#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AASDHPPT	60496	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	105962108	105962108	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:105962108A>T	ENST00000278618.4	+	4	819	c.597A>T	c.(595-597)gaA>gaT	p.E199D	RP11-677I18.3_ENST00000532422.1_RNA	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	199					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)	p.E199D(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		AGCGGCTTGAATTTGATCTAT	0.363																																																	1	Substitution - Missense(1)	kidney(1)											107.0	117.0	114.0					11																	105962108		2200	4299	6499	SO:0001583	missense	60496			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.597A>T	11.37:g.105962108A>T	ENSP00000278618:p.Glu199Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	ENST00000278618.4	37	CCDS31664.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.750876	0.49257	.	.	ENSG00000149313	ENST00000533423;ENST00000524411;ENST00000278618	.	.	.	5.77	3.13	0.36017	4&apos (2);-phosphopantetheinyl transferase (2);	0.000000	0.85682	D	0.000000	T	0.55673	0.1935	L	0.58510	1.815	0.40843	D	0.983685	B	0.19706	0.038	B	0.25987	0.065	T	0.52968	-0.8504	9	0.33141	T	0.24	.	9.2163	0.37348	0.7747:0.0:0.2253:0.0	.	199	Q9NRN7	ADPPT_HUMAN	D	134;134;199	.	ENSP00000278618:E199D	E	+	3	2	AASDHPPT	105467318	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.563000	0.45922	1.020000	0.39573	0.477000	0.44152	GAA		0.363	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388734.1		NM_015423	
ABCA7	10347	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	1043790	1043790	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:1043790C>G	ENST00000263094.6	+	10	1228	c.997C>G	c.(997-999)Ccc>Gcc	p.P333A	ABCA7_ENST00000433129.1_Missense_Mutation_p.P333A|ABCA7_ENST00000435683.2_Missense_Mutation_p.P195A	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	333					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)	p.P333A(1)		NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATGCTGGGACCCCGGATCTT	0.632																																																	1	Substitution - Missense(1)	kidney(1)											172.0	170.0	170.0					19																	1043790		2203	4300	6503	SO:0001583	missense	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.997C>G	19.37:g.1043790C>G	ENSP00000263094:p.Pro333Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576673	0.28092	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.86230	-2.09;-2.09	4.33	3.28	0.37604	.	.	.	.	.	D	0.92064	0.7485	M	0.79693	2.465	0.32201	N	0.577854	D;P	0.67145	0.996;0.894	D;P	0.65233	0.933;0.682	D	0.91455	0.5184	9	0.40728	T	0.16	.	12.001	0.53230	0.0:0.8235:0.1765:0.0	.	195;333	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	A	333	ENSP00000263094:P333A;ENSP00000414062:P333A	ENSP00000263094:P333A	P	+	1	0	ABCA7	994790	0.995000	0.38212	0.569000	0.28460	0.324000	0.28378	3.510000	0.53393	0.793000	0.33875	0.455000	0.32223	CCC		0.632	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1		NM_019112	
ABCA8	10351	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	66878106	66878106	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr17:66878106C>A	ENST00000269080.2	-	29	3861	c.3724G>T	c.(3724-3726)Gcc>Tcc	p.A1242S	ABCA8_ENST00000430352.2_Missense_Mutation_p.A1282S|ABCA8_ENST00000586539.1_Missense_Mutation_p.A1282S	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1242					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A1242S(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					AGACAGCTGGCAATGATGACT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											130.0	122.0	125.0					17																	66878106		2203	4300	6503	SO:0001583	missense	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3724G>T	17.37:g.66878106C>A	ENSP00000269080:p.Ala1242Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619502	0.87460	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.86097	-2.05;-2.07	4.75	4.75	0.60458	.	0.000000	0.52532	D	0.000066	D	0.93549	0.7941	M	0.90019	3.08	0.40766	D	0.983042	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.78314	0.991;0.986;0.991	D	0.94550	0.7753	10	0.56958	D	0.05	.	17.2614	0.87071	0.0:1.0:0.0:0.0	.	1282;1282;1242	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	S	1242;1282	ENSP00000269080:A1242S;ENSP00000402814:A1282S	ENSP00000269080:A1242S	A	-	1	0	ABCA8	64389701	0.980000	0.34600	0.969000	0.41365	0.961000	0.63080	2.538000	0.45710	2.623000	0.88846	0.563000	0.77884	GCC		0.413	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1		NM_007168	
ABCF1	23	broad.mit.edu;hgsc.bcm.edu	37	6	30548295	30548295	+	Splice_Site	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:30548295A>G	ENST00000326195.8	+	8	789	c.677A>G	c.(676-678)cAg>cGg	p.Q226R	ABCF1_ENST00000376545.3_Splice_Site_p.Q226R|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	226	Glu-rich.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)	p.Q226R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						AAGGCAGAGCAGGTGTGTATT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											30.0	24.0	26.0					6																	30548295		1509	2707	4216	SO:0001630	splice_region_variant	23			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.678+1A>G	6.37:g.30548295A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.301037	0.23650	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000455943;ENST00000441867	T;T;T	0.56103	0.48;0.64;0.94	5.0	3.8	0.43715	.	1.003210	0.08033	N	0.993855	T	0.16300	0.0392	N	0.14661	0.345	0.80722	D	1	B;B;B	0.26445	0.149;0.149;0.037	B;B;B	0.26202	0.067;0.067;0.025	T	0.16012	-1.0417	10	0.15952	T	0.53	-10.8409	8.6396	0.33970	0.9088:0.0:0.0912:0.0	.	226;226;226	Q2L6I2;Q8NE71;A2BF75	.;ABCF1_HUMAN;.	R	226;226;227;227	ENSP00000313603:Q226R;ENSP00000365728:Q226R;ENSP00000405512:Q227R	ENSP00000313603:Q226R	Q	+	2	0	ABCF1	30656274	1.000000	0.71417	0.947000	0.38551	0.766000	0.43426	1.217000	0.32455	0.718000	0.32166	0.383000	0.25322	CAG		0.473	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3			Missense_Mutation
ABCC10	89845	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43402438	43402438	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:43402438C>T	ENST00000372530.4	+	4	1675	c.1460C>T	c.(1459-1461)gCc>gTc	p.A487V	ABCC10_ENST00000443426.2_3'UTR|ABCC10_ENST00000244533.3_Missense_Mutation_p.A444V	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	487	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A444V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CGAGTAGAGGCCTGCCGGGCT	0.602																																																	1	Substitution - Missense(1)	kidney(1)											90.0	100.0	96.0					6																	43402438		2203	4300	6503	SO:0001583	missense	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1460C>T	6.37:g.43402438C>T	ENSP00000361608:p.Ala487Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324305	0.41197	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.89617	-2.54;-2.54;-2.54	5.93	4.99	0.66335	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.676502	0.15525	N	0.257839	T	0.79125	0.4393	L	0.37507	1.11	0.09310	N	1	B;P	0.38677	0.001;0.642	B;B	0.38106	0.005;0.265	T	0.73949	-0.3821	10	0.36615	T	0.2	-12.7575	17.1045	0.86658	0.1516:0.8484:0.0:0.0	.	444;487	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	V	43;487;444	ENSP00000361593:A43V;ENSP00000361608:A487V;ENSP00000244533:A444V	ENSP00000244533:A444V	A	+	2	0	ABCC10	43510416	0.069000	0.21087	1.000000	0.80357	0.955000	0.61496	0.457000	0.21875	2.826000	0.97356	0.655000	0.94253	GCC		0.602	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2		NM_033450	
ADM2	79924	broad.mit.edu	37	22	50921276	50921276	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr22:50921276G>A	ENST00000395738.2	+	2	683	c.391G>A	c.(391-393)Gcc>Acc	p.A131T	ADM2_ENST00000395737.1_Missense_Mutation_p.A131T|ADM2_ENST00000362068.2_Silent_p.R47R	NM_001253845.1|NM_024866.5	NP_001240774.1|NP_079142.2	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2	131					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|digestion (GO:0007586)|feeding behavior (GO:0007631)|negative regulation of blood pressure (GO:0045776)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)	extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.A131T(1)		breast(1)|kidney(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CATGGGACCGGCCGGCCGGCA	0.706																																																	1	Substitution - Missense(1)	kidney(1)											8.0	10.0	10.0					22																	50921276		2019	4061	6080	SO:0001583	missense	79924			AF529213	CCDS33682.1	22q13.33	2013-02-25			ENSG00000128165	ENSG00000128165		"""Endogenous ligands"""	28898	protein-coding gene	gene with protein product		608682				14706825	Standard	NM_024866		Approved	AM2, FLJ21135	uc003blj.3	Q7Z4H4	OTTHUMG00000150202	ENST00000395738.2:c.391G>A	22.37:g.50921276G>A	ENSP00000379087:p.Ala131Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q3LFQ0	Missense_Mutation	SNP	ENST00000395738.2	37	CCDS33682.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332246	0.41297	.	.	ENSG00000128165	ENST00000395738;ENST00000395737	T;T	0.21932	1.98;1.98	4.62	0.716	0.18191	.	.	.	.	.	T	0.14356	0.0347	N	0.25647	0.755	0.09310	N	1	B	0.21520	0.057	B	0.28784	0.094	T	0.32079	-0.9920	9	0.62326	D	0.03	.	5.2203	0.15366	0.1992:0.0:0.5703:0.2306	.	131	Q7Z4H4	ADM2_HUMAN	T	131	ENSP00000379087:A131T;ENSP00000379086:A131T	ENSP00000379086:A131T	A	+	1	0	ADM2	49268142	0.050000	0.20438	0.001000	0.08648	0.095000	0.18619	1.644000	0.37228	0.359000	0.24239	0.448000	0.29417	GCC		0.706	ADM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316816.1		NM_024866	
AKNA	80709	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	117106062	117106062	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr9:117106062G>T	ENST00000307564.4	-	19	3844	c.3683C>A	c.(3682-3684)tCc>tAc	p.S1228Y	AKNA_ENST00000374088.3_Missense_Mutation_p.S1228Y|AKNA_ENST00000374079.4_Missense_Mutation_p.S173Y|AKNA_ENST00000223791.3_Missense_Mutation_p.S688Y|AKNA_ENST00000492875.1_5'UTR|AKNA_ENST00000374075.5_Missense_Mutation_p.S1147Y	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1228					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S1228Y(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CGCCTTAGGGGACAGAACATG	0.522																																																	1	Substitution - Missense(1)	kidney(1)											87.0	86.0	86.0					9																	117106062		2203	4300	6503	SO:0001583	missense	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3683C>A	9.37:g.117106062G>T	ENSP00000303769:p.Ser1228Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.725|4.725	0.134793|0.134793	0.09032|0.09032	.|.	.|.	ENSG00000106948|ENSG00000106948	ENST00000320310|ENST00000307564;ENST00000374079;ENST00000374088;ENST00000223791;ENST00000374075	.|T;T;T;T;T	.|0.20069	.|2.52;2.1;2.52;2.29;2.51	4.06|4.06	2.23|2.23	0.28157|0.28157	.|.	.|1.020720	.|0.07815	.|N	.|0.958750	.|T	.|0.18964	.|0.0455	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	.|P;P	.|0.39782	.|0.561;0.688	.|B;B	.|0.40444	.|0.176;0.329	.|T	.|0.24512	.|-1.0158	.|10	.|0.72032	.|D	.|0.01	.|-4.9867	6.3913|6.3913	0.21589|0.21589	0.2183:0.0:0.7817:0.0|0.2183:0.0:0.7817:0.0	.|.	.|1228;1147	.|Q7Z591;Q7Z591-2	.|AKNA_HUMAN;.	.|Y	-1|1228;173;1228;688;1147	.|ENSP00000303769:S1228Y;ENSP00000363192:S173Y;ENSP00000363201:S1228Y;ENSP00000223791:S688Y;ENSP00000363188:S1147Y	.|ENSP00000223791:S688Y	.|S	-|-	.|2	.|0	AKNA|AKNA	116145883|116145883	0.944000|0.944000	0.32072|0.32072	0.099000|0.099000	0.21106|0.21106	0.025000|0.025000	0.11179|0.11179	1.574000|1.574000	0.36482|0.36482	0.689000|0.689000	0.31550|0.31550	0.650000|0.650000	0.86243|0.86243	.|TCC		0.522	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2		NM_030767	
SLC35G5	83650	broad.mit.edu;hgsc.bcm.edu	37	8	11188632	11188632	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:11188632C>A	ENST00000382435.4	+	1	236	c.17C>A	c.(16-18)cCc>cAc	p.P6H		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	6						integral component of membrane (GO:0016021)		p.P6H(1)									GGCAGTCACCCCTACTTCAAC	0.642																																																	1	Substitution - Missense(1)	kidney(1)											46.0	47.0	47.0					8																	11188632		2202	4298	6500	SO:0001583	missense	0			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.17C>A	8.37:g.11188632C>A	ENSP00000371872:p.Pro6His	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.336636	0.41398	.	.	ENSG00000177710	ENST00000382435	T	0.37058	1.22	0.34	0.34	0.15985	.	0.155085	0.30093	N	0.010435	T	0.39145	0.1067	N	0.24115	0.695	0.26545	N	0.974001	D	0.89917	1.0	D	0.85130	0.997	T	0.14587	-1.0467	9	0.72032	D	0.01	-11.4858	.	.	.	.	6	Q96KT7	S35G5_HUMAN	H	6	ENSP00000371872:P6H	ENSP00000371872:P6H	P	+	2	0	SLC35G5	11226042	0.597000	0.26874	0.979000	0.43373	0.354000	0.29330	0.657000	0.24963	0.426000	0.26116	0.089000	0.15464	CCC		0.642	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2		NM_054028	
ANGPTL3	27329	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	63063407	63063407	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:63063407T>A	ENST00000371129.3	+	1	250	c.170T>A	c.(169-171)cTt>cAt	p.L57H	DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000251157.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	57					acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)	p.L57H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						GGACATGGTCTTAAAGACTTT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											73.0	73.0	73.0					1																	63063407		2203	4300	6503	SO:0001583	missense	27329			AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.170T>A	1.37:g.63063407T>A	ENSP00000360170:p.Leu57His	Somatic		WXS	Illumina HiSeq	Phase_I	A0JLS0|B1ALJ0|B2RCW1	Missense_Mutation	SNP	ENST00000371129.3	37	CCDS622.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.452722	0.84209	.	.	ENSG00000132855	ENST00000371129	T	0.68181	-0.31	6.02	6.02	0.97574	.	0.132257	0.50627	D	0.000102	T	0.78220	0.4249	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.81376	-0.0961	10	0.87932	D	0	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	57	Q9Y5C1	ANGL3_HUMAN	H	57	ENSP00000360170:L57H	ENSP00000360170:L57H	L	+	2	0	ANGPTL3	62835995	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.698000	0.84413	2.299000	0.77371	0.528000	0.53228	CTT		0.358	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1		NM_014495	
ANKRD36B	57730	hgsc.bcm.edu	37	2	98165911	98165912	+	RNA	INS	-	-	C	rs1839230|rs112877086	byFrequency	TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr2:98165911_98165912insC	ENST00000443455.1	-	0	1557_1558							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		ATCCTTTTTTTCTCTGGCTATA	0.307																																																	0																																												57730			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98165912_98165912dupC		Somatic		WXS	Illumina HiSeq	Phase_I	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	Frame_Shift_Ins	INS	ENST00000443455.1	37																																																																																					0.307	ANKRD36B-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000328967.2		NM_025190	
ANKS1B	56899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	99793525	99793525	+	Missense_Mutation	SNP	T	T	C	rs560515400		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr12:99793525T>C	ENST00000547776.2	-	12	1639	c.1640A>G	c.(1639-1641)tAt>tGt	p.Y547C	ANKS1B_ENST00000329257.7_Missense_Mutation_p.Y547C|ANKS1B_ENST00000547010.1_Missense_Mutation_p.Y127C	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	547						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)	p.Y547C(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GATTTCAAAATATTCTTGGTT	0.418													T|||	1	0.000199681	0.0	0.0	5008	,	,		16303	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											180.0	198.0	192.0					12																	99793525		1895	4116	6011	SO:0001583	missense	56899			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1640A>G	12.37:g.99793525T>C	ENSP00000449629:p.Tyr547Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.293890	0.60086	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.61040	0.95;0.14;0.95;0.87	5.73	5.73	0.89815	.	0.281820	0.30920	N	0.008603	T	0.58666	0.2138	L	0.36672	1.1	0.80722	D	1	D;D;P	0.61697	0.99;0.969;0.947	P;P;B	0.53593	0.726;0.73;0.339	T	0.57046	-0.7878	9	.	.	.	-10.5233	13.5328	0.61631	0.0:0.0:0.0:1.0	.	513;127;547	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	C	547;127;547;126;513	ENSP00000449629:Y547C;ENSP00000448512:Y127C;ENSP00000331381:Y547C;ENSP00000449894:Y513C	.	Y	-	2	0	ANKS1B	98317656	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.708000	0.54845	2.184000	0.69523	0.477000	0.44152	TAT		0.418	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3		NM_020140	
ARL13A	392509	hgsc.bcm.edu	37	X	100240888	100240889	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chrX:100240888_100240889insG	ENST00000450049.2	+	4	476_477	c.363_364insG	c.(364-366)gggfs	p.G122fs		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	122					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						AAAGAGTGGCAGGGAAACCCAT	0.446																																																	0																																										SO:0001589	frameshift_variant	392509				CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.366dupG	X.37:g.100240891_100240891dupG	ENSP00000398637:p.Gly122fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTT6|B4DX50	Frame_Shift_Ins	INS	ENST00000450049.2	37	CCDS55463.1																																																																																				0.446	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000057504.2		XM_373358	
ATXN2L	11273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	28841977	28841977	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr16:28841977G>T	ENST00000336783.4	+	9	1243	c.1076G>T	c.(1075-1077)gGt>gTt	p.G359V	ATXN2L_ENST00000340394.8_Missense_Mutation_p.G359V|ATXN2L_ENST00000395547.2_Missense_Mutation_p.G359V|ATXN2L_ENST00000325215.6_Missense_Mutation_p.G359V|ATXN2L_ENST00000570200.1_Missense_Mutation_p.G359V|ATXN2L_ENST00000382686.4_Missense_Mutation_p.G359V|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000564304.1_Missense_Mutation_p.G359V	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	359					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)	p.G359V(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GTCCGGGAAGGTCCCCGGGGA	0.582																																																	2	Substitution - Missense(2)	kidney(2)											43.0	43.0	43.0					16																	28841977		2197	4300	6497	SO:0001583	missense	11273				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1076G>T	16.37:g.28841977G>T	ENSP00000338718:p.Gly359Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	37	CCDS10641.1	.	.	.	.	.	.	.	.	.	.	.	16.07	3.017738	0.54576	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.45668	0.91;0.89;0.9;0.92;0.91	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.49081	0.1536	N	0.17474	0.49	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.76575	0.988;0.988;0.973;0.973;0.988;0.988;0.973;0.988	T	0.38373	-0.9664	10	0.22109	T	0.4	-9.3951	18.8117	0.92059	0.0:0.0:1.0:0.0	.	359;359;359;359;359;359;359;359	Q8WWM7-6;Q8WWM7-5;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;.;ATX2L_HUMAN;.;.;.;.	V	359	ENSP00000341459:G359V;ENSP00000378917:G359V;ENSP00000338718:G359V;ENSP00000372133:G359V;ENSP00000315650:G359V	ENSP00000315650:G359V	G	+	2	0	ATXN2L	28749478	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.889000	0.69766	2.750000	0.94351	0.563000	0.77884	GGT		0.582	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1		NM_007245	
