#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAP1	11033	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	939073	939073	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr7:939073A>C	ENST00000265846.5	-	9	1069	c.850T>G	c.(850-852)Tac>Gac	p.Y284D	ADAP1_ENST00000539900.1_Missense_Mutation_p.Y295D|ADAP1_ENST00000449296.2_Missense_Mutation_p.Y212D	NM_001284308.1|NM_001284309.1|NM_001284311.1|NM_006869.2	NP_001271237.1|NP_001271238.1|NP_001271240.1|NP_006860	O75689	ADAP1_HUMAN	ArfGAP with dual PH domains 1	284	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF GTPase activity (GO:0032312)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.Y284D(1)		endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	6						TCTTTGAAGTACATGAGCCTG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											70.0	57.0	62.0					7																	939073		2203	4299	6502	SO:0001583	missense	11033			AJ006422	CCDS5318.1, CCDS64576.1, CCDS64577.1, CCDS75558.1	7p22.3	2013-01-10	2008-09-22	2008-09-22	ENSG00000105963	ENSG00000105963		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16486	protein-coding gene	gene with protein product		608114	"""centaurin, alpha 1"""	CENTA1		10333475	Standard	NM_006869		Approved	GCS1L	uc003sjo.4	O75689	OTTHUMG00000023380	ENST00000265846.5:c.850T>G	7.37:g.939073A>C	ENSP00000265846:p.Tyr284Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2Q2|B3KRZ4|B4DVA6|F6XZ68|H7C2Q4	Missense_Mutation	SNP	ENST00000265846.5	37	CCDS5318.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	16.14|16.14	3.038262|3.038262	0.54896|0.54896	.|.	.|.	ENSG00000105963|ENSG00000105963	ENST00000446141|ENST00000265846;ENST00000449296;ENST00000449929;ENST00000538188;ENST00000539900;ENST00000453175	.|T;T;T	.|0.37752	.|1.18;1.18;1.18	4.4|4.4	4.4|4.4	0.53042|0.53042	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.063724	.|0.64402	.|D	.|0.000004	T|T	0.67439|0.67439	0.2893|0.2893	M|M	0.92169|0.92169	3.28|3.28	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	T|T	0.76537|0.76537	-0.2923|-0.2923	5|10	.|0.87932	.|D	.|0	-25.7198|-25.7198	13.2599|13.2599	0.60098|0.60098	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|189;284	.|B4DUZ7;O75689	.|.;ADAP1_HUMAN	W|D	266|284;212;110;170;295;149	.|ENSP00000265846:Y284D;ENSP00000407267:Y212D;ENSP00000442682:Y295D	.|ENSP00000265846:Y284D	C|Y	-|-	3|1	2|0	ADAP1|ADAP1	905599|905599	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.303000|0.303000	0.27691|0.27691	5.759000|5.759000	0.68785|0.68785	1.611000|1.611000	0.50210|0.50210	0.454000|0.454000	0.30748|0.30748	TGT|TAC		0.662	ADAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059701.2		NM_006869	
AKR1B10	57016	hgsc.bcm.edu;ucsc.edu	37	7	134222410	134222410	+	Silent	SNP	C	C	T	rs61735101	byFrequency	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr7:134222410C>T	ENST00000359579.4	+	7	1058	c.738C>T	c.(736-738)gcC>gcT	p.A246A		NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	246					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						AAACCGCAGCCCAGGTGCCAT	0.453													C|||	23	0.00459265	0.0174	0.0	5008	,	,		21292	0.0		0.0	False		,,,				2504	0.0																0								C		82,4324		0,82,2121	81.0	90.0	87.0		738	0.8	1.0	7	dbSNP_129	87	0,8600		0,0,4300	no	coding-synonymous	AKR1B10	NM_020299.4		0,82,6421	TT,TC,CC		0.0,1.8611,0.6305		246/317	134222410	82,12924	2203	4300	6503	SO:0001819	synonymous_variant	57016			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.738C>T	7.37:g.134222410C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1P1|O75890|Q6FHF3|Q8IWZ1	Silent	SNP	ENST00000359579.4	37	CCDS5832.1																																																																																				0.453	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1		NM_020299	
ALPK3	57538	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	85406027	85406027	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr15:85406027G>A	ENST00000258888.5	+	10	5064	c.4897G>A	c.(4897-4899)Ggg>Agg	p.G1633R		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1633	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G1633R(2)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GGTCATCTACGGGCTGGAACC	0.607																																																	2	Substitution - Missense(2)	kidney(2)											95.0	93.0	93.0					15																	85406027		2203	4299	6502	SO:0001583	missense	57538			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4897G>A	15.37:g.85406027G>A	ENSP00000258888:p.Gly1633Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849162	0.91277	.	.	ENSG00000136383	ENST00000258888	T	0.08282	3.11	4.86	4.86	0.63082	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	M	0.62723	1.935	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.00510	-1.1697	10	0.87932	D	0	-25.6664	15.5217	0.75871	0.0:0.0:1.0:0.0	.	1633	Q96L96	ALPK3_HUMAN	R	1633	ENSP00000258888:G1633R	ENSP00000258888:G1633R	G	+	1	0	ALPK3	83207031	1.000000	0.71417	0.995000	0.50966	0.920000	0.55202	9.069000	0.93967	2.507000	0.84556	0.655000	0.94253	GGG		0.607	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1		NM_020778	
ANLN	54443	broad.mit.edu	37	7	36478858	36478858	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr7:36478858A>C	ENST00000265748.2	+	21	3150	c.2929A>C	c.(2929-2931)Aaa>Caa	p.K977Q	ANLN_ENST00000396068.2_Missense_Mutation_p.K940Q	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	977	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.K977Q(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						tttaaaaataaaatGTCAAGT	0.303																																																	1	Substitution - Missense(1)	kidney(1)											76.0	77.0	76.0					7																	36478858		2200	4297	6497	SO:0001583	missense	54443			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2929A>C	7.37:g.36478858A>C	ENSP00000265748:p.Lys977Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	CCDS5447.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	11.76|11.76|11.76	1.735488|1.735488|1.735488	0.30774|0.30774|0.30774	.|.|.	.|.|.	ENSG00000011426|ENSG00000011426|ENSG00000011426	ENST00000265748;ENST00000396068|ENST00000428612|ENST00000457743	T;T|.|.	0.12361|.|.	2.69;2.7|.|.	5.22|5.22|5.22	5.22|5.22|5.22	0.72569|0.72569|0.72569	Pleckstrin homology-type (1);|.|.	