	.	.	-17.7762	11.7189	0.51670	0.8676:0.0:0.0:0.1324	.	646	Q9Y2K1	ZBTB1_HUMAN	T	646	ENSP00000451000:K646T;ENSP00000378201:K646T	.	K	+	2	0	ZBTB1	64059912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.919000	0.92770	0.884000	0.36064	0.529000	0.55759	AAA		0.418	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1			
ZCWPW1	55063	hgsc.bcm.edu;ucsc.edu	37	7	100017327	100017327	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr7:100017327T>A	ENST00000398027.2	-	4	455	c.208A>T	c.(208-210)Aag>Tag	p.K70*	ZCWPW1_ENST00000490721.1_5'UTR|ZCWPW1_ENST00000360951.4_Nonsense_Mutation_p.K70*|ZCWPW1_ENST00000324725.6_5'UTR	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	70							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGAACATTCTTCATGGTTGCT	0.483																																																	0													155.0	142.0	146.0					7																	100017327		1860	4090	5950	SO:0001587	stop_gained	55063			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.208A>T	7.37:g.100017327T>A	ENSP00000381109:p.Lys70*	Somatic		WXS	SOLID	Phase_I	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Nonsense_Mutation	SNP	ENST00000398027.2	37	CCDS43623.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.344262	0.41498	.	.	ENSG00000078487	ENST00000398027;ENST00000360951;ENST00000379559	.	.	.	4.94	2.14	0.27477	.	0.306075	0.23716	N	0.045261	.	.	.	.	.	.	0.22342	N	0.999189	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.888	5.7601	0.18195	0.0:0.6678:0.0:0.3322	.	.	.	.	X	70	.	.	K	-	1	0	ZCWPW1	99855263	0.066000	0.20996	0.200000	0.23457	0.003000	0.03518	0.174000	0.16743	0.769000	0.33313	-0.242000	0.12053	AAG		0.483	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356083.1		NM_017984	
ZFP64	55734	hgsc.bcm.edu	37	20	50768804	50768804	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr20:50768804T>C	ENST00000216923.4	-	6	2276	c.1927A>G	c.(1927-1929)Aca>Gca	p.T643A	ZFP64_ENST00000371515.4_Missense_Mutation_p.T641A|ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000346617.4_Missense_Mutation_p.T589A|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	643					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GGTGGCGCTGTGGTGGCCACT	0.567																																																	0													99.0	80.0	87.0					20																	50768804		2203	4300	6503	SO:0001583	missense	55734			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1927A>G	20.37:g.50768804T>C	ENSP00000216923:p.Thr643Ala	Somatic		WXS	SOLID	Phase_I	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	T	3.151	-0.174129	0.06421	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083	T;T;T	0.06768	3.26;3.31;3.26	5.57	4.47	0.54385	.	0.203476	0.34507	N	0.003906	T	0.06280	0.0162	L	0.27053	0.805	0.27320	N	0.957063	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12156	0.007;0.002;0.002	T	0.29427	-1.0012	10	0.33141	T	0.24	-18.8896	8.3541	0.32321	0.0:0.0718:0.1413:0.7869	.	589;641;643	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	A	643;589;641;485	ENSP00000216923:T643A;ENSP00000344615:T589A;ENSP00000360570:T641A	ENSP00000216923:T643A	T	-	1	0	ZFP64	50202211	0.946000	0.32159	0.986000	0.45419	0.087000	0.18053	0.350000	0.20079	0.939000	0.37446	-0.297000	0.09499	ACA		0.567	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1		NM_018197	