AVIL	10677	hgsc.bcm.edu	37	12	58203422	58203423	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr12:58203422_58203423insC	ENST00000257861.3	-	8	1326_1327	c.896_897insG	c.(895-897)ggafs	p.G299fs	AVIL_ENST00000537081.1_Frame_Shift_Ins_p.G292fs	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	299	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CCTTTGTGGCTCCTTTTCCTTT	0.46																																																	0																																										SO:0001589	frameshift_variant	10677			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.897dupG	12.37:g.58203424_58203424dupC	ENSP00000257861:p.Gly299fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAU7|Q2NKM9	Frame_Shift_Ins	INS	ENST00000257861.3	37	CCDS8959.1																																																																																				0.460	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1		NM_006576	
AXIN2	8313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	63532473	63532473	+	Silent	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr17:63532473G>T	ENST00000375702.5	-	6	2019	c.1911C>A	c.(1909-1911)cgC>cgA	p.R637R	AXIN2_ENST00000307078.5_Silent_p.R702R			Q9Y2T1	AXIN2_HUMAN	axin 2	702					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.R702R(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						CAGCTAGCCTGCGACAGGCCT	0.652									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								1	Substitution - coding silent(1)	kidney(1)											20.0	20.0	20.0					17																	63532473		2203	4299	6502	SO:0001819	synonymous_variant	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1911C>A	17.37:g.63532473G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJ88|Q9H3M6|Q9UH84	Silent	SNP	ENST00000375702.5	37																																																																																					0.652	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1		NM_004655	
BAP1	8314	hgsc.bcm.edu;ucsc.edu	37	3	52439219	52439238	+	Frame_Shift_Del	DEL	GCTGCCTGGAGGCTTCACCA	GCTGCCTGGAGGCTTCACCA	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	GCTGCCTGGAGGCTTCACCA	GCTGCCTGGAGGCTTCACCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:52439219_52439238delGCTGCCTGGAGGCTTCACCA	ENST00000460680.1	-	11	1475_1494	c.1004_1023delTGGTGAAGCCTCCAGGCAGC	c.(1003-1023)gtggtgaagcctccaggcagcfs	p.VVKPPGS335fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.VVKPPGS317fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G340S(1)|p.V335fs*10(1)|p.S341fs*21(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CATTGAGGCTGCTGCCTGGAGGCTTCACCACTAGCTTGGG	0.586			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	3	Deletion - Frameshift(2)|Substitution - Missense(1)	pleura(1)|lung(1)|skin(1)																																								SO:0001589	frameshift_variant	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1004_1023delTGGTGAAGCCTCCAGGCAGC	3.37:g.52439219_52439238delGCTGCCTGGAGGCTTCACCA	ENSP00000417132:p.Val335fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																				0.586	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
ASUN	55726	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	27059272	27059272	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr12:27059272T>A	ENST00000261191.7	-	16	2580	c.2044A>T	c.(2044-2046)Aga>Tga	p.R682*	ASUN_ENST00000539625.1_Nonsense_Mutation_p.R581*	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	682					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R682*(1)									AGTTCAGCTCTGTTATTAACA	0.353																																																	1	Substitution - Nonsense(1)	kidney(1)											133.0	139.0	137.0					12																	27059272		2202	4298	6500	SO:0001587	stop_gained	0			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.2044A>T	12.37:g.27059272T>A	ENSP00000261191:p.Arg682*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Nonsense_Mutation	SNP	ENST00000261191.7	37	CCDS8708.1	.	.	.	.	.	.	.	.	.	.	T	37	6.140797	0.97320	.	.	ENSG00000064102	ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745	.	.	.	5.35	4.13	0.48395	.	0.051495	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-24.13	12.2507	0.54597	0.0:0.0:0.1417:0.8583	.	.	.	.	X	329;682;581;269	.	ENSP00000261191:R682X	R	-	1	2	C12orf11	26950539	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.726000	0.61986	2.179000	0.69175	0.477000	0.44152	AGA		0.353	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1		NM_018164	
SAYSD1	55776	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	39073238	39073238	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:39073238C>G	ENST00000229903.4	-	2	621	c.522G>C	c.(520-522)gaG>gaC	p.E174D	SAYSD1_ENST00000373249.1_Missense_Mutation_p.E107D	NM_018322.1	NP_060792.1	Q9NPB0	SMDC1_HUMAN	SAYSVFN motif domain containing 1	174						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)		p.E174D(1)									TCAACTGTAACTCGCGCTCCA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											103.0	106.0	105.0					6																	39073238		2203	4300	6503	SO:0001583	missense	0			BC022007	CCDS4840.1	6p21.1	2011-12-13	2011-12-13	2011-12-13	ENSG00000112167	ENSG00000112167			21025	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 64"""	C6orf64			Standard	XM_005249222		Approved	FLJ11101	uc003ook.1	Q9NPB0	OTTHUMG00000014641	ENST00000229903.4:c.522G>C	6.37:g.39073238C>G	ENSP00000229903:p.Glu174Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H0D8	Missense_Mutation	SNP	ENST00000229903.4	37	CCDS4840.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126582	0.56721	.	.	ENSG00000112167	ENST00000373249;ENST00000229903	.	.	.	5.75	4.7	0.59300	Uncharacterised domain SAYSvFN (1);	0.000000	0.85682	D	0.000000	T	0.60444	0.2269	L	0.52206	1.635	0.58432	D	0.999998	D	0.71674	0.998	D	0.72982	0.979	T	0.62895	-0.6757	9	0.62326	D	0.03	-27.16	9.9268	0.41496	0.0:0.7936:0.0:0.2064	.	174	Q9NPB0	CF064_HUMAN	D	107;174	.	ENSP00000229903:E174D	E	-	3	2	C6orf64	39181216	0.995000	0.38212	0.968000	0.41197	0.904000	0.53231	2.472000	0.45136	2.720000	0.93068	0.563000	0.77884	GAG		0.532	SAYSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040448.1		NM_018322	
CAND1	55832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	67696132	67696132	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr12:67696132G>T	ENST00000545606.1	+	8	1467	c.1030G>T	c.(1030-1032)Gac>Tac	p.D344Y		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	344	Asp-rich.				cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.D344Y(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TGATGATGATGACATGAGTTG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											200.0	191.0	194.0					12																	67696132		2203	4300	6503	SO:0001583	missense	55832				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1030G>T	12.37:g.67696132G>T	ENSP00000442318:p.Asp344Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656993	0.88154	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047;ENST00000544619	T;T	0.71817	-0.6;-0.6	5.29	5.29	0.74685	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88779	0.6529	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	D	0.91341	0.5097	9	.	.	.	-11.0003	19.3152	0.94208	0.0:0.0:1.0:0.0	.	344;344	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	Y	344;344;186;52	ENSP00000442318:D344Y;ENSP00000444089:D52Y	.	D	+	1	0	CAND1	65982399	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.779000	0.99018	2.648000	0.89879	0.563000	0.77884	GAC		0.393	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1		NM_018448	
CAPN6	827	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	110491970	110491970	+	Silent	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chrX:110491970G>A	ENST00000324068.1	-	10	1478	c.1311C>T	c.(1309-1311)caC>caT	p.H437H	CAPN6_ENST00000541758.1_Silent_p.H182H	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	437	Domain III.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.H437H(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						TGTAGAGGTGGTGGAGGCGGA	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											105.0	93.0	97.0					X																	110491970		2203	4300	6503	SO:0001819	synonymous_variant	827			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1311C>T	X.37:g.110491970G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DUY7|Q9UEQ1|Q9UJA8	Silent	SNP	ENST00000324068.1	37	CCDS14555.1																																																																																				0.448	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			
CCDC33	80125	broad.mit.edu;ucsc.edu	37	15	74622668	74622668	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr15:74622668G>A	ENST00000398814.3	+	12	1860	c.1429G>A	c.(1429-1431)Ggc>Agc	p.G477S	CCDC33_ENST00000558821.1_Missense_Mutation_p.G70S|CCDC33_ENST00000321288.5_Missense_Mutation_p.G680S|CCDC33_ENST00000268082.4_Missense_Mutation_p.G70S	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	680								p.G477S(1)|p.G70S(1)|p.G680S(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGAGGGGCAGGGCAAAGCCAG	0.642																																																	3	Substitution - Missense(3)	kidney(3)											32.0	43.0	39.0					15																	74622668		2046	4186	6232	SO:0001583	missense	80125			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1429G>A	15.37:g.74622668G>A	ENSP00000381795:p.Gly477Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	ENST00000398814.3	37	CCDS42058.1	.	.	.	.	.	.	.	.	.	.	G	4.872	0.162004	0.09287	.	.	ENSG00000140481	ENST00000321288;ENST00000398814;ENST00000321374;ENST00000268082	T;T;T;T	0.34072	1.38;2.46;2.09;2.09	4.62	1.03	0.20045	.	1.809800	0.02379	N	0.078623	T	0.19485	0.0468	N	0.17082	0.46	0.09310	N	1	B;B;B;B	0.14438	0.008;0.01;0.005;0.008	B;B;B;B	0.17433	0.013;0.018;0.006;0.003	T	0.17258	-1.0375	10	0.02654	T	1	.	3.4978	0.07661	0.2837:0.0:0.5259:0.1904	.	70;70;680;477	Q8N5R6-4;Q8N5R6-5;C9JFX2;Q8N5R6-6	.;.;.;.	S	680;477;70;70	ENSP00000325012:G680S;ENSP00000381795:G477S;ENSP00000325661:G70S;ENSP00000268082:G70S	ENSP00000268082:G70S	G	+	1	0	CCDC33	72409721	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	0.472000	0.22116	0.345000	0.23873	0.643000	0.83706	GGC		0.642	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2		NM_182791	
CDH2	1000	broad.mit.edu;ucsc.edu	37	18	25591824	25591824	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr18:25591824G>A	ENST00000269141.3	-	4	955	c.532C>T	c.(532-534)Caa>Taa	p.Q178*	CDH2_ENST00000399380.3_Nonsense_Mutation_p.Q147*	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	178	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.Q178*(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ACAAGCTCTTGAGGAAAAGGT	0.398																																																	1	Substitution - Nonsense(1)	kidney(1)											148.0	141.0	144.0					18																	25591824		2203	4300	6503	SO:0001587	stop_gained	1000			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.532C>T	18.37:g.25591824G>A	ENSP00000269141:p.Gln178*	Somatic		WXS	Illumina GAIIx	Phase_I	A8MWK3|B0YIY6|Q14923|Q8N173	Nonsense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767298	0.90020	.	.	ENSG00000170558	ENST00000269141;ENST00000399380;ENST00000418492;ENST00000430882	.	.	.	5.93	5.93	0.95920	.	0.053328	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	X	178;147;127;93	.	ENSP00000269141:Q178X	Q	-	1	0	CDH2	23845822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.509000	0.81698	2.826000	0.97356	0.655000	0.94253	CAA		0.398	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3		NM_001792	
CEACAM5	1048	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	42221409	42221409	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:42221409T>G	ENST00000221992.6	+	5	1108	c.994T>G	c.(994-996)Tcc>Gcc	p.S332A	CEACAM5_ENST00000398599.4_Missense_Mutation_p.S331A|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Missense_Mutation_p.S332A	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	332	Ig-like 4.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.S332A(1)		breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CAGCAACAACTCCAACCCCGT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											145.0	147.0	146.0					19																	42221409		2203	4300	6503	SO:0001583	missense	1048			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.994T>G	19.37:g.42221409T>G	ENSP00000221992:p.Ser332Ala	Somatic		WXS	Illumina HiSeq	Phase_I	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.22|11.22	1.573716|1.573716	0.28092|0.28092	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816	.|T;T	.|0.50001	.|0.76;0.76	2.77|2.77	-1.41|-1.41	0.08941|0.08941	.|Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.62684|0.62684	0.2448|0.2448	M|M	0.85542|0.85542	2.76|2.76	0.09310|0.09310	N|N	1|1	.|D;B	.|0.69078	.|0.997;0.103	.|D;B	.|0.77557	.|0.99;0.153	T|T	0.51568|0.51568	-0.8689|-0.8689	5|9	.|0.45353	.|T	.|0.12	.|.	2.468|2.468	0.04557|0.04557	0.2135:0.2896:0.0:0.4968|0.2135:0.2896:0.0:0.4968	.|.	.|332;332	.|P06731;Q53G30	.|CEAM5_HUMAN;.	R|A	327|332	.|ENSP00000221992:S332A;ENSP00000385072:S332A	.|ENSP00000221992:S332A	L|S	+|+	2|1	0|0	CEACAM5|CEACAM5	46913249|46913249	0.001000|0.001000	0.12720|0.12720	0.021000|0.021000	0.16686|0.16686	0.189000|0.189000	0.23516|0.23516	0.023000|0.023000	0.13533|0.13533	-0.545000|-0.545000	0.06224|0.06224	0.392000|0.392000	0.25879|0.25879	CTC|TCC		0.522	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2		NM_004363	
COL16A1	1307	broad.mit.edu;hgsc.bcm.edu	37	1	32149718	32149718	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:32149718C>T	ENST00000373672.3	-	32	2791	c.2275G>A	c.(2275-2277)Ggt>Agt	p.G759S	COL16A1_ENST00000271069.6_Missense_Mutation_p.G758S|COL16A1_ENST00000373668.3_Missense_Mutation_p.G759S	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	759	Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.G759S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		ACGGGTTTACCAGGTCGGCCC	0.692																																					Colon(143;498 1786 21362 25193 36625)												1	Substitution - Missense(1)	kidney(1)											21.0	28.0	26.0					1																	32149718		2022	4160	6182	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2275G>A	1.37:g.32149718C>T	ENSP00000362776:p.Gly759Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366593	0.61513	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	D;D;D	0.97888	-4.59;-4.59;-4.59	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.99045	0.9673	H	0.95004	3.61	0.49483	D	0.999798	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.99226	1.0880	10	0.66056	D	0.02	.	15.1286	0.72503	0.0:1.0:0.0:0.0	.	759;759;759	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	S	759;758;759	ENSP00000362776:G759S;ENSP00000271069:G758S;ENSP00000362772:G759S	ENSP00000271069:G758S	G	-	1	0	COL16A1	31922305	0.950000	0.32346	0.837000	0.33122	0.258000	0.26162	5.346000	0.65992	2.724000	0.93272	0.491000	0.48974	GGT		0.692	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2		NM_001856	
COL8A1	1295	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	99513362	99513362	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:99513362G>A	ENST00000261037.3	+	5	997	c.617G>A	c.(616-618)gGc>gAc	p.G206D	COL8A1_ENST00000273342.4_Missense_Mutation_p.G206D	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	206	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)		p.G206D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						GGACTTCCTGGCATTGGGAAG	0.592																																																	1	Substitution - Missense(1)	kidney(1)											50.0	53.0	52.0					3																	99513362		2202	4300	6502	SO:0001583	missense	1295			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.617G>A	3.37:g.99513362G>A	ENSP00000261037:p.Gly206Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970859	0.53614	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.99353	-5.77;-5.77	5.37	5.37	0.77165	.	0.048139	0.85682	D	0.000000	D	0.99651	0.9871	H	0.97611	4.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.97593	1.0118	10	0.72032	D	0.01	.	16.5979	0.84801	0.0:0.0:1.0:0.0	.	207;206	E7EPK9;P27658	.;CO8A1_HUMAN	D	206	ENSP00000261037:G206D;ENSP00000273342:G206D	ENSP00000261037:G206D	G	+	2	0	COL8A1	100996052	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.858000	0.86971	2.511000	0.84671	0.655000	0.94253	GGC		0.592	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1		NM_001850	
CYB5B	80777	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	69481136	69481138	+	Missense_Mutation	TNP	TGC	TGC	AAT	rs199873890		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T|G|C	T|G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr16:69481136_69481138TGC>AAT	ENST00000512062.1	+	2	417_419	c.246_248TGC>AAT	c.(244-249)gaTGCc>gaAATc	p.82_83DA>EI	CYB5B_ENST00000515314.1_Missense_Mutation_p.82_83DA>EI|CYB5B_ENST00000307892.8_Missense_Mutation_p.86_87DA>EI|CYB5B_ENST00000561792.1_Missense_Mutation_p.82_83DA>EI			O43169	CYB5B_HUMAN	cytochrome b5 type B (outer mitochondrial membrane)	82	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	heme binding (GO:0020037)|metal ion binding (GO:0046872)	p.D86E(1)|p.A87V(1)|p.A87T(1)		endometrium(3)|kidney(3)|lung(2)	8		Ovarian(137;0.101)				ACTCTTCTGATGCCAGAGAAATG	0.443																																																	3	Substitution - Missense(3)	kidney(3)																																								SO:0001583	missense	80777				CCDS10880.2	16q22.1	2006-02-02			ENSG00000103018	ENSG00000103018			24374	protein-coding gene	gene with protein product		611964				11867265, 14733950	Standard	NM_030579		Approved	CYB5-M	uc002exg.1	O43169	OTTHUMG00000133020	ENST00000512062.1:c.246_248TGC>AAT	16.37:g.69481136TGC>AAT	ENSP00000423679:p.D82_A83delinsEI	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6B1|Q96CC3|Q9BT35	Missense_Mutation	SNP	ENST00000512062.1	37																																																																																					0.443	CYB5B-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256606.2		NM_030579	
CYP2D7	1564	broad.mit.edu	37	22	42538870	42538870	+	RNA	SNP	A	A	C	rs2982057	byFrequency	TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr22:42538870A>C	ENST00000428786.1	-	0	0				CYP2D7P1_ENST00000424775.1_RNA|CYP2D7P1_ENST00000358097.4_RNA|CYP2D7P1_ENST00000433992.1_RNA																							CCATAGCGCGACAGGAACACC	0.687													N|||	80	0.0159744	0.0023	0.0317	5008	,	,		11900	0.0109		0.0348	False		,,,				2504	0.0092																0																																												1564																															22.37:g.42538870A>C		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000428786.1	37		30	0.013736263736263736	1	0.0020325203252032522	5	0.013812154696132596	5	0.008741258741258742	19	0.025065963060686015	C	8.846	0.943329	0.18281	.	.	ENSG00000205702	ENST00000428297;ENST00000381321;ENST00000436260	.	.	.	3.26	3.26	0.37387	.	.	.	.	.	T	0.04724	0.0128	.	.	.	0.28613	N	0.908552	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23154	-1.0196	7	0.02654	T	1	.	8.0614	0.30635	0.2422:0.7578:0.0:0.0	rs2982057	122;32	Q6XP50;F5H167	.;.	A	121;71;32	.	ENSP00000446103:S71A	S	-	1	0	CYP2D7P1	40868814	0.299000	0.24426	0.017000	0.16124	0.002000	0.02628	0.565000	0.23578	0.961000	0.38030	-0.290000	0.09829	TCG		0.687	RP4-669P10.16-001	KNOWN	basic|exp_conf	sense_intronic	sense_intronic	OTTHUMT00000320534.1			