0.198017|0.198017|.	0.52532|0.52532|.	D|D|.	0.000064|0.000064|.	T|T|.	0.43765|0.43765|.	0.1262|0.1262|.	N|N|N	0.16307|0.16307|0.16307	0.4|0.4|0.4	0.39746|0.39746|0.39746	D|D|D	0.971814|0.971814|0.971814	P;B;B;B|.|.	0.48089|.|.	0.905;0.027;0.045;0.058|.|.	P;B;B;B|.|.	0.46758|.|.	0.526;0.012;0.028;0.012|.|.	T|T|.	0.41106|0.41106|.	-0.9527|-0.9527|.	10|6|.	0.26408|.|.	T|.|.	0.33|.|.	-1.3396|-1.3396|-1.3396	14.2117|14.2117|14.2117	0.65769|0.65769|0.65769	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	854;939;940;977|.|.	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6|.|.	.;.;.;ANLN_HUMAN|.|.	Q|T|Y	977;940|141|198	ENSP00000265748:K977Q;ENSP00000379380:K940Q|.|.	ENSP00000265748:K977Q|.|.	K|K|X	+|+|+	1|2|3	0|0|2	ANLN|ANLN|ANLN	36445383|36445383|36445383	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	3.760000|3.760000|3.760000	0.55235|0.55235|0.55235	2.084000|2.084000|2.084000	0.62774|0.62774|0.62774	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	AAA|AAA|TAA		0.303	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3		NM_018685	
ARHGAP5	394	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	32560575	32560575	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr14:32560575delA	ENST00000345122.3	+	2	1015	c.700delA	c.(700-702)aacfs	p.N234fs	ARHGAP5_ENST00000432921.1_Frame_Shift_Del_p.N234fs|ARHGAP5_ENST00000556611.1_Frame_Shift_Del_p.N234fs|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Frame_Shift_Del_p.N234fs	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	234					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		ATTTAATGTCAACATTGAAAC	0.348																																					NSCLC(9;77 350 3443 29227 41353)												0													97.0	104.0	102.0					14																	32560575		2203	4300	6503	SO:0001589	frameshift_variant	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.700delA	14.37:g.32560575delA	ENSP00000371897:p.Asn234fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Frame_Shift_Del	DEL	ENST00000345122.3	37	CCDS32062.1																																																																																				0.348	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1		NM_001030055	
ATR	545	hgsc.bcm.edu;ucsc.edu	37	3	142266605	142266605	+	Frame_Shift_Del	DEL	A	A	-	rs368676027		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr3:142266605delA	ENST00000350721.4	-	16	3440	c.3319delT	c.(3319-3321)tatfs	p.Y1107fs	ATR_ENST00000383101.3_Frame_Shift_Del_p.Y1043fs	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1107					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GGGCCCTGATATGGATCATCA	0.358								Other conserved DNA damage response genes																																									0													114.0	105.0	108.0					3																	142266605		2203	4300	6503	SO:0001589	frameshift_variant	545			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.3319delT	3.37:g.142266605delA	ENSP00000343741:p.Tyr1107fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Frame_Shift_Del	DEL	ENST00000350721.4	37	CCDS3124.1																																																																																				0.358	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2		NM_001184	
PHF7	51533	broad.mit.edu;hgsc.bcm.edu	37	3	52442512	52442512	+	5'Flank	SNP	T	T	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr3:52442512T>C	ENST00000327906.3	+	0	0				PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Missense_Mutation_p.N78S|BAP1_ENST00000296288.5_Missense_Mutation_p.N78S	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.N78S(2)|p.I72fs*7(1)|p.I76fs*45(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		GAACATGTTATTCACAATATC	0.488																																																	4	Substitution - Missense(2)|Deletion - Frameshift(2)	kidney(2)|eye(1)|pleura(1)											63.0	53.0	56.0					3																	52442512		2202	4299	6501	SO:0001631	upstream_gene_variant	8314			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52442512T>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.931031	0.73327	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.40756	1.02;1.02	5.52	5.52	0.82312	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.090448	0.85682	D	0.000000	T	0.41926	0.1180	N	0.25031	0.7	0.80722	D	1	P	0.41978	0.767	P	0.49361	0.608	T	0.30909	-0.9962	10	0.42905	T	0.14	-2.8537	15.6492	0.77078	0.0:0.0:0.0:1.0	.	78	Q92560	BAP1_HUMAN	S	78	ENSP00000417132:N78S;ENSP00000296288:N78S	ENSP00000296288:N78S	N	-	2	0	BAP1	52417552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.005000	0.88553	2.106000	0.64143	0.533000	0.62120	AAT		0.488	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1		NM_016483	
NATD1	256302	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	21147503	21147503	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr17:21147503G>A	ENST00000468196.1	-	2	285	c.140C>T	c.(139-141)aCg>aTg	p.T47M	C17orf103_ENST00000399011.2_Silent_p.Y46Y			Q8N6N6	NATD1_HUMAN		0	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.							p.Y46Y(1)|p.T47M(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						GCTTGCCCACGTACTCATAGA	0.627																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)											44.0	47.0	46.0					17																	21147503		2160	4261	6421	SO:0001583	missense	256302																														ENST00000468196.1:c.140C>T	17.37:g.21147503G>A	ENSP00000457007:p.Thr47Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8MWQ7|B3KX70	Missense_Mutation	SNP	ENST00000468196.1	37																																																																																					0.627	C17orf103-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253275.4			
