#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AAK1	22848	broad.mit.edu;ucsc.edu	37	2	69704092	69704092	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:69704092A>G	ENST00000409085.4	-	21	3087	c.2711T>C	c.(2710-2712)tTt>tCt	p.F904S	AAK1_ENST00000409068.1_Intron	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	904					endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)	p.F904S(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						AGGGACATCAAAACCTGAGAT	0.418																																																	1	Substitution - Missense(1)	kidney(1)											88.0	84.0	86.0					2																	69704092		1879	4110	5989	SO:0001583	missense	22848			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.2711T>C	2.37:g.69704092A>G	ENSP00000386456:p.Phe904Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137091	0.77775	.	.	ENSG00000115977	ENST00000409085	T	0.32988	1.43	5.71	5.71	0.89125	.	.	.	.	.	T	0.19644	0.0472	L	0.27053	0.805	0.80722	D	1	P	0.34864	0.473	B	0.24848	0.056	T	0.06862	-1.0803	9	0.16896	T	0.51	.	15.1717	0.72878	1.0:0.0:0.0:0.0	.	904	Q2M2I8	AAK1_HUMAN	S	904	ENSP00000386456:F904S	ENSP00000386456:F904S	F	-	2	0	AAK1	69557596	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.270000	0.65547	2.176000	0.68965	0.533000	0.62120	TTT		0.418	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4		NM_014911	
ACACA	31	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	35640308	35640308	+	Splice_Site	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr17:35640308T>C	ENST00000394406.2	-	5	551		c.e5-2		ACACA_ENST00000353139.5_Splice_Site|ACACA_ENST00000335166.5_Splice_Site|ACACA_ENST00000360679.3_Splice_Site	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha						acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.?(2)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AATAAGAACCTGGGAGGGGGA	0.403																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												2	Unknown(2)	kidney(2)											61.0	55.0	57.0					17																	35640308		2203	4300	6503	SO:0001630	splice_region_variant	31			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.361-2A>G	17.37:g.35640308T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Splice_Site	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696779	0.88830	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000456066	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.226	0.82293	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACACA	32714421	1.000000	0.71417	0.915000	0.36163	0.927000	0.56198	7.932000	0.87634	2.230000	0.72887	0.528000	0.53228	.		0.403	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1		NM_198836	Intron
ACTG1	71	broad.mit.edu	37	17	79479120	79479120	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr17:79479120C>T	ENST00000575842.1	-	2	598	c.172G>A	c.(172-174)Gcc>Acc	p.A58T	ACTG1_ENST00000331925.2_Missense_Mutation_p.A58T|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.A58T|ACTG1_ENST00000573283.1_Missense_Mutation_p.A58T|RP13-766D20.2_ENST00000430912.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1	58					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)	p.A58T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TTGCTCTGGGCCTCGTCGCCC	0.632																																																	1	Substitution - Missense(1)	kidney(1)											67.0	66.0	66.0					17																	79479120		2203	4300	6503	SO:0001583	missense	71				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.172G>A	17.37:g.79479120C>T	ENSP00000458162:p.Ala58Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456560	0.43634	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.92149	-2.98	3.99	2.99	0.34606	Actin, conserved site (1);	0.000000	0.64402	U	0.000002	D	0.94732	0.8300	H	0.97415	4	0.47407	D	0.999413	B	0.19073	0.033	B	0.27170	0.077	D	0.93176	0.6570	10	0.87932	D	0	.	11.7036	0.51585	0.1787:0.8213:0.0:0.0	.	58	P63261	ACTG_HUMAN	T	58	ENSP00000331514:A58T	ENSP00000331514:A58T	A	-	1	0	ACTG1	77093715	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.227000	0.78070	0.859000	0.35456	0.563000	0.77884	GCC		0.632	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2		NM_001614	
ADAMTS20	80070	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	43769952	43769952	+	Splice_Site	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr12:43769952C>T	ENST00000389420.3	-	35	5220		c.e35-1			NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20						extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.?(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CACAATAAATCTAAAGAAAAA	0.303																																																	2	Unknown(2)	kidney(2)											61.0	60.0	61.0					12																	43769952		2203	4300	6503	SO:0001630	splice_region_variant	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.5221-1G>A	12.37:g.43769952C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NNC9|J3QT00	Splice_Site	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930499	0.52866	.	.	ENSG00000173157	ENST00000389420	.	.	.	5.14	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0476	0.64714	0.0:0.9267:0.0:0.0733	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS20	42056219	1.000000	0.71417	0.582000	0.28627	0.710000	0.40934	3.361000	0.52306	1.305000	0.44909	0.650000	0.86243	.		0.303	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1		NM_025003	Intron
ADAMTS6	11174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	64483842	64483842	+	Splice_Site	SNP	C	C	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr5:64483842C>G	ENST00000314351.5	-	3	570		c.e3+1					Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(2)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		GATTTCCTTACCTCAGACCAG	0.433																																																	2	Unknown(2)	kidney(2)											88.0	88.0	88.0					5																	64483842		2203	4300	6503	SO:0001630	splice_region_variant	11174			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.752+1G>C	5.37:g.64483842C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Splice_Site	SNP	ENST00000314351.5	37		.	.	.	.	.	.	.	.	.	.	C	23.0	4.364473	0.82463	.	.	ENSG00000049192	ENST00000381055	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6423	0.91399	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS6	64519598	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.484000	0.81180	2.385000	0.81259	0.591000	0.81541	.		0.433	ADAMTS6-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000157334.2		NM_197941	Intron
ADCK2	90956	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	140387007	140387007	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr7:140387007T>A	ENST00000072869.4	+	5	1701	c.1523T>A	c.(1522-1524)tTc>tAc	p.F508Y	ADCK2_ENST00000476491.1_Missense_Mutation_p.F508Y	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	508	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.F508Y(1)		cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					CTGAGGAATTTCCGGGCAGTT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											34.0	26.0	29.0					7																	140387007		2202	4298	6500	SO:0001583	missense	90956			AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.1523T>A	7.37:g.140387007T>A	ENSP00000072869:p.Phe508Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96CN6|Q9Y6T5	Missense_Mutation	SNP	ENST00000072869.4	37	CCDS5861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.59|16.59	3.164389|3.164389	0.57476|0.57476	.|.	.|.	ENSG00000133597|ENSG00000133597	ENST00000483369|ENST00000072869;ENST00000476491;ENST00000473512	.|T;T;T	.|0.46819	.|0.86;0.86;2.1	4.91|4.91	3.73|3.73	0.42828|0.42828	.|.	0.140157|0.140157	0.49305|0.49305	D|D	0.000142|0.000142	T|T	0.62889|0.62889	0.2465|0.2465	M|M	0.61703|0.61703	1.905|1.905	0.46586|0.46586	D|D	0.999115|0.999115	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.71656	.|0.974;0.959	T|T	0.64875|0.64875	-0.6304|-0.6304	6|10	.|0.72032	.|D	.|0.01	-9.9628|-9.9628	11.7986|11.7986	0.52114|0.52114	0.0:0.0:0.1472:0.8528|0.0:0.0:0.1472:0.8528	.|.	.|508;508	.|C9JE15;Q7Z695	.|.;ADCK2_HUMAN	L|Y	345|508;508;148	.|ENSP00000072869:F508Y;ENSP00000420512:F508Y;ENSP00000420288:F148Y	.|ENSP00000072869:F508Y	F|F	+|+	3|2	2|0	ADCK2|ADCK2	140033476|140033476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.112000|0.112000	0.19704|0.19704	7.490000|7.490000	0.81461|0.81461	0.878000|0.878000	0.35920|0.35920	-0.619000|-0.619000	0.04042|0.04042	TTT|TTC		0.562	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348734.1		NM_052853	
ATP13A4	84239	broad.mit.edu;ucsc.edu	37	3	193158423	193158423	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:193158423A>C	ENST00000342695.4	-	21	2765	c.2443T>G	c.(2443-2445)Ttg>Gtg	p.L815V	ATP13A4_ENST00000392443.3_Missense_Mutation_p.L796V	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	815						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.L815V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CCATTGATCAATATCTGTAAG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											74.0	76.0	75.0					3																	193158423		2203	4300	6503	SO:0001583	missense	84239			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2443T>G	3.37:g.193158423A>C	ENSP00000339182:p.Leu815Val	Somatic		WXS	Illumina GAIIx	Phase_I	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	A	15.52	2.857570	0.51376	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	D;D	0.87650	-1.99;-2.28	5.7	0.953	0.19590	HAD-like domain (2);	0.000000	0.53938	D	0.000051	D	0.87755	0.6257	L	0.60012	1.86	0.80722	D	1	P;B;P	0.50156	0.88;0.419;0.932	P;B;P	0.55087	0.768;0.422;0.708	D	0.83539	0.0095	10	0.40728	T	0.16	-14.0576	9.4145	0.38512	0.4179:0.0:0.5821:0.0	.	796;815;815	B7WPN9;Q4VNC1-2;Q4VNC1	.;.;AT134_HUMAN	V	796;815	ENSP00000376238:L796V;ENSP00000339182:L815V	ENSP00000339182:L815V	L	-	1	2	ATP13A4	194641117	0.527000	0.26306	0.995000	0.50966	0.872000	0.50106	0.371000	0.20450	-0.109000	0.12044	-0.147000	0.13772	TTG		0.403	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4		NM_032279	
DQX1	165545	broad.mit.edu;ucsc.edu	37	2	74754424	74754424	+	5'Flank	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:74754424T>C	ENST00000404568.3	-	0	0				HTRA2_ENST00000258080.3_5'Flank|HTRA2_ENST00000352222.3_5'Flank|DQX1_ENST00000393951.2_5'Flank|AUP1_ENST00000377526.3_Missense_Mutation_p.E343G	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.E343G(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						GGTGATGTCTTCAGGCATGAA	0.547																																																	1	Substitution - Missense(1)	kidney(1)											52.0	53.0	53.0					2																	74754424		1971	4142	6113	SO:0001631	upstream_gene_variant	550			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74754424T>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_I	Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	T	16.71	3.197906	0.58126	.	.	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	.	.	.	5.15	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.63908	0.2551	L	0.40543	1.245	0.52099	D	0.999941	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.87578	0.994;0.991;0.998	T	0.63207	-0.6689	9	0.54805	T	0.06	-7.2361	7.5904	0.28017	0.0:0.0946:0.0:0.9054	.	400;409;343	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	G	343;407;345	.	ENSP00000258081:E407G	E	-	2	0	AUP1	74607932	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.150000	0.64869	0.978000	0.38470	0.533000	0.62120	GAA		0.547	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3		NM_133637	
AVIL	10677	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	58202005	58202005	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr12:58202005A>G	ENST00000257861.3	-	10	1596	c.1166T>C	c.(1165-1167)aTg>aCg	p.M389T	RNU6-1083P_ENST00000384022.1_RNA|AVIL_ENST00000537081.1_Missense_Mutation_p.M382T|AVIL_ENST00000550083.1_5'Flank	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	389	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)	p.M389T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					ATCATCGACCATTCTTTCCTG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											188.0	181.0	183.0					12																	58202005		2203	4300	6503	SO:0001583	missense	10677			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1166T>C	12.37:g.58202005A>G	ENSP00000257861:p.Met389Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAU7|Q2NKM9	Missense_Mutation	SNP	ENST00000257861.3	37	CCDS8959.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.032471	0.75504	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	T;T	0.32515	1.45;1.45	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.66448	-0.5921	10	0.72032	D	0.01	-32.1139	14.1407	0.65318	1.0:0.0:0.0:0.0	.	382;389	O75366-2;O75366	.;AVIL_HUMAN	T	382;389	ENSP00000443207:M382T;ENSP00000257861:M389T	ENSP00000257861:M389T	M	-	2	0	AVIL	56488272	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	9.062000	0.93920	2.176000	0.68965	0.379000	0.24179	ATG		0.512	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1		NM_006576	
BCL9	607	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	147096204	147096204	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr1:147096204C>A	ENST00000234739.3	+	10	4465	c.3725C>A	c.(3724-3726)tCt>tAt	p.S1242Y		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1242	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.S1242Y(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					ATTATTCCATCTGAGAAGCCC	0.552			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	1	Substitution - Missense(1)	kidney(1)											57.0	61.0	60.0					1																	147096204		2203	4300	6503	SO:0001583	missense	607			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3725C>A	1.37:g.147096204C>A	ENSP00000234739:p.Ser1242Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.751244	0.69533	.	.	ENSG00000116128	ENST00000234739	T	0.54279	0.58	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.63721	0.2535	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.67221	-0.5725	10	0.72032	D	0.01	-11.6976	18.49	0.90843	0.0:1.0:0.0:0.0	.	1242;1242	Q1JQ81;O00512	.;BCL9_HUMAN	Y	1242	ENSP00000234739:S1242Y	ENSP00000234739:S1242Y	S	+	2	0	BCL9	145562828	1.000000	0.71417	0.910000	0.35882	0.976000	0.68499	7.776000	0.85560	2.437000	0.82529	0.655000	0.94253	TCT		0.552	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1		NM_004326	
BRWD1	54014	broad.mit.edu;ucsc.edu	37	21	40572254	40572254	+	Silent	SNP	A	A	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr21:40572254A>G	ENST00000333229.2	-	39	4971	c.4644T>C	c.(4642-4644)tcT>tcC	p.S1548S	BRWD1_ENST00000380800.3_Silent_p.S1548S|BRWD1_ENST00000342449.3_Silent_p.S1548S	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1548	Poly-Ser.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S1548S(2)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TGCTTTCCTCAGAACTACTGG	0.428																																					Melanoma(170;988 1986 4794 16843 39731)												2	Substitution - coding silent(2)	kidney(2)											125.0	124.0	124.0					21																	40572254		2203	4300	6503	SO:0001819	synonymous_variant	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.4644T>C	21.37:g.40572254A>G		Somatic		WXS	Illumina GAIIx	Phase_I	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	37	CCDS13662.1																																																																																				0.428	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3		NM_033656	