ZNF618	114991	hgsc.bcm.edu	37	9	116770786	116770786	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr9:116770786G>A	ENST00000374126.5	+	9	805	c.706G>A	c.(706-708)Gac>Aac	p.D236N	ZNF618_ENST00000288466.7_Missense_Mutation_p.D204N			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						CGTGGCCACGGACGAGGTGAA	0.667																																																	0													47.0	55.0	53.0					9																	116770786		1945	4119	6064	SO:0001583	missense	114991			BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.706G>A	9.37:g.116770786G>A	ENSP00000363241:p.Asp236Asn	Somatic		WXS	SOLID	Phase_I	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	ENST00000374126.5	37		.	.	.	.	.	.	.	.	.	.	G	21.2	4.119241	0.77323	.	.	ENSG00000157657	ENST00000374126;ENST00000288466;ENST00000452710;ENST00000374124	T;T;T	0.19669	4.43;2.7;2.13	5.98	5.98	0.97165	.	0.127353	0.56097	D	0.000036	T	0.16514	0.0397	N	0.14661	0.345	0.29584	N	0.848904	P;B;P;B;P	0.41848	0.651;0.094;0.653;0.143;0.763	B;B;B;B;B	0.41440	0.212;0.054;0.357;0.133;0.288	T	0.04229	-1.0967	10	0.28530	T	0.3	-26.0353	17.95	0.89050	0.0:0.0:1.0:0.0	.	204;204;236;204;204	B5MDS3;B9EG82;Q5T7W0;Q5T7W0-2;Q5T7W0-3	.;.;ZN618_HUMAN;.;.	N	236;204;192;204	ENSP00000288466:D204N;ENSP00000395400:D192N;ENSP00000363239:D204N	ENSP00000288466:D204N	D	+	1	0	ZNF618	115810607	1.000000	0.71417	0.995000	0.50966	0.931000	0.56810	8.692000	0.91284	2.847000	0.97988	0.591000	0.81541	GAC		0.667	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1		XM_054983	
ZNF646	9726	hgsc.bcm.edu	37	16	31089315	31089315	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr16:31089315A>C	ENST00000394979.2	+	1	2093	c.1670A>C	c.(1669-1671)aAa>aCa	p.K557T	ZNF646_ENST00000300850.5_Missense_Mutation_p.K557T			O15015	ZN646_HUMAN	zinc finger protein 646	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CATGTGTGCAAACATGAAGAA	0.587																																																	0													67.0	70.0	69.0					16																	31089315		2197	4300	6497	SO:0001583	missense	9726			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1670A>C	16.37:g.31089315A>C	ENSP00000378429:p.Lys557Thr	Somatic		WXS	SOLID	Phase_I	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	A	4.535	0.099368	0.08681	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.09073	3.02;3.04	4.49	-0.556	0.11803	.	.	.	.	.	T	0.05135	0.0137	L	0.27053	0.805	0.20926	N	0.99982	B	0.23806	0.091	B	0.22386	0.039	T	0.44817	-0.9303	9	0.23302	T	0.38	-12.2414	5.2411	0.15471	0.6162:0.1412:0.2426:0.0	.	557	O15015-2	.	T	557	ENSP00000300850:K557T;ENSP00000378429:K557T	ENSP00000300850:K557T	K	+	2	0	ZNF646	30996816	0.000000	0.05858	0.078000	0.20375	0.321000	0.28281	-0.814000	0.04486	-0.211000	0.10124	0.533000	0.62120	AAA		0.587	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2		NM_014699	
ZNF823	55552	hgsc.bcm.edu;ucsc.edu	37	19	11833073	11833073	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4841-01A-01D-1361-10	TCGA-B0-4841-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd70430c-c9de-4d59-b72c-50e471dbbebb	9542799b-552f-42d3-aa1f-cadfeeffb85d	g.chr19:11833073T>A	ENST00000341191.6	-	4	1429	c.1276A>T	c.(1276-1278)Agt>Tgt	p.S426C	ZNF823_ENST00000545749.1_Missense_Mutation_p.S244C	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						CCGGCAAGACTGAAGGCTTTA	0.433										HNSCC(68;0.2)																																							0													64.0	71.0	69.0					19																	11833073		2202	4299	6501	SO:0001583	missense	55552			X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1276A>T	19.37:g.11833073T>A	ENSP00000340683:p.Ser426Cys	Somatic		WXS	SOLID	Phase_I	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	37	CCDS45981.1	.	.	.	.	.	.	.	.	.	.	N	9.776	1.174078	0.21704	.	.	ENSG00000197933	ENST00000545749;ENST00000341191;ENST00000431998	T;T;T	0.07688	3.17;3.17;3.17	0.566	0.566	0.17317	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11110	0.0271	M	0.78285	2.405	0.20196	N	0.999925	B	0.09022	0.002	B	0.04013	0.001	T	0.25328	-1.0135	9	0.59425	D	0.04	.	5.4308	0.16452	0.0:1.0E-4:0.0:0.9999	.	426	P16415	ZN823_HUMAN	C	244;426;382	ENSP00000440162:S244C;ENSP00000340683:S426C;ENSP00000410654:S382C	ENSP00000340683:S426C	S	-	1	0	ZNF823	11694073	0.009000	0.17119	0.011000	0.14972	0.401000	0.30781	0.513000	0.22770	0.480000	0.27534	0.155000	0.16302	AGT		0.433	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2		NM_001080493	