C3	718	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6686809	6686809	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr19:6686809C>G	ENST00000245907.6	-	28	3686	c.3594G>C	c.(3592-3594)caG>caC	p.Q1198H		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1198					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.Q1198H(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	GCCTGCCCATCTGGGCCAGAG	0.532																																																	1	Substitution - Missense(1)	kidney(1)											158.0	147.0	151.0					19																	6686809		2203	4300	6503	SO:0001583	missense	718			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.3594G>C	19.37:g.6686809C>G	ENSP00000245907:p.Gln1198His	Somatic		WXS	Illumina HiSeq	Phase_I	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.584678	0.28268	.	.	ENSG00000125730	ENST00000245907	T	0.32753	1.44	6.06	1.46	0.22682	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.695276	0.14070	N	0.343441	T	0.16257	0.0391	N	0.17082	0.46	0.09310	N	1	B	0.18461	0.028	B	0.19148	0.024	T	0.19192	-1.0313	10	0.51188	T	0.08	.	4.1592	0.10275	0.1315:0.5997:0.127:0.1418	.	1198	P01024	CO3_HUMAN	H	1198	ENSP00000245907:Q1198H	ENSP00000245907:Q1198H	Q	-	3	2	C3	6637809	0.000000	0.05858	0.000000	0.03702	0.419000	0.31324	0.154000	0.16343	0.122000	0.18314	0.655000	0.94253	CAG		0.532	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2		NM_000064	
TMEM242	729515	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	157744466	157744466	+	Silent	SNP	A	A	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr6:157744466A>G	ENST00000400788.4	-	1	167	c.66T>C	c.(64-66)aaT>aaC	p.N22N	TMEM242_ENST00000367144.4_Silent_p.N22N|RP5-933K21.3_ENST00000603032.1_lincRNA	NM_018452.4	NP_060922.2	Q9NWH2	TM242_HUMAN	transmembrane protein 242	22						integral component of membrane (GO:0016021)		p.N22N(1)									AAAGCCGGTCATTCGTGGACC	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											116.0	130.0	125.0					6																	157744466		1938	4135	6073	SO:0001819	synonymous_variant	0			AF217510	CCDS43519.1	6q25.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000215712	ENSG00000215712			17206	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 35"""	C6orf35			Standard	NM_018452		Approved	BM033	uc003sih.4	Q9NWH2	OTTHUMG00000015893	ENST00000400788.4:c.66T>C	6.37:g.157744466A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B9EJD0|Q9NZ88|Q9P094	Silent	SNP	ENST00000400788.4	37	CCDS43519.1																																																																																				0.637	TMEM242-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042837.2			
CAPN3	825	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42702005	42702005	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr15:42702005T>G	ENST00000397163.3	+	18	2232	c.2013T>G	c.(2011-2013)gaT>gaG	p.D671E	CAPN3_ENST00000569136.1_Missense_Mutation_p.D6E|CAPN3_ENST00000357568.3_Missense_Mutation_p.D665E|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000337571.4_Missense_Mutation_p.D6E|CAPN3_ENST00000356316.3_Missense_Mutation_p.D578E|CAPN3_ENST00000397200.4_Missense_Mutation_p.D159E|CAPN3_ENST00000349748.3_Missense_Mutation_p.D579E|CAPN3_ENST00000318023.7_Missense_Mutation_p.D665E|CAPN3_ENST00000562199.1_3'UTR|CAPN3_ENST00000561817.1_Missense_Mutation_p.D6E|CAPN3_ENST00000397204.4_Missense_Mutation_p.D6E	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	671	Domain IV.|EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.D578E(1)|p.D665E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TCTGTGCAGATGAGCTCAAGA	0.537																																																	2	Substitution - Missense(2)	kidney(2)											150.0	143.0	145.0					15																	42702005		2203	4299	6502	SO:0001583	missense	825			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2013T>G	15.37:g.42702005T>G	ENSP00000380349:p.Asp671Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	T	12.12	1.842273	0.32513	.	.	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200;ENST00000337571;ENST00000397204	T;T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84	4.79	-1.7	0.08159	EF-hand-like domain (1);	0.123301	0.53938	U	0.000058	T	0.42854	0.1221	N	0.04297	-0.235	0.31256	N	0.693509	B;B;B;B;B;B;B	0.20052	0.023;0.041;0.008;0.018;0.033;0.02;0.002	B;B;B;B;B;B;B	0.30716	0.042;0.119;0.029;0.024;0.072;0.033;0.013	T	0.40098	-0.9581	10	0.07325	T	0.83	.	4.2445	0.10665	0.1076:0.4118:0.1106:0.37	.	536;584;6;579;665;671;578	C6EVS4;C6EVS3;A4FTZ9;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;.;CAN3_HUMAN;.	E	578;159;671;665;579;665;159;6;6	ENSP00000348667:D578E;ENSP00000380349:D671E;ENSP00000350181:D665E;ENSP00000183936:D579E;ENSP00000326281:D665E;ENSP00000380384:D159E;ENSP00000336840:D6E;ENSP00000380387:D6E	ENSP00000326281:D665E	D	+	3	2	CAPN3	40489297	0.511000	0.26179	0.988000	0.46212	0.971000	0.66376	-0.280000	0.08468	-0.515000	0.06479	-0.512000	0.04463	GAT		0.537	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1			
CCNT1	904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	49110458	49110458	+	Start_Codon_SNP	SNP	T	T	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr12:49110458T>G	ENST00000261900.3	-	1	223	c.1A>C	c.(1-3)Atg>Ctg	p.M1L		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	1					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.M1L(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						TCTCCCTCCATAGTGCTTCAA	0.557											OREG0021767	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											159.0	143.0	149.0					12																	49110458		2203	4300	6503	SO:0001582	initiator_codon_variant	904			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1A>C	12.37:g.49110458T>G	ENSP00000261900:p.Met1Leu	Somatic	959	WXS	Illumina HiSeq	Phase_I	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	T	17.18	3.322691	0.60634	.	.	ENSG00000129315	ENST00000261900	T	0.15487	2.42	5.65	5.65	0.86999	.	0.115539	0.64402	D	0.000008	T	0.14056	0.0340	.	.	.	0.80722	D	1	B	0.21309	0.054	B	0.16722	0.016	T	0.04509	-1.0946	9	0.56958	D	0.05	-12.6003	8.7079	0.34365	0.0:0.0847:0.0:0.9153	.	1	O60563	CCNT1_HUMAN	L	1	ENSP00000261900:M1L	ENSP00000261900:M1L	M	-	1	0	CCNT1	47396725	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.013000	0.49582	2.288000	0.76882	0.533000	0.62120	ATG		0.557	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1		NM_001240	Missense_Mutation