PROSER2	254427	broad.mit.edu;hgsc.bcm.edu	37	10	11894170	11894170	+	Silent	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:11894170C>T	ENST00000277570.5	+	2	248	c.94C>T	c.(94-96)Ctg>Ttg	p.L32L	PROSER2-AS1_ENST00000445498.1_RNA|PROSER2_ENST00000474155.1_3'UTR	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	32	Ser-rich.							p.L32L(1)									AGGCGGCAGCCTGGAGAGTCG	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											57.0	45.0	49.0					10																	11894170		2203	4299	6502	SO:0001819	synonymous_variant	0			BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.94C>T	10.37:g.11894170C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Silent	SNP	ENST00000277570.5	37	CCDS7085.1																																																																																				0.552	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2		NM_153256	
BUB3	9184	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	124917322	124917322	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:124917322A>G	ENST00000368865.4	+	4	552	c.343A>G	c.(343-345)Agt>Ggt	p.S115G	BUB3_ENST00000368859.2_Missense_Mutation_p.S115G|BUB3_ENST00000368858.5_Missense_Mutation_p.S115G|BUB3_ENST00000538238.1_Missense_Mutation_p.S35G	NM_004725.3	NP_004716.1	O43684	BUB3_HUMAN	BUB3 mitotic checkpoint protein	115					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|regulation of chromosome segregation (GO:0051983)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly checkpoint (GO:0071173)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)		p.S115G(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				GGTCACTGGAAGTTGGGATCA	0.433																																					GBM(161;1111 1985 17553 20049 26037)												2	Substitution - Missense(2)	kidney(2)											118.0	115.0	116.0					10																	124917322		2203	4300	6503	SO:0001583	missense	9184			AF053304	CCDS7635.1, CCDS31306.1	10q24	2013-01-17	2013-01-17		ENSG00000154473	ENSG00000154473		"""WD repeat domain containing"""	1151	protein-coding gene	gene with protein product		603719	"""BUB3 (budding uninhibited by benzimidazoles 3, yeast) homolog"", ""budding uninhibited by benzimidazoles 3 homolog (yeast)"""			9660858	Standard	NM_004725		Approved	BUB3L	uc001lhe.2	O43684	OTTHUMG00000019197	ENST00000368865.4:c.343A>G	10.37:g.124917322A>G	ENSP00000357858:p.Ser115Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ42|B2R6E7|D3DRE9|O43685	Missense_Mutation	SNP	ENST00000368865.4	37	CCDS7635.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.681169	0.68042	.	.	ENSG00000154473	ENST00000368865;ENST00000538238;ENST00000368859;ENST00000368858;ENST00000407911	T;T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53;-0.53	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.219310	0.52532	D	0.000069	T	0.65575	0.2704	L	0.43152	1.355	0.80722	D	1	B;B	0.17465	0.022;0.002	B;B	0.20955	0.032;0.004	T	0.60915	-0.7168	10	0.40728	T	0.16	-5.679	16.1141	0.81289	1.0:0.0:0.0:0.0	.	115;115	O43684;O43684-2	BUB3_HUMAN;.	G	115;35;115;115;115	ENSP00000357858:S115G;ENSP00000444354:S35G;ENSP00000357852:S115G;ENSP00000357851:S115G;ENSP00000383941:S115G	ENSP00000357851:S115G	S	+	1	0	BUB3	124907312	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.307000	0.96226	2.214000	0.71695	0.528000	0.53228	AGT		0.433	BUB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050835.1			
SIGLECL1	284369	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	51767348	51767348	+	Splice_Site	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:51767348G>T	ENST00000316401.7	+	2	403	c.22G>T	c.(22-24)Gta>Tta	p.V8L	CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000597824.1_Splice_Site_p.G8*|SIGLECL1_ENST00000593968.1_3'UTR	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	0					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.V8L(1)									GCTACAGCTGGGTAAGTAAGG	0.527																																																	1	Substitution - Missense(1)	kidney(1)											140.0	115.0	123.0					19																	51767348		2203	4300	6503	SO:0001630	splice_region_variant	0			AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.22+1G>T	19.37:g.51767348G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	G	5.857	0.342354	0.11069	.	.	ENSG00000179213	ENST00000316401	T	0.30448	1.53	2.94	0.787	0.18596	.	.	.	.	.	T	0.12305	0.0299	N	0.08118	0	0.09310	N	0.999999	B	0.19073	0.033	B	0.14023	0.01	T	0.34875	-0.9811	9	0.13108	T	0.6	-2.7619	5.1279	0.14894	0.2817:0.0:0.7183:0.0	.	8	Q8N7X8	CS075_HUMAN	L	8	ENSP00000321249:V8L	ENSP00000321249:V8L	V	+	1	0	C19orf75	56459160	0.853000	0.29707	0.170000	0.22879	0.015000	0.08874	0.960000	0.29253	0.284000	0.22305	0.650000	0.86243	GTA		0.527	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2		NM_173635	Missense_Mutation
CCAR1	55749	hgsc.bcm.edu;ucsc.edu	37	10	70520853	70520857	+	Frame_Shift_Del	DEL	TAAAG	TAAAG	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	TAAAG	TAAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:70520853_70520857delTAAAG	ENST00000265872.6	+	16	2129_2133	c.2010_2014delTAAAG	c.(2008-2016)cttaaagtafs	p.KV671fs	MIR1254-1_ENST00000408257.1_RNA|CCAR1_ENST00000543719.1_Frame_Shift_Del_p.KV656fs|CCAR1_ENST00000535016.1_Frame_Shift_Del_p.KV656fs	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	671					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						CAAAACAGCTTAAAGTAGAGGAACA	0.361																																																	0																																										SO:0001589	frameshift_variant	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.2010_2014delTAAAG	10.37:g.70520853_70520857delTAAAG	ENSP00000265872:p.Lys671fs	Somatic		WXS	Illumina HiSeq	Phase_I	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Frame_Shift_Del	DEL	ENST00000265872.6	37	CCDS7282.1																																																																																				0.361	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2		NM_018237	
CD1E	913	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	158324301	158324301	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr1:158324301C>A	ENST00000368167.3	+	2	432	c.193C>A	c.(193-195)Cat>Aat	p.H65N	CD1E_ENST00000368163.3_Missense_Mutation_p.H65N|CD1E_ENST00000368155.3_Missense_Mutation_p.H65N|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368165.3_Missense_Mutation_p.H65N|CD1E_ENST00000368160.3_Missense_Mutation_p.H65N|CD1E_ENST00000368156.1_Missense_Mutation_p.H65N|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.H63N|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.H65N	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	65					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.H65N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CCTGCAGACTCATGGCTGGGA	0.557																																																	1	Substitution - Missense(1)	kidney(1)											67.0	72.0	70.0					1																	158324301		2181	4299	6480	SO:0001583	missense	913			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.193C>A	1.37:g.158324301C>A	ENSP00000357149:p.His65Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717359	0.30413	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.07800	3.16;3.16;3.28;3.16;3.16;3.16;3.5;3.41	3.8	2.88	0.33553	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.354296	0.20738	N	0.086581	T	0.19927	0.0479	M	0.89287	3.02	0.34900	D	0.746392	D;P;P;D;D;D;B;D	0.71674	0.989;0.944;0.944;0.979;0.969;0.998;0.131;0.993	D;P;P;D;P;D;B;D	0.72075	0.929;0.624;0.624;0.959;0.844;0.976;0.046;0.967	T	0.05582	-1.0876	10	0.72032	D	0.01	-11.0716	9.4353	0.38635	0.0:0.7828:0.2172:0.0	.	63;65;65;65;65;65;65;65	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	N	63;65;65;65;65;65;65;65	ENSP00000401957:H63N;ENSP00000357149:H65N;ENSP00000357147:H65N;ENSP00000357145:H65N;ENSP00000357142:H65N;ENSP00000357143:H65N;ENSP00000357138:H65N;ENSP00000357137:H65N	ENSP00000357137:H65N	H	+	1	0	CD1E	156590925	0.017000	0.18338	0.533000	0.28001	0.035000	0.12851	0.314000	0.19432	1.171000	0.42768	0.563000	0.77884	CAT		0.557	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3		NM_030893	
CD8A	925	hgsc.bcm.edu	37	2	87015623	87015623	+	Intron	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:87015623G>A	ENST00000409511.2	-	8	1687				CD8A_ENST00000352580.3_Intron|CD8A_ENST00000538832.1_Intron|CD8A_ENST00000283635.3_Intron|CD8A_ENST00000409781.1_Intron|CD8A_ENST00000456996.2_Intron	NM_001145873.1	NP_001139345.1	P01732	CD8A_HUMAN	CD8a molecule						antigen processing and presentation (GO:0019882)|cytotoxic T cell differentiation (GO:0045065)|defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of calcium-mediated signaling (GO:0050850)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|T cell mediated immunity (GO:0002456)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	8						GCTGGCCAAGGTGAGCAGGCT	0.542																																																	0													43.0	42.0	42.0					2																	87015623		2203	4300	6503	SO:0001627	intron_variant	925				CCDS1992.1, CCDS1993.1	2p12	2014-09-17	2006-03-28		ENSG00000153563	ENSG00000153563		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1706	protein-coding gene	gene with protein product		186910	"""CD8 antigen, alpha polypeptide (p32)"", ""T-cell surface glycoprotein CD8 alpha chain"""	CD8		1541829	Standard	NM_171827		Approved		uc002sru.3	P01732	OTTHUMG00000130265	ENST00000409511.2:c.656+29C>T	2.37:g.87015623G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DT80|D6W5M8|Q13970|Q4ZG17	RNA	SNP	ENST00000409511.2	37	CCDS1992.1																																																																																				0.542	CD8A-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330784.3		NM_001768	
CDAN1	146059	broad.mit.edu;hgsc.bcm.edu	37	15	43021465	43021465	+	Silent	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:43021465G>A	ENST00000356231.3	-	18	2526	c.2503C>T	c.(2503-2505)Ctg>Ttg	p.L835L		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	835					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L835L(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		TGGGCTCCCAGGCTGGTGGTA	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											34.0	38.0	37.0					15																	43021465		2203	4299	6502	SO:0001819	synonymous_variant	146059			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2503C>T	15.37:g.43021465G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6NYD0|Q7Z7L5|Q969N3	Silent	SNP	ENST00000356231.3	37	CCDS32209.1																																																																																				0.647	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1		XM_085300	
CNTRL	11064	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	123870184	123870184	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr9:123870184A>T	ENST00000373855.1	+	8	1173	c.913A>T	c.(913-915)Aaa>Taa	p.K305*	CNTRL_ENST00000238341.5_Nonsense_Mutation_p.K305*|CNTRL_ENST00000373865.2_Nonsense_Mutation_p.K305*			Q7Z7A1	CNTRL_HUMAN	centriolin	305					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.K305*(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AAATCAAGATAAATTGAATAA	0.333																																																	1	Substitution - Nonsense(1)	kidney(1)											42.0	45.0	44.0					9																	123870184		2203	4299	6502	SO:0001587	stop_gained	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.913A>T	9.37:g.123870184A>T	ENSP00000362962:p.Lys305*	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Nonsense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	A	38	6.945976	0.97956	.	.	ENSG00000119397	ENST00000373865;ENST00000373855;ENST00000238341;ENST00000454238	.	.	.	5.98	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	5.6448	0.17584	0.7421:0.0:0.2579:0.0	.	.	.	.	X	305	.	ENSP00000238341:K305X	K	+	1	0	CNTRL	122910005	1.000000	0.71417	0.999000	0.59377	0.923000	0.55619	2.824000	0.48088	2.296000	0.77279	0.482000	0.46254	AAA		0.333	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1		NM_007018	
CLTC	1213	broad.mit.edu;ucsc.edu	37	17	57754361	57754361	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr17:57754361T>C	ENST00000269122.3	+	17	2882	c.2608T>C	c.(2608-2610)Tgt>Cgt	p.C870R	CLTC_ENST00000579815.1_3'UTR|CLTC_ENST00000393043.1_Missense_Mutation_p.C870R|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	870	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)	p.C870R(1)	CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCATGAGGGCTGTGAGGAGCC	0.413			T	"""ALK, TFE3"""	"""ALCL, renal """																																			Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	1	Substitution - Missense(1)	kidney(1)											54.0	58.0	57.0					17																	57754361		2203	4300	6503	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2608T>C	17.37:g.57754361T>C	ENSP00000269122:p.Cys870Arg	Somatic		WXS	Illumina GAIIx	Phase_I	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.730410	0.89390	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.18016	2.24;2.24	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.39118	0.1066	L	0.57536	1.79	0.80722	D	1	D;B	0.69078	0.997;0.007	D;B	0.87578	0.998;0.123	T	0.12243	-1.0555	10	0.56958	D	0.05	.	15.5204	0.75862	0.0:0.0:0.0:1.0	.	870;870	Q00610;Q00610-2	CLH1_HUMAN;.	R	870	ENSP00000269122:C870R;ENSP00000376763:C870R	ENSP00000269122:C870R	C	+	1	0	CLTC	55109143	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.946000	0.87746	2.077000	0.62373	0.455000	0.32223	TGT		0.413	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1		NM_004859	