DCTPP1	79077	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	30435760	30435760	+	Silent	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr16:30435760G>A	ENST00000319285.4	-	3	401	c.307C>T	c.(307-309)Ctg>Ttg	p.L103L	DCTPP1_ENST00000568434.1_5'UTR|ZNF771_ENST00000566625.1_Intron|DCTPP1_ENST00000568973.1_5'UTR|DCTPP1_ENST00000565758.1_5'UTR|DCTPP1_ENST00000567983.1_Intron	NM_024096.1	NP_077001.1	Q9H773	DCTP1_HUMAN	dCTP pyrophosphatase 1	103					nucleoside triphosphate catabolic process (GO:0009143)|protein homotetramerization (GO:0051289)	cytosol (GO:0005829)	dCTP diphosphatase activity (GO:0047840)|magnesium ion binding (GO:0000287)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|pyrimidine deoxyribonucleotide binding (GO:0032556)	p.L103L(1)		kidney(1)|large_intestine(3)|upper_aerodigestive_tract(1)	5						AATGCCACCAGGTAGATGAGG	0.622																																																	1	Substitution - coding silent(1)	kidney(1)											61.0	55.0	57.0					16																	30435760		2197	4300	6497	SO:0001819	synonymous_variant	79077			BC001344	CCDS10680.1	16p11.2	2009-02-11			ENSG00000179958	ENSG00000179958	3.6.1.12		28777	protein-coding gene	gene with protein product	"""XTP3-transactivated protein A"""	615840				15740738	Standard	NM_024096		Approved	MGC5627, RS21C6, CDA03, XTP3TPA	uc002dyf.3	Q9H773	OTTHUMG00000132416	ENST00000319285.4:c.307C>T	16.37:g.30435760G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000319285.4	37	CCDS10680.1																																																																																				0.622	DCTPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255553.2		NM_024096	
DEC1	50514	broad.mit.edu;hgsc.bcm.edu	37	9	118163493	118163493	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr9:118163493A>G	ENST00000374016.1	+	7	628	c.109A>G	c.(109-111)Aga>Gga	p.R37G		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	37					negative regulation of cell proliferation (GO:0008285)			p.R37G(1)		kidney(1)|large_intestine(1)|ovary(1)	3						TGCCCTGCACAGAGAGAGGTC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											118.0	119.0	119.0					9																	118163493		2203	4300	6503	SO:0001583	missense	50514			AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.109A>G	9.37:g.118163493A>G	ENSP00000363128:p.Arg37Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000374016.1	37	CCDS6812.1	.	.	.	.	.	.	.	.	.	.	A	3.734	-0.055012	0.07362	.	.	ENSG00000173077	ENST00000374016	T	0.58358	0.34	3.57	-5.35	0.02697	.	.	.	.	.	T	0.31451	0.0797	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.29305	-1.0016	8	0.87932	D	0	.	0.1376	0.00080	0.283:0.259:0.196:0.2621	.	37	Q9P2X7	DEC1_HUMAN	G	37	ENSP00000363128:R37G	ENSP00000363128:R37G	R	+	1	2	DEC1	117203314	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.922000	0.04004	-1.271000	0.02430	-1.292000	0.01352	AGA		0.473	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053791.1		NM_017418	
DENND3	22898	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	142178354	142178354	+	Silent	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:142178354C>A	ENST00000262585.2	+	13	2043	c.1765C>A	c.(1765-1767)Cgg>Agg	p.R589R	DENND3_ENST00000519811.1_Silent_p.R669R|DENND3_ENST00000424248.1_Silent_p.R537R	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	589					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R589R(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			AACAGACATACGGATCTTTCC	0.557																																																	1	Substitution - coding silent(1)	kidney(1)											99.0	103.0	102.0					8																	142178354		2203	4300	6503	SO:0001819	synonymous_variant	22898			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1765C>A	8.37:g.142178354C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	2.871	-0.233885	0.05983	.	.	ENSG00000105339	ENST00000518668	.	.	.	5.56	-10.1	0.00402	.	.	.	.	.	T	0.27765	0.0683	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33624	-0.9861	4	.	.	.	-14.9305	11.0772	0.48038	0.5438:0.2152:0.2409:0.0	.	.	.	.	K	593	.	.	T	+	2	0	DENND3	142247536	0.000000	0.05858	0.000000	0.03702	0.470000	0.32858	-0.498000	0.06420	-1.381000	0.02112	-0.467000	0.05162	ACG		0.557	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_014957	
EBPL	84650	broad.mit.edu;hgsc.bcm.edu	37	13	50243946	50243947	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr13:50243946_50243947CG>TT	ENST00000242827.6	-	2	257_258	c.207_208CG>AA	c.(205-210)aaCGtt>aaAAtt	p.69_70NV>KI	EBPL_ENST00000378282.5_Missense_Mutation_p.69_70NV>KI|EBPL_ENST00000378270.5_Intron|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378284.2_Missense_Mutation_p.69_70NV>KI|EBPL_ENST00000378272.5_Missense_Mutation_p.69_70NV>KI|EBPL_ENST00000378268.1_Missense_Mutation_p.69_70NV>KI	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	69					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.N69K(1)|p.N69>?(1)|p.V70I(1)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		GAATTTGCAACGTTTCCTACTA	0.401											OREG0022412	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(39;857 1083 36109 42364 51411)												3	Substitution - Missense(2)|Complex(1)	kidney(3)																																								SO:0001583	missense	84650			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.207_208delinsTT	13.37:g.50243946_50243947delinsTT	ENSP00000242827:p.N69_V70delinsKI	Somatic	968	WXS	Illumina HiSeq	Phase_I	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1																																																																																				0.401	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2		NM_032565	
EFCAB5	374786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	28384816	28384816	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr17:28384816G>C	ENST00000394835.3	+	13	2680	c.2488G>C	c.(2488-2490)Gac>Cac	p.D830H	EFCAB5_ENST00000378738.3_Missense_Mutation_p.D830H|RNY4P13_ENST00000384284.1_RNA|EFCAB5_ENST00000320856.5_Intron|EFCAB5_ENST00000536908.2_Missense_Mutation_p.D774H|EFCAB5_ENST00000541045.1_Missense_Mutation_p.D487H|AC104984.4_ENST00000583250.1_RNA|EFCAB5_ENST00000394832.2_Missense_Mutation_p.D830H	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	830							calcium ion binding (GO:0005509)	p.D830H(1)		breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TGTTGGTGAAGACGCTCCCTT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											123.0	115.0	117.0					17																	28384816		1861	4098	5959	SO:0001583	missense	374786			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2488G>C	17.37:g.28384816G>C	ENSP00000378312:p.Asp830His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	37	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	G	15.96	2.987768	0.53934	.	.	ENSG00000176927	ENST00000536908;ENST00000541045;ENST00000394835;ENST00000394832;ENST00000378738;ENST00000423598	T;T;T;T;T	0.52754	1.66;0.65;2.8;2.06;1.73	5.51	5.51	0.81932	.	.	.	.	.	T	0.64972	0.2647	L	0.55103	1.725	0.33111	D	0.540466	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.73380	0.956;0.98;0.98;0.98	T	0.70887	-0.4750	9	0.52906	T	0.07	-21.3082	17.2709	0.87102	0.0:0.0:1.0:0.0	.	774;774;830;830	B4DS75;F5GYL2;B5MEA3;A4FU69	.;.;.;EFCB5_HUMAN	H	774;487;830;830;830;774	ENSP00000440619:D774H;ENSP00000445575:D487H;ENSP00000378312:D830H;ENSP00000378309:D830H;ENSP00000368012:D830H	ENSP00000368012:D830H	D	+	1	0	EFCAB5	25408942	1.000000	0.71417	0.996000	0.52242	0.900000	0.52787	6.105000	0.71505	2.736000	0.93811	0.655000	0.94253	GAC		0.443	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4		NM_198529	
EPHA7	2045	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	93964470	93964470	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:93964470C>A	ENST00000369303.4	-	14	2611	c.2427G>T	c.(2425-2427)caG>caT	p.Q809H		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	809	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.Q809H(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ATTTCCGGTACTGGATGGCTT	0.363																																																	1	Substitution - Missense(1)	kidney(1)											128.0	110.0	116.0					6																	93964470		2203	4300	6503	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2427G>T	6.37:g.93964470C>A	ENSP00000358309:p.Gln809His	Somatic		WXS	Illumina HiSeq	Phase_I	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947516	0.73672	.	.	ENSG00000135333	ENST00000369303	D	0.83075	-1.68	5.51	-8.02	0.01118	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76292	0.3967	N	0.16201	0.385	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	P;D;D	0.91635	0.688;0.999;0.999	T	0.82335	-0.0508	10	0.87932	D	0	.	21.385	0.99952	0.0:0.7164:0.0:0.2836	.	805;804;809	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	H	809	ENSP00000358309:Q809H	ENSP00000358309:Q809H	Q	-	3	2	EPHA7	94021191	0.023000	0.18921	0.739000	0.30968	0.991000	0.79684	-0.749000	0.04813	-1.565000	0.01676	-0.302000	0.09304	CAG		0.363	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			
FBXL18	80028	broad.mit.edu;ucsc.edu	37	7	5541300	5541300	+	Silent	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr7:5541300G>A	ENST00000382368.3	-	3	723	c.600C>T	c.(598-600)taC>taT	p.Y200Y	FBXL18_ENST00000453700.3_Silent_p.Y200Y	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	200								p.Y200Y(2)	FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GAATCTCGAAGTAGAGCAGCA	0.647																																																	2	Substitution - coding silent(2)	kidney(2)											21.0	26.0	24.0					7																	5541300		2056	4209	6265	SO:0001819	synonymous_variant	80028			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.600C>T	7.37:g.5541300G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q9BR90|Q9BTC7|Q9HAK7	Silent	SNP	ENST00000382368.3	37	CCDS43546.1	.	.	.	.	.	.	.	.	.	.	G	6.605	0.480032	0.12581	.	.	ENSG00000155034	ENST00000458142	.	.	.	5.4	4.32	0.51571	.	.	.	.	.	T	0.64182	0.2575	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62115	-0.6922	4	.	.	.	.	12.9446	0.58365	0.1351:0.0:0.8649:0.0	.	.	.	.	I	84	.	.	T	-	2	0	FBXL18	5507826	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.138000	0.31491	2.528000	0.85240	0.655000	0.94253	ACT		0.647	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1		NM_024963	
FCGBP	8857	broad.mit.edu	37	19	40376319	40376319	+	Silent	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:40376319G>A	ENST00000221347.6	-	25	11992	c.11985C>T	c.(11983-11985)taC>taT	p.Y3995Y	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3995	Cys-rich.					extracellular vesicular exosome (GO:0070062)		p.Y3995Y(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTACCTCATAGTAGACACCAT	0.547																																																	1	Substitution - coding silent(1)	kidney(1)											61.0	56.0	57.0					19																	40376319		2199	4300	6499	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11985C>T	19.37:g.40376319G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.547	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1		NM_003890	
FETUB	26998	broad.mit.edu;ucsc.edu	37	3	186364117	186364117	+	Silent	SNP	A	A	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:186364117A>T	ENST00000265029.3	+	5	776	c.675A>T	c.(673-675)tcA>tcT	p.S225S	FETUB_ENST00000450521.1_Silent_p.S225S|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382134.3_Silent_p.S160S|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000382136.3_Silent_p.S188S|FETUB_ENST00000539949.1_Silent_p.S77S	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	225	Cystatin fetuin-B-type 2. {ECO:0000255|PROSITE-ProRule:PRU00862}.				binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)	p.S225S(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		GCAGCTGTTCACTTCAGTCCT	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											143.0	148.0	146.0					3																	186364117		2203	4300	6503	SO:0001819	synonymous_variant	26998			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.675A>T	3.37:g.186364117A>T		Somatic		WXS	Illumina GAIIx	Phase_I	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Silent	SNP	ENST00000265029.3	37	CCDS3279.1																																																																																				0.413	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1		NM_014375	
GNS	2799	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	65136922	65136922	+	Splice_Site	SNP	G	G	A	rs575544204		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr12:65136922G>A	ENST00000258145.3	-	6	961	c.791C>T	c.(790-792)aCg>aTg	p.T264M	GNS_ENST00000543646.1_Splice_Site_p.T296M|GNS_ENST00000542058.1_Splice_Site_p.T244M|GNS_ENST00000418919.2_Splice_Site_p.T208M	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	264					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)	p.T264M(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		GGAAGCTACCGTTCCATGGAT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											217.0	208.0	211.0					12																	65136922		2203	4300	6503	SO:0001630	splice_region_variant	2799				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.792+1C>T	12.37:g.65136922G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DYH8|Q53F05	Missense_Mutation	SNP	ENST00000258145.3	37	CCDS8970.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370620	0.24771	.	.	ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825;ENST00000545471;ENST00000545273	D;D;D;D;D	0.99894	-4.6;-5.0;-4.63;-4.69;-7.58	5.47	-2.11	0.07187	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.358195	0.33732	N	0.004610	D	0.99130	0.9700	L	0.52126	1.63	0.33785	D	0.624746	B;B;B;B	0.24426	0.103;0.012;0.042;0.003	B;B;B;B	0.28011	0.085;0.013;0.046;0.003	D	0.99987	1.3452	9	.	.	.	-7.6662	5.1105	0.14806	0.4032:0.0:0.3582:0.2385	.	244;296;264;208	B4DYH8;F6S8M0;P15586;Q7Z3X3	.;.;GNS_HUMAN;.	M	208;264;296;244;181;201;188	ENSP00000413130:T208M;ENSP00000258145:T264M;ENSP00000438497:T296M;ENSP00000444819:T244M;ENSP00000445055:T188M	.	T	-	2	0	GNS	63423189	1.000000	0.71417	0.994000	0.49952	0.677000	0.39632	1.659000	0.37387	-0.132000	0.11557	-1.073000	0.02249	ACG		0.458	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401195.2			Missense_Mutation
TNIP1	10318	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	150407548	150407548	+	IGR	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr5:150407548C>A	ENST00000389378.2	-	0	3268				GPX3_ENST00000388825.4_Missense_Mutation_p.R180S|GPX3_ENST00000517973.1_3'UTR	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1						defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.R180S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCACGACATCCGCTGGAACTT	0.567																																																	1	Substitution - Missense(1)	kidney(1)											55.0	57.0	56.0					5																	150407548		2031	4218	6249	SO:0001628	intergenic_variant	2878			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025			5.37:g.150407548C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	CCDS34280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.20|15.20	2.761744|2.761744	0.49468|0.49468	.|.	.|.	ENSG00000211445|ENSG00000211445	ENST00000521632|ENST00000388825	.|T	.|0.03982	.|3.74	5.33|5.33	4.47|4.47	0.54385|0.54385	.|Thioredoxin-like fold (2);	.|0.124148	.|0.50627	.|D	.|0.000119	T|T	0.11067|0.11067	0.0270|0.0270	L|L	0.45285|0.45285	1.41|1.41	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.66084	.|0.941	T|T	0.13150|0.13150	-1.0520|-1.0520	5|10	.|0.34782	.|T	.|0.22	.|.	7.4921|7.4921	0.27469|0.27469	0.2749:0.6417:0.0:0.0834|0.2749:0.6417:0.0:0.0834	.|.	.|180	.|P22352	.|GPX3_HUMAN	Q|S	116|180	.|ENSP00000373477:R180S	.|ENSP00000373477:R180S	P|R	+|+	2|1	0|0	GPX3|GPX3	150387741|150387741	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	3.913000|3.913000	0.56394|0.56394	1.242000|1.242000	0.43836|0.43836	-0.136000|-0.136000	0.14681|0.14681	CCG|CGC		0.567	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1		NM_006058	
GRAMD1A	57655	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	35501023	35501023	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:35501023T>G	ENST00000317991.5	+	5	545	c.353T>G	c.(352-354)aTc>aGc	p.I118S	GRAMD1A_ENST00000598073.1_3'UTR|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.I205S|GRAMD1A_ENST00000504615.2_De_novo_Start_OutOfFrame|GRAMD1A_ENST00000424536.2_Missense_Mutation_p.I118S|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.I111S	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	118	GRAM.					integral component of membrane (GO:0016021)		p.I118S(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CAGCGTGAGATCCTGCTCCAG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											87.0	93.0	91.0					19																	35501023		1952	4132	6084	SO:0001583	missense	57655			AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.353T>G	19.37:g.35501023T>G	ENSP00000441032:p.Ile118Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.631028	0.87660	.	.	ENSG00000089351	ENST00000453966;ENST00000317991;ENST00000411896	D;D	0.88046	-2.33;-2.33	5.38	5.38	0.77491	GRAM (2);	0.000000	0.85682	D	0.000000	D	0.95236	0.8455	H	0.95328	3.655	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;0.998	D;D;D;D	0.91635	0.988;0.998;0.999;0.991	D	0.96305	0.9224	10	0.87932	D	0	.	13.3999	0.60876	0.0:0.0:0.0:1.0	.	118;118;111;205	Q96CP6-3;Q96CP6;Q96CP6-2;F5GZ02	.;GRM1A_HUMAN;.;.	S	205;118;111	ENSP00000441032:I118S;ENSP00000439267:I111S	ENSP00000441032:I118S	I	+	2	0	GRAMD1A	40192863	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.716000	0.84723	2.254000	0.74563	0.533000	0.62120	ATC		0.657	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1		NM_020895	
GRID1	2894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	87407078	87407078	+	Silent	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr10:87407078G>T	ENST00000327946.7	-	13	2159	c.2074C>A	c.(2074-2076)Cga>Aga	p.R692R	GRID1_ENST00000536331.1_Silent_p.R263R|RP11-93H12.4_ENST00000474115.2_RNA|RN7SKP238_ENST00000516483.1_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	692					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.R692R(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CCCTTGGCTCGGAAGTACTCA	0.552										Multiple Myeloma(13;0.14)																																							1	Substitution - coding silent(1)	kidney(1)											277.0	259.0	265.0					10																	87407078		2203	4300	6503	SO:0001819	synonymous_variant	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2074C>A	10.37:g.87407078G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	CCDS31236.1																																																																																				0.552	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3		XM_043613	
HERC5	51191	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	89385020	89385020	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr4:89385020T>G	ENST00000264350.3	+	6	948	c.795T>G	c.(793-795)ttT>ttG	p.F265L		NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	265					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.F265L(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GGCTGCTGTTTACTTTCGGTG	0.388																																					Esophageal Squamous(39;887 1012 34045 50514)												1	Substitution - Missense(1)	kidney(1)											176.0	158.0	164.0					4																	89385020		2203	4300	6503	SO:0001583	missense	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.795T>G	4.37:g.89385020T>G	ENSP00000264350:p.Phe265Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760532	0.69763	.	.	ENSG00000138646	ENST00000264350	D	0.87571	-2.27	4.85	-0.0555	0.13809	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.091054	0.47852	D	0.000219	D	0.89681	0.6785	M	0.63843	1.955	0.80722	D	1	D	0.63880	0.993	D	0.68483	0.958	D	0.87299	0.2304	10	0.72032	D	0.01	.	8.5037	0.33175	0.0:0.4529:0.0:0.5471	.	265	Q9UII4	HERC5_HUMAN	L	265	ENSP00000264350:F265L	ENSP00000264350:F265L	F	+	3	2	HERC5	89604043	0.953000	0.32496	0.999000	0.59377	0.996000	0.88848	-0.033000	0.12246	0.121000	0.18284	0.528000	0.53228	TTT		0.388	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2		NM_016323	