CHL1	10752	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	443351	443351	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr3:443351C>T	ENST00000256509.2	+	27	4070	c.3428C>T	c.(3427-3429)tCa>tTa	p.S1143L	CHL1_ENST00000397491.2_Missense_Mutation_p.S1127L	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.S1143L(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GAAATTCAGTCAGTAAAAGAT	0.303																																																	1	Substitution - Missense(1)	kidney(1)											91.0	95.0	94.0					3																	443351		2203	4300	6503	SO:0001583	missense	10752			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3428C>T	3.37:g.443351C>T	ENSP00000256509:p.Ser1143Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.98|19.98	3.927647|3.927647	0.73327|0.73327	.|.	.|.	ENSG00000134121|ENSG00000134121	ENST00000445697|ENST00000256509;ENST00000397491	.|D;D	.|0.85861	.|-2.04;-2.04	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	.|0.175393	.|0.40469	.|N	.|0.001086	.|D	.|0.85182	.|0.5638	L|L	0.33485|0.33485	1.01|1.01	0.39587|0.39587	D|D	0.969522|0.969522	.|P;P	.|0.47034	.|0.845;0.889	.|P;P	.|0.51135	.|0.642;0.66	.|D	.|0.85889	.|0.1427	.|10	.|0.42905	.|T	.|0.14	.|.	18.7377|18.7377	0.91761|0.91761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1127;1143	.|O00533;O00533-2	.|CHL1_HUMAN;.	X|L	277|1143;1127	.|ENSP00000256509:S1143L;ENSP00000380628:S1127L	.|ENSP00000256509:S1143L	Q|S	+|+	1|2	0|0	CHL1|CHL1	418351|418351	1.000000|1.000000	0.71417|0.71417	0.824000|0.824000	0.32777|0.32777	0.990000|0.990000	0.78478|0.78478	2.705000|2.705000	0.47127|0.47127	2.417000|2.417000	0.82017|0.82017	0.585000|0.585000	0.79938|0.79938	CAG|TCA		0.303	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2		NM_006614	
CIDEB	27141	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24774973	24774973	+	Splice_Site	SNP	T	T	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr14:24774973T>C	ENST00000336557.5	-	8	1830		c.e8-2		CIDEB_ENST00000258807.5_Splice_Site|NOP9_ENST00000267425.3_3'UTR|CIDEB_ENST00000554411.1_Splice_Site			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b						apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)	p.?(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		AGGAGCTCCCTGAATGGCAGA	0.532																																																	1	Unknown(1)	kidney(1)											53.0	48.0	50.0					14																	24774973		2203	4300	6503	SO:0001630	splice_region_variant	27141			AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.528-2A>G	14.37:g.24774973T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DS73|Q546V8|Q9NNW9	Splice_Site	SNP	ENST00000336557.5	37	CCDS32056.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711061	0.68730	.	.	ENSG00000136305	ENST00000554411;ENST00000336557;ENST00000258807;ENST00000541830	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2259	0.65858	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CIDEB	23844813	1.000000	0.71417	0.936000	0.37596	0.966000	0.64601	4.695000	0.61767	2.013000	0.59113	0.383000	0.25322	.		0.532	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414120.1			Intron
CPEB1	64506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	83226709	83226709	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr15:83226709C>A	ENST00000562019.1	-	4	723	c.407G>T	c.(406-408)gGa>gTa	p.G136V	CPEB1_ENST00000564522.1_Missense_Mutation_p.G61V|CPEB1_ENST00000568128.1_Missense_Mutation_p.G136V|CPEB1_ENST00000450751.2_Missense_Mutation_p.G61V|CPEB1_ENST00000423133.2_Missense_Mutation_p.G61V|CPEB1_ENST00000563800.1_Missense_Mutation_p.G163V|CPEB1_ENST00000398592.2_Intron|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000568757.1_Missense_Mutation_p.G61V|CPEB1_ENST00000261723.6_Missense_Mutation_p.G139V|CPEB1_ENST00000398591.2_Missense_Mutation_p.G61V|RP11-152F13.10_ENST00000562833.1_5'Flank			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	136					cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.G136V(1)|p.G61V(1)		breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			TAGGACATTTCCCAGTGGGTT	0.502																																																	2	Substitution - Missense(2)	kidney(2)											52.0	54.0	53.0					15																	83226709		1903	4127	6030	SO:0001583	missense	64506			AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.407G>T	15.37:g.83226709C>A	ENSP00000457836:p.Gly136Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	ENST00000562019.1	37		.	.	.	.	.	.	.	.	.	.	C	19.58	3.854770	0.71719	.	.	ENSG00000214575	ENST00000450751;ENST00000398593;ENST00000423133;ENST00000398591;ENST00000261723	.	.	.	5.84	5.84	0.93424	.	0.241744	0.37623	U	0.002015	T	0.64864	0.2637	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.76494	0.999;0.996;0.999;0.999	D;D;D;D	0.68192	0.956;0.914;0.956;0.956	T	0.68727	-0.5332	9	0.87932	D	0	-11.3744	19.1261	0.93384	0.0:1.0:0.0:0.0	.	139;136;136;136	B7Z237;Q9BZB8-3;Q9BZB8;E7ET70	.;.;CPEB1_HUMAN;.	V	136;136;61;61;139	.	ENSP00000261723:G139V	G	-	2	0	CPEB1	81023764	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	6.934000	0.75880	2.779000	0.95612	0.655000	0.94253	GGA		0.502	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000421102.1		NM_030594	
CPXCR1	53336	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	88009260	88009260	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chrX:88009260G>A	ENST00000276127.4	+	3	1104	c.845G>A	c.(844-846)gGa>gAa	p.G282E	CPXCR1_ENST00000373111.1_Missense_Mutation_p.G282E	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	282							metal ion binding (GO:0046872)	p.G282E(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CCCATCTGTGGAAGGCTTTTT	0.299																																																	1	Substitution - Missense(1)	kidney(1)											43.0	43.0	43.0					X																	88009260		2202	4293	6495	SO:0001583	missense	53336			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.845G>A	X.37:g.88009260G>A	ENSP00000276127:p.Gly282Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321036	0.23994	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.02258	4.37;4.37	3.57	3.57	0.40892	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.42964	D	0.000628	T	0.03959	0.0111	L	0.27053	0.805	0.09310	N	1	D	0.67145	0.996	P	0.57960	0.83	T	0.45687	-0.9244	9	.	.	.	-6.6129	9.7587	0.40519	0.0:0.0:1.0:0.0	.	282	Q8N123	CPXCR_HUMAN	E	282	ENSP00000276127:G282E;ENSP00000362203:G282E	.	G	+	2	0	CPXCR1	87895916	0.008000	0.16893	0.004000	0.12327	0.010000	0.07245	2.122000	0.41987	2.051000	0.60960	0.594000	0.82650	GGA		0.299	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1		NM_033048	