COL4A5	1287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	107929324	107929324	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:107929324G>T	ENST00000361603.2	+	46	4506	c.4262G>T	c.(4261-4263)gGg>gTg	p.G1421V	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1427V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1421	Triple-helical region.		G -> W (in APSX; adult type). {ECO:0000269|PubMed:9452056}.		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G1421V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGTGCAGGAGGGCGCAAAGGA	0.517									Alport syndrome with Diffuse Leiomyomatosis																																								1	Substitution - Missense(1)	kidney(1)											80.0	62.0	68.0					X																	107929324		2203	4300	6503	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4262G>T	X.37:g.107929324G>T	ENSP00000354505:p.Gly1421Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.5|27.5	4.839606|4.839606	0.91117|0.91117	.|.	.|.	ENSG00000188153|ENSG00000188153	ENST00000515658|ENST00000328300;ENST00000361603;ENST00000508186	D|D;D	0.99369|0.99353	-5.78|-5.77;-5.77	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.99638|0.99638	0.9867|0.9867	H|H	0.95884|0.95884	3.735|3.735	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.97593|0.97593	1.0118|1.0118	8|10	0.87932|0.87932	D|D	0|0	.|.	18.1848|18.1848	0.89789|0.89789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1424;1421	.|E7EVY4;P29400	.|.;CO4A5_HUMAN	C|V	26|1427;1421;1427	ENSP00000423520:G26C|ENSP00000331902:G1427V;ENSP00000354505:G1421V	ENSP00000423520:G26C|ENSP00000331902:G1427V	G|G	+|+	1|2	0|0	COL4A5|COL4A5	107815980|107815980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.507000|9.507000	0.97996|0.97996	2.318000|2.318000	0.78349|0.78349	0.600000|0.600000	0.82982|0.82982	GGC|GGG		0.517	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			
CTSL	1514	broad.mit.edu;hgsc.bcm.edu	37	9	90343025	90343026	+	Frame_Shift_Del	DEL	AC	AC	-	rs147396029|rs141209993	byFrequency	TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr9:90343025_90343026delAC	ENST00000343150.5	+	3	1100_1101	c.210_211delAC	c.(208-213)aaacacfs	p.H71fs	CTSL_ENST00000495822.1_Intron|CTSL_ENST00000340342.6_Frame_Shift_Del_p.H71fs|CTSL_ENST00000342020.5_Frame_Shift_Del_p.H71fs			P07711	CATL1_HUMAN	cathepsin L	71					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										GGGAAGGGAAACACAGCTTCAC	0.465																																																	0																																										SO:0001589	frameshift_variant	1514			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.210_211delAC	9.37:g.90343027_90343028delAC	ENSP00000345344:p.His71fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IAV1|Q96QJ0	Frame_Shift_Del	DEL	ENST00000343150.5	37	CCDS6675.1																																																																																				0.465	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1		NM_001912	
DIP2C	22982	broad.mit.edu;hgsc.bcm.edu	37	10	375486	375486	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:375486G>T	ENST00000280886.6	-	30	3727	c.3640C>A	c.(3640-3642)Ccc>Acc	p.P1214T		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1214						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.P1214T(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CACAAGGCGGGGTTGGTTTCC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											57.0	51.0	53.0					10																	375486		2203	4300	6503	SO:0001583	missense	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3640C>A	10.37:g.375486G>T	ENSP00000280886:p.Pro1214Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.03|18.03	3.531270|3.531270	0.64972|0.64972	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000434695|ENST00000280886;ENST00000535541;ENST00000381503	.|T	.|0.13196	.|2.61	5.71|5.71	5.71|5.71	0.89125|0.89125	.|AMP-dependent synthetase/ligase (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.39759|0.39759	0.1090|0.1090	M|M	0.75884|0.75884	2.315|2.315	0.80722|0.80722	D|D	1|1	.|D	.|0.56521	.|0.976	.|D	.|0.64877	.|0.93	T|T	0.12553|0.12553	-1.0543|-1.0543	6|10	.|0.87932	.|D	.|0	-19.9|-19.9	19.8535|19.8535	0.96748|0.96748	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1214	.|Q9Y2E4	.|DIP2C_HUMAN	H|T	19|1214;139;63	.|ENSP00000280886:P1214T	.|ENSP00000280886:P1214T	P|P	-|-	2|1	0|0	DIP2C|DIP2C	365486|365486	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.014000|0.014000	0.08584|0.08584	8.008000|8.008000	0.88588|0.88588	2.694000|2.694000	0.91930|0.91930	0.557000|0.557000	0.71058|0.71058	CCC|CCC		0.582	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1		NM_014974	
DMXL2	23312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	51741365	51741365	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:51741365A>G	ENST00000251076.5	-	43	9214	c.8927T>C	c.(8926-8928)cTa>cCa	p.L2976P	DMXL2_ENST00000543779.2_Missense_Mutation_p.L2977P|DMXL2_ENST00000449909.3_Missense_Mutation_p.L2340P|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2976						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.L2976P(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TGAATGAATTAGGCCATGGCC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											99.0	90.0	93.0					15																	51741365		2196	4293	6489	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.8927T>C	15.37:g.51741365A>G	ENSP00000251076:p.Leu2976Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590623	0.66219	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.01313	5.02;5.02;5.02	5.6	5.6	0.85130	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.07143	0.0181	L	0.60455	1.87	0.80722	D	1	D;D;D;B	0.76494	0.999;0.998;0.999;0.343	D;D;D;P	0.85130	0.981;0.991;0.997;0.546	T	0.12967	-1.0527	10	0.54805	T	0.06	.	16.0786	0.80985	1.0:0.0:0.0:0.0	.	2977;2340;2976;2977	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	P	2976;2977;2340;542	ENSP00000251076:L2976P;ENSP00000441858:L2977P;ENSP00000400855:L2340P	ENSP00000251076:L2976P	L	-	2	0	DMXL2	49528657	1.000000	0.71417	0.211000	0.23655	0.986000	0.74619	8.859000	0.92264	2.254000	0.74563	0.460000	0.39030	CTA		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2		NM_015263	
DMXL2	23312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	51839582	51839582	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:51839582C>G	ENST00000251076.5	-	7	878	c.591G>C	c.(589-591)tgG>tgC	p.W197C	DMXL2_ENST00000543779.2_Missense_Mutation_p.W197C|DMXL2_ENST00000449909.3_Missense_Mutation_p.W197C|DMXL2_ENST00000560421.1_5'UTR	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	197						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.W197C(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TCATAGGATACCACACTTTCA	0.313																																																	1	Substitution - Missense(1)	kidney(1)											77.0	76.0	76.0					15																	51839582		2195	4293	6488	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.591G>C	15.37:g.51839582C>G	ENSP00000251076:p.Trp197Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197312	0.58126	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	D;D;D	0.83506	-1.73;-1.73;-1.73	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94205	0.8140	H	0.95043	3.615	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.95544	0.8615	10	0.87932	D	0	.	19.3281	0.94270	0.0:1.0:0.0:0.0	.	197;197;197	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	C	197	ENSP00000251076:W197C;ENSP00000441858:W197C;ENSP00000400855:W197C	ENSP00000251076:W197C	W	-	3	0	DMXL2	49626874	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.398000	0.79919	2.588000	0.87417	0.585000	0.79938	TGG		0.313	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2		NM_015263	
DNAH8	1769	hgsc.bcm.edu;ucsc.edu	37	6	38957910	38957910	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr6:38957910delC	ENST00000359357.3	+	86	12779	c.12525delC	c.(12523-12525)aacfs	p.N4175fs	DNAH8_ENST00000441566.1_Frame_Shift_Del_p.N4139fs			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4175					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCCTAGATAACCCTGAAGTCT	0.403																																																	0													210.0	196.0	201.0					6																	38957910		2203	4300	6503	SO:0001589	frameshift_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12525delC	6.37:g.38957910delC	ENSP00000352312:p.Asn4175fs	Somatic		WXS	Illumina HiSeq	Phase_I	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Frame_Shift_Del	DEL	ENST00000359357.3	37																																																																																					0.403	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1		NM_001206927	
EMR3	84658	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	14736333	14736333	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:14736333T>C	ENST00000253673.5	-	15	1991	c.1891A>G	c.(1891-1893)Aag>Gag	p.K631E	EMR3_ENST00000344373.4_Missense_Mutation_p.K579E|EMR3_ENST00000443157.2_Missense_Mutation_p.K505E|EMR3_ENST00000599900.1_Missense_Mutation_p.K416E	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	631					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.K631E(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						GGACCCATCTTGCTGGAAAGT	0.388																																																	1	Substitution - Missense(1)	kidney(1)											227.0	202.0	210.0					19																	14736333		2203	4300	6503	SO:0001583	missense	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1891A>G	19.37:g.14736333T>C	ENSP00000253673:p.Lys631Glu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000253673.5	37	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	T	6.033	0.374372	0.11409	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.37584	1.19;1.19;1.19	3.79	2.73	0.32206	.	.	.	.	.	T	0.22085	0.0532	N	0.19112	0.55	0.22947	N	0.998527	P;P;B	0.38020	0.615;0.551;0.049	B;B;B	0.39258	0.155;0.295;0.028	T	0.12116	-1.0560	9	0.19590	T	0.45	.	7.0718	0.25183	0.0:0.0:0.2321:0.7679	.	505;579;631	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	E	505;631;579	ENSP00000396208:K505E;ENSP00000253673:K631E;ENSP00000340758:K579E	ENSP00000253673:K631E	K	-	1	0	EMR3	14597333	0.886000	0.30341	0.664000	0.29753	0.311000	0.27955	1.337000	0.33862	0.596000	0.29794	0.455000	0.32223	AAG		0.388	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1		NM_032571	
ERF	2077	broad.mit.edu;hgsc.bcm.edu	37	19	42753474	42753474	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:42753474delG	ENST00000222329.4	-	4	947	c.790delC	c.(790-792)ctcfs	p.L264fs	ERF_ENST00000595941.1_5'Flank|ERF_ENST00000440177.2_Frame_Shift_Del_p.L189fs|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	264					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				GCCGGGGAGAGCTGAGGGGGC	0.711																																																	0													13.0	13.0	13.0					19																	42753474		2187	4258	6445	SO:0001589	frameshift_variant	2077			U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.790delC	19.37:g.42753474delG	ENSP00000222329:p.Leu264fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Frame_Shift_Del	DEL	ENST00000222329.4	37	CCDS12600.1																																																																																				0.711	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1		NM_006494	
F8	2157	broad.mit.edu;ucsc.edu	37	X	154129670	154129670	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:154129670G>A	ENST00000360256.4	-	20	6363	c.6163C>T	c.(6163-6165)Cag>Tag	p.Q2055*		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2055	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.Q2055*(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GCTGTAATCTGAAAATCTCTA	0.388																																																	2	Substitution - Nonsense(2)	kidney(2)											116.0	115.0	115.0					X																	154129670		2203	4300	6503	SO:0001587	stop_gained	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6163C>T	X.37:g.154129670G>A	ENSP00000353393:p.Gln2055*	Somatic		WXS	Illumina GAIIx	Phase_I	Q14286|Q5HY69	Nonsense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	g	48	14.713771	0.99807	.	.	ENSG00000185010	ENST00000360256	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.5724	15.8005	0.78450	0.0:0.0:1.0:0.0	.	.	.	.	X	2055	.	ENSP00000353393:Q2055X	Q	-	1	0	F8	153782864	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.174000	0.89682	2.329000	0.79093	0.538000	0.68166	CAG		0.388	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			
FBLN1	2192	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	45928965	45928965	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr22:45928965G>T	ENST00000327858.6	+	6	662	c.567G>T	c.(565-567)caG>caT	p.Q189H	FBLN1_ENST00000348697.2_Missense_Mutation_p.Q189H|FBLN1_ENST00000262722.7_Missense_Mutation_p.Q189H|FBLN1_ENST00000340923.5_Missense_Mutation_p.Q189H|FBLN1_ENST00000402984.3_Missense_Mutation_p.Q227H|FBLN1_ENST00000442170.2_Missense_Mutation_p.Q189H	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	189	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.Q189H(3)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GCAAGCAGCAGTGCCGAGACA	0.627																																																	3	Substitution - Missense(3)	kidney(3)											128.0	88.0	101.0					22																	45928965		2203	4300	6503	SO:0001583	missense	2192				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.567G>T	22.37:g.45928965G>T	ENSP00000331544:p.Gln189His	Somatic		WXS	Illumina HiSeq	Phase_I	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823288	0.50739	.	.	ENSG00000077942	ENST00000455233;ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923;ENST00000451475	T;T;T;T;T;T;T;T	0.71934	0.88;-0.61;1.56;1.56;1.56;1.56;1.56;-0.61	5.44	1.03	0.20045	Epidermal growth factor-like (1);	0.248513	0.42172	D	0.000758	T	0.75265	0.3826	L	0.46819	1.47	0.41129	D	0.985871	D;D;D;D	0.89917	1.0;0.998;0.997;1.0	D;D;P;D	0.91635	0.998;0.995;0.898;0.999	T	0.70718	-0.4795	10	0.41790	T	0.15	.	9.4322	0.38617	0.3511:0.0:0.6489:0.0	.	227;189;189;189	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	H	169;189;227;189;189;189;189;109	ENSP00000402963:Q169H;ENSP00000262723:Q189H;ENSP00000385521:Q227H;ENSP00000262722:Q189H;ENSP00000331544:Q189H;ENSP00000393812:Q189H;ENSP00000342212:Q189H;ENSP00000415160:Q109H	ENSP00000262722:Q189H	Q	+	3	2	FBLN1	44307629	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	1.061000	0.30542	0.024000	0.15214	0.484000	0.47621	CAG		0.627	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1		NM_006486	
FLYWCH1	84256	hgsc.bcm.edu;ucsc.edu	37	16	2983285	2983286	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr16:2983285_2983286delCA	ENST00000253928.9	+	5	1356_1357	c.951_952delCA	c.(949-954)atcaccfs	p.T318fs	FLYWCH1_ENST00000399667.2_Frame_Shift_Del_p.T318fs|FLYWCH1_ENST00000416288.2_Frame_Shift_Del_p.T317fs			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	318						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						GCCGGGCCATCACCCAGGGACA	0.668																																																	0																																										SO:0001589	frameshift_variant	84256			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.951_952delCA	16.37:g.2983285_2983286delCA	ENSP00000253928:p.Thr318fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Frame_Shift_Del	DEL	ENST00000253928.9	37																																																																																					0.668	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000436479.1		NM_032296	