HPRT1	3251	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	133609298	133609298	+	Missense_Mutation	SNP	C	C	A	rs137852481		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chrX:133609298C>A	ENST00000298556.7	+	3	381	c.222C>A	c.(220-222)ttC>ttA	p.F74L	HPRT1_ENST00000462974.1_3'UTR	NM_000194.2	NP_000185.1	P00492	HPRT_HUMAN	hypoxanthine phosphoribosyltransferase 1	74			F -> L (in LNS; Flint/RJK 892/DW/Perth/ 1522, Japan). {ECO:0000269|PubMed:20544509, ECO:0000269|PubMed:2071157, ECO:0000269|PubMed:2347587, ECO:0000269|PubMed:3384338}.		adenine salvage (GO:0006168)|central nervous system neuron development (GO:0021954)|cerebral cortex neuron differentiation (GO:0021895)|cytolysis (GO:0019835)|dendrite morphogenesis (GO:0048813)|dopamine metabolic process (GO:0042417)|GMP catabolic process (GO:0046038)|GMP salvage (GO:0032263)|grooming behavior (GO:0007625)|guanine salvage (GO:0006178)|hypoxanthine metabolic process (GO:0046100)|hypoxanthine salvage (GO:0043103)|IMP metabolic process (GO:0046040)|IMP salvage (GO:0032264)|locomotory behavior (GO:0007626)|lymphocyte proliferation (GO:0046651)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of dopamine metabolic process (GO:0045964)|protein homotetramerization (GO:0051289)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside salvage (GO:0006166)|purine-containing compound salvage (GO:0043101)|response to amphetamine (GO:0001975)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	guanine phosphoribosyltransferase activity (GO:0052657)|hypoxanthine phosphoribosyltransferase activity (GO:0004422)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)	p.F74L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(192;0.000127)				Azathioprine(DB00993)|Mercaptopurine(DB01033)|Tioguanine(DB00352)	GCTATAAATTCTTTGCTGACC	0.423																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CM890066|CM952438	HPRT1	M	rs137852481						84.0	76.0	79.0					X																	133609298		2203	4300	6503	SO:0001583	missense	3251			M26434	CCDS14641.1	Xq26.2	2012-10-02	2008-08-01		ENSG00000165704	ENSG00000165704	2.4.2.8		5157	protein-coding gene	gene with protein product	"""Lesch-Nyhan syndrome"""	308000		HPRT		12175903	Standard	NM_000194		Approved	HGPRT	uc004exl.4	P00492	OTTHUMG00000022452	ENST00000298556.7:c.222C>A	X.37:g.133609298C>A	ENSP00000298556:p.Phe74Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHF0|B2R8M9	Missense_Mutation	SNP	ENST00000298556.7	37	CCDS14641.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481127	0.63849	.	.	ENSG00000165704	ENST00000298556;ENST00000370796	D	0.99226	-5.59	4.68	2.91	0.33838	Phosphoribosyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.99227	0.9731	M	0.86097	2.795	0.80722	A	1	D	0.76494	0.999	D	0.73708	0.981	D	0.99936	1.1358	9	0.87932	D	0	-14.9482	7.8961	0.29708	0.0:0.7007:0.0:0.2993	.	74	P00492	HPRT_HUMAN	L	74	ENSP00000298556:F74L	ENSP00000298556:F74L	F	+	3	2	HPRT1	133436964	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.301000	0.33447	0.364000	0.24374	-0.208000	0.12717	TTC		0.423	HPRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058361.1		NM_000194	
IDUA	3425	broad.mit.edu	37	4	980873	980873	+	Start_Codon_SNP	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr4:980873A>G	ENST00000247933.4	+	1	89	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	IDUA_ENST00000453894.1_Start_Codon_SNP_p.M1V|SLC26A1_ENST00000398520.2_Intron	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	1					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)	p.M1V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACGCGTGGCCATGCGTCCCCT	0.796																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CM970760	IDUA	M							3.0	4.0	4.0					4																	980873		1173	2450	3623	SO:0001582	initiator_codon_variant	3425			M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1A>G	4.37:g.980873A>G	ENSP00000247933:p.Met1Val	Somatic		WXS	Illumina GAIIx	Phase_I	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.522392	0.44866	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000502910	D;D;D	0.95069	-3.35;-3.6;-3.29	3.19	-2.03	0.07365	.	0.180215	0.33161	N	0.005207	D	0.88142	0.6357	.	.	.	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.75419	-0.3324	9	0.87932	D	0	-2.1425	4.0719	0.09885	0.44:0.4254:0.1346:0.0	.	1;1	B3KWK6;P35475	.;IDUA_HUMAN	V	1	ENSP00000247933:M1V;ENSP00000396458:M1V;ENSP00000422952:M1V	ENSP00000247933:M1V	M	+	1	0	IDUA	970873	0.000000	0.05858	0.093000	0.20910	0.081000	0.17604	-0.801000	0.04550	-0.126000	0.11682	0.260000	0.18958	ATG		0.796	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1		NM_000203	Missense_Mutation
IL16	3603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	81601012	81601012	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr15:81601012C>T	ENST00000302987.4	+	18	3872	c.3872C>T	c.(3871-3873)gCc>gTc	p.A1291V	IL16_ENST00000394660.2_Missense_Mutation_p.A1290V|IL16_ENST00000394652.2_Missense_Mutation_p.A590V|RP11-761I4.4_ENST00000607019.1_RNA			Q14005	IL16_HUMAN	interleukin 16	1291	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A1291V(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GGTGGCACTGCCATGCAGGGC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											99.0	87.0	91.0					15																	81601012		2203	4300	6503	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.3872C>T	15.37:g.81601012C>T	ENSP00000302935:p.Ala1291Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659364	0.47467	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000394652	T;T;T	0.27557	1.66;1.66;1.66	5.3	5.3	0.74995	PDZ/DHR/GLGF (4);	0.456522	0.18631	N	0.135597	T	0.24160	0.0585	L	0.31420	0.93	0.09310	N	1	P;B;B	0.36048	0.534;0.026;0.008	B;B;B	0.38458	0.274;0.056;0.013	T	0.16719	-1.0393	10	0.48119	T	0.1	.	9.0637	0.36449	0.0:0.7742:0.1487:0.0771	.	783;1291;1290	Q6ZTT5;Q14005;Q14005-2	.;IL16_HUMAN;.	V	1290;1122;1291;590	ENSP00000378155:A1290V;ENSP00000302935:A1291V;ENSP00000378147:A590V	ENSP00000302935:A1291V	A	+	2	0	IL16	79388067	0.000000	0.05858	0.343000	0.25615	0.937000	0.57800	0.441000	0.21611	2.462000	0.83206	0.655000	0.94253	GCC		0.522	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1		NM_172217	
INSM2	84684	hgsc.bcm.edu;ucsc.edu	37	14	36005119	36005119	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr14:36005119delA	ENST00000307169.3	+	1	1872	c.1661delA	c.(1660-1662)caafs	p.Q554fs		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	554					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GAAAGCCGGCAAGTGCTGCTG	0.552																																																	0													42.0	45.0	44.0					14																	36005119		2185	4254	6439	SO:0001589	frameshift_variant	84684			AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.1661delA	14.37:g.36005119delA	ENSP00000306523:p.Gln554fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L432|J9Y024|Q8N8K7|Q96Q84	Frame_Shift_Del	DEL	ENST00000307169.3	37	CCDS9657.1																																																																																				0.552	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1			
JMJD7	100137047	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42127085	42127085	+	Missense_Mutation	SNP	A	A	G	rs148006565		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr15:42127085A>G	ENST00000397299.4	+	2	252	c.212A>G	c.(211-213)tAt>tGt	p.Y71C	PLA2G4B_ENST00000542534.2_Missense_Mutation_p.Y71C|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.Y71C|JMJD7_ENST00000408047.1_Intron|PLA2G4B_ENST00000452633.1_5'Flank|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.Y71C	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	71								p.Y71C(3)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						TCCCTCCCCTATTTCAGGTGG	0.622																																																	3	Substitution - Missense(3)	kidney(3)						A	CYS/TYR,CYS/TYR,CYS/TYR	0,4406		0,0,2203	66.0	67.0	67.0		212,212,212	3.6	1.0	15	dbSNP_134	67	1,8599		0,1,4299	no	missense,missense,missense	JMJD7-PLA2G4B,JMJD7	NM_001114632.1,NM_001198588.1,NM_005090.3	194,194,194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	71/317,71/894,71/1013	42127085	1,13005	2203	4300	6503	SO:0001583	missense	100137047				CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.212A>G	15.37:g.42127085A>G	ENSP00000380467:p.Tyr71Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000397299.4	37	CCDS45240.1	.	.	.	.	.	.	.	.	.	.	.	20.7	4.032305	0.75504	0.0	1.16E-4	ENSG00000243789;ENSG00000168970;ENSG00000168970;ENSG00000168970	ENST00000397299;ENST00000542534;ENST00000382448;ENST00000342159	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	4.77	3.63	0.41609	.	0.000000	0.47455	D	0.000231	D	0.87362	0.6158	M	0.92604	3.325	0.80722	D	1	P;D;D	0.89917	0.617;1.0;1.0	B;D;D	0.81914	0.221;0.995;0.989	D	0.88993	0.3416	10	0.87932	D	0	-10.7494	9.7536	0.40490	0.9169:0.0:0.0831:0.0	.	71;71;71	P0C869-7;P0C869-6;P0C870	.;.;JMJD7_HUMAN	C	71	ENSP00000380467:Y71C;ENSP00000441905:Y71C;ENSP00000371886:Y71C;ENSP00000342785:Y71C	ENSP00000380467:Y71C	Y	+	2	0	JMJD7-PLA2G4B;JMJD7	39914377	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.919000	0.70005	1.919000	0.55581	0.533000	0.62120	TAT		0.622	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326082.1		NM_001114632	
KDM6A	7403	hgsc.bcm.edu	37	X	44732886	44732886	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5075-01A-01D-1392-10	TCGA-B0-5075-11A-01D-1392-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0807b5fd-c193-41c9-bc78-015db179bafd	a3072f6e-9882-45f3-a3f6-a4e3fa1d71f2	g.chrX:44732886C>T	ENST00000377967.4	+	1	130	c.89C>T	c.(88-90)gCg>gTg	p.A30V	KDM6A_ENST00000382899.4_Missense_Mutation_p.A30V|KDM6A_ENST00000536777.1_Missense_Mutation_p.A30V|KDM6A_ENST00000543216.1_Missense_Mutation_p.A30V	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	30	Interaction with SUPT6H. {ECO:0000250}.		A -> T (in dbSNP:rs6529).		canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(8)|p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						GCGGGAAAAGCGAGCGGCGAG	0.687			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	14	No detectable mRNA/protein(8)|Whole gene deletion(6)	haematopoietic_and_lymphoid_tissue(6)|oesophagus(4)|breast(2)|pancreas(2)											6.0	8.0	7.0					X																	44732886		2090	4093	6183	SO:0001583	missense	7403			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.89C>T	X.37:g.44732886C>T	ENSP00000367203:p.Ala30Val	Somatic		WXS	Illumina MiSeq	Phase_I	Q52LL9|Q5JVQ7	Missense_Mutation	SNP	ENST00000377967.4	37	CCDS14265.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.896705	0.91962	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000542299	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	3.82	3.82	0.43975	.	0.057844	0.64402	N	0.000002	T	0.73853	0.3640	M	0.70595	2.14	0.58432	D	0.999999	D;P;P;D;P	0.76494	0.999;0.948;0.95;0.999;0.95	D;P;P;D;P	0.76071	0.987;0.637;0.667;0.97;0.667	T	0.78633	-0.2128	10	0.87932	D	0	-4.1103	15.0117	0.71555	0.0:1.0:0.0:0.0	.	30;30;30;30;30	F8W8R6;F5H6S1;B7ZKN5;B4E253;O15550	.;.;.;.;KDM6A_HUMAN	V	30	ENSP00000367203:A30V;ENSP00000437405:A30V;ENSP00000372355:A30V;ENSP00000443078:A30V	ENSP00000367203:A30V	A	+	2	0	KDM6A	44617830	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.458000	0.73509	1.886000	0.54624	0.523000	0.50628	GCG		0.687	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1		NM_021140	
KIAA2018	205717	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	113377055	113377055	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:113377055C>A	ENST00000478658.1	-	5	3491	c.3474G>T	c.(3472-3474)agG>agT	p.R1158S	KIAA2018_ENST00000316407.4_Missense_Mutation_p.R1158S|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1158						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.R1158S(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AAGCAACTTCCCTTATATCAG	0.468																																																	1	Substitution - Missense(1)	kidney(1)											105.0	96.0	99.0					3																	113377055		1882	4111	5993	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3474G>T	3.37:g.113377055C>A	ENSP00000420721:p.Arg1158Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	C	7.904	0.734977	0.15574	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.14766	2.48;2.48	5.43	1.72	0.24424	.	0.335327	0.30809	N	0.008821	T	0.05044	0.0135	N	0.19112	0.55	0.20074	N	0.999938	P	0.35433	0.501	B	0.22386	0.039	T	0.41197	-0.9522	10	0.09338	T	0.73	-5.8388	5.5968	0.17331	0.0:0.5795:0.1306:0.2898	.	1158	Q68DE3	K2018_HUMAN	S	1158	ENSP00000320794:R1158S;ENSP00000420721:R1158S	ENSP00000320794:R1158S	R	-	3	2	KIAA2018	114859745	0.238000	0.23825	0.370000	0.25965	0.952000	0.60782	0.158000	0.16422	0.043000	0.15746	-1.075000	0.02238	AGG		0.468	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1		NM_001009899	
LAMC2	3918	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	183197726	183197726	+	Silent	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:183197726G>A	ENST00000264144.4	+	11	1751	c.1686G>A	c.(1684-1686)ttG>ttA	p.L562L	LAMC2_ENST00000493293.1_Silent_p.L562L	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	562	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.L562L(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						GGGACCCATTGGCTCCCAACC	0.567											OREG0014041	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											91.0	89.0	90.0					1																	183197726		2203	4300	6503	SO:0001819	synonymous_variant	3918			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.1686G>A	1.37:g.183197726G>A		Somatic	1982	WXS	Illumina HiSeq	Phase_I	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Silent	SNP	ENST00000264144.4	37	CCDS1352.1																																																																																				0.567	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1		NM_005562	
LARP1B	55132	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	129043237	129043237	+	Missense_Mutation	SNP	G	G	C	rs142360155		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr4:129043237G>C	ENST00000326639.6	+	11	1629	c.1418G>C	c.(1417-1419)cGg>cCg	p.R473P	LARP1B_ENST00000512292.1_Missense_Mutation_p.R473P|LARP1B_ENST00000264584.5_Missense_Mutation_p.R426P|LARP1B_ENST00000427266.1_Missense_Mutation_p.R473P|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000441387.1_Missense_Mutation_p.R473P	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	473				R -> Q (in Ref. 1; BAC03970). {ECO:0000305}.		nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R473P(2)|p.R473L(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						CACATGTCTCGGGCAAAAATC	0.388																																																	3	Substitution - Missense(3)	kidney(2)|large_intestine(1)											113.0	105.0	108.0					4																	129043237		2203	4300	6503	SO:0001583	missense	55132				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1418G>C	4.37:g.129043237G>C	ENSP00000321997:p.Arg473Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	CCDS3738.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761733	0.31228	.	.	ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000264584;ENST00000441387;ENST00000427266	T;T;T;T;T;T	0.53857	1.11;0.6;0.63;1.17;1.08;0.62	5.09	-1.77	0.07982	.	0.313899	0.34200	N	0.004170	T	0.53400	0.1794	M	0.84326	2.69	0.36025	D	0.839029	B;B;B	0.28439	0.212;0.031;0.008	B;B;B	0.31686	0.134;0.048;0.008	T	0.56673	-0.7940	10	0.72032	D	0.01	.	11.8238	0.52254	0.5243:0.0:0.4757:0.0	.	426;473;473	D6RJB0;Q659C4;G3XAJ5	.;LAR1B_HUMAN;.	P	473;473;426;426;473;473	ENSP00000321997:R473P;ENSP00000422850:R473P;ENSP00000427281:R426P;ENSP00000264584:R426P;ENSP00000396521:R473P;ENSP00000403586:R473P	ENSP00000264584:R426P	R	+	2	0	LARP1B	129262687	0.224000	0.23674	0.036000	0.18154	0.764000	0.43329	0.504000	0.22626	-0.700000	0.05070	0.585000	0.79938	CGG		0.388	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2		NM_018078	
LDHC	3948	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	18460186	18460186	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:18460186delT	ENST00000541669.1	+	6	815	c.704delT	c.(703-705)attfs	p.I235fs	LDHC_ENST00000535809.1_Intron|LDHC_ENST00000536880.1_Frame_Shift_Del_p.I221fs|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000546146.1_Frame_Shift_Del_p.I177fs|LDHC_ENST00000544105.1_Frame_Shift_Del_p.I235fs|LDHC_ENST00000280704.4_Frame_Shift_Del_p.I235fs			P07864	LDHC_HUMAN	lactate dehydrogenase C	235					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAACAAGTTATTCAAAGGTAA	0.358																																																	0													98.0	91.0	93.0					11																	18460186		2199	4293	6492	SO:0001589	frameshift_variant	3948			AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.704delT	11.37:g.18460186delT	ENSP00000437783:p.Ile235fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQY4|Q6GSG8|Q7Z7J4	Frame_Shift_Del	DEL	ENST00000541669.1	37	CCDS7840.1																																																																																				0.358	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1		NM_017448	
LMO4	8543	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	87805218	87805218	+	Splice_Site	SNP	G	G	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:87805218G>C	ENST00000370544.5	+	3	1016		c.e3-1		LMO4_ENST00000370542.1_Splice_Site|LMO4_ENST00000489303.1_Splice_Site	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4						negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		CTTTGTTTCAGGTTATTTGGA	0.448																																																	1	Unknown(1)	kidney(1)											90.0	88.0	88.0					1																	87805218		2203	4300	6503	SO:0001630	splice_region_variant	8543			U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.237-1G>C	1.37:g.87805218G>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DT23|O00158|O88894	Splice_Site	SNP	ENST00000370544.5	37	CCDS713.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911622	0.92178	.	.	ENSG00000143013	ENST00000370544;ENST00000370542	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8737	0.96861	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LMO4	87577806	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.687000	0.91594	0.655000	0.94253	.		0.448	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028264.2		NM_006769	Intron