CRK	1398	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	1326915	1326915	+	Silent	SNP	A	A	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr17:1326915A>G	ENST00000300574.2	-	3	947	c.807T>C	c.(805-807)atT>atC	p.I269I	CRK_ENST00000574295.1_Intron|RP11-818O24.3_ENST00000570924.1_RNA|RP11-818O24.3_ENST00000576825.1_RNA|CRK_ENST00000572145.1_5'UTR|CRK_ENST00000398970.5_3'UTR	NM_016823.3	NP_058431.2	P46108	CRK_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog	269	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|ephrin receptor signaling pathway (GO:0048013)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Rho GTPase activity (GO:0032319)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|SH2 domain binding (GO:0042169)	p.I269I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)	9				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		CACTCACATTAATCTTCGTAA	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											216.0	165.0	182.0					17																	1326915		2203	4300	6503	SO:0001819	synonymous_variant	1398			D10656	CCDS11002.1, CCDS45561.1	17p13	2013-07-09	2013-07-09		ENSG00000167193	ENSG00000167193		"""SH2 domain containing"""	2362	protein-coding gene	gene with protein product		164762				1690891	Standard	NM_005206		Approved		uc002fsl.3	P46108	OTTHUMG00000090317	ENST00000300574.2:c.807T>C	17.37:g.1326915A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MWE8|B0LPE8|D3DTH6|Q96GA9|Q96HJ0	Silent	SNP	ENST00000300574.2	37	CCDS11002.1																																																																																				0.488	CRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206679.1		NM_016823	
CUX1	1523	hgsc.bcm.edu;ucsc.edu	37	7	101845357	101845358	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr7:101845357_101845358insC	ENST00000292535.7	+	18	2818_2819	c.2780_2781insC	c.(2779-2784)gtccccfs	p.VP927fs	CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Frame_Shift_Ins_p.VP938fs|CUX1_ENST00000549414.2_Frame_Shift_Ins_p.VP905fs|CUX1_ENST00000550008.2_Frame_Shift_Ins_p.VP871fs|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Frame_Shift_Ins_p.VP769fs|CUX1_ENST00000546411.2_Frame_Shift_Ins_p.VP825fs|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	927					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AAGCCCTCGGTCCCCCCGCTGA	0.644																																																	0																																										SO:0001589	frameshift_variant	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2786dupC	7.37:g.101845363_101845363dupC	ENSP00000292535:p.Val927fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Frame_Shift_Ins	INS	ENST00000292535.7	37	CCDS5721.1																																																																																				0.644	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1		NM_001913	
CUZD1	50624	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	124593448	124593448	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr10:124593448C>T	ENST00000368904.1	-	10	2340	c.1391G>A	c.(1390-1392)cGa>cAa	p.R464Q	CUZD1_ENST00000545804.1_Missense_Mutation_p.R464Q|CUZD1_ENST00000392790.1_Missense_Mutation_p.R464Q					CUB and zona pellucida-like domains 1									p.R464Q(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		AGTTTCATCTCGACTACATCT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											77.0	78.0	78.0					10																	124593448		2203	4300	6503	SO:0001583	missense	50624			AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.1391G>A	10.37:g.124593448C>T	ENSP00000357900:p.Arg464Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000368904.1	37	CCDS7631.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.086979	0.36855	.	.	ENSG00000138161	ENST00000368904;ENST00000368901;ENST00000368900;ENST00000338948;ENST00000368899;ENST00000545804;ENST00000392790	D;D;D	0.81996	-1.56;-1.56;-1.56	5.37	-2.32	0.06745	Zona pellucida sperm-binding protein (3);	1.151220	0.06275	N	0.696401	T	0.65575	0.2704	N	0.11201	0.11	0.09310	N	1	B	0.21309	0.054	B	0.09377	0.004	T	0.48175	-0.9058	10	0.15066	T	0.55	-0.0259	11.2916	0.49254	0.0:0.2723:0.0:0.7277	.	464	Q86UP6	CUZD1_HUMAN	Q	464;183;183;98;183;464;464	ENSP00000357900:R464Q;ENSP00000441590:R464Q;ENSP00000376540:R464Q	ENSP00000340905:R98Q	R	-	2	0	CUZD1	124583438	0.000000	0.05858	0.000000	0.03702	0.892000	0.51952	-1.355000	0.02612	-0.583000	0.05921	0.655000	0.94253	CGA		0.353	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050829.2		NM_022034	
CYP26B1	56603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	72359545	72359545	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr2:72359545G>T	ENST00000001146.2	-	6	1553	c.1350C>A	c.(1348-1350)ttC>ttA	p.F450L	CYP26B1_ENST00000412253.1_Missense_Mutation_p.F259L|CYP26B1_ENST00000546307.1_Missense_Mutation_p.F375L	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	450					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.F450L(1)		breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						GCACCTTCAGGAACAGCTTGG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											51.0	45.0	47.0					2																	72359545		2203	4300	6503	SO:0001583	missense	56603				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1350C>A	2.37:g.72359545G>T	ENSP00000001146:p.Phe450Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834305	0.32421	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.67865	-0.29;-0.29;-0.29	5.64	5.64	0.86602	.	0.046703	0.85682	D	0.000000	T	0.50017	0.1591	N	0.08118	0	0.80722	D	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.24701	0.055;0.03;0.03	T	0.42344	-0.9457	10	0.18710	T	0.47	-15.8291	18.6588	0.91465	0.0:0.0:1.0:0.0	.	375;433;450	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	L	450;259;375	ENSP00000001146:F450L;ENSP00000401465:F259L;ENSP00000443304:F375L	ENSP00000001146:F450L	F	-	3	2	CYP26B1	72213053	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.934000	0.56553	2.837000	0.97791	0.655000	0.94253	TTC		0.672	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1		NM_019885	