GLRA2	2742	broad.mit.edu;ucsc.edu	37	X	14748581	14748581	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:14748581C>T	ENST00000218075.4	+	9	1863	c.1333C>T	c.(1333-1335)Cgg>Tgg	p.R445W	GLRA2_ENST00000443437.2_Missense_Mutation_p.R356W|GLRA2_ENST00000355020.4_Missense_Mutation_p.R445W	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	445					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.R445W(2)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	CAAGATCATTCGGCATGAAGA	0.438																																																	2	Substitution - Missense(2)	kidney(2)											150.0	118.0	129.0					X																	14748581		2203	4300	6503	SO:0001583	missense	2742				CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.1333C>T	X.37:g.14748581C>T	ENSP00000218075:p.Arg445Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	CCDS14160.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366413	0.41902	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020	T;T;T	0.81247	-1.47;-1.47;-1.47	5.62	3.84	0.44239	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.85461	0.5702	L	0.58810	1.83	0.58432	D	0.999998	B;D;D	0.89917	0.118;1.0;1.0	B;D;D	0.79784	0.052;0.973;0.993	D	0.84018	0.0352	10	0.72032	D	0.01	.	8.0621	0.30640	0.2813:0.6448:0.0:0.0739	.	429;445;445	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	W	356;445;445	ENSP00000387756:R356W;ENSP00000218075:R445W;ENSP00000347123:R445W	ENSP00000218075:R445W	R	+	1	2	GLRA2	14658502	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.407000	0.44565	0.538000	0.28769	-0.330000	0.08379	CGG		0.438	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1			
GRAMD1B	57476	hgsc.bcm.edu	37	11	123480598	123480599	+	Frame_Shift_Ins	INS	-	-	C	rs201009984|rs139670625		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr11:123480598_123480599insC	ENST00000529750.1	+	12	1651_1652	c.1324_1325insC	c.(1324-1326)actfs	p.T442fs	GRAMD1B_ENST00000450171.2_Frame_Shift_Ins_p.T133fs|GRAMD1B_ENST00000322282.7_Frame_Shift_Ins_p.T442fs|GRAMD1B_ENST00000456860.2_Frame_Shift_Ins_p.T449fs	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	442						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GGCTCCCAAAACTGCCACTGTC	0.5																																																	0																																										SO:0001589	frameshift_variant	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1325dupC	11.37:g.123480599_123480599dupC	ENSP00000436500:p.Thr442fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UW85|Q9ULL9	Frame_Shift_Ins	INS	ENST00000529750.1	37	CCDS53720.1																																																																																				0.500	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2		XM_370660	
GRIA2	2891	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	158282180	158282180	+	Silent	SNP	A	A	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr4:158282180A>C	ENST00000264426.9	+	14	2589	c.2310A>C	c.(2308-2310)gcA>gcC	p.A770A	GRIA2_ENST00000507898.1_Intron|AC079233.1_ENST00000578227.1_RNA|GRIA2_ENST00000393815.2_Intron|GRIA2_ENST00000449365.1_Intron|GRIA2_ENST00000296526.7_Intron	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	770					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A770A(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTAACCTCGCAGTACTAAAAC	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											71.0	72.0	71.0					4																	158282180		2203	4300	6503	SO:0001819	synonymous_variant	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.2310A>C	4.37:g.158282180A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8MT92|I6L997|Q96FP6	Silent	SNP	ENST00000264426.9	37	CCDS43274.1																																																																																				0.393	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			
HCLS1	3059	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	121366274	121366274	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:121366274T>G	ENST00000314583.3	-	4	271	c.180A>C	c.(178-180)aaA>aaC	p.K60N	HCLS1_ENST00000428394.2_Missense_Mutation_p.K60N	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	60	Involved in HAX-1 binding.				actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)	p.K60N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		CCTCTGATACTTTGTTCCTCA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											148.0	139.0	142.0					3																	121366274		2203	4300	6503	SO:0001583	missense	3059				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.180A>C	3.37:g.121366274T>G	ENSP00000320176:p.Lys60Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	T	3.966	-0.009335	0.07727	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.20200	2.09;2.1	5.64	3.28	0.37604	.	0.094646	0.64402	D	0.000001	T	0.06462	0.0166	N	0.04297	-0.235	0.53005	D	0.99996	B;P;B	0.39480	0.001;0.675;0.397	B;B;B	0.30105	0.001;0.111;0.057	T	0.32798	-0.9893	10	0.09338	T	0.73	-17.3361	8.4714	0.32988	0.0:0.1572:0.0:0.8428	.	60;60;60	B4DTP2;E7EVW7;P14317	.;.;HCLS1_HUMAN	N	60	ENSP00000320176:K60N;ENSP00000387645:K60N	ENSP00000320176:K60N	K	-	3	2	HCLS1	122848964	0.998000	0.40836	1.000000	0.80357	0.574000	0.36063	0.439000	0.21575	0.568000	0.29311	-0.297000	0.09499	AAA		0.483	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1		NM_005335	
ITPRIP	85450	hgsc.bcm.edu	37	10	106074435	106074435	+	Missense_Mutation	SNP	G	G	A	rs145628846		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:106074435G>A	ENST00000337478.1	-	2	1546	c.1375C>T	c.(1375-1377)Cac>Tac	p.H459Y	RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000278071.2_Missense_Mutation_p.H459Y|ITPRIP_ENST00000358187.2_Missense_Mutation_p.H459Y	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	459						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						AGCAACTCGTGCAGACGAGCG	0.632																																																	0													50.0	54.0	53.0					10																	106074435		2203	4300	6503	SO:0001583	missense	85450			AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.1375C>T	10.37:g.106074435G>A	ENSP00000337178:p.His459Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	G	9.726	1.160871	0.21538	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.07567	3.18;3.18;3.18	4.97	2.99	0.34606	.	0.861642	0.10408	N	0.678281	T	0.07143	0.0181	N	0.22421	0.69	0.09310	N	1	B	0.28178	0.202	B	0.32090	0.14	T	0.22800	-1.0206	10	0.51188	T	0.08	-7.4517	8.6195	0.33853	0.078:0.0:0.6744:0.2476	.	459	Q8IWB1	IPRI_HUMAN	Y	459	ENSP00000337178:H459Y;ENSP00000278071:H459Y;ENSP00000350915:H459Y	ENSP00000278071:H459Y	H	-	1	0	ITPRIP	106064425	0.764000	0.28473	0.858000	0.33744	0.514000	0.34195	3.807000	0.55591	2.462000	0.83206	0.561000	0.74099	CAC		0.632	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1		NM_033397	
KCNG3	170850	hgsc.bcm.edu;ucsc.edu	37	2	42671444	42671444	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:42671444A>G	ENST00000306078.1	-	2	1536	c.941T>C	c.(940-942)tTg>tCg	p.L314S	KCNG3_ENST00000394973.4_Missense_Mutation_p.L303S	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	314					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						TTTGAGAGTCAAACCGAGTGT	0.453																																																	0													105.0	98.0	100.0					2																	42671444		2203	4300	6503	SO:0001583	missense	170850			AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.941T>C	2.37:g.42671444A>G	ENSP00000304127:p.Leu314Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q53SC1	Missense_Mutation	SNP	ENST00000306078.1	37	CCDS1809.1	.	.	.	.	.	.	.	.	.	.	A	17.03	3.283425	0.59867	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	T;T	0.51325	0.71;0.71	5.22	5.22	0.72569	Ion transport (1);	0.000000	0.64402	D	0.000001	T	0.61937	0.2387	L	0.46885	1.475	0.48830	D	0.999717	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.61671	-0.7015	10	0.44086	T	0.13	.	15.1298	0.72514	1.0:0.0:0.0:0.0	.	314;303	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	S	314;303	ENSP00000304127:L314S;ENSP00000378424:L303S	ENSP00000304127:L314S	L	-	2	0	KCNG3	42524948	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.345000	0.79337	1.972000	0.57404	0.460000	0.39030	TTG		0.453	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2		NM_172344	
KCTD12	115207	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	77459423	77459423	+	Silent	SNP	C	C	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr13:77459423C>G	ENST00000377474.2	-	1	1102	c.861G>C	c.(859-861)tcG>tcC	p.S287S	AC000403.1_ENST00000579275.1_RNA|KCTD12_ENST00000317765.2_Silent_p.S287S	NM_138444.3	NP_612453.1	Q96CX2	KCD12_HUMAN	potassium channel tetramerization domain containing 12	287					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	poly(A) RNA binding (GO:0044822)	p.S287S(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.0499)		TGTGGAAGCCCGACTCGGACA	0.632											OREG0022449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											48.0	40.0	43.0					13																	77459423		2203	4300	6503	SO:0001819	synonymous_variant	115207			AF359381	CCDS9455.1	13q21	2013-06-20	2013-06-20	2003-11-26	ENSG00000178695	ENSG00000178695			14678	protein-coding gene	gene with protein product	"""predominantly fetal expressed T1 domain"""	610521	"""chromosome 13 open reading frame 2"", ""potassium channel tetramerisation domain containing 12"""	C13orf2		15357420	Standard	NM_138444		Approved	KIAA1778, PFET1	uc010aeu.1	Q96CX2	OTTHUMG00000017096	ENST00000377474.2:c.861G>C	13.37:g.77459423C>G		Somatic	1175	WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000377474.2	37	CCDS9455.1																																																																																				0.632	KCTD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045309.2		NM_138444	
KLHL15	80311	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	24007140	24007140	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:24007140G>T	ENST00000328046.8	-	4	968	c.713C>A	c.(712-714)aCa>aAa	p.T238K		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	238					protein ubiquitination (GO:0016567)			p.T238K(1)		autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						AAATTCTGATGTCTTAACCTA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											36.0	38.0	37.0					X																	24007140		2182	4275	6457	SO:0001583	missense	80311			AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.713C>A	X.37:g.24007140G>T	ENSP00000332791:p.Thr238Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Missense_Mutation	SNP	ENST00000328046.8	37	CCDS35217.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.850025	0.32699	.	.	ENSG00000174010	ENST00000328046	T	0.73258	-0.73	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.55878	0.1948	N	0.14661	0.345	0.80722	D	1	P	0.41673	0.759	B	0.37833	0.259	T	0.61603	-0.7029	10	0.42905	T	0.14	.	17.6255	0.88092	0.0:0.0:1.0:0.0	.	238	Q96M94	KLH15_HUMAN	K	238	ENSP00000332791:T238K	ENSP00000332791:T238K	T	-	2	0	KLHL15	23917061	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.420000	0.97426	2.178000	0.69098	0.523000	0.50628	ACA		0.373	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1		XM_040383	
KLHL7	55975	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	23183605	23183605	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr7:23183605C>G	ENST00000339077.5	+	6	997	c.754C>G	c.(754-756)Ctt>Gtt	p.L252V	KLHL7_ENST00000542558.1_Missense_Mutation_p.L27V|KLHL7_ENST00000409689.1_Missense_Mutation_p.L204V|KLHL7_ENST00000539124.1_Missense_Mutation_p.L176V|KLHL7_ENST00000545443.1_Missense_Mutation_p.L230V|KLHL7_ENST00000322231.7_Missense_Mutation_p.L230V	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	252					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.L230V(1)|p.L252V(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGCTGAACCACTTATTCAAGA	0.363																																																	2	Substitution - Missense(2)	kidney(2)											105.0	99.0	101.0					7																	23183605		2203	4300	6503	SO:0001583	missense	55975				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.754C>G	7.37:g.23183605C>G	ENSP00000343273:p.Leu252Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	37	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823173	0.90873	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000322231;ENST00000339077;ENST00000539124;ENST00000542558;ENST00000409689;ENST00000545443;ENST00000414163	T;T;T;T;T;T;D	0.90069	-0.92;-0.94;-0.93;-1.17;-0.91;-0.92;-2.61	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.91284	0.7252	M	0.66297	2.02	0.58432	D	0.999998	D;D;P	0.56968	0.978;0.978;0.932	P;P;B	0.49829	0.623;0.623;0.444	D	0.91841	0.5483	10	0.62326	D	0.03	.	19.5857	0.95489	0.0:1.0:0.0:0.0	.	27;252;230	B7Z3P9;Q8IXQ5;Q8IXQ5-2	.;KLHL7_HUMAN;.	V	93;218;230;252;176;27;204;230;20	ENSP00000322958:L230V;ENSP00000343273:L252V;ENSP00000441136:L176V;ENSP00000442367:L27V;ENSP00000386263:L204V;ENSP00000442366:L230V;ENSP00000404181:L20V	ENSP00000322958:L230V	L	+	1	0	KLHL7	23150130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.199000	0.77831	2.696000	0.92011	0.591000	0.81541	CTT		0.363	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3		NM_018846	
LILRA2	11027	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	55085805	55085805	+	Silent	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:55085805C>A	ENST00000251377.3	+	4	241	c.108C>A	c.(106-108)ggC>ggA	p.G36G	LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391737.1_Silent_p.G24G|LILRA2_ENST00000495786.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Silent_p.G36G|LILRA2_ENST00000391738.3_Silent_p.G36G			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	36	Ig-like C2-type 1.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.G36G(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CTGAGCCAGGCTCTGTGATCA	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											91.0	95.0	94.0					19																	55085805		2203	4300	6503	SO:0001819	synonymous_variant	11027			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.108C>A	19.37:g.55085805C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75020	Silent	SNP	ENST00000251377.3	37	CCDS46179.1																																																																																				0.552	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			
MARCH1	55016	broad.mit.edu;ucsc.edu	37	4	164450028	164450028	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr4:164450028G>T	ENST00000503008.1	-	8	1718	c.742C>A	c.(742-744)Ctg>Atg	p.L248M	RP11-218F10.3_ENST00000609356.1_lincRNA|MARCH1_ENST00000274056.7_Missense_Mutation_p.L248M|MARCH1_ENST00000514618.1_Missense_Mutation_p.L504M|MARCH1_ENST00000339875.5_Missense_Mutation_p.L231M	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	248	Responsible for down-regulation of CD86 and MHC class II cell surface expression. {ECO:0000250}.				antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L231M(1)|p.L248M(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTCTTCTCCAGTTTTTTGGCA	0.453																																																	2	Substitution - Missense(2)	kidney(2)											121.0	108.0	112.0					4																	164450028		2203	4299	6502	SO:0001583	missense	55016			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.742C>A	4.37:g.164450028G>T	ENSP00000427223:p.Leu248Met	Somatic		WXS	Illumina GAIIx	Phase_I	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382310	0.61845	.	.	ENSG00000145416	ENST00000274056;ENST00000503008;ENST00000514618;ENST00000339875	T;T;T;T	0.33865	1.83;1.83;1.39;1.42	5.58	4.73	0.59995	.	0.555807	0.16237	N	0.223339	T	0.44201	0.1282	L	0.47716	1.5	0.27242	N	0.959123	P;P	0.35714	0.517;0.508	B;P	0.49140	0.289;0.601	T	0.39078	-0.9631	10	0.45353	T	0.12	-32.2407	10.2151	0.43164	0.0708:0.1373:0.7919:0.0	.	248;231	Q8TCQ1;Q8TCQ1-2	MARH1_HUMAN;.	M	248;248;504;231	ENSP00000274056:L248M;ENSP00000427223:L248M;ENSP00000421322:L504M;ENSP00000345676:L231M	ENSP00000274056:L248M	L	-	1	2	MARCH1	164669478	0.983000	0.35010	0.997000	0.53966	0.999000	0.98932	0.526000	0.22971	1.481000	0.48307	0.655000	0.94253	CTG		0.453	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2		NM_017923	