LPPR4	9890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	99771434	99771434	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:99771434C>G	ENST00000370185.3	+	7	1657	c.1160C>G	c.(1159-1161)aCa>aGa	p.T387R	LPPR4_ENST00000457765.1_Missense_Mutation_p.T329R|LPPR4_ENST00000370184.1_Missense_Mutation_p.T229R	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		387					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.T387R(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AGCTCTCTGACAAATCTCAAA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											73.0	72.0	72.0					1																	99771434		2203	4300	6503	SO:0001583	missense	9890																														ENST00000370185.3:c.1160C>G	1.37:g.99771434C>G	ENSP00000359204:p.Thr387Arg	Somatic		WXS	Illumina HiSeq	Phase_I	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	8.439	0.850456	0.17034	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.22743	2.52;2.53;1.94	5.31	4.4	0.53042	.	0.309946	0.37577	N	0.002033	T	0.16514	0.0397	N	0.22421	0.69	0.50467	D	0.999874	D;B	0.67145	0.996;0.262	P;B	0.62184	0.899;0.096	T	0.03673	-1.1014	9	.	.	.	-15.3639	13.7847	0.63102	0.0:0.9259:0.0:0.0741	.	329;387	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	R	387;329;387;229	ENSP00000359204:T387R;ENSP00000394913:T329R;ENSP00000359203:T229R	.	T	+	2	0	RP4-788L13.1	99544022	1.000000	0.71417	0.969000	0.41365	0.338000	0.28826	3.565000	0.53798	1.223000	0.43536	0.557000	0.71058	ACA		0.478	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			
MALAT1	378938	broad.mit.edu;hgsc.bcm.edu	37	11	65273403	65273403	+	lincRNA	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:65273403C>A	ENST00000534336.1	+	0	8171					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TGCAAAAATTCTCTGCTAAGA	0.443																																																	0													98.0	95.0	96.0					11																	65273403		874	1988	2862			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273403C>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000534336.1	37																																																																																					0.443	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1		NR_002819	
MMRN2	79812	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	88702115	88702115	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr10:88702115C>G	ENST00000372027.5	-	6	2747	c.2426G>C	c.(2425-2427)gGg>gCg	p.G809A	MMRN2_ENST00000488950.1_5'Flank	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	809					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G809A(1)		breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						TGGCACAGGCCCTGTGACCCG	0.647																																																	1	Substitution - Missense(1)	kidney(1)											76.0	71.0	72.0					10																	88702115		2203	4300	6503	SO:0001583	missense	79812			AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.2426G>C	10.37:g.88702115C>G	ENSP00000361097:p.Gly809Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q504V7|Q6P2N2	Missense_Mutation	SNP	ENST00000372027.5	37	CCDS7379.1	.	.	.	.	.	.	.	.	.	.	C	1.689	-0.504562	0.04261	.	.	ENSG00000173269	ENST00000372027;ENST00000443699	T	0.14640	2.49	5.19	3.29	0.37713	.	0.464235	0.19156	N	0.121327	T	0.10208	0.0250	M	0.71581	2.175	0.09310	N	1	P;P;P	0.43788	0.817;0.524;0.524	B;B;B	0.28849	0.095;0.084;0.095	T	0.25502	-1.0130	10	0.11794	T	0.64	-19.3901	6.7154	0.23300	0.175:0.7331:0.0:0.0918	.	587;748;809	E7EN39;B4E3H8;Q9H8L6	.;.;MMRN2_HUMAN	A	809;587	ENSP00000361097:G809A	ENSP00000361097:G809A	G	-	2	0	MMRN2	88692095	0.000000	0.05858	0.002000	0.10522	0.180000	0.23129	-0.047000	0.11963	0.650000	0.30769	0.462000	0.41574	GGG		0.647	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049179.2		NM_024756	
MTUS1	57509	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	17612616	17612616	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:17612616G>T	ENST00000262102.6	-	2	925	c.701C>A	c.(700-702)aCa>aAa	p.T234K	MTUS1_ENST00000381862.3_Missense_Mutation_p.T234K|MTUS1_ENST00000381869.3_Missense_Mutation_p.T234K|MTUS1_ENST00000519263.1_Missense_Mutation_p.T234K	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	234					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T234K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TTCTGATGGTGTGACTTGAGG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											191.0	166.0	174.0					8																	17612616		1903	4125	6028	SO:0001583	missense	57509			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.701C>A	8.37:g.17612616G>T	ENSP00000262102:p.Thr234Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575404	0.28092	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.20069	3.1;3.09;3.1;2.1	4.14	2.31	0.28768	.	0.802457	0.11048	N	0.605308	T	0.14013	0.0339	L	0.27053	0.805	0.09310	N	1	B;B;B	0.32829	0.386;0.386;0.386	B;B;B	0.33521	0.165;0.087;0.124	T	0.27673	-1.0067	9	.	.	.	0.3378	7.3872	0.26888	0.0886:0.0:0.745:0.1664	.	234;234;234	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	K	234	ENSP00000371293:T234K;ENSP00000262102:T234K;ENSP00000430167:T234K;ENSP00000371286:T234K	.	T	-	2	0	MTUS1	17656896	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.252000	0.08806	0.681000	0.31386	0.655000	0.94253	ACA		0.393	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1		XM_372031	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9067241	9067242	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:9067241_9067242GA>TG	ENST00000397910.4	-	3	20407_20408	c.20204_20205TC>CA	c.(20203-20205)aTC>aCA	p.I6735T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6737	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.I6735T(4)|p.I6735I(4)|p.I2368I(2)|p.I2368T(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCGAGTGATGATGGTCATATT	0.515																																																	12	Substitution - Missense(6)|Substitution - coding silent(6)	kidney(9)|lung(3)																																								SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20204_20205delinsTG	19.37:g.9067241_9067242delinsTG	ENSP00000381008:p.Ile6735Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Silent|Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.515	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MUC2	4583	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1086012	1086012	+	Missense_Mutation	SNP	C	C	T	rs575288673		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:1086012C>T	ENST00000441003.2	+	22	2879	c.2852C>T	c.(2851-2853)aCg>aTg	p.T951M	MUC2_ENST00000359061.5_Missense_Mutation_p.T951M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	951	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T951M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCCTACACCACGCGGGAGGTG	0.617																																																	2	Substitution - Missense(2)	kidney(2)											47.0	55.0	53.0					11																	1086012		2150	4229	6379	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2852C>T	11.37:g.1086012C>T	ENSP00000415183:p.Thr951Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	10.39	1.338193	0.24253	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.59906	0.23;0.23	3.85	1.95	0.26073	.	0.739095	0.11923	N	0.516434	T	0.48187	0.1486	L	0.37561	1.115	0.09310	N	1	P	0.48764	0.915	P	0.48425	0.577	T	0.42241	-0.9463	10	0.66056	D	0.02	.	1.1477	0.01779	0.2183:0.4402:0.1395:0.202	.	951	E7EUV1	.	M	951	ENSP00000415183:T951M;ENSP00000351956:T951M	ENSP00000351956:T951M	T	+	2	0	MUC2	1076012	0.033000	0.19621	0.104000	0.21259	0.893000	0.52053	0.321000	0.19558	0.312000	0.23038	0.486000	0.48141	ACG		0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
MUC2	4583	broad.mit.edu	37	11	1090371	1090371	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:1090371C>A	ENST00000441003.2	+	27	3694	c.3667C>A	c.(3667-3669)Ccg>Acg	p.P1223T	MUC2_ENST00000361558.6_5'Flank|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1223					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1223T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CGTCTGCAGGCCGGAGGAAGG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											60.0	65.0	63.0					11																	1090371		2190	4277	6467	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3667C>A	11.37:g.1090371C>A	ENSP00000415183:p.Pro1223Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	1.990	-0.431969	0.04669	.	.	ENSG00000198788	ENST00000441003	T	0.12465	2.68	2.43	-2.26	0.06867	.	.	.	.	.	T	0.05868	0.0153	N	0.22421	0.69	0.09310	N	1	B	0.19073	0.033	B	0.19148	0.024	T	0.43032	-0.9416	9	0.05959	T	0.93	.	3.326	0.07067	0.0:0.3408:0.2161:0.4431	.	1223	E7EUV1	.	T	1223	ENSP00000415183:P1223T	ENSP00000415183:P1223T	P	+	1	0	MUC2	1080371	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.728000	0.04925	-0.534000	0.06315	0.441000	0.28932	CCG		0.657	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
N4BP2	55728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	40122527	40122527	+	Silent	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr4:40122527C>T	ENST00000261435.6	+	9	3212	c.2796C>T	c.(2794-2796)ggC>ggT	p.G932G		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	932					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)	p.G932G(1)		breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						CCTGTTGGGGCACAAGCTCTC	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											62.0	59.0	60.0					4																	40122527		2203	4300	6503	SO:0001819	synonymous_variant	55728			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2796C>T	4.37:g.40122527C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0AVR3|Q9NVK2|Q9P2D4	Silent	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.418226	0.01136	.	.	ENSG00000078177	ENST00000513269	.	.	.	5.62	-0.35	0.12606	.	.	.	.	.	T	0.42585	0.1209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22347	-1.0219	4	.	.	.	-0.805	2.7343	0.05236	0.1139:0.5098:0.1163:0.26	.	.	.	.	Y	579	.	.	H	+	1	0	N4BP2	39798922	0.993000	0.37304	0.886000	0.34754	0.111000	0.19643	0.947000	0.29082	-0.096000	0.12329	-0.136000	0.14681	CAC		0.413	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2		NM_018177	
NBAS	51594	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	15607839	15607839	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr2:15607839T>C	ENST00000281513.5	-	18	1992	c.1967A>G	c.(1966-1968)gAa>gGa	p.E656G	NBAS_ENST00000441750.1_Missense_Mutation_p.E656G	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	656					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.E656G(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GAGCTCCTTTTCCTTTTTATT	0.338																																																	1	Substitution - Missense(1)	kidney(1)											113.0	103.0	106.0					2																	15607839		2202	4300	6502	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.1967A>G	2.37:g.15607839T>C	ENSP00000281513:p.Glu656Gly	Somatic		WXS	Illumina HiSeq	Phase_I	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.742441	0.30865	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.11604	2.76;2.9	5.65	1.93	0.25924	.	0.149773	0.64402	N	0.000015	T	0.10294	0.0252	L	0.57536	1.79	0.19775	N	0.999951	B	0.32573	0.376	B	0.29267	0.1	T	0.18085	-1.0348	10	0.87932	D	0	.	6.8093	0.23794	0.0:0.1345:0.128:0.7376	.	656	A2RRP1	NBAS_HUMAN	G	656	ENSP00000413201:E656G;ENSP00000281513:E656G	ENSP00000281513:E656G	E	-	2	0	NBAS	15525290	0.999000	0.42202	0.002000	0.10522	0.411000	0.31082	3.226000	0.51254	0.090000	0.17273	0.528000	0.53228	GAA		0.338	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1		NM_015909	
NR2C2AP	126382	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19313200	19313200	+	Silent	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:19313200C>T	ENST00000331552.7	-	4	606	c.243G>A	c.(241-243)caG>caA	p.Q81Q	NR2C2AP_ENST00000538165.2_Silent_p.Q81Q|NR2C2AP_ENST00000544883.1_Missense_Mutation_p.R46K|NR2C2AP_ENST00000420605.3_Silent_p.Q81Q	NM_176880.4	NP_795361.1	Q86WQ0	NR2CA_HUMAN	nuclear receptor 2C2-associated protein	81					cell adhesion (GO:0007155)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)		p.Q81Q(1)		breast(1)|cervix(1)|kidney(2)|ovary(1)	5			Epithelial(12;0.00235)			CCTGAGTGCCCTGTGAACCTT	0.582																																																	1	Substitution - coding silent(1)	kidney(1)											160.0	162.0	161.0					19																	19313200		2203	4300	6503	SO:0001819	synonymous_variant	126382			AY101377	CCDS32967.1, CCDS74316.1	19p13.11	2008-01-10				ENSG00000184162			30763	protein-coding gene	gene with protein product	"""TR4 orphan receptor associated protein TRA16"""	608719				12486131	Standard	XM_005259740		Approved	TRA16	uc002nlx.3	Q86WQ0		ENST00000331552.7:c.243G>A	19.37:g.19313200C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NGP7|B4DW92	Silent	SNP	ENST00000331552.7	37	CCDS32967.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761827	0.31228	.	.	ENSG00000184162	ENST00000544883	.	.	.	5.16	0.58	0.17402	.	.	.	.	.	T	0.09468	0.0233	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35425	-0.9789	5	0.02654	T	1	-16.0535	4.1088	0.10049	0.1612:0.5771:0.0:0.2617	.	.	.	.	K	46	.	ENSP00000438092:R46K	R	-	2	0	NR2C2AP	19174200	0.000000	0.05858	0.004000	0.12327	0.069000	0.16628	-0.032000	0.12266	0.062000	0.16340	0.462000	0.41574	AGG		0.582	NR2C2AP-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402936.4		NM_176880	
OXSR1	9943	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	38294372	38294372	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:38294372G>A	ENST00000311806.3	+	18	1946	c.1574G>A	c.(1573-1575)aGc>aAc	p.S525N		NM_005109.2	NP_005100.1			oxidative stress responsive 1									p.S525N(1)		skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GCCCAGCTCAGCATCAGCTAA	0.448																																																	1	Substitution - Missense(1)	kidney(1)											112.0	103.0	106.0					3																	38294372		2203	4300	6503	SO:0001583	missense	9943			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000311806.3:c.1574G>A	3.37:g.38294372G>A	ENSP00000311713:p.Ser525Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000311806.3	37	CCDS2675.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382546	0.82792	.	.	ENSG00000172939	ENST00000311806	T	0.74737	-0.87	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.86401	0.5924	M	0.79693	2.465	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.88086	0.2810	10	0.72032	D	0.01	-9.7419	15.9544	0.79871	0.0:0.0:1.0:0.0	.	525	O95747	OXSR1_HUMAN	N	525	ENSP00000311713:S525N	ENSP00000311713:S525N	S	+	2	0	OXSR1	38269376	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.218000	0.89768	2.519000	0.84933	0.585000	0.79938	AGC		0.448	OXSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253744.1		NM_005109	
PARS2	25973	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55224207	55224207	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:55224207A>G	ENST00000371279.3	-	2	710	c.628T>C	c.(628-630)Tac>Cac	p.Y210H		NM_152268.3	NP_689481.2	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase 2, mitochondrial (putative)	210					gene expression (GO:0010467)|prolyl-tRNA aminoacylation (GO:0006433)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|proline-tRNA ligase activity (GO:0004827)	p.Y210H(1)		breast(1)|endometrium(3)|kidney(2)|lung(4)|ovary(2)|prostate(2)|skin(1)	15					L-Proline(DB00172)	TCAAAGGTGTACATATCCTTC	0.547																																																	1	Substitution - Missense(1)	kidney(1)											64.0	62.0	63.0					1																	55224207		2203	4300	6503	SO:0001583	missense	25973			AK025585	CCDS597.1	1p32.2	2011-07-01	2007-02-23		ENSG00000162396	ENSG00000162396	6.1.1.15	"""Aminoacyl tRNA synthetases / Class II"""	30563	protein-coding gene	gene with protein product	"""proline tRNA ligase 2, mitochondrial (putative)"""	612036				15779907	Standard	NM_152268		Approved	DKFZp727A071	uc001cxy.3	Q7L3T8	OTTHUMG00000009915	ENST00000371279.3:c.628T>C	1.37:g.55224207A>G	ENSP00000360327:p.Tyr210His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0W4|Q9H6S5|Q9UFT1	Missense_Mutation	SNP	ENST00000371279.3	37	CCDS597.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905160	0.72868	.	.	ENSG00000162396	ENST00000371279	T	0.80123	-1.34	4.68	4.68	0.58851	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.93334	0.7875	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95583	0.8648	10	0.87932	D	0	-19.4026	14.3325	0.66566	1.0:0.0:0.0:0.0	.	210	Q7L3T8	SYPM_HUMAN	H	210	ENSP00000360327:Y210H	ENSP00000360327:Y210H	Y	-	1	0	PARS2	54996795	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.099000	0.94207	1.964000	0.57103	0.460000	0.39030	TAC		0.547	PARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027436.1		NM_152268	
PDE4A	5141	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	10568586	10568586	+	Silent	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:10568586C>T	ENST00000352831.6	+	8	1019	c.909C>T	c.(907-909)ccC>ccT	p.P303P	PDE4A_ENST00000293683.5_Silent_p.P277P|PDE4A_ENST00000344979.3_Silent_p.P64P|PDE4A_ENST00000380702.2_Silent_p.P281P|PDE4A_ENST00000592685.1_Silent_p.P281P|PDE4A_ENST00000440014.2_Silent_p.P242P	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	303					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)	p.P242P(1)|p.P64P(1)|p.P277P(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TCCCATCACCCACGATGAAGG	0.557																																																	3	Substitution - coding silent(3)	kidney(3)											72.0	80.0	77.0					19																	10568586		2203	4300	6503	SO:0001819	synonymous_variant	5141				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.909C>T	19.37:g.10568586C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Silent	SNP	ENST00000352831.6	37	CCDS45961.1																																																																																				0.557	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1			
PIGU	128869	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	33245016	33245016	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr20:33245016C>A	ENST00000374820.2	-	2	183	c.163G>T	c.(163-165)Gta>Tta	p.V55L	PIGU_ENST00000452740.2_Missense_Mutation_p.V55L			Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class U	55					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|regulation of JAK-STAT cascade (GO:0046425)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V55L(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	9						TACGGAGATACTCCCAAGTCC	0.403																																																	1	Substitution - Missense(1)	kidney(1)											111.0	98.0	102.0					20																	33245016		2203	4300	6503	SO:0001583	missense	128869			AL118520	CCDS13239.1	20q11.22	2013-02-26	2006-11-07	2006-11-07	ENSG00000101464	ENSG00000101464		"""Phosphatidylinositol glycan anchor biosynthesis"""	15791	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	608528	"""CDC91 (cell division cycle 91, S. cerevisiae, homolog)-like 1"", ""CDC91 cell division cycle 91-like 1 (S. cerevisiae)"""	CDC91L1		12802054, 15034568	Standard	NM_080476		Approved	bA346K17.2, GAB1	uc002xas.3	Q9H490	OTTHUMG00000032304	ENST00000374820.2:c.163G>T	20.37:g.33245016C>A	ENSP00000363953:p.Val55Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z489|Q8N2F2	Missense_Mutation	SNP	ENST00000374820.2	37		.	.	.	.	.	.	.	.	.	.	C	16.17	3.046309	0.55110	.	.	ENSG00000101464	ENST00000217446;ENST00000374820;ENST00000452740	.	.	.	5.39	4.45	0.53987	.	0.123733	0.53938	D	0.000054	T	0.52403	0.1732	N	0.25957	0.775	0.51767	D	0.99993	D;B;B	0.63046	0.992;0.134;0.163	D;B;B	0.77004	0.989;0.103;0.165	T	0.50775	-0.8788	9	0.05620	T	0.96	.	11.0808	0.48059	0.0:0.9131:0.0:0.0869	.	55;55;55	E7EVL4;Q9H490-2;Q9H490	.;.;PIGU_HUMAN	L	55	.	ENSP00000217446:V55L	V	-	1	0	PIGU	32708677	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.326000	0.52037	1.272000	0.44329	0.585000	0.79938	GTA		0.403	PIGU-201	KNOWN	basic	protein_coding	protein_coding			NM_080476	