ECM1	1893	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	150482475	150482475	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:150482475G>A	ENST00000369047.4	+	4	426	c.301G>A	c.(301-303)Gaa>Aaa	p.E101K	ECM1_ENST00000369049.4_Missense_Mutation_p.E128K|ECM1_ENST00000346569.6_Missense_Mutation_p.E101K|ECM1_ENST00000470432.1_3'UTR	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	101					angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.E128K(1)|p.E101K(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGCTGAAAAGGAAGGTGAGCG	0.587																																					Melanoma(156;1696 2560 11093 19685)												2	Substitution - Missense(2)	kidney(2)											103.0	102.0	102.0					1																	150482475		2203	4300	6503	SO:0001583	missense	1893			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.301G>A	1.37:g.150482475G>A	ENSP00000358043:p.Glu101Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	ENST00000369047.4	37	CCDS953.1	.	.	.	.	.	.	.	.	.	.	G	2.771	-0.255643	0.05829	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	T;T;T	0.74421	-0.84;-0.84;-0.84	4.48	-2.23	0.06930	.	1.445980	0.04343	N	0.354387	T	0.22666	0.0547	N	0.03324	-0.35	0.09310	N	0.999999	B;B;B;B;B;B	0.10296	0.001;0.003;0.002;0.0;0.0;0.0	B;B;B;B;B;B	0.12837	0.008;0.003;0.004;0.001;0.001;0.002	T	0.05131	-1.0904	10	0.15952	T	0.53	0.1261	5.4049	0.16316	0.4004:0.1859:0.4137:0.0	.	23;30;128;101;101;101	B7ZAS5;Q16610-3;Q16610-4;C8CHS3;Q16610-2;Q16610	.;.;.;.;.;ECM1_HUMAN	K	128;101;101	ENSP00000358045:E128K;ENSP00000358043:E101K;ENSP00000271630:E101K	ENSP00000271630:E101K	E	+	1	0	ECM1	148749099	0.000000	0.05858	0.058000	0.19502	0.105000	0.19272	-1.578000	0.02125	-0.502000	0.06596	-0.391000	0.06502	GAA		0.587	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2		NM_004425	
EVPL	2125	broad.mit.edu;hgsc.bcm.edu	37	17	74011147	74011147	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr17:74011147C>T	ENST00000301607.3	-	17	2325	c.2072G>A	c.(2071-2073)cGg>cAg	p.R691Q	EVPL_ENST00000586740.1_Missense_Mutation_p.R713Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	691	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.R691Q(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GCGGTGTAGCCGCAGCACGCA	0.687																																																	1	Substitution - Missense(1)	kidney(1)											26.0	29.0	28.0					17																	74011147		2200	4290	6490	SO:0001583	missense	2125			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.2072G>A	17.37:g.74011147C>T	ENSP00000301607:p.Arg691Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356702	0.24598	.	.	ENSG00000167880	ENST00000301607	T	0.33216	1.42	4.82	3.83	0.44106	.	0.352145	0.32258	N	0.006352	T	0.10637	0.0260	N	0.03608	-0.345	0.21802	N	0.99953	B;B	0.19445	0.007;0.036	B;B	0.10450	0.001;0.005	T	0.24512	-1.0158	10	0.14252	T	0.57	-65.5485	4.6788	0.12725	0.0:0.5994:0.2053:0.1953	.	713;691	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	691	ENSP00000301607:R691Q	ENSP00000301607:R691Q	R	-	2	0	EVPL	71522742	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	1.792000	0.38754	1.307000	0.44944	0.561000	0.74099	CGG		0.687	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1		NM_001988	
FAM86DP	692099	broad.mit.edu	37	3	75475709	75475709	+	RNA	SNP	T	T	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr3:75475709T>C	ENST00000459803.1	-	0	820					NR_024241.1				family with sequence similarity 86, member D, pseudogene									p.I261V(1)									CTCCGCAGGATCCCGACCAGC	0.562																																																	1	Substitution - Missense(1)	kidney(1)																																										0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75475709T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000459803.1	37																																																																																					0.562	FAM86DP-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352425.1		NR_024241	
FBN3	84467	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	8165827	8165827	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr19:8165827C>T	ENST00000600128.1	-	41	5533	c.5119G>A	c.(5119-5121)Gcc>Acc	p.A1707T	FBN3_ENST00000270509.2_Missense_Mutation_p.A1707T|FBN3_ENST00000601739.1_Missense_Mutation_p.A1707T			Q75N90	FBN3_HUMAN	fibrillin 3	1707						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.A1707T(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AATCCCGGGGCCTGATTTCCA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											128.0	116.0	120.0					19																	8165827		2203	4300	6503	SO:0001583	missense	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5119G>A	19.37:g.8165827C>T	ENSP00000470498:p.Ala1707Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	c	1.837	-0.468472	0.04445	.	.	ENSG00000142449	ENST00000270509	D	0.87103	-2.21	3.24	3.24	0.37175	Matrix fibril-associated (2);	0.194805	0.43747	U	0.000539	T	0.80110	0.4563	L	0.46157	1.445	0.44976	D	0.997993	B	0.32245	0.361	B	0.22386	0.039	T	0.76881	-0.2795	10	0.22706	T	0.39	.	13.3594	0.60646	0.0:1.0:0.0:0.0	.	1707	Q75N90	FBN3_HUMAN	T	1707	ENSP00000270509:A1707T	ENSP00000270509:A1707T	A	-	1	0	FBN3	8071827	0.027000	0.19231	0.262000	0.24481	0.021000	0.10359	0.828000	0.27435	1.503000	0.48686	0.486000	0.48141	GCC		0.622	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2		NM_032447	
FCRLA	84824	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	161677075	161677075	+	Silent	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:161677075C>A	ENST00000236938.6	+	1	314	c.72C>A	c.(70-72)ctC>ctA	p.L24L	FCRLA_ENST00000367959.2_Silent_p.L24L|FCRLA_ENST00000367949.2_Silent_p.L24L|FCRLA_ENST00000540926.1_Silent_p.L7L|FCRLA_ENST00000349527.4_Silent_p.L7L|FCRLA_ENST00000367953.3_Silent_p.L7L|FCRLA_ENST00000309691.6_Silent_p.L7L|FCRLA_ENST00000367950.1_5'Flank|FCRLA_ENST00000546024.1_Silent_p.L24L|FCRLA_ENST00000350710.3_Silent_p.L24L|FCRLA_ENST00000294796.4_Silent_p.L7L|FCRLA_ENST00000367957.2_Silent_p.L24L|FCRLA_ENST00000540521.1_Silent_p.L24L	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	7					cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.L24L(1)|p.L7L(1)		breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			GCTGTGTCCTCATGGCCTGGG	0.478																																																	2	Substitution - coding silent(2)	kidney(2)											143.0	129.0	133.0					1																	161677075		2203	4300	6503	SO:0001819	synonymous_variant	84824			AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000236938.6:c.72C>A	1.37:g.161677075C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Silent	SNP	ENST00000236938.6	37	CCDS30926.1																																																																																				0.478	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1		NM_032738	