MED12L	116931	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	150874118	150874118	+	Splice_Site	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:150874118G>T	ENST00000474524.1	+	5	764		c.e5+1		MED12L_ENST00000273432.4_Splice_Site|MED12L_ENST00000309237.4_Splice_Site|MED12L_ENST00000422248.2_Splice_Site	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like							mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.?(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CATGTTCCAGGTAACCTTTTG	0.453																																																	1	Unknown(1)	kidney(1)											128.0	118.0	121.0					3																	150874118		2203	4300	6503	SO:0001630	splice_region_variant	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.726+1G>T	3.37:g.150874118G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Splice_Site	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603499	0.87157	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4315	0.90627	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MED12L	152356808	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	9.250000	0.95477	2.515000	0.84797	0.557000	0.71058	.		0.453	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2		NM_053002	Intron
MTOR	2475	broad.mit.edu;ucsc.edu	37	1	11187799	11187799	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr1:11187799T>A	ENST00000361445.4	-	44	6174	c.6098A>T	c.(6097-6099)gAg>gTg	p.E2033V	MTOR_ENST00000376838.1_Missense_Mutation_p.E238V	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2033	Sufficient for interaction with the FKBP1A/rapamycin complex. {ECO:0000250}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E2033V(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ACGAGATGCCTCTTCCAGGCC	0.537																																																	1	Substitution - Missense(1)	kidney(1)											218.0	224.0	222.0					1																	11187799		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6098A>T	1.37:g.11187799T>A	ENSP00000354558:p.Glu2033Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.916112	0.92178	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.13089	2.84;2.62	5.8	5.8	0.92144	FKBP12-rapamycin-associated protein, FKBP12-rapamycin-binding (3);	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	M	0.89414	3.03	0.80722	D	1	P	0.49635	0.926	P	0.54706	0.759	T	0.45264	-0.9273	10	0.87932	D	0	-13.1711	16.1549	0.81657	0.0:0.0:0.0:1.0	.	2033	P42345	MTOR_HUMAN	V	2033;238	ENSP00000354558:E2033V;ENSP00000366034:E238V	ENSP00000354558:E2033V	E	-	2	0	MTOR	11110386	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.665000	0.83852	2.209000	0.71365	0.533000	0.62120	GAG		0.537	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
Unknown	0	broad.mit.edu	37	1	16974277	16974277	+	IGR	SNP	A	A	C	rs201514041	byFrequency	TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr1:16974277A>C								CROCCP2 (13223 upstream) : RNU1-3 (19002 downstream)																							GGTCCATCTAAGGGTCCGAGG	0.657																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974277A>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.657									
NAGS	162417	broad.mit.edu	37	17	42083124	42083124	+	Silent	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr17:42083124T>C	ENST00000293404.3	+	2	664	c.546T>C	c.(544-546)gcT>gcC	p.A182A	PYY_ENST00000360085.2_5'Flank	NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	182	Amino-acid kinase domain (AAK).				arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)	p.A182A(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCCCTACGGCTCCCTCGGGCT	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											22.0	21.0	22.0					17																	42083124		2196	4297	6493	SO:0001819	synonymous_variant	162417			AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.546T>C	17.37:g.42083124T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RAZ9|Q8IWR4	Silent	SNP	ENST00000293404.3	37	CCDS11473.1																																																																																				0.662	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457660.1		NM_153006	
NHLRC2	374354	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	115664580	115664580	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:115664580C>G	ENST00000369301.3	+	10	1921	c.1709C>G	c.(1708-1710)cCc>cGc	p.P570R		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	570								p.P570R(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		TCCTAGCTCCCCATCTTCAGA	0.338																																																	1	Substitution - Missense(1)	kidney(1)											54.0	53.0	53.0					10																	115664580		2203	4300	6503	SO:0001583	missense	374354			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1709C>G	10.37:g.115664580C>G	ENSP00000358307:p.Pro570Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N1H1|Q8N5A6	Missense_Mutation	SNP	ENST00000369301.3	37	CCDS7585.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975378	0.34848	.	.	ENSG00000196865	ENST00000369301	T	0.43688	0.94	5.79	5.79	0.91817	.	0.055226	0.64402	D	0.000001	T	0.33352	0.0860	L	0.29908	0.895	0.80722	D	1	P	0.39862	0.692	B	0.37422	0.249	T	0.04723	-1.0931	10	0.19147	T	0.46	-13.9198	18.2154	0.89884	0.0:1.0:0.0:0.0	.	570	Q8NBF2	NHLC2_HUMAN	R	570	ENSP00000358307:P570R	ENSP00000358307:P570R	P	+	2	0	NHLRC2	115654570	1.000000	0.71417	0.904000	0.35570	0.169000	0.22640	6.472000	0.73567	2.744000	0.94065	0.650000	0.86243	CCC		0.338	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1		NM_198514	
NHSL1	57224	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	138753025	138753025	+	Silent	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr6:138753025C>T	ENST00000427025.2	-	5	3097	c.2469G>A	c.(2467-2469)ggG>ggA	p.G823G	NHSL1_ENST00000343505.5_Silent_p.G819G	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	823								p.G823G(1)|p.G819G(1)		breast(2)|endometrium(4)|kidney(1)	7						TGGCTCTGGACCCTTCTTGGA	0.582																																																	2	Substitution - coding silent(2)	kidney(2)											115.0	99.0	104.0					6																	138753025		692	1591	2283	SO:0001819	synonymous_variant	57224			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.2469G>A	6.37:g.138753025C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q3ZCS5|Q5SYE8|Q9P2J0	Silent	SNP	ENST00000427025.2	37	CCDS55063.1																																																																																				0.582	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2		XM_050421	
NTN4	59277	hgsc.bcm.edu;ucsc.edu	37	12	96107078	96107078	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr12:96107078delG	ENST00000343702.4	-	4	1351	c.903delC	c.(901-903)ggcfs	p.G301fs	NTN4_ENST00000552603.1_5'UTR|NTN4_ENST00000553059.1_Frame_Shift_Del_p.G301fs|NTN4_ENST00000538383.1_Frame_Shift_Del_p.G264fs|NTN4_ENST00000344911.4_Frame_Shift_Del_p.G264fs	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	301	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GGCAGTGGCTGCCTGCTGTGT	0.517																																																	0													109.0	95.0	100.0					12																	96107078		2203	4300	6503	SO:0001589	frameshift_variant	59277			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.903delC	12.37:g.96107078delG	ENSP00000340998:p.Gly301fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Frame_Shift_Del	DEL	ENST00000343702.4	37	CCDS9054.1																																																																																				0.517	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1		NM_021229	
OCRL	4952	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	128720994	128720994	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:128720994C>T	ENST00000371113.4	+	20	2320	c.2155C>T	c.(2155-2157)Caa>Taa	p.Q719*	OCRL_ENST00000357121.5_Nonsense_Mutation_p.Q711*	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	719					cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.Q719*(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						ATCCCTTCTGCAAATGGTTCC	0.423																																																	1	Substitution - Nonsense(1)	kidney(1)											182.0	189.0	187.0					X																	128720994		2203	4300	6503	SO:0001587	stop_gained	4952			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2155C>T	X.37:g.128720994C>T	ENSP00000360154:p.Gln719*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Nonsense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	C	39	7.302291	0.98196	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	.	.	.	5.46	4.54	0.55810	.	0.467586	0.23452	N	0.048022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	13.4455	0.61138	0.0:0.8459:0.1541:0.0	.	.	.	.	X	719;711	.	ENSP00000349635:Q711X	Q	+	1	0	OCRL	128548675	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	1.751000	0.38339	2.286000	0.76751	0.594000	0.82650	CAA		0.423	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1		NM_000276	
OPRM1	4988	broad.mit.edu;hgsc.bcm.edu	37	6	154412543	154412543	+	Missense_Mutation	SNP	G	G	T	rs201516315		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr6:154412543G>T	ENST00000330432.7	+	3	1337	c.1100G>T	c.(1099-1101)cGa>cTa	p.R367L	OPRM1_ENST00000522555.1_Missense_Mutation_p.R267L|OPRM1_ENST00000419506.2_Missense_Mutation_p.R367L|OPRM1_ENST00000428397.2_Missense_Mutation_p.R367L|OPRM1_ENST00000452687.2_Missense_Mutation_p.R367L|OPRM1_ENST00000434900.2_Missense_Mutation_p.R460L|OPRM1_ENST00000435918.2_Missense_Mutation_p.R367L|OPRM1_ENST00000518759.1_Missense_Mutation_p.R286L|OPRM1_ENST00000229768.5_Missense_Mutation_p.R367L|OPRM1_ENST00000360422.4_Missense_Mutation_p.R367L|OPRM1_ENST00000522236.1_Missense_Mutation_p.R267L|OPRM1_ENST00000414028.2_Missense_Mutation_p.R367L|OPRM1_ENST00000337049.4_Missense_Mutation_p.R367L|OPRM1_ENST00000520708.1_Missense_Mutation_p.R267L|OPRM1_ENST00000524163.1_Missense_Mutation_p.R367L	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	367					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)	p.R367L(2)|p.R460L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AACTCCACTCGAATTCGTCAG	0.443																																																	3	Substitution - Missense(3)	kidney(3)											59.0	58.0	58.0					6																	154412543		1916	4124	6040	SO:0001583	missense	4988			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1100G>T	6.37:g.154412543G>T	ENSP00000328264:p.Arg367Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578391	0.86645	.	.	ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000428397;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24	6.16	5.3	0.74995	.	0.291378	0.34067	N	0.004299	T	0.53642	0.1809	M	0.77616	2.38	0.52501	D	0.999955	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0;0.993;0.98;1.0;0.999;1.0;1.0;0.999	D;D;D;D;D;D;P;D;D;D;D;D	0.91635	0.999;0.988;0.991;0.999;0.993;0.937;0.895;0.994;0.98;0.99;0.997;0.988	T	0.62539	-0.6833	10	0.87932	D	0	.	15.319	0.74105	0.0662:0.0:0.9338:0.0	.	367;367;367;367;460;286;267;367;367;367;367;367	P35372-4;P35372-8;P35372-11;P35372-9;P35372-10;B8Q1L9;Q6UPP1;P35372-5;P35372;P35372-7;P35372-3;P35372-2	.;.;.;.;.;.;.;.;OPRM_HUMAN;.;.;.	L	460;267;286;367;367;367;367;367;367;367;367;367;367;267;267	ENSP00000394624:R460L;ENSP00000430876:R267L;ENSP00000430260:R286L;ENSP00000328264:R367L;ENSP00000353598:R367L;ENSP00000411903:R367L;ENSP00000410497:R367L;ENSP00000229768:R367L;ENSP00000403549:R367L;ENSP00000430097:R367L;ENSP00000399359:R367L;ENSP00000413752:R367L;ENSP00000338381:R367L;ENSP00000429719:R267L;ENSP00000429373:R267L	ENSP00000229768:R367L	R	+	2	0	OPRM1	154454236	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	6.535000	0.73838	1.626000	0.50381	0.650000	0.86243	CGA		0.443	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2		NM_000914	
OR3A2	4995	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	3181512	3181512	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr17:3181512C>A	ENST00000408891.2	-	1	756	c.718G>T	c.(718-720)Gtg>Ttg	p.V240L	RP11-64J4.2_ENST00000573491.1_RNA	NM_002551.3	NP_002542.3	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A, member 2	240					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)	p.V240L(1)		ovary(1)	1						CGGCCCTCCACTGAACGGATT	0.527																																					GBM(166;478 2018 3875 5042 31983)|Esophageal Squamous(77;407 1232 1405 14297 15272)												1	Substitution - Missense(1)	kidney(1)											53.0	55.0	54.0					17																	3181512		2203	4300	6503	SO:0001583	missense	4995			U04713	CCDS42233.1	17p13.3	2012-08-09				ENSG00000221882		"""GPCR / Class A : Olfactory receptors"""	8283	protein-coding gene	gene with protein product						8921386, 10673334	Standard	NM_002551		Approved	OLFRA04, OR228, OR17-228	uc002fvg.3	P47893		ENST00000408891.2:c.718G>T	17.37:g.3181512C>A	ENSP00000386180:p.Val240Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFM3|Q9P1Q3	Missense_Mutation	SNP	ENST00000408891.2	37	CCDS42233.1	.	.	.	.	.	.	.	.	.	.	C	5.376	0.254597	0.10185	.	.	ENSG00000221882	ENST00000408891	T	0.00054	8.8	4.9	1.7	0.24286	GPCR, rhodopsin-like superfamily (1);	1.150540	0.06726	N	0.775739	T	0.00109	0.0003	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.19549	-1.0302	10	0.51188	T	0.08	-0.9104	5.0734	0.14618	0.1477:0.6206:0.0:0.2316	.	240	P47893	OR3A2_HUMAN	L	240	ENSP00000386180:V240L	ENSP00000386180:V240L	V	-	1	0	OR3A2	3128262	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.257000	0.08745	0.324000	0.23333	0.561000	0.74099	GTG		0.527	OR3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438370.1			
OR56A3	390083	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	5969272	5969272	+	Silent	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr11:5969272C>A	ENST00000329564.6	+	1	703	c.696C>A	c.(694-696)ctC>ctA	p.L232L		NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L232L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCTGAGACTCAAGGCAGAGG	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											203.0	198.0	200.0					11																	5969272		2186	4288	6474	SO:0001819	synonymous_variant	390083				CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.696C>A	11.37:g.5969272C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NN77|Q6IFF7	Silent	SNP	ENST00000329564.6	37	CCDS41614.1																																																																																				0.517	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1		NM_001003443	