PIK3R4	30849	hgsc.bcm.edu;ucsc.edu	37	3	130463485	130463487	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:130463485_130463487delCTC	ENST00000356763.3	-	2	1133_1135	c.576_578delGAG	c.(574-579)aggaga>aga	p.192_193RR>R		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	192	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						ATAGCAAGTTCTCCTCCGTGATG	0.404																																																	0																																										SO:0001651	inframe_deletion	30849			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.576_578delGAG	3.37:g.130463488_130463490delCTC	ENSP00000349205:p.Arg193del	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TBF4	In_Frame_Del	DEL	ENST00000356763.3	37	CCDS3067.1																																																																																				0.404	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1		NM_014602	
PLEKHA4	57664	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	49362923	49362923	+	Silent	SNP	A	A	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:49362923A>C	ENST00000263265.6	-	7	1050	c.495T>G	c.(493-495)ccT>ccG	p.P165P	PLEKHA4_ENST00000355496.5_Silent_p.P165P|PLEKHA4_ENST00000596713.1_5'UTR	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	165	Pro-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.P165P(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GGGGTCGTGCAGGTGACCTGG	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											20.0	20.0	20.0					19																	49362923		2199	4295	6494	SO:0001819	synonymous_variant	57664			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.495T>G	19.37:g.49362923A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N4M8|Q8N658	Silent	SNP	ENST00000263265.6	37	CCDS12737.1																																																																																				0.607	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1			
POU6F2	11281	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	39247075	39247075	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr7:39247075A>T	ENST00000403058.1	+	5	521	c.367A>T	c.(367-369)Att>Ttt	p.I123F	POU6F2_ENST00000518318.2_Missense_Mutation_p.I123F|POU6F2_ENST00000517348.1_3'UTR|POU6F2_ENST00000559001.1_Missense_Mutation_p.I115F	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	123					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I123F(1)		NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						GCCAATCCTCATTCCCTTCAA	0.597																																																	1	Substitution - Missense(1)	kidney(1)											102.0	104.0	103.0					7																	39247075		2203	4300	6503	SO:0001583	missense	11281			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.367A>T	7.37:g.39247075A>T	ENSP00000384004:p.Ile123Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	A	33	5.197428	0.94960	.	.	ENSG00000106536	ENST00000403058;ENST00000518318;ENST00000451021	D;D	0.89746	-2.51;-2.56	6.17	6.17	0.99709	.	1.685670	0.03119	N	0.163488	D	0.94528	0.8238	L	0.50333	1.59	0.53005	D	0.999963	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.986	T	0.82727	-0.0314	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	123;123	P78424-2;P78424	.;PO6F2_HUMAN	F	123;123;124	ENSP00000384004:I123F;ENSP00000430514:I123F	ENSP00000384004:I123F	I	+	1	0	POU6F2	39213600	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	ATT		0.597	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3		NM_007252	
PRAMEF4	400735	broad.mit.edu;hgsc.bcm.edu	37	1	12943139	12943139	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:12943139G>A	ENST00000235349.5	-	2	147	c.77C>T	c.(76-78)gCc>gTc	p.A26V		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	26					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.A26V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGGACATGGCCAAAGCTTG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											110.0	111.0	111.0					1																	12943139		2183	4283	6466	SO:0001583	missense	400735				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.77C>T	1.37:g.12943139G>A	ENSP00000235349:p.Ala26Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	g	13.54	2.266238	0.40095	.	.	ENSG00000243073	ENST00000235349	T	0.05382	3.45	1.48	1.48	0.22813	.	0.158012	0.43416	D	0.000567	T	0.09335	0.0230	M	0.70595	2.14	0.09310	N	1	P	0.44521	0.837	B	0.44133	0.442	T	0.10753	-1.0616	10	0.54805	T	0.06	.	6.4564	0.21932	0.0:0.0:1.0:0.0	.	26	O60810	PRAM4_HUMAN	V	26	ENSP00000235349:A26V	ENSP00000235349:A26V	A	-	2	0	PRAMEF4	12865726	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.312000	0.19397	1.137000	0.42214	0.400000	0.26472	GCC		0.577	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1		NM_001009611	
RCCD1	91433	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	91504264	91504264	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr15:91504264A>C	ENST00000394258.2	+	7	1161	c.959A>C	c.(958-960)gAg>gCg	p.E320A	RCCD1_ENST00000555155.1_Missense_Mutation_p.E318A|RCCD1_ENST00000556618.1_Missense_Mutation_p.E320A	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	320						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.E320A(1)		breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			GGAACAGGGGAGCTCTACACC	0.507																																																	1	Substitution - Missense(1)	kidney(1)											102.0	100.0	101.0					15																	91504264		2198	4298	6496	SO:0001583	missense	91433				CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.959A>C	15.37:g.91504264A>C	ENSP00000377801:p.Glu320Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	37	CCDS32333.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.613035	0.87258	.	.	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618;ENST00000556333	D;D;D	0.84873	-1.91;-1.91;-1.91	5.65	5.65	0.86999	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.063667	0.64402	D	0.000008	D	0.84000	0.5376	L	0.39467	1.215	0.54753	D	0.999988	P;P	0.49783	0.911;0.928	P;P	0.50896	0.521;0.653	T	0.81254	-0.1016	10	0.20046	T	0.44	.	14.9067	0.70724	1.0:0.0:0.0:0.0	.	318;320	G3V2I3;A6NED2	.;RCCD1_HUMAN	A	320;318;320;109	ENSP00000377801:E320A;ENSP00000450678:E318A;ENSP00000451963:E320A	ENSP00000377801:E320A	E	+	2	0	RCCD1	89305268	1.000000	0.71417	0.993000	0.49108	0.797000	0.45037	7.960000	0.87893	2.167000	0.68274	0.454000	0.30748	GAG		0.507	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1		NM_033544	
RHOT2	89941	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	720301	720301	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr16:720301A>G	ENST00000315082.4	+	7	496	c.382A>G	c.(382-384)Atg>Gtg	p.M128V	RHOT2_ENST00000569943.2_3'UTR	NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2	128	Miro 1.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.M128V(1)		endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				GGGGAGCTCCATGGAGGCCGT	0.632																																																	1	Substitution - Missense(1)	kidney(1)											76.0	80.0	79.0					16																	720301		2200	4300	6500	SO:0001583	missense	89941			BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.382A>G	16.37:g.720301A>G	ENSP00000321971:p.Met128Val	Somatic		WXS	Illumina HiSeq	Phase_I	A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	Missense_Mutation	SNP	ENST00000315082.4	37	CCDS10417.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.619954	0.28801	.	.	ENSG00000140983	ENST00000315082	T	0.67523	-0.27	4.98	2.64	0.31445	MIRO (1);	0.150498	0.64402	N	0.000001	T	0.55847	0.1946	L	0.35854	1.095	0.51012	D	0.999902	P;B	0.41345	0.746;0.228	B;B	0.43754	0.43;0.236	T	0.48779	-0.9005	10	0.44086	T	0.13	-23.4621	6.6003	0.22697	0.7614:0.1553:0.0833:0.0	.	1;128	Q8IXI1-2;Q8IXI1	.;MIRO2_HUMAN	V	128	ENSP00000321971:M128V	ENSP00000321971:M128V	M	+	1	0	RHOT2	660302	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	3.633000	0.54295	0.222000	0.20900	-0.464000	0.05259	ATG		0.632	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241617.1		NM_138769	
SEC23A	10484	broad.mit.edu;hgsc.bcm.edu	37	14	39511999	39511999	+	Nonsense_Mutation	SNP	A	A	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr14:39511999A>C	ENST00000307712.6	-	17	2494	c.1977T>G	c.(1975-1977)taT>taG	p.Y659*	SEC23A_ENST00000537403.1_Nonsense_Mutation_p.Y457*|SEC23A_ENST00000536508.1_Nonsense_Mutation_p.Y557*|SEC23A_ENST00000545328.2_Nonsense_Mutation_p.Y630*	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	659					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.Y659*(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CCTCACCATGATAAATCAAAA	0.338																																																	1	Substitution - Nonsense(1)	kidney(1)											93.0	97.0	96.0					14																	39511999		2203	4300	6503	SO:0001587	stop_gained	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1977T>G	14.37:g.39511999A>C	ENSP00000306881:p.Tyr659*	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5P4|B3KXI2|Q8NE16	Nonsense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	A	43	10.044627	0.99324	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	.	.	.	5.55	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-17.2779	8.5012	0.33159	0.8543:0.0:0.1457:0.0	.	.	.	.	X	457;659;557;630	.	ENSP00000306881:Y659X	Y	-	3	2	SEC23A	38581750	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.588000	0.46137	2.234000	0.73211	0.533000	0.62120	TAT		0.338	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			
SFXN4	119559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	120917388	120917388	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr10:120917388T>G	ENST00000355697.2	-	8	485	c.466A>C	c.(466-468)Agt>Cgt	p.S156R	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.S147R	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	156					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.S156R(1)		central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		CTCACGTAACTTCTGTTTCCA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											120.0	116.0	118.0					10																	120917388		2203	4300	6503	SO:0001583	missense	119559				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.466A>C	10.37:g.120917388T>G	ENSP00000347924:p.Ser156Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6WSU4|Q86TD9	Missense_Mutation	SNP	ENST00000355697.2	37	CCDS7610.1	.	.	.	.	.	.	.	.	.	.	T	17.04	3.286048	0.59867	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875;ENST00000369131;ENST00000419372	T;T;T	0.32023	1.47;1.47;1.47	4.64	4.64	0.57946	.	0.188882	0.44483	D	0.000458	T	0.50086	0.1595	M	0.68952	2.095	0.09310	N	0.999999	D	0.76494	0.999	D	0.75020	0.985	T	0.40059	-0.9583	10	0.56958	D	0.05	-15.5373	10.6157	0.45449	0.0:0.0:0.0:1.0	.	156	Q6P4A7	SFXN4_HUMAN	R	156;147;39;40;40	ENSP00000347924:S156R;ENSP00000333200:S147R;ENSP00000358127:S40R	ENSP00000333200:S147R	S	-	1	0	SFXN4	120907378	0.037000	0.19845	0.110000	0.21437	0.063000	0.16089	3.062000	0.49971	2.066000	0.61787	0.528000	0.53228	AGT		0.408	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3		XM_058406	
SLC16A4	9122	hgsc.bcm.edu;ucsc.edu	37	1	110923620	110923623	+	Frame_Shift_Del	DEL	ATCT	ATCT	-	rs545257111		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	ATCT	ATCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:110923620_110923623delATCT	ENST00000369779.4	-	5	756_759	c.507_510delAGAT	c.(505-510)atagatfs	p.ID169fs	SLC16A4_ENST00000437429.2_Frame_Shift_Del_p.ID59fs|SLC16A4_ENST00000369781.4_Frame_Shift_Del_p.ID169fs|SLC16A4_ENST00000541986.1_Frame_Shift_Del_p.ID107fs|SLC16A4_ENST00000472422.2_Frame_Shift_Del_p.ID121fs|SLC16A4_ENST00000497687.1_Intron|LAMTOR5-AS1_ENST00000590413.1_RNA	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	169					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	AGTCATACAGATCTATCAGGAATT	0.392																																																	0																																										SO:0001589	frameshift_variant	9122			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.507_510delAGAT	1.37:g.110923620_110923623delATCT	ENSP00000358794:p.Ile169fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Frame_Shift_Del	DEL	ENST00000369779.4	37	CCDS823.1																																																																																				0.392	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3		NM_004696	
SLC22A9	114571	broad.mit.edu;hgsc.bcm.edu	37	11	63175588	63175588	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:63175588G>A	ENST00000279178.3	+	8	1542	c.1293G>A	c.(1291-1293)atG>atA	p.M431I	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	431					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.M431I(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						CTCCAGAAATGCAGACGCTGC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											77.0	72.0	74.0					11																	63175588		2201	4298	6499	SO:0001583	missense	114571			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.1293G>A	11.37:g.63175588G>A	ENSP00000279178:p.Met431Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	37	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557516	0.45590	.	.	ENSG00000149742	ENST00000279178	T	0.58210	0.35	2.46	-0.565	0.11771	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.497971	0.22716	N	0.056506	T	0.69070	0.3070	M	0.90252	3.1	0.38373	D	0.944912	D	0.76494	0.999	D	0.71656	0.974	T	0.67205	-0.5729	10	0.51188	T	0.08	.	5.1628	0.15070	0.4586:0.0:0.5414:0.0	.	431	Q8IVM8	S22A9_HUMAN	I	431	ENSP00000279178:M431I	ENSP00000279178:M431I	M	+	3	0	SLC22A9	62932164	1.000000	0.71417	0.526000	0.27913	0.643000	0.38383	1.403000	0.34612	-0.124000	0.11724	0.205000	0.17691	ATG		0.478	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1		NM_080866	
SLC2A6	11182	hgsc.bcm.edu;ucsc.edu	37	9	136340534	136340534	+	Silent	SNP	G	G	A	rs115835881	byFrequency	TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr9:136340534G>A	ENST00000371899.4	-	5	839	c.762C>T	c.(760-762)aaC>aaT	p.N254N	SLC2A6_ENST00000371897.4_Silent_p.N254N|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	254					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		GTCTCCGGACGTTGTCCTGGA	0.667													G|||	63	0.0125799	0.0454	0.0043	5008	,	,		16717	0.0		0.0	False		,,,				2504	0.0																0								G	,	202,4202	120.0+/-157.7	4,194,2004	40.0	30.0	34.0		762,762	0.3	1.0	9	dbSNP_132	34	3,8595	3.0+/-9.4	0,3,4296	no	coding-synonymous,coding-synonymous	SLC2A6	NM_001145099.1,NM_017585.3	,	4,197,6300	AA,AG,GG		0.0349,4.5867,1.5767	,	254/446,254/508	136340534	205,12797	2202	4299	6501	SO:0001819	synonymous_variant	11182			AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.762C>T	9.37:g.136340534G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	ENST00000371899.4	37	CCDS6975.1	30	0.013736263736263736	27	0.054878048780487805	3	0.008287292817679558	0	0.0	0	0.0	G	13.61	2.288037	0.40494	0.045867	3.49E-4	ENSG00000160326	ENST00000432868	D	0.91011	-2.77	5.39	0.337	0.15966	.	.	.	.	.	T	0.70596	0.3242	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.79443	-0.1801	6	0.56958	D	0.05	.	9.8337	0.40956	0.348:0.0:0.652:0.0	.	.	.	.	M	216	ENSP00000405124:T216M	ENSP00000405124:T216M	T	-	2	0	SLC2A6	135330355	0.084000	0.21492	0.984000	0.44739	0.870000	0.49936	-0.136000	0.10405	0.013000	0.14918	-1.036000	0.02392	ACG		0.667	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1		NM_017585	
SPATC1	375686	broad.mit.edu	37	8	145096167	145096167	+	Silent	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:145096167T>G	ENST00000377470.3	+	4	1443	c.1341T>G	c.(1339-1341)ggT>ggG	p.G447G	SPATC1_ENST00000447830.2_Intron	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	447						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.G447G(1)|p.G356G(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCTGGTGGGTGAGATTGCCT	0.622																																																	2	Substitution - coding silent(2)	kidney(2)											69.0	52.0	57.0					8																	145096167		2203	4300	6503	SO:0001819	synonymous_variant	375686			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1341T>G	8.37:g.145096167T>G		Somatic		WXS	Illumina GAIIx	Phase_I	B4DWW9|Q5U5I8|Q7Z6L7	Silent	SNP	ENST00000377470.3	37	CCDS6413.2																																																																																				0.622	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1		NM_198572	
TRIM51	84767	broad.mit.edu;ucsc.edu	37	11	55653128	55653128	+	Missense_Mutation	SNP	T	T	A	rs200343592	byFrequency	TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:55653128T>A	ENST00000449290.2	+	2	316	c.224T>A	c.(223-225)tTc>tAc	p.F75Y	TRIM51_ENST00000244891.3_5'Flank	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	75						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.F75Y(1)									AACATGGCTTTCATTGCCAGA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											26.0	22.0	23.0					11																	55653128		692	1591	2283	SO:0001583	missense	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.224T>A	11.37:g.55653128T>A	ENSP00000395086:p.Phe75Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37		.	.	.	.	.	.	.	.	.	.	.	7.052	0.564746	0.13498	.	.	ENSG00000124900	ENST00000449290	D	0.84146	-1.81	0.803	-1.61	0.08399	Zinc finger, RING/FYVE/PHD-type (1);	.	.	.	.	T	0.65344	0.2682	N	0.08118	0	0.09310	N	1	B	0.26744	0.158	B	0.23716	0.048	T	0.50734	-0.8793	9	0.72032	D	0.01	.	2.3193	0.04207	0.4816:0.296:0.0:0.2223	.	75	Q9BSJ1	SPRY5_HUMAN	Y	75	ENSP00000395086:F75Y	ENSP00000395086:F75Y	F	+	2	0	SPRYD5	55409704	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.240000	0.08952	-1.515000	0.01784	-1.353000	0.01230	TTC		0.473	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1		NM_032681	
SPTBN4	57731	hgsc.bcm.edu	37	19	41062976	41062977	+	Frame_Shift_Ins	INS	-	-	G	rs147656135		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:41062976_41062977insG	ENST00000352632.3	+	26	5423_5424	c.5337_5338insG	c.(5338-5340)gggfs	p.G1780fs	SPTBN4_ENST00000598249.1_Frame_Shift_Ins_p.G1780fs|SPTBN4_ENST00000392023.1_Frame_Shift_Ins_p.G456fs|SPTBN4_ENST00000392025.1_Frame_Shift_Ins_p.G523fs|SPTBN4_ENST00000338932.3_Frame_Shift_Ins_p.G1780fs|SPTBN4_ENST00000595535.1_Frame_Shift_Ins_p.G1780fs			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1780					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGGTATGGCAGGGCGGGAACG	0.599																																																	0																																										SO:0001589	frameshift_variant	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5340dupG	19.37:g.41062979_41062979dupG	ENSP00000263373:p.Gly1780fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Frame_Shift_Ins	INS	ENST00000352632.3	37	CCDS12559.1																																																																																				0.599	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			
TBC1D5	9779	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	17279709	17279709	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:17279709G>A	ENST00000253692.7	-	17	3198	c.1534C>T	c.(1534-1536)Cag>Tag	p.Q512*	TBC1D5_ENST00000446818.2_Nonsense_Mutation_p.Q512*|TBC1D5_ENST00000429383.4_Nonsense_Mutation_p.Q512*|TBC1D5_ENST00000429924.2_Nonsense_Mutation_p.Q464*|TBC1D5_ENST00000414318.2_5'UTR	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	512						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)	p.Q512*(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						TGCTGCTGCTGTTGCTGTTGC	0.473																																																	1	Substitution - Nonsense(1)	kidney(1)											58.0	57.0	58.0					3																	17279709		2203	4300	6503	SO:0001587	stop_gained	9779			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1534C>T	3.37:g.17279709G>A	ENSP00000253692:p.Gln512*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NP25|C9JP52	Nonsense_Mutation	SNP	ENST00000253692.7	37	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	G	36	5.886867	0.97068	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	.	.	.	5.5	4.55	0.56014	.	0.543665	0.21420	N	0.074826	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	6.9544	0.24562	0.0774:0.1195:0.6665:0.1366	.	.	.	.	X	512;512;512;464	.	ENSP00000253692:Q512X	Q	-	1	0	TBC1D5	17254713	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	3.473000	0.53122	2.573000	0.86826	0.555000	0.69702	CAG		0.473	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3		NM_014744	