FGFBP1	9982	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	15938034	15938034	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr4:15938034C>A	ENST00000382333.1	-	3	516	c.222G>T	c.(220-222)gaG>gaT	p.E74D	FGFBP1_ENST00000259988.2_Missense_Mutation_p.E74D	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	74					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)	p.E74D(1)		NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						CCTCCTCCTGCTCAGTAGCAG	0.507																																																	1	Substitution - Missense(1)	kidney(1)											146.0	137.0	140.0					4																	15938034		2203	4300	6503	SO:0001583	missense	9982			M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.222G>T	4.37:g.15938034C>A	ENSP00000371770:p.Glu74Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J2	Missense_Mutation	SNP	ENST00000382333.1	37	CCDS3418.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.629171	0.67015	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.15372	2.43;2.43	5.71	2.03	0.26663	.	0.734122	0.12778	N	0.439876	T	0.25975	0.0633	L	0.52011	1.625	0.09310	N	1	D	0.61697	0.99	P	0.60949	0.881	T	0.09487	-1.0672	10	0.36615	T	0.2	5.2489	4.7834	0.13213	0.1458:0.557:0.0:0.2972	.	74	Q14512	FGFP1_HUMAN	D	74	ENSP00000371770:E74D;ENSP00000259988:E74D	ENSP00000259988:E74D	E	-	3	2	FGFBP1	15547132	0.005000	0.15991	0.009000	0.14445	0.964000	0.63967	0.167000	0.16602	0.343000	0.23821	-0.234000	0.12200	GAG		0.507	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1		NM_005130	
FLVCR2	55640	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	76088434	76088434	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr14:76088434A>G	ENST00000238667.4	+	2	1038	c.682A>G	c.(682-684)Att>Gtt	p.I228V	FLVCR2_ENST00000539311.1_Missense_Mutation_p.I23V|FLVCR2_ENST00000553587.1_5'UTR|FLVCR2_ENST00000556241.1_3'UTR|FLVCR2_ENST00000556856.1_5'Flank	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	228					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)	p.I228V(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		TGGAATTGCGATTGGGTTCTT	0.438																																																	1	Substitution - Missense(1)	kidney(1)											320.0	293.0	302.0					14																	76088434		2203	4300	6503	SO:0001583	missense	55640			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.682A>G	14.37:g.76088434A>G	ENSP00000238667:p.Ile228Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	ENST00000238667.4	37	CCDS9844.1	.	.	.	.	.	.	.	.	.	.	A	2.546	-0.305120	0.05495	.	.	ENSG00000119686	ENST00000238667;ENST00000539311	T;T	0.59638	0.25;0.25	5.86	0.173	0.15036	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.187356	0.46442	D	0.000299	T	0.34571	0.0902	L	0.31926	0.97	0.58432	D	0.999999	B;B	0.06786	0.001;0.0	B;B	0.19666	0.026;0.008	T	0.04621	-1.0938	10	0.13470	T	0.59	-5.3741	1.8935	0.03252	0.4862:0.2508:0.1417:0.1213	.	23;228	B7Z485;Q9UPI3	.;FLVC2_HUMAN	V	228;23	ENSP00000238667:I228V;ENSP00000443439:I23V	ENSP00000238667:I228V	I	+	1	0	AC007182.1	75158187	0.076000	0.21285	0.512000	0.27736	0.530000	0.34684	0.555000	0.23422	0.467000	0.27218	-0.316000	0.08728	ATT		0.438	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413672.1		NM_017791	
GP6	51206	hgsc.bcm.edu	37	19	55526103	55526104	+	3'UTR	INS	-	-	CAGA	rs59110861|rs138680589|rs375520233		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr19:55526103_55526104insCAGA	ENST00000417454.1	-	0	1232_1233				CTC-550B14.7_ENST00000593060.1_RNA|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Frame_Shift_Ins_p.P404fs|GP6_ENST00000333884.2_3'UTR	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		agacagagaggcagacagacag	0.594																																																	0																																										SO:0001624	3_prime_UTR_variant	51206			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*186->TCTG	19.37:g.55526108_55526111dupCAGA		Somatic		WXS	Illumina HiSeq	Phase_I	Q9HCN7|Q9UIF2	Frame_Shift_Ins	INS	ENST00000417454.1	37	CCDS46184.1																																																																																				0.594	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1			
GPX6	257202	hgsc.bcm.edu;ucsc.edu	37	6	28483478	28483478	+	Frame_Shift_Del	DEL	G	G	-	rs559264173		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr6:28483478delG	ENST00000474923.1	-	1	86	c.43delC	c.(43-45)ctgfs	p.L15fs	GPX6_ENST00000483058.1_Intron|GPX6_ENST00000361902.1_Frame_Shift_Del_p.L15fs			P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	15					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	AAGCCAACCAGGAAAAACAGG	0.542																																																	0													87.0	100.0	96.0					6																	28483478		1975	4159	6134	SO:0001589	frameshift_variant	257202				CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000474923.1:c.43delC	6.37:g.28483478delG	ENSP00000417364:p.Leu15fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4PJ17	Frame_Shift_Del	DEL	ENST00000474923.1	37																																																																																					0.542	GPX6-002	PUTATIVE	basic|exp_conf|seleno	protein_coding	protein_coding	OTTHUMT00000356246.5			
JMY	133746	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	78608277	78608277	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr5:78608277C>A	ENST00000396137.4	+	8	2482	c.2020C>A	c.(2020-2022)Caa>Aaa	p.Q674K	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	674					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q320K(1)|p.Q674K(1)		endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CTGGGTTAGCCAAGAGAGACA	0.294																																																	2	Substitution - Missense(2)	kidney(2)											104.0	106.0	105.0					5																	78608277		1800	4080	5880	SO:0001583	missense	133746			AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2020C>A	5.37:g.78608277C>A	ENSP00000379441:p.Gln674Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865656	0.91511	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.07327	3.2	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.31918	0.0812	M	0.79123	2.44	0.80722	D	1	D	0.67145	0.996	D	0.72982	0.979	T	0.03852	-1.0998	10	0.62326	D	0.03	.	18.8472	0.92212	0.0:1.0:0.0:0.0	.	674	Q8N9B5	JMY_HUMAN	K	674	ENSP00000379441:Q674K	ENSP00000282259:Q674K	Q	+	1	0	JMY	78644033	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.659000	0.74412	2.447000	0.82792	0.655000	0.94253	CAA		0.294	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4		NM_152405	