OTOF	9381	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	26684967	26684967	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:26684967C>A	ENST00000272371.2	-	42	5401	c.5275G>T	c.(5275-5277)Gac>Tac	p.D1759Y	OTOF_ENST00000403946.3_Missense_Mutation_p.D1759Y|OTOF_ENST00000338581.6_Missense_Mutation_p.D992Y|OTOF_ENST00000402415.3_Missense_Mutation_p.D1069Y|OTOF_ENST00000339598.3_Missense_Mutation_p.D992Y	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1759					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.D1069N(1)|p.D1759Y(1)|p.D992N(1)|p.D1759N(1)|p.D1069Y(1)|p.D992Y(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACGAAGATGTCACTGGACTTC	0.617																																					GBM(102;732 1451 20652 24062 31372)												6	Substitution - Missense(6)	urinary_tract(3)|kidney(3)											179.0	162.0	168.0					2																	26684967		2203	4300	6503	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5275G>T	2.37:g.26684967C>A	ENSP00000272371:p.Asp1759Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416266	0.83449	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	4.84	4.84	0.62591	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.95182	0.8438	H	0.96889	3.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.97031	0.9750	10	0.87932	D	0	-36.4813	17.5497	0.87872	0.0:1.0:0.0:0.0	.	1759;992;1069;992	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	Y	992;992;1069;1759;1759	ENSP00000345137:D992Y;ENSP00000344521:D992Y;ENSP00000383906:D1069Y;ENSP00000272371:D1759Y;ENSP00000385255:D1759Y	ENSP00000272371:D1759Y	D	-	1	0	OTOF	26538471	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.773000	0.85462	2.245000	0.73994	0.561000	0.74099	GAC		0.617	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52623124	52623124	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:52623124delT	ENST00000296302.7	-	18	2928	c.2927delA	c.(2926-2928)catfs	p.H976fs	PBRM1_ENST00000356770.4_Frame_Shift_Del_p.H944fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.H991fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.H976fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.H991fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.H976fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.H976fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.H976fs			Q86U86	PB1_HUMAN	polybromo 1	976	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACAGACGATATGTGGTTGTAG	0.418			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													175.0	168.0	170.0					3																	52623124		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2927delA	3.37:g.52623124delT	ENSP00000296302:p.His976fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.418	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDH11X	27328	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	91137907	91137907	+	Intron	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:91137907C>A	ENST00000373094.1	+	2	3878				PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000395337.2_Splice_Site_p.T1012N|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000406881.1_Intron|PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000298274.8_Intron	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked						homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1012N(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TTGTCCTAGACTGATTCCAGG	0.338																																					NSCLC(38;925 1092 2571 38200 45895)												1	Substitution - Missense(1)	kidney(1)											186.0	165.0	172.0					X																	91137907		2203	4299	6502	SO:0001627	intron_variant	27328			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+3635C>A	X.37:g.91137907C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570165	0.28003	.	.	ENSG00000102290	ENST00000395337	T	0.52295	0.67	3.64	2.77	0.32553	.	.	.	.	.	T	0.33498	0.0865	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.13415	-1.0510	8	0.42905	T	0.14	.	6.0254	0.19652	0.0:0.8554:0.0:0.1446	.	1012	Q9BZA7-2	.	N	1012	ENSP00000378746:T1012N	ENSP00000378746:T1012N	T	+	2	0	PCDH11X	91024563	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.515000	0.22801	0.894000	0.36317	0.523000	0.50628	ACT		0.338	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1		NM_032969	
PCDH9	5101	broad.mit.edu;ucsc.edu	37	13	67801923	67801923	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr13:67801923G>T	ENST00000377865.2	-	1	784	c.650C>A	c.(649-651)aCc>aAc	p.T217N	PCDH9_ENST00000456367.1_Missense_Mutation_p.T217N|PCDH9_ENST00000377861.3_Missense_Mutation_p.T217N|PCDH9_ENST00000544246.1_Missense_Mutation_p.T217N|PCDH9_ENST00000328454.5_Missense_Mutation_p.T217N			Q9HC56	PCDH9_HUMAN	protocadherin 9	217	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T217N(2)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CATCACATAGGTATCTTTCTG	0.453																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											145.0	139.0	141.0					13																	67801923		2203	4300	6503	SO:0001583	missense	5101			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.650C>A	13.37:g.67801923G>T	ENSP00000367096:p.Thr217Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062885	0.36373	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	6.17	5.32	0.75619	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.59128	0.2171	L	0.31065	0.9	0.58432	D	0.999997	B;D;D;D	0.89917	0.392;1.0;1.0;1.0	B;D;D;D	0.85130	0.374;0.995;0.991;0.997	T	0.63862	-0.6541	10	0.72032	D	0.01	.	16.966	0.86286	0.0:0.0:0.8712:0.1288	.	217;217;217;217	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	217	ENSP00000442186:T217N;ENSP00000367096:T217N;ENSP00000401699:T217N;ENSP00000332060:T217N;ENSP00000367092:T217N	ENSP00000332060:T217N	T	-	2	0	PCDH9	66699924	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.062000	0.89475	1.607000	0.50170	-0.181000	0.13052	ACC		0.453	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1		NM_203487	
PFKP	5214	hgsc.bcm.edu	37	10	3172145	3172145	+	Silent	SNP	C	C	T	rs1052337	byFrequency	TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr10:3172145C>T	ENST00000381125.4	+	17	1894	c.1818C>T	c.(1816-1818)ttC>ttT	p.F606F	PFKP_ENST00000381072.1_Silent_p.F24F|PFKP_ENST00000381075.2_Silent_p.F598F	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	606	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		CATACATTTTCGAAGAGCCCT	0.627													C|||	625	0.1248	0.1967	0.0821	5008	,	,		16234	0.0526		0.1292	False		,,,				2504	0.1278																0								C	,	828,3578	313.6+/-293.2	76,676,1451	45.0	42.0	43.0		1794,1818	-5.4	0.2	10	dbSNP_86	43	1252,7348	243.5+/-273.1	99,1054,3147	no	coding-synonymous,coding-synonymous	PFKP	NM_001242339.1,NM_002627.4	,	175,1730,4598	TT,TC,CC		14.5581,18.7926,15.9926	,	598/777,606/785	3172145	2080,10926	2203	4300	6503	SO:0001819	synonymous_variant	5214			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.1818C>T	10.37:g.3172145C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KS15|Q5VSR7|Q5VSR8	Silent	SNP	ENST00000381125.4	37	CCDS7059.1																																																																																				0.627	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1		NM_002627	
PLA2G4D	283748	broad.mit.edu;ucsc.edu	37	15	42386652	42386652	+	Silent	SNP	C	C	T	rs148416017		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:42386652C>T	ENST00000290472.3	-	1	100	c.6G>A	c.(4-6)gaG>gaA	p.E2E		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	2					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.E2E(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GTGACAGGCTCTCCATGCTAG	0.632																																																	1	Substitution - coding silent(1)	kidney(1)						C		1,4405	2.1+/-5.4	0,1,2202	116.0	93.0	101.0		6	0.3	0.8	15	dbSNP_134	101	0,8598		0,0,4299	no	coding-synonymous	PLA2G4D	NM_178034.3		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		2/819	42386652	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	283748			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.6G>A	15.37:g.42386652C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q8N176	Silent	SNP	ENST00000290472.3	37	CCDS32203.1																																																																																				0.632	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1		NM_178034	
PPP2R5A	5525	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	212506854	212506854	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr1:212506854T>A	ENST00000261461.2	+	3	968	c.394T>A	c.(394-396)Ttc>Atc	p.F132I	PPP2R5A_ENST00000537030.3_Missense_Mutation_p.F75I|RP11-384C4.7_ENST00000442146.1_RNA|PPP2R5A_ENST00000498129.2_3'UTR	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	132					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)	p.F132I(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		TGCTAACATCTTCCGTACACT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											109.0	104.0	106.0					1																	212506854		2203	4300	6503	SO:0001583	missense	5525			BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.394T>A	1.37:g.212506854T>A	ENSP00000261461:p.Phe132Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Missense_Mutation	SNP	ENST00000261461.2	37	CCDS1503.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411331	0.83340	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	5.29	5.29	0.74685	Armadillo-type fold (1);	0.045421	0.85682	D	0.000000	T	0.77212	0.4097	M	0.90425	3.115	0.80722	D	1	B;B	0.31153	0.31;0.31	B;B	0.38562	0.276;0.276	T	0.80493	-0.1358	9	0.87932	D	0	-9.2483	15.2237	0.73333	0.0:0.0:0.0:1.0	.	75;132	B7Z7L2;Q15172	.;2A5A_HUMAN	I	132;132;75	.	ENSP00000261461:F132I	F	+	1	0	PPP2R5A	210573477	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.809000	0.86057	2.013000	0.59113	0.454000	0.30748	TTC		0.368	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1		NM_006243	
PRRG3	79057	broad.mit.edu;hgsc.bcm.edu	37	X	150869198	150869198	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:150869198C>A	ENST00000370353.3	+	4	779	c.389C>A	c.(388-390)cCc>cAc	p.P130H	PRRG3_ENST00000538575.1_Missense_Mutation_p.P130H			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	130						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.P130H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					CACACCCTCCCCCGGGTCATG	0.652																																																	1	Substitution - Missense(1)	kidney(1)											62.0	64.0	64.0					X																	150869198		2203	4300	6503	SO:0001583	missense	79057			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.389C>A	X.37:g.150869198C>A	ENSP00000359378:p.Pro130His	Somatic		WXS	Illumina HiSeq	Phase_I	A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	ENST00000370353.3	37	CCDS14699.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.237067	0.79800	.	.	ENSG00000130032	ENST00000538575;ENST00000370353	D;D	0.98968	-5.28;-5.28	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.98479	0.9493	L	0.48642	1.525	0.49299	D	0.999773	D	0.89917	1.0	D	0.87578	0.998	D	0.98586	1.0652	9	.	.	.	-21.9768	14.3415	0.66630	0.0:1.0:0.0:0.0	.	130	Q9BZD7	TMG3_HUMAN	H	130	ENSP00000440217:P130H;ENSP00000359378:P130H	.	P	+	2	0	PRRG3	150619854	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.700000	0.74619	2.050000	0.60909	0.529000	0.55759	CCC		0.652	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1		NM_024082	
RBM19	9904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	114364985	114364985	+	Silent	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr12:114364985T>C	ENST00000545145.2	-	17	2196	c.2118A>G	c.(2116-2118)gcA>gcG	p.A706A	RBM19_ENST00000392561.3_Silent_p.A706A|RBM19_ENST00000261741.5_Silent_p.A706A	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	706					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A706A(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AAGAGTTGTCTGCTCCTTCCT	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	40.0	41.0					12																	114364985		2203	4300	6503	SO:0001819	synonymous_variant	9904			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2118A>G	12.37:g.114364985T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5X9|Q9BPY6|Q9UFN5	Silent	SNP	ENST00000545145.2	37	CCDS9172.1																																																																																				0.418	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1		NM_016196	
RRP8	23378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6621799	6621800	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr11:6621799_6621800insT	ENST00000254605.6	-	6	1284_1285	c.1167_1168insA	c.(1165-1170)aaagtgfs	p.V390fs	RRP8_ENST00000534343.1_Frame_Shift_Ins_p.V74fs	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	390					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						ACCTCAGCCACTTTCAGGAGAC	0.525																																																	0																																										SO:0001589	frameshift_variant	23378			AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.1168dupA	11.37:g.6621802_6621802dupT	ENSP00000254605:p.Val390fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q7KZ78|Q9BVM6	Frame_Shift_Ins	INS	ENST00000254605.6	37	CCDS31411.1																																																																																				0.525	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1		NM_015324	
SCN7A	6332	broad.mit.edu;ucsc.edu	37	2	167289087	167289087	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:167289087A>T	ENST00000409855.1	-	15	2459	c.2333T>A	c.(2332-2334)aTg>aAg	p.M778K		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	778					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.M778K(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TACATGGTCCATTGTGTCCTT	0.343																																																	2	Substitution - Missense(2)	kidney(2)											182.0	172.0	175.0					2																	167289087		1843	4092	5935	SO:0001583	missense	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2333T>A	2.37:g.167289087A>T	ENSP00000386796:p.Met778Lys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	A	0.046	-1.265996	0.01433	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.82433	-1.61;-1.61	5.51	-3.24	0.05094	Sodium ion transport-associated (1);	1.096010	0.06855	N	0.798094	T	0.62332	0.2419	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.51028	-0.8757	10	0.06365	T	0.9	.	0.3394	0.00331	0.3095:0.1327:0.2537:0.3042	.	778	Q01118	SCN7A_HUMAN	K	778	ENSP00000386796:M778K;ENSP00000413699:M778K	ENSP00000259060:M778K	M	-	2	0	SCN7A	166997333	0.000000	0.05858	0.004000	0.12327	0.581000	0.36288	-0.169000	0.09911	-0.299000	0.08909	0.459000	0.35465	ATG		0.343	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			