TBP	6908	hgsc.bcm.edu;ucsc.edu	37	6	170878701	170878703	+	Splice_Site	DEL	GAA	GAA	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:170878701_170878703delGAA	ENST00000392092.2	+	6	958_960	c.679_681delGAA	c.(679-681)gaadel	p.E228del	TBP_ENST00000540980.1_Splice_Site_p.E208del|TBP_ENST00000230354.6_Splice_Site_p.E228del	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	228					cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		TTTCCCTAGTGAAGAACAGTCCA	0.355																																																	0																																										SO:0001630	splice_region_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.678-1GAA>-	6.37:g.170878704_170878706delGAA		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Del	DEL	ENST00000392092.2	37	CCDS5315.1																																																																																				0.355	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2		NM_003194	In_Frame_Del
TFDP2	7029	hgsc.bcm.edu;ucsc.edu	37	3	141671843	141671843	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:141671843delG	ENST00000489671.1	-	12	1497	c.1067delC	c.(1066-1068)cctfs	p.P356fs	TFDP2_ENST00000317104.7_Frame_Shift_Del_p.P280fs|TFDP2_ENST00000479040.1_Frame_Shift_Del_p.P295fs|TFDP2_ENST00000467072.1_Frame_Shift_Del_p.P296fs|TFDP2_ENST00000477292.1_Frame_Shift_Del_p.P220fs|TFDP2_ENST00000486111.1_Frame_Shift_Del_p.P296fs|TFDP2_ENST00000495310.1_Frame_Shift_Del_p.P259fs|TFDP2_ENST00000397991.4_Frame_Shift_Del_p.P328fs|TFDP2_ENST00000310282.6_Frame_Shift_Del_p.P296fs|TFDP2_ENST00000499676.2_Frame_Shift_Del_p.P296fs			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	356					gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						TAACCAAGAAGGTCCTGTGGA	0.428																																																	0													98.0	98.0	98.0					3																	141671843		1850	4093	5943	SO:0001589	frameshift_variant	7029			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.1067delC	3.37:g.141671843delG	ENSP00000420616:p.Pro356fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Frame_Shift_Del	DEL	ENST00000489671.1	37	CCDS54650.1																																																																																				0.428	TFDP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353294.4		NM_006286	
THAP10	56906	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	71174954	71174954	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr15:71174954G>T	ENST00000249861.4	-	3	1125	c.613C>A	c.(613-615)Ctg>Atg	p.L205M	LRRC49_ENST00000544974.2_Intron	NM_020147.3	NP_064532.1	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	205							DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L205M(1)		NS(1)|kidney(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GCATTACACAGTCTTTTTCCA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											121.0	116.0	118.0					15																	71174954		2199	4297	6496	SO:0001583	missense	56906			AL360202	CCDS10237.1	15q22.32	2013-01-25			ENSG00000129028	ENSG00000129028		"""THAP (C2CH-type zinc finger) domain containing"""	23193	protein-coding gene	gene with protein product		612538				12575992	Standard	NM_020147		Approved		uc002asv.3	Q9P2Z0	OTTHUMG00000133388	ENST00000249861.4:c.613C>A	15.37:g.71174954G>T	ENSP00000249861:p.Leu205Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8R0	Missense_Mutation	SNP	ENST00000249861.4	37	CCDS10237.1	.	.	.	.	.	.	.	.	.	.	G	5.469	0.271648	0.10349	.	.	ENSG00000129028	ENST00000249861	.	.	.	2.89	2.89	0.33648	.	.	.	.	.	T	0.16214	0.0390	N	0.19112	0.55	0.09310	N	1	P	0.49090	0.919	B	0.34779	0.189	T	0.06463	-1.0825	8	0.45353	T	0.12	.	9.3393	0.38069	0.0:0.0:1.0:0.0	.	205	Q9P2Z0	THA10_HUMAN	M	205	.	ENSP00000249861:L205M	L	-	1	2	THAP10	68962008	0.865000	0.29922	0.002000	0.10522	0.208000	0.24298	1.477000	0.35431	1.628000	0.50416	0.460000	0.39030	CTG		0.363	THAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257242.2		NM_020147	
THBS3	7059	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	155170785	155170785	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:155170785A>T	ENST00000368378.3	-	13	1471	c.1451T>A	c.(1450-1452)cTt>cAt	p.L484H	RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA|THBS3_ENST00000541990.1_Missense_Mutation_p.L13H|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000541576.1_5'UTR|THBS3_ENST00000486260.1_5'UTR|THBS3_ENST00000457183.2_Missense_Mutation_p.L364H	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	484					bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.L484H(1)		breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGTGTCAAAAGGCAGTTGTC	0.562																																																	1	Substitution - Missense(1)	kidney(1)											272.0	244.0	253.0					1																	155170785		2203	4300	6503	SO:0001583	missense	7059			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.1451T>A	1.37:g.155170785A>T	ENSP00000357362:p.Leu484His	Somatic		WXS	Illumina HiSeq	Phase_I	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	A	13.13	2.146146	0.37923	.	.	ENSG00000169231	ENST00000368378;ENST00000457183;ENST00000541990;ENST00000428962	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.48	4.45	4.45	0.53987	.	0.422412	0.21485	N	0.073777	D	0.95617	0.8575	L	0.43923	1.385	0.31393	N	0.677595	P;P;P;P	0.48016	0.904;0.904;0.847;0.847	P;B;B;B	0.51866	0.682;0.401;0.401;0.401	D	0.93786	0.7088	10	0.52906	T	0.07	-11.2686	11.9754	0.53089	1.0:0.0:0.0:0.0	.	364;484;484;484	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	H	484;364;13;334	ENSP00000357362:L484H;ENSP00000392207:L364H;ENSP00000437353:L13H;ENSP00000404040:L334H	ENSP00000357362:L484H	L	-	2	0	THBS3	153437409	0.172000	0.23043	1.000000	0.80357	0.992000	0.81027	0.901000	0.28445	2.001000	0.58596	0.383000	0.25322	CTT		0.562	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1		NM_007112	
TIAM2	26230	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	155498049	155498049	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:155498049G>A	ENST00000461783.3	+	12	3734	c.2461G>A	c.(2461-2463)Gga>Aga	p.G821R	TIAM2_ENST00000367174.2_Missense_Mutation_p.G197R|TIAM2_ENST00000456144.1_Missense_Mutation_p.G821R|TIAM2_ENST00000456877.2_Missense_Mutation_p.G133R|TIAM2_ENST00000318981.5_Missense_Mutation_p.G821R|TIAM2_ENST00000528391.2_Missense_Mutation_p.G157R|TIAM2_ENST00000529824.2_Missense_Mutation_p.G821R|TIAM2_ENST00000360366.4_Missense_Mutation_p.G845R			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	821	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G821R(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGACAATCACGGAGTTACTGT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											160.0	140.0	147.0					6																	155498049		2203	4300	6503	SO:0001583	missense	26230				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2461G>A	6.37:g.155498049G>A	ENSP00000437188:p.Gly821Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518873	0.44763	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.05199	3.65;3.54;3.61;3.65;3.48;3.65;3.61;3.48;3.48	5.55	5.55	0.83447	Raf-like Ras-binding (2);	0.260219	0.39544	N	0.001329	T	0.05868	0.0153	L	0.51422	1.61	0.41370	D	0.987482	P;D;D;P	0.53619	0.569;0.961;0.961;0.934	B;P;P;B	0.46172	0.112;0.506;0.506;0.214	T	0.47935	-0.9078	10	0.25751	T	0.34	.	18.0566	0.89365	0.0:0.0:1.0:0.0	.	157;821;845;821	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	R	821;1067;821;821;821;197;845;821;133;157	ENSP00000437188:G821R;ENSP00000434901:G821R;ENSP00000407746:G821R;ENSP00000327315:G821R;ENSP00000356142:G197R;ENSP00000353528:G845R;ENSP00000433348:G821R;ENSP00000407183:G133R;ENSP00000435335:G157R	ENSP00000327315:G821R	G	+	1	0	TIAM2	155539741	0.928000	0.31464	0.101000	0.21167	0.020000	0.10135	6.013000	0.70776	2.768000	0.95171	0.655000	0.94253	GGA		0.423	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2		NM_012454	
TLL2	7093	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	98273269	98273269	+	Splice_Site	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr10:98273269G>A	ENST00000357947.3	-	1	399	c.174C>T	c.(172-174)gcC>gcT	p.A58A	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	58					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A58A(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GGCACCTACCGGCTTTGCAAG	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	49.0	50.0					10																	98273269		2202	4298	6500	SO:0001630	splice_region_variant	7093			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.175+1C>T	10.37:g.98273269G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	CCDS7449.1																																																																																				0.642	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			Silent
TM7SF2	7108	broad.mit.edu	37	11	64879505	64879505	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr11:64879505delC	ENST00000279263.7	+	1	180	c.18delC	c.(16-18)ggcfs	p.G6fs	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000540748.1_5'UTR|TM7SF2_ENST00000345348.5_Frame_Shift_Del_p.G6fs	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	6					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCACTCAGGGCCCCCGGGCCC	0.642																																																	0													12.0	14.0	14.0					11																	64879505		1800	4066	5866	SO:0001589	frameshift_variant	7108			BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.18delC	11.37:g.64879505delC	ENSP00000279263:p.Gly6fs	Somatic		WXS	Illumina GAIIx	Phase_I	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Frame_Shift_Del	DEL	ENST00000279263.7	37	CCDS41669.1																																																																																				0.642	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1		NM_003273	
TNPO2	30000	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	12825697	12825697	+	Silent	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:12825697C>T	ENST00000592287.1	-	9	936	c.828G>A	c.(826-828)gaG>gaA	p.E276E	TNPO2_ENST00000441499.1_Silent_p.E276E|TNPO2_ENST00000589956.1_Intron|TNPO2_ENST00000356861.5_Silent_p.E276E|TNPO2_ENST00000425528.1_Silent_p.E276E|TNPO2_ENST00000588216.1_Silent_p.E276E|TNPO2_ENST00000450764.2_Silent_p.E276E	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	276					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)	p.E276E(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TCAGCCAGAACTCACAGGCCT	0.627																																																	2	Substitution - coding silent(2)	kidney(2)											122.0	132.0	129.0					19																	12825697		2141	4234	6375	SO:0001819	synonymous_variant	30000			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.828G>A	19.37:g.12825697C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O14655|Q6IN77	Silent	SNP	ENST00000592287.1	37	CCDS45991.1																																																																																				0.627	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1		NM_013433	
TRPV4	59341	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	110240804	110240804	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr12:110240804T>C	ENST00000418703.2	-	3	798	c.704A>G	c.(703-705)tAc>tGc	p.Y235C	TRPV4_ENST00000541794.1_Missense_Mutation_p.Y235C|TRPV4_ENST00000346520.2_Missense_Mutation_p.Y235C|TRPV4_ENST00000392719.2_Missense_Mutation_p.Y235C|TRPV4_ENST00000261740.2_Missense_Mutation_p.Y235C|TRPV4_ENST00000537083.1_Missense_Mutation_p.Y235C|TRPV4_ENST00000544971.1_Missense_Mutation_p.Y235C|TRPV4_ENST00000536838.1_Missense_Mutation_p.Y201C	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	235					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)	p.Y235C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						ACCTCGATAGTAGATGTCACG	0.607																																																	1	Substitution - Missense(1)	kidney(1)											71.0	60.0	64.0					12																	110240804		2203	4300	6503	SO:0001583	missense	59341			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.704A>G	12.37:g.110240804T>C	ENSP00000406191:p.Tyr235Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528732	0.64860	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	T;T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	4.51	4.51	0.55191	Ankyrin repeat-containing domain (1);	0.194522	0.46758	D	0.000269	T	0.73885	0.3644	L	0.27053	0.805	0.41466	D	0.988076	D;D;D;P;D	0.89917	1.0;1.0;1.0;0.918;1.0	D;D;D;P;D	0.91635	0.996;0.988;0.996;0.749;0.999	T	0.74553	-0.3627	10	0.40728	T	0.16	-9.2943	12.9815	0.58567	0.0:0.0:0.0:1.0	.	235;235;235;235;201	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	C	235;235;235;235;235;235;235;201	ENSP00000406191:Y235C;ENSP00000261740:Y235C;ENSP00000376480:Y235C;ENSP00000319003:Y235C;ENSP00000443611:Y235C;ENSP00000442738:Y235C;ENSP00000442167:Y235C;ENSP00000444336:Y201C	ENSP00000261740:Y235C	Y	-	2	0	TRPV4	108725187	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	7.691000	0.84191	1.809000	0.52856	0.459000	0.35465	TAC		0.607	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1		NM_021625	
TTC39C	125488	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	21694593	21694593	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr18:21694593G>A	ENST00000317571.3	+	7	1296	c.1060G>A	c.(1060-1062)Gtc>Atc	p.V354I	RP11-799B12.2_ENST00000583782.1_RNA|TTC39C_ENST00000540918.2_Missense_Mutation_p.V47I|TTC39C_ENST00000304621.6_Missense_Mutation_p.V293I	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	354								p.V293I(1)|p.V354I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						AATTCAACATGTCTGTCTGTA	0.378																																																	2	Substitution - Missense(2)	kidney(2)											177.0	155.0	162.0					18																	21694593		2203	4300	6503	SO:0001583	missense	125488			AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.1060G>A	18.37:g.21694593G>A	ENSP00000323645:p.Val354Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Missense_Mutation	SNP	ENST00000317571.3	37	CCDS45839.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076347	0.55753	.	.	ENSG00000168234	ENST00000304621;ENST00000317571;ENST00000540918	T;T;T	0.42131	0.98;0.98;0.98	5.17	5.17	0.71159	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.33990	0.0882	L	0.45137	1.4	0.80722	D	1	B	0.31383	0.321	B	0.18871	0.023	T	0.10474	-1.0628	10	0.19590	T	0.45	-26.941	17.7852	0.88535	0.0:0.0:1.0:0.0	.	354	Q8N584	TT39C_HUMAN	I	293;354;47	ENSP00000306598:V293I;ENSP00000323645:V354I;ENSP00000443016:V47I	ENSP00000306598:V293I	V	+	1	0	TTC39C	19948591	1.000000	0.71417	0.992000	0.48379	0.954000	0.61252	7.246000	0.78247	2.581000	0.87130	0.655000	0.94253	GTC		0.378	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1		NM_153211	
TXN	7295	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	113007067	113007067	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr9:113007067C>G	ENST00000374517.5	-	4	450	c.246G>C	c.(244-246)aaG>aaC	p.K82N	TXN_ENST00000487892.1_5'UTR|TXN_ENST00000374515.5_Missense_Mutation_p.K62N	NM_003329.3	NP_003320.2	P10599	THIO_HUMAN	thioredoxin	82	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|glycerol ether metabolic process (GO:0006662)|innate immune response (GO:0045087)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oxidation-reduction process (GO:0055114)|positive regulation of DNA binding (GO:0043388)|regulation of protein import into nucleus, translocation (GO:0033158)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	peptide disulfide oxidoreductase activity (GO:0015037)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)	p.K82N(1)		kidney(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		CCTTTTGTCCCTTCTTAAAAA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											175.0	166.0	169.0					9																	113007067		2203	4300	6503	SO:0001583	missense	7295			X77584	CCDS35103.1, CCDS59139.1	9q31	2008-02-05			ENSG00000136810	ENSG00000136810			12435	protein-coding gene	gene with protein product		187700					Standard	NM_003329		Approved	TRX	uc004bep.2	P10599	OTTHUMG00000020480	ENST00000374517.5:c.246G>C	9.37:g.113007067C>G	ENSP00000363641:p.Lys82Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B1ALW1|O60744|Q53X69|Q96KI3|Q9UDG5	Missense_Mutation	SNP	ENST00000374517.5	37	CCDS35103.1	.	.	.	.	.	.	.	.	.	.	C	3.177	-0.168680	0.06461	.	.	ENSG00000136810	ENST00000374517;ENST00000374515	T;T	0.18810	4.03;2.19	5.67	2.55	0.30701	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.108823	0.64402	D	0.000012	T	0.03915	0.0110	N	0.00422	-1.515	0.38069	D	0.936307	B;B	0.12013	0.005;0.005	B;B	0.15484	0.007;0.013	T	0.35475	-0.9787	10	0.02654	T	1	-6.7777	6.4373	0.21831	0.4821:0.4275:0.0:0.0904	.	62;82	B1ALW1;P10599	.;THIO_HUMAN	N	82;62	ENSP00000363641:K82N;ENSP00000363639:K62N	ENSP00000363639:K62N	K	-	3	2	TXN	112046888	0.984000	0.35163	1.000000	0.80357	0.992000	0.81027	0.079000	0.14782	0.736000	0.32559	0.561000	0.74099	AAG		0.393	TXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053614.1			
UBA5	79876	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	132387698	132387698	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:132387698A>G	ENST00000356232.4	+	4	1406	c.334A>G	c.(334-336)Aat>Gat	p.N112D	UBA5_ENST00000264991.4_Missense_Mutation_p.N56D|UBA5_ENST00000494238.2_Missense_Mutation_p.N56D|UBA5_ENST00000493720.2_Missense_Mutation_p.N112D|UBA5_ENST00000473651.1_Missense_Mutation_p.N112D	NM_024818.3	NP_079094.1	Q9GZZ9	UBA5_HUMAN	ubiquitin-like modifier activating enzyme 5	112					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|UFM1 activating enzyme activity (GO:0071566)	p.N112D(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						GGAACTAGCCAATATGAATAG	0.323																																																	1	Substitution - Missense(1)	kidney(1)											128.0	128.0	128.0					3																	132387698		2203	4298	6501	SO:0001583	missense	79876			AY253672	CCDS3076.1, CCDS3077.1	3q22	2007-11-30	2007-11-30	2007-11-30	ENSG00000081307	ENSG00000081307		"""Ubiquitin-like modifier activating enzymes"""	23230	protein-coding gene	gene with protein product	"""UBA5, ubiquitin-activating enzyme E1 homolog (yeast)"""	610552	"""ubiquitin-activating enzyme E1-domain containing 1"""	UBE1DC1		11230166, 15071506	Standard	NM_198329		Approved	FLJ23251	uc003epa.4	Q9GZZ9	OTTHUMG00000159759	ENST00000356232.4:c.334A>G	3.37:g.132387698A>G	ENSP00000348565:p.Asn112Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJL3|D3DNC8|Q96ST1	Missense_Mutation	SNP	ENST00000356232.4	37	CCDS3076.1	.	.	.	.	.	.	.	.	.	.	A	31	5.086816	0.94100	.	.	ENSG00000081307	ENST00000264991;ENST00000356232;ENST00000493720;ENST00000468022;ENST00000473651;ENST00000494238;ENST00000464068;ENST00000489361	T;T;T;T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52;0.52;0.52;0.52	5.62	5.62	0.85841	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.039492	0.85682	D	0.000000	T	0.80979	0.4728	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86954	0.2087	10	0.87932	D	0	-19.7757	15.837	0.78805	1.0:0.0:0.0:0.0	.	112;112	E7EWE1;Q9GZZ9	.;UBA5_HUMAN	D	56;112;112;56;112;56;22;56	ENSP00000264991:N56D;ENSP00000348565:N112D;ENSP00000417879:N112D;ENSP00000418569:N56D;ENSP00000424984:N112D;ENSP00000418807:N56D;ENSP00000420055:N22D;ENSP00000417905:N56D	ENSP00000264991:N56D	N	+	1	0	UBA5	133870388	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.265000	0.95647	2.140000	0.66376	0.460000	0.39030	AAT		0.323	UBA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357187.2		NM_024818	
UBE4B	10277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	10163026	10163026	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr1:10163026A>T	ENST00000253251.8	+	5	1295	c.456A>T	c.(454-456)gaA>gaT	p.E152D	UBE4B_ENST00000377157.3_Missense_Mutation_p.E36D|UBE4B_ENST00000343090.6_Missense_Mutation_p.E152D					ubiquitination factor E4B									p.E152D(2)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CGGGCCCTGAAGTGTCTGAAG	0.448																																																	2	Substitution - Missense(2)	kidney(2)											82.0	77.0	79.0					1																	10163026		2203	4300	6503	SO:0001583	missense	10277			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.456A>T	1.37:g.10163026A>T	ENSP00000253251:p.Glu152Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.321114	0.60634	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.54479	0.68;0.69;0.57	5.98	-3.85	0.04243	.	0.046905	0.85682	D	0.000000	T	0.34454	0.0898	N	0.20986	0.625	0.27364	N	0.955891	B;B	0.09022	0.002;0.002	B;B	0.11329	0.004;0.006	T	0.12142	-1.0559	10	0.30854	T	0.27	-23.2899	16.0175	0.80455	0.4499:0.0:0.5501:0.0	.	152;152	O95155;O95155-2	UBE4B_HUMAN;.	D	152;36;152	ENSP00000253251:E152D;ENSP00000366362:E36D;ENSP00000343001:E152D	ENSP00000253251:E152D	E	+	3	2	UBE4B	10085613	0.996000	0.38824	0.973000	0.42090	0.996000	0.88848	0.391000	0.20784	-0.680000	0.05211	0.528000	0.53228	GAA		0.448	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1		NM_006048	
UBR5	51366	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	103341598	103341598	+	Silent	SNP	A	A	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:103341598A>G	ENST00000520539.1	-	10	1734	c.1128T>C	c.(1126-1128)gcT>gcC	p.A376A	UBR5_ENST00000521922.1_Silent_p.A370A|UBR5_ENST00000220959.4_Silent_p.A376A	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	376					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.A376A(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGAATACAGAGCCCCAATAC	0.333																																					Ovarian(131;96 1741 5634 7352 27489)												1	Substitution - coding silent(1)	kidney(1)											113.0	123.0	120.0					8																	103341598		2203	4300	6503	SO:0001819	synonymous_variant	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.1128T>C	8.37:g.103341598A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	37	CCDS34933.1																																																																																				0.333	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2		NM_015902	
DNAH17-AS1	100996295	broad.mit.edu	37	17	76497744	76497744	+	3'UTR	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr17:76497744T>G	ENST00000598378.1	+	0	2834				RP11-559N14.5_ENST00000591373.1_RNA|DNAH17_ENST00000585328.1_Intron|DNAH17_ENST00000389840.5_Intron					DNAH17 antisense RNA 1																		AGTGGCAGGGTCTGAAGTCCC	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0					17q25.3	2014-02-12	2013-05-21		ENSG00000268470	ENSG00000267432		"""Long non-coding RNAs"""	48594	non-coding RNA	RNA, long non-coding							Standard	NR_102401		Approved				OTTHUMG00000177588	ENST00000598378.1:c.*1181T>G	17.37:g.76497744T>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000598378.1	37																																																																																					0.627	DNAH17-AS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				
UQCRB	7381	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	97244062	97244062	+	Silent	SNP	T	T	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:97244062T>A	ENST00000287022.5	-	3	301	c.198A>T	c.(196-198)gcA>gcT	p.A66A	UQCRB_ENST00000518406.1_Silent_p.A66A|UQCRB_ENST00000517523.1_Silent_p.A34A|UQCRB_ENST00000523920.1_Silent_p.A66A	NM_001199975.2|NM_006294.4	NP_001186904.1|NP_006285.1	P14927	QCR7_HUMAN	ubiquinol-cytochrome c reductase binding protein	66					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)		p.A66A(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10	Breast(36;5.16e-05)					TCAGGTCCAGTGCCCTCTTAA	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											176.0	156.0	163.0					8																	97244062		2203	4300	6503	SO:0001819	synonymous_variant	7381			X13585	CCDS6269.1, CCDS59107.1	8q22	2011-07-04			ENSG00000156467	ENSG00000156467		"""Mitochondrial respiratory chain complex / Complex III"""	12582	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VI"", ""cytochrome b-c1 complex subunit 7"""	191330		UQBP		2167087, 2543413, 3056408	Standard	NM_006294		Approved	QP-C, QCR7, UQCR6	uc022ayx.1	P14927	OTTHUMG00000164711	ENST00000287022.5:c.198A>T	8.37:g.97244062T>A		Somatic		WXS	Illumina HiSeq	Phase_I	E5RJU0|Q6FGD1	Silent	SNP	ENST00000287022.5	37	CCDS6269.1																																																																																				0.413	UQCRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379863.1		NM_006294	
IFI35	3430	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	41168133	41168133	+	IGR	SNP	T	T	G			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr17:41168133T>G	ENST00000415816.2	+	0	1241				VAT1_ENST00000420567.3_Missense_Mutation_p.E242A|VAT1_ENST00000587173.1_Missense_Mutation_p.E308A|VAT1_ENST00000355653.3_Missense_Mutation_p.E376A	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35						cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.E376A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		ATTCTTCTTCTCCTGCATCTG	0.557																																																	1	Substitution - Missense(1)	kidney(1)											341.0	315.0	324.0					17																	41168133		2203	4300	6503	SO:0001628	intergenic_variant	10493			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720		17.37:g.41168133T>G		Somatic		WXS	Illumina HiSeq	Phase_I	C9JGX1|Q92984|Q99537|Q9BV98	Missense_Mutation	SNP	ENST00000415816.2	37		.	.	.	.	.	.	.	.	.	.	T	16.54	3.152071	0.57259	.	.	ENSG00000108828	ENST00000355653;ENST00000542468;ENST00000420567	T;T	0.10960	3.55;2.82	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.13628	0.0330	L	0.41356	1.27	0.80722	D	1	D;B	0.54772	0.968;0.125	P;B	0.45343	0.477;0.082	T	0.01212	-1.1417	10	0.59425	D	0.04	-27.1017	15.1481	0.72674	0.0:0.0:0.0:1.0	.	308;376	B4DPX4;Q99536	.;VAT1_HUMAN	A	376;283;242	ENSP00000347872:E376A;ENSP00000408553:E242A	ENSP00000347872:E376A	E	-	2	0	VAT1	38421659	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.432000	0.59922	1.998000	0.58463	0.459000	0.35465	GAG		0.557	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000395851.1		NM_005533	
VCPIP1	80124	hgsc.bcm.edu;ucsc.edu	37	8	67546975	67546980	+	In_Frame_Del	DEL	CAACTT	CAACTT	-			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	CAACTT	CAACTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:67546975_67546980delCAACTT	ENST00000310421.4	-	3	3683_3688	c.3425_3430delAAGTTG	c.(3424-3432)gaagttgtg>gtg	p.EV1142del		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1142					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GAAGAACTCACAACTTCTGTTTTCCT	0.422																																					NSCLC(179;265 2915 6144 43644)												0																																										SO:0001651	inframe_deletion	80124			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3425_3430delAAGTTG	8.37:g.67546975_67546980delCAACTT	ENSP00000309031:p.Glu1142_Val1143del	Somatic		WXS	Illumina HiSeq	Phase_I	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	In_Frame_Del	DEL	ENST00000310421.4	37	CCDS6192.1																																																																																				0.422	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1			
VHL	7428	broad.mit.edu	37	3	10183864	10183865	+	Frame_Shift_Ins	INS	-	-	A	rs104893824		TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	Illumina Miseq;PacBio			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr3:10183864_10183865insA	ENST00000256474.2	+	1	1173_1174	c.333_334insA	c.(334-336)tacfs	p.Y112fs	VHL_ENST00000345392.2_Frame_Shift_Ins_p.Y112fs|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	112	Involved in binding to CCT complex.		Y -> H (in VHLD; type IIA).|Y -> N (in VHLD). {ECO:0000269|PubMed:10533030}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.S111R(3)|p.S111S(2)|p.?(1)|p.Y112D(1)|p.I109_R113del(1)|p.S111fs*45(1)|p.H110_S111del(1)|p.S111_Y112del(1)|p.Y112fs*47(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCATCCACAGCTACCGAGGTAC	0.693		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	12	Substitution - Missense(4)|Deletion - In frame(3)|Deletion - Frameshift(2)|Substitution - coding silent(2)|Unknown(1)	kidney(12)	GRCh37	CM951281|CM951283|CM992977	VHL	M	rs104893824																																			SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	Exception_encountered	3.37:g.10183864_10183865insA	ENSP00000256474:p.Tyr112fs	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Ins	INS	ENST00000256474.2	37	CCDS2597.1																																																																																				0.693	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR11	55717	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	122663626	122663626	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr10:122663626G>A	ENST00000263461.6	+	24	3245	c.2999G>A	c.(2998-3000)tGt>tAt	p.C1000Y	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.C1000Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						ACAAGGAAATGTACAGACCAG	0.338																																																	1	Substitution - Missense(1)	kidney(1)											110.0	110.0	110.0					10																	122663626		2203	4300	6503	SO:0001583	missense	55717			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.2999G>A	10.37:g.122663626G>A	ENSP00000263461:p.Cys1000Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	37	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004802	0.93287	.	.	ENSG00000120008	ENST00000263461	D	0.91577	-2.87	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.94860	0.8339	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.76494	0.998;0.995;0.999;0.99	D;D;D;P	0.78314	0.991;0.986;0.952;0.643	D	0.94614	0.7807	10	0.72032	D	0.01	-19.3312	20.1802	0.98196	0.0:0.0:1.0:0.0	.	1000;1000;291;529	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	Y	1000	ENSP00000263461:C1000Y	ENSP00000263461:C1000Y	C	+	2	0	WDR11	122653616	1.000000	0.71417	0.973000	0.42090	0.982000	0.71751	8.816000	0.91979	2.777000	0.95525	0.655000	0.94253	TGT		0.338	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2			
XPO7	23039	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	21840307	21840307	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr8:21840307G>C	ENST00000252512.9	+	11	1361	c.1261G>C	c.(1261-1263)Gtg>Ctg	p.V421L	XPO7_ENST00000433566.4_Missense_Mutation_p.V422L|XPO7_ENST00000434536.1_Missense_Mutation_p.V430L	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	421				Missing (in Ref. 3; BAA34465). {ECO:0000305}.	mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)	p.V421L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		GTTGGAATCTGTGCACATCAT	0.517																																																	1	Substitution - Missense(1)	kidney(1)											153.0	152.0	152.0					8																	21840307		2036	4206	6242	SO:0001583	missense	23039			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1261G>C	8.37:g.21840307G>C	ENSP00000252512:p.Val421Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	37	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	G	34	5.358393	0.95854	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.65549	-0.16;-0.16;-0.16	5.84	5.84	0.93424	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81880	0.4916	M	0.88512	2.96	0.80722	D	1	D;P;B	0.65815	0.995;0.691;0.353	D;B;B	0.65443	0.935;0.414;0.188	T	0.79904	-0.1606	10	0.28530	T	0.3	-17.3276	19.7463	0.96253	0.0:0.0:1.0:0.0	.	422;430;421	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	L	430;421;422	ENSP00000404853:V430L;ENSP00000252512:V421L;ENSP00000410249:V422L	ENSP00000252512:V421L	V	+	1	0	XPO7	21896253	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.946000	0.87746	2.771000	0.95319	0.655000	0.94253	GTG		0.517	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1		NM_015024	
ZC3H18	124245	broad.mit.edu;ucsc.edu	37	16	88696911	88696911	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr16:88696911C>T	ENST00000301011.5	+	17	2785	c.2585C>T	c.(2584-2586)tCa>tTa	p.S862L	ZC3H18_ENST00000452588.2_Missense_Mutation_p.S886L	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	862						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S862L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GACCGGAAGTCAGGTGGGAGA	0.632																																					Ovarian(121;375 2276 20373 38669)												1	Substitution - Missense(1)	kidney(1)											53.0	49.0	50.0					16																	88696911		2197	4300	6497	SO:0001583	missense	124245			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2585C>T	16.37:g.88696911C>T	ENSP00000301011:p.Ser862Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	37	CCDS10967.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.458495|4.458495	0.84317|0.84317	.|.	.|.	ENSG00000158545|ENSG00000158545	ENST00000289509|ENST00000301011;ENST00000452588	.|T;T	.|0.32272	.|1.46;1.47	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.369277	.|0.30492	.|N	.|0.009507	.|T	.|0.38268	.|0.1034	L|L	0.36672|0.36672	1.1|1.1	0.31694|0.31694	N|N	0.641501|0.641501	.|P;P	.|0.52692	.|0.955;0.955	.|P;P	.|0.53401	.|0.725;0.725	.|T	.|0.40961	.|-0.9535	.|10	0.87932|0.51188	D|T	0|0.08	-14.9406|-14.9406	15.8382|15.8382	0.78814|0.78814	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|886;862	.|E7ERS3;Q86VM9	.|.;ZCH18_HUMAN	X|L	688|862;886	.|ENSP00000301011:S862L;ENSP00000416951:S886L	ENSP00000289509:Q688X|ENSP00000301011:S862L	Q|S	+|+	1|2	0|0	ZC3H18|ZC3H18	87224412|87224412	0.998000|0.998000	0.40836|0.40836	0.965000|0.965000	0.40720|0.40720	0.966000|0.966000	0.64601|0.64601	3.238000|3.238000	0.51352|0.51352	2.517000|2.517000	0.84864|0.84864	0.462000|0.462000	0.41574|0.41574	CAG|TCA		0.632	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1		NM_144604	
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	G	A	rs113700997	byFrequency	TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr19:52942411G>A	ENST00000332323.6	+	4	1798	c.1737G>A	c.(1735-1737)gcG>gcA	p.A579A	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Silent_p.A566A|ZNF534_ENST00000432303.2_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	579					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A579A(4)		central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CACACCTTGCGCGACATAGGA	0.443																																																	4	Substitution - coding silent(4)	kidney(4)											63.0	62.0	62.0					19																	52942411		692	1591	2283	SO:0001819	synonymous_variant	147658			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1737G>A	19.37:g.52942411G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q76KX9	Silent	SNP	ENST00000332323.6	37	CCDS46165.1																																																																																				0.443	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1		NM_182512	
ZNF76	7629	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	35258122	35258122	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr6:35258122G>T	ENST00000373953.3	+	6	778	c.512G>T	c.(511-513)gGc>gTc	p.G171V	ZNF76_ENST00000339411.5_Missense_Mutation_p.G171V|ZNF76_ENST00000440666.2_Missense_Mutation_p.G145V	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	171					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G171V(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						GGCTACAAGGGCTGTGGGCGT	0.532																																					Esophageal Squamous(52;92 1039 20612 23956 34676)												1	Substitution - Missense(1)	kidney(1)											221.0	203.0	209.0					6																	35258122		2203	4300	6503	SO:0001583	missense	7629			M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.512G>T	6.37:g.35258122G>T	ENSP00000363064:p.Gly171Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BQB2	Missense_Mutation	SNP	ENST00000373953.3	37	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.729151	0.89390	.	.	ENSG00000065029	ENST00000469195;ENST00000448999;ENST00000373953;ENST00000417184;ENST00000440666;ENST00000339411	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	4.49	4.49	0.54785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42548	D	0.000695	T	0.44180	0.1281	L	0.41415	1.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.44528	-0.9322	10	0.72032	D	0.01	.	16.7003	0.85348	0.0:0.0:1.0:0.0	.	171;171;171	B7Z851;P36508-2;P36508	.;.;ZNF76_HUMAN	V	171;171;171;171;145;171	ENSP00000419106:G171V;ENSP00000363064:G171V;ENSP00000392243:G145V;ENSP00000344097:G171V	ENSP00000344097:G171V	G	+	2	0	ZNF76	35366100	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.591000	0.98241	2.505000	0.84491	0.561000	0.74099	GGC		0.532	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2		NM_003427	
MACROD2	140733	ucsc.edu	37	20	15412103	15412103	+	Intron	SNP	A	A	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr20:15412103A>T	ENST00000310348.4	+	7	571				MACROD2_ENST00000402914.1_Intron|MACROD2_ENST00000217246.4_Intron			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2						brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GCTTTTGATGATGTTTGTATT	0.303																																						.											0													265.0	232.0	242.0					20																	15412103		1826	4085	5911	SO:0001627	intron_variant	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.571+23A>T	20.37:g.15412103A>T		Somatic		WXS	Illumina HiSeq	.	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Intron	SNP	ENST00000310348.4	37	CCDS13120.2																																																																																				0.303	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_080676	
ZNF831	128611	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	57766296	57766296	+	Silent	SNP	C	C	T			TCGA-B0-5075-01A-01D-1462-08	TCGA-B0-5075-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	93237b8e-c9a1-45dd-b160-cfe97e648598	efae71ac-e747-402b-bb95-346f534076cd	g.chr20:57766296C>T	ENST00000371030.2	+	1	222	c.222C>T	c.(220-222)cgC>cgT	p.R74R		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	74	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R74R(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCCAGCCCCGCGCCCCGCTAG	0.701																																																	2	Substitution - coding silent(2)	kidney(1)|endometrium(1)											8.0	9.0	9.0					20																	57766296		1826	4018	5844	SO:0001819	synonymous_variant	128611			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.222C>T	20.37:g.57766296C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	CCDS42894.1																																																																																				0.701	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2		NM_178457	