SEC24D	9871	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	119718966	119718966	+	Splice_Site	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr4:119718966C>T	ENST00000280551.6	-	8	1152		c.e8-1		SEC24D_ENST00000419654.2_Splice_Site|SEC24D_ENST00000379735.5_Splice_Site			O94855	SC24D_HUMAN	SEC24 family member D						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.?(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						CTGGCATTTCCTGAAACATTC	0.353																																																	1	Unknown(1)	kidney(1)											91.0	78.0	82.0					4																	119718966		2203	4300	6503	SO:0001630	splice_region_variant	9871			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.914-1G>A	4.37:g.119718966C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYI7	Splice_Site	SNP	ENST00000280551.6	37	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397650	0.83120	.	.	ENSG00000150961	ENST00000280551;ENST00000379735	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2733	0.90074	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEC24D	119938414	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.394000	0.79862	2.616000	0.88540	0.655000	0.94253	.		0.353	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4			Intron
SERPINB11	89778	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	61390295	61390295	+	RNA	SNP	G	G	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr18:61390295G>C	ENST00000382749.5	+	0	1086				SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000544088.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E79Q(1)|p.E281Q(1)		breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				GATGGAAAGAGAAGTTGAAGT	0.423																																					Ovarian(27;496 784 5942 8975 23930)												2	Substitution - Missense(2)	kidney(2)											43.0	39.0	40.0					18																	61390295		1886	4121	6007			89778					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61390295G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	ENST00000382749.5	37		.	.	.	.	.	.	.	.	.	.	G	9.102	1.004378	0.19199	.	.	ENSG00000206072	ENST00000544088;ENST00000538847;ENST00000536691	D;D;D	0.84730	-1.89;-1.89;-1.89	5.05	4.18	0.49190	Serpin domain (3);	0.815699	0.10709	N	0.643045	D	0.82806	0.5117	L	0.35288	1.05	0.09310	N	1	P;D;B;P;P	0.53151	0.879;0.958;0.42;0.928;0.942	P;P;B;P;P	0.52386	0.572;0.483;0.099;0.572;0.697	T	0.70590	-0.4830	10	0.41790	T	0.15	.	6.9139	0.24349	0.278:0.0:0.722:0.0	.	106;79;194;281;281	F5GWT8;F5GY69;Q96P15-2;F5GYW9;Q96P15	.;.;.;.;SPB11_HUMAN	Q	281;79;106	ENSP00000441497:E281Q;ENSP00000440795:E79Q;ENSP00000441708:E106Q	ENSP00000421854:E281Q	E	+	1	0	SERPINB11	59541275	0.014000	0.17966	0.009000	0.14445	0.039000	0.13416	1.773000	0.38563	1.246000	0.43901	0.655000	0.94253	GAA		0.423	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3		NM_080475	
SETD2	29072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	47144873	47144873	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:47144873A>C	ENST00000409792.3	-	7	4922	c.4880T>G	c.(4879-4881)aTg>aGg	p.M1627R		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1627	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.M1627R(1)|p.M1124R(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GCTGTGATTCATGAAACGAGA	0.333			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	kidney(2)											166.0	154.0	158.0					3																	47144873		2203	4300	6503	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4880T>G	3.37:g.47144873A>C	ENSP00000386759:p.Met1627Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598492	0.87055	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.81908	-1.55	5.83	5.83	0.93111	SET domain (3);	0.000000	0.64402	D	0.000003	D	0.91161	0.7216	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.987;0.997	D	0.92242	0.5801	10	0.87932	D	0	.	14.7708	0.69675	1.0:0.0:0.0:0.0	.	1627;1627	F2Z317;Q9BYW2	.;SETD2_HUMAN	R	1627	ENSP00000386759:M1627R	ENSP00000386759:M1627R	M	-	2	0	SETD2	47119877	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.890000	0.92477	2.240000	0.73641	0.528000	0.53228	ATG		0.333	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
SLC13A3	64849	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	45192089	45192089	+	Silent	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr20:45192089G>A	ENST00000279027.4	-	12	1614	c.1596C>T	c.(1594-1596)atC>atT	p.I532I	SLC13A3_ENST00000290317.5_Silent_p.I485I|SLC13A3_ENST00000495082.1_Silent_p.I485I|SLC13A3_ENST00000472148.1_Silent_p.I450I|SLC13A3_ENST00000413164.2_Silent_p.I482I|SLC13A3_ENST00000396360.1_Silent_p.I450I|SLC13A3_ENST00000435032.1_Silent_p.I117I	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	532					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.I532I(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	AGGCGAAGGCGATGGAGTTGG	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	41.0	43.0					20																	45192089		2203	4300	6503	SO:0001819	synonymous_variant	64849			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1596C>T	20.37:g.45192089G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	ENST00000279027.4	37	CCDS13400.1																																																																																				0.632	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2			
SLC15A5	729025	hgsc.bcm.edu;ucsc.edu	37	12	16410792	16410792	+	Silent	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr12:16410792G>A	ENST00000344941.3	-	3	596	c.597C>T	c.(595-597)ctC>ctT	p.L199L		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	199					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						TTAGGTTCATGAGCCAATAAA	0.338																																																	0													102.0	92.0	95.0					12																	16410792		692	1591	2283	SO:0001819	synonymous_variant	729025					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.597C>T	12.37:g.16410792G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000344941.3	37																																																																																					0.338	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401119.2		XM_001129090	
SPTLC2	9517	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	78045381	78045381	+	Silent	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr14:78045381G>A	ENST00000216484.2	-	3	592	c.399C>T	c.(397-399)aaC>aaT	p.N133N		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	133					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)	p.N133N(1)		kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	GCCGATTCCAGTTGTCTCTTA	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											88.0	83.0	85.0					14																	78045381		2203	4300	6503	SO:0001819	synonymous_variant	9517			AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.399C>T	14.37:g.78045381G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q16685	Silent	SNP	ENST00000216484.2	37	CCDS9865.1																																																																																				0.418	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1		NM_004863	
TEC	7006	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	48148400	48148400	+	Silent	SNP	A	A	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr4:48148400A>T	ENST00000381501.3	-	12	1180	c.1023T>A	c.(1021-1023)ctT>ctA	p.L341L	TEC_ENST00000511471.2_5'UTR	NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	341	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.L341L(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						CTGGGTACCGAAGCCTGGTGA	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											153.0	148.0	149.0					4																	48148400		2203	4300	6503	SO:0001819	synonymous_variant	100124696			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.1023T>A	4.37:g.48148400A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKZ6|Q3MIS5	Silent	SNP	ENST00000381501.3	37	CCDS3481.1																																																																																				0.413	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250492.3			
TMCC3	57458	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	94975953	94975953	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr12:94975953C>A	ENST00000261226.4	-	2	571	c.440G>T	c.(439-441)gGa>gTa	p.G147V	TMCC3_ENST00000551457.1_Missense_Mutation_p.G116V	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	147						integral component of membrane (GO:0016021)		p.G147V(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						CCTAGAGGCTCCATTCTGCTC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											93.0	93.0	93.0					12																	94975953		2203	4300	6503	SO:0001583	missense	57458			AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.440G>T	12.37:g.94975953C>A	ENSP00000261226:p.Gly147Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	37	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650913	0.67472	.	.	ENSG00000057704	ENST00000261226;ENST00000551457;ENST00000548918	T;T;T	0.44881	0.91;0.91;0.91	5.74	5.74	0.90152	.	0.089261	0.85682	D	0.000000	T	0.63236	0.2494	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55903	-0.8067	10	0.36615	T	0.2	-28.2242	20.2825	0.98528	0.0:1.0:0.0:0.0	.	147	Q9ULS5	TMCC3_HUMAN	V	147;116;116	ENSP00000261226:G147V;ENSP00000449888:G116V;ENSP00000450078:G116V	ENSP00000261226:G147V	G	-	2	0	TMCC3	93500084	0.995000	0.38212	0.710000	0.30468	0.983000	0.72400	3.471000	0.53107	2.873000	0.98535	0.561000	0.74099	GGA		0.478	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1		NM_020698	
TMOD3	29766	broad.mit.edu	37	15	52213781	52213781	+	IGR	DEL	C	C	-			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:52213781delC								TMOD3 (9446 upstream) : TMOD3 (12392 downstream)																							acttcctcctccatgcagcct	0.493																																																	0																																										SO:0001628	intergenic_variant	29766																															15.37:g.52213781delC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.493									
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179622487	179622487	+	Intron	SNP	C	C	A	rs531271853		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:179622487C>A	ENST00000591111.1	-	44	10528				TTN_ENST00000360870.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R3441M|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R3487M|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R3441M(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCAGAAACCCTCGCATGAAA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											116.0	115.0	115.0					2																	179622487		1880	4112	5992	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10303+1223G>T	2.37:g.179622487C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.13	2.146447	0.37923	.	.	ENSG00000155657	ENST00000359218	T	0.68331	-0.32	6.16	6.16	0.99307	.	.	.	.	.	T	0.73087	0.3542	.	.	.	0.24944	N	0.991834	P	0.45634	0.863	P	0.49597	0.616	T	0.69072	-0.5242	8	0.87932	D	0	.	15.5636	0.76269	0.1378:0.8622:0.0:0.0	.	3441	E7EQE6	.	M	3441	ENSP00000352154:R3441M	ENSP00000352154:R3441M	R	-	2	0	TTN	179330732	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.123000	0.50453	2.937000	0.99478	0.650000	0.86243	AGG		0.483	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
TYRO3	7301	hgsc.bcm.edu	37	15	41862436	41862436	+	Splice_Site	SNP	A	A	G	rs201371674	byFrequency	TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:41862436A>G	ENST00000263798.3	+	11	1606		c.e11-1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTTTTCCTTTAGGCAAGCCTT	0.587																																																	0																																										SO:0001630	splice_region_variant	7301			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1383-1A>G	15.37:g.41862436A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862477	0.71949	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0491	0.58944	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39649728	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	7.007000	0.76335	2.208000	0.71279	0.533000	0.62120	.		0.587	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2			Intron
UBA1	7317	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	47062342	47062342	+	Splice_Site	SNP	G	G	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:47062342G>A	ENST00000335972.6	+	12	1417	c.1234G>A	c.(1234-1236)Gcc>Acc	p.A412T	INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Splice_Site_p.A412T|UBA1_ENST00000490869.1_3'UTR	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	412	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.A412T(1)		breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCCTCTCCAGGCCTGCTCCGG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											52.0	44.0	47.0					X																	47062342		2203	4300	6503	SO:0001630	splice_region_variant	7317			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1234-1G>A	X.37:g.47062342G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714239	0.89112	.	.	ENSG00000130985	ENST00000377351;ENST00000335972	T;T	0.53857	0.6;0.6	5.42	5.42	0.78866	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.78698	0.4324	M	0.93720	3.45	0.80722	D	1	D	0.71674	0.998	D	0.64144	0.922	D	0.84934	0.0861	9	.	.	.	-21.3664	17.144	0.86761	0.0:0.0:1.0:0.0	.	412	P22314	UBA1_HUMAN	T	412	ENSP00000366568:A412T;ENSP00000338413:A412T	.	A	+	1	0	UBA1	46947286	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.765000	0.98953	2.400000	0.81607	0.597000	0.82753	GCC		0.577	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1		NM_003334	Missense_Mutation
ULK4	54986	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	41795894	41795895	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:41795894_41795895insA	ENST00000301831.4	-	22	2741_2742	c.2279_2280insT	c.(2278-2280)ttgfs	p.L760fs		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	760					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		GGTTATAAATCAAAATATATAG	0.381																																																	0																																										SO:0001589	frameshift_variant	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2280dupT	3.37:g.41795898_41795898dupA	ENSP00000301831:p.Leu760fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Frame_Shift_Ins	INS	ENST00000301831.4	37	CCDS43071.1																																																																																				0.381	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1		XM_929989	
C17orf64	124773	broad.mit.edu	37	17	58511110	58511110	+	IGR	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr17:58511110C>A	ENST00000269127.4	+	0	950				RPL12P38_ENST00000588627.1_RNA	NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64											breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			TCCACAGCACCACTGTTGATG	0.403																																																	0																																										SO:0001628	intergenic_variant	0			BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171		17.37:g.58511110C>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q8IY87	RNA	SNP	ENST00000269127.4	37	CCDS32698.2																																																																																				0.403	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000347743.1		NM_181707	
ZNF730	100129543	broad.mit.edu	37	19	23329317	23329317	+	Silent	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:23329317C>A	ENST00000597761.2	+	4	1670	c.1471C>A	c.(1471-1473)Cgg>Agg	p.R491R		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R491R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						AGCCTTTAGGCGGTTCTCACA	0.353																																																	1	Substitution - coding silent(1)	kidney(1)																																								SO:0001819	synonymous_variant	0			AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.1471C>A	19.37:g.23329317C>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000597761.2	37	CCDS59371.1																																																																																				0.353	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465737.2		XM_001719792	
CTD-2066L21.3	0	broad.mit.edu	37	5	33162312	33162312	+	lincRNA	SNP	C	C	A	rs540794656	byFrequency	TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr5:33162312C>A	ENST00000510327.1	-	0	346																											CAACTGGCACCAGCGCCGCAA	0.547													A|||	2	0.000399361	0.0	0.0	5008	,	,		16124	0.0		0.002	False		,,,				2504	0.0																0																																												0																															5.37:g.33162312C>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000510327.1	37																																																																																					0.547	CTD-2066L21.3-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000366718.1			
WASH6P	653440	broad.mit.edu	37	X	155252987	155252988	+	RNA	INS	-	-	CAGCACCAC			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chrX:155252987_155252988insCAGCACCAC	ENST00000461007.1	+	0	1903_1904				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TGGGGTactaacaccaccccca	0.658														2815	0.562101	0.5726	0.585	5008	,	,		4013	0.4742		0.6402	False		,,,				2504	0.5419																0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252987_155252988insCAGCACCAC		Somatic		WXS	Illumina GAIIx	Phase_I	A6NGF1|Q8N305	In_Frame_Ins	INS	ENST00000461007.1	37																																																																																					0.658	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1		NG_008380	
USP18	11274	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	18643020	18643020	+	Missense_Mutation	SNP	C	C	A	rs200425361		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr22:18643020C>A	ENST00000215794.7	+	3	669	c.239C>A	c.(238-240)aCc>aAc	p.T80N		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	80	USP.				cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.T80N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						GTGGACTTCACCAGGATATTG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											162.0	138.0	146.0					22																	18643020		2203	4300	6503	SO:0001583	missense	11274			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.239C>A	22.37:g.18643020C>A	ENSP00000215794:p.Thr80Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	ENST00000215794.7	37	CCDS13752.1	.	.	.	.	.	.	.	.	.	.	.	11.91	1.778419	0.31502	.	.	ENSG00000184979	ENST00000215794	T	0.30981	1.51	4.64	3.6	0.41247	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.171770	0.05996	N	0.646914	T	0.40791	0.1131	L	0.48362	1.52	0.23089	N	0.99832	P	0.44877	0.845	P	0.49332	0.607	T	0.32508	-0.9904	10	0.87932	D	0	.	10.3224	0.43773	0.0:0.7899:0.2101:0.0	.	80	Q9UMW8	UBP18_HUMAN	N	80	ENSP00000215794:T80N	ENSP00000215794:T80N	T	+	2	0	USP18	17023020	0.966000	0.33281	0.994000	0.49952	0.290000	0.27261	2.609000	0.46317	1.129000	0.42072	0.478000	0.44815	ACC		0.423	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316368.1			
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10191469	10191469	+	Splice_Site	SNP	A	A	G	rs5030816		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr3:10191469A>G	ENST00000256474.2	+	3	1303		c.e3-1		VHL_ENST00000477538.1_Splice_Site|VHL_ENST00000345392.2_Splice_Site	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase						cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(8)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TTGCCCTTCCAGTGTATACTC	0.498		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	8	Unknown(8)	kidney(7)|adrenal_gland(1)	GRCh37	CS941546|CS961704|CS961705	VHL	S	rs5030816						87.0	79.0	82.0					3																	10191469		2203	4300	6503	SO:0001630	splice_region_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.464-1A>G	3.37:g.10191469A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Splice_Site	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.147006	0.37923	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2441	0.54560	1.0:0.0:0.0:0.0	rs5030816	.	.	.	.	-1	.	.	.	+	.	.	VHL	10166469	1.000000	0.71417	0.996000	0.52242	0.357000	0.29423	6.694000	0.74587	2.052000	0.61016	0.533000	0.62120	.		0.498	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	Intron
VPS18	57617	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	41192166	41192166	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr15:41192166C>T	ENST00000220509.5	+	4	1489	c.1150C>T	c.(1150-1152)Cgg>Tgg	p.R384W	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	384					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)	p.R384W(1)		autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CTACACTGAGCGGGCTGTCTT	0.597																																																	1	Substitution - Missense(1)	kidney(1)											62.0	61.0	61.0					15																	41192166		2203	4300	6503	SO:0001583	missense	57617			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.1150C>T	15.37:g.41192166C>T	ENSP00000220509:p.Arg384Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	ENST00000220509.5	37	CCDS10069.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033737	0.54896	.	.	ENSG00000104142	ENST00000220509	T	0.22134	1.97	5.3	5.3	0.74995	Pep3/Vps18/deep orange (1);	0.157107	0.51477	D	0.000091	T	0.39064	0.1064	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	T	0.09378	-1.0677	10	0.72032	D	0.01	-29.433	12.4906	0.55897	0.2786:0.7214:0.0:0.0	.	384	Q9P253	VPS18_HUMAN	W	384	ENSP00000220509:R384W	ENSP00000220509:R384W	R	+	1	2	VPS18	38979458	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	2.030000	0.41108	2.633000	0.89246	0.561000	0.74099	CGG		0.597	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252443.2			
WASL	8976	broad.mit.edu	37	7	123332892	123332892	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr7:123332892C>A	ENST00000223023.4	-	9	1188	c.856G>T	c.(856-858)Ggg>Tgg	p.G286W		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	286	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)	p.G286W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ggaggtggCCCTCCCCTTGAT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											49.0	55.0	53.0					7																	123332892		2197	4292	6489	SO:0001583	missense	8976			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.856G>T	7.37:g.123332892C>A	ENSP00000223023:p.Gly286Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	37	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768733	0.49680	.	.	ENSG00000106299	ENST00000223023	D	0.91237	-2.81	5.72	5.72	0.89469	Wiscott-Aldrich syndrome, C-terminal (1);	0.050242	0.85682	D	0.000000	D	0.93654	0.7973	M	0.71206	2.165	0.58432	D	0.999999	D	0.56287	0.975	P	0.53649	0.731	D	0.93831	0.7128	10	0.72032	D	0.01	-3.3564	19.9234	0.97095	0.0:1.0:0.0:0.0	.	286	O00401	WASL_HUMAN	W	286	ENSP00000223023:G286W	ENSP00000223023:G286W	G	-	1	0	WASL	123120128	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.342000	0.65970	2.718000	0.92993	0.644000	0.83932	GGG		0.522	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1		NM_003941	
ZBTB46	140685	broad.mit.edu;hgsc.bcm.edu	37	20	62407316	62407316	+	Splice_Site	SNP	C	C	T			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr20:62407316C>T	ENST00000245663.4	-	3	1088		c.e3-1		ZBTB46_ENST00000302995.2_Splice_Site|ZBTB46_ENST00000395104.1_Splice_Site	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46						negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.?(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					AGGTCCGCATCTGGGGACAGA	0.617																																																	1	Unknown(1)	kidney(1)											40.0	41.0	41.0					20																	62407316		2203	4300	6503	SO:0001630	splice_region_variant	140685			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.938-1G>A	20.37:g.62407316C>T		Somatic		WXS	Illumina HiSeq	Phase_I	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Splice_Site	SNP	ENST00000245663.4	37	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	C	9.734	1.163087	0.21538	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2751	0.90080	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZBTB46	61877760	1.000000	0.71417	0.470000	0.27216	0.046000	0.14306	6.351000	0.73022	2.574000	0.86865	0.491000	0.48974	.		0.617	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2		NM_025224	Intron
ZFAND2B	130617	broad.mit.edu;ucsc.edu	37	2	220072989	220072989	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr2:220072989T>C	ENST00000289528.5	+	5	641	c.446T>C	c.(445-447)aTc>aCc	p.I149T	ZFAND2B_ENST00000409097.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409336.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409206.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409217.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409594.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000444522.2_Missense_Mutation_p.I149T	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	149						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)	p.I149T(1)		endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGCTGCCATCTCCAGAGCA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											75.0	62.0	66.0					2																	220072989		2203	4300	6503	SO:0001583	missense	130617			AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.446T>C	2.37:g.220072989T>C	ENSP00000289528:p.Ile149Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NB98	Missense_Mutation	SNP	ENST00000289528.5	37	CCDS2435.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.286451	0.40494	.	.	ENSG00000158552	ENST00000409206;ENST00000409594;ENST00000289528;ENST00000422255;ENST00000409097;ENST00000409336;ENST00000409217;ENST00000444522	T;T;T;T;T;T;T;T	0.44881	0.95;0.95;0.91;0.92;0.91;0.91;0.92;0.91	5.32	5.32	0.75619	Zinc finger, AN1-type (1);	0.400654	0.26646	N	0.023223	T	0.38480	0.1042	L	0.54323	1.7	0.38030	D	0.93514	P;B;B	0.36438	0.553;0.019;0.149	B;B;B	0.35470	0.203;0.022;0.053	T	0.44283	-0.9338	10	0.48119	T	0.1	-15.7601	11.5973	0.50981	0.0:0.0:0.0:1.0	.	40;149;149	B3KQB0;Q8WV99;B4DEN4	.;ZFN2B_HUMAN;.	T	149	ENSP00000386824:I149T;ENSP00000386399:I149T;ENSP00000289528:I149T;ENSP00000409931:I149T;ENSP00000387179:I149T;ENSP00000386898:I149T;ENSP00000386370:I149T;ENSP00000411334:I149T	ENSP00000289528:I149T	I	+	2	0	ZFAND2B	219781233	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	3.720000	0.54933	2.233000	0.73108	0.533000	0.62120	ATC		0.532	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256824.2		NM_138802	
ZNF570	148268	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	37975687	37975687	+	Missense_Mutation	SNP	G	G	T	rs368632033		TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:37975687G>T	ENST00000330173.1	+	5	1692	c.1163G>T	c.(1162-1164)tGt>tTt	p.C388F	ZNF570_ENST00000586475.1_Missense_Mutation_p.C444F|ZNF570_ENST00000388801.3_Missense_Mutation_p.C185F	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C388F(1)		endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCCTATGAATGTAAGGAATGT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											79.0	79.0	79.0					19																	37975687		2203	4300	6503	SO:0001583	missense	148268			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1163G>T	19.37:g.37975687G>T	ENSP00000331540:p.Cys388Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A1L472|B4DMP1	Missense_Mutation	SNP	ENST00000330173.1	37	CCDS12504.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385896	0.61956	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	D;D	0.85088	-1.94;-1.94	4.17	4.17	0.49024	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41712	D	0.000833	D	0.95242	0.8457	H	0.98027	4.13	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97053	0.9765	10	0.87932	D	0	.	15.7538	0.78009	0.0:0.0:1.0:0.0	.	185;388	B4DMP1;Q96NI8	.;ZN570_HUMAN	F	388;185	ENSP00000331540:C388F;ENSP00000373453:C185F	ENSP00000331540:C388F	C	+	2	0	ZNF570	42667527	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	6.207000	0.72159	2.313000	0.78055	0.557000	0.71058	TGT		0.408	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1		NM_144694	
ZNF772	400720	hgsc.bcm.edu	37	19	57988666	57988667	+	In_Frame_Ins	INS	-	-	GCC	rs77164240|rs528587884|rs34678661|rs193920834	byFrequency	TCGA-B0-4852-01A-01D-1501-10	TCGA-B0-4852-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28dbeb57-c919-4f91-aa3c-7b8f3809011e	b19198c1-7ef5-4673-bb17-fbdce6183d7f	g.chr19:57988666_57988667insGCC	ENST00000343280.4	-	1	271_272	c.11_12insGGC	c.(10-12)gct>gcGGCt	p.4_4A>AA	AC004076.9_ENST00000596831.1_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000356584.3_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000601768.1_In_Frame_Ins_p.4_4A>AA|AC004076.9_ENST00000415705.3_5'UTR|AC003005.2_ENST00000595422.1_lincRNA|ZNF772_ENST00000427512.2_5'UTR|ZNF772_ENST00000425074.3_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000600175.1_In_Frame_Ins_p.4_4A>AA	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		CCATCGGCTCAGCCGCCGCCAT	0.644											OREG0025695	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		2037	0.406749	0.3124	0.4481	5008	,	,		16965	0.5823		0.2753	False		,,,				2504	0.4591				Melanoma(5;289 436 14293 15924 30817)												0									,	1273,2975		195,883,1046					,	-4.0	0.0		dbSNP_126	62	2294,5946		320,1654,2146	no	coding,coding	ZNF772	NM_001144068.1,NM_001024596.2	,	515,2537,3192	A1A1,A1R,RR		27.8398,29.967,28.5634	,	,		3567,8921				SO:0001652	inframe_insertion	400720			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.9_11dupGGC	19.37:g.57988673_57988675dupGCC	ENSP00000341165:p.Ala4dup	Somatic	1027	WXS	Illumina HiSeq	Phase_I	A6NJK9|B4DH56|B4DYS0	In_Frame_Ins	INS	ENST00000343280.4	37	CCDS33133.1																																																																																				0.644	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1		NM_001024596	