LAMA1	284217	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	7026067	7026067	+	Silent	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr18:7026067C>T	ENST00000389658.3	-	17	2406	c.2313G>A	c.(2311-2313)caG>caA	p.Q771Q		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	771	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.Q771Q(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CGGGCAAGCACTGCTCACAGT	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	35.0	39.0					18																	7026067		2203	4300	6503	SO:0001819	synonymous_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2313G>A	18.37:g.7026067C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.572	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1		NM_005559	
MAB21L1	4081	broad.mit.edu;ucsc.edu	37	13	36049373	36049373	+	Silent	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr13:36049373G>A	ENST00000379919.4	-	1	1459	c.903C>T	c.(901-903)aaC>aaT	p.N301N	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	301					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.N301N(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GCAAAATCCCGTTCAGCCGAT	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											112.0	97.0	102.0					13																	36049373		2203	4300	6503	SO:0001819	synonymous_variant	4081			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.903C>T	13.37:g.36049373G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q6I9T5	Silent	SNP	ENST00000379919.4	37	CCDS9353.1																																																																																				0.517	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3		NM_005584	
MUC5B	727897	broad.mit.edu	37	11	1268529	1268529	+	Silent	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr11:1268529G>A	ENST00000529681.1	+	31	10477	c.10419G>A	c.(10417-10419)tcG>tcA	p.S3473S	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.S3476S	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3473	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S3452S(1)|p.S3473S(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTGGACTTCGGCCACCTCGG	0.672																																																	2	Substitution - coding silent(2)	kidney(2)											61.0	87.0	78.0					11																	1268529		2117	4207	6324	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10419G>A	11.37:g.1268529G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2		XM_001126093	
NEB	4703	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	152352797	152352797	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	A	G	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr2:152352797A>G	ENST00000172853.10	-	140	19058	c.18911T>C	c.(18910-18912)aTt>aCt	p.I6304T	NEB_ENST00000509223.2_Missense_Mutation_p.I104T|NEB_ENST00000603639.1_Missense_Mutation_p.I8160T|NEB_ENST00000604864.1_Missense_Mutation_p.I8160T|NEB_ENST00000498015.2_Intron|NEB_ENST00000427231.2_Missense_Mutation_p.I8160T|NEB_ENST00000409198.1_Missense_Mutation_p.I6304T|RIF1_ENST00000457745.1_Intron|NEB_ENST00000397345.3_Missense_Mutation_p.I8160T|NEB_ENST00000397336.2_Missense_Mutation_p.I135T			P20929	NEBU_HUMAN	nebulin	6304					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.I8160T(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TACCGAGCTAATATTTTCTTG	0.338																																																	1	Substitution - Missense(1)	kidney(1)											96.0	76.0	82.0					2																	152352797		1818	4078	5896	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.18911T>C	2.37:g.152352797A>G	ENSP00000172853:p.Ile6304Thr	Somatic		WXS	Illumina HiSeq	Phase_I	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	15.65	2.894845	0.52121	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000413693;ENST00000172853;ENST00000397336;ENST00000509223	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.0	5.0	0.66597	.	.	.	.	.	T	0.72669	0.3489	M	0.88775	2.98	0.44149	D	0.996941	B;B;P;B;B;D	0.61080	0.433;0.084;0.464;0.123;0.047;0.989	B;B;B;B;B;D	0.72625	0.297;0.061;0.297;0.155;0.037;0.978	T	0.78819	-0.2054	9	0.66056	D	0.02	.	14.6987	0.69142	1.0:0.0:0.0:0.0	.	104;135;104;6304;2704;8160	B7Z6B9;B7Z6P9;B7Z6N8;P20929;Q14215;F8WCL5	.;.;.;NEBU_HUMAN;.;.	T	6304;8160;8160;2704;6304;135;104	ENSP00000386259:I6304T;ENSP00000380505:I8160T;ENSP00000416578:I8160T;ENSP00000410961:I2704T;ENSP00000172853:I6304T;ENSP00000380497:I135T;ENSP00000427083:I104T	ENSP00000172853:I6304T	I	-	2	0	NEB	152061043	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	5.411000	0.66386	2.010000	0.58986	0.533000	0.62120	ATT		0.338	NEB-201	KNOWN	basic	protein_coding	protein_coding			NM_004543	
NHS	4810	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	17745608	17745608	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chrX:17745608C>G	ENST00000380060.3	+	6	3657	c.3319C>G	c.(3319-3321)Cca>Gca	p.P1107A	NHS_ENST00000398097.3_Missense_Mutation_p.P951A	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1128					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.P1107A(1)|p.P951A(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					GTCGAATCCTCCACCGTCCCT	0.403																																																	2	Substitution - Missense(2)	kidney(2)											138.0	131.0	134.0					X																	17745608		2203	4300	6503	SO:0001583	missense	4810				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3319C>G	X.37:g.17745608C>G	ENSP00000369400:p.Pro1107Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	C	0.723	-0.782678	0.02907	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.46451	0.87;0.87	5.94	4.15	0.48705	.	0.150033	0.64402	N	0.000008	T	0.30198	0.0757	L	0.41492	1.28	0.27207	N	0.960028	B;B;B;B	0.10296	0.003;0.003;0.003;0.001	B;B;B;B	0.12156	0.007;0.007;0.007;0.003	T	0.14671	-1.0464	10	0.30078	T	0.28	-9.6833	6.5468	0.22410	0.0:0.6618:0.1317:0.2064	.	1128;949;951;1107	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	A	1107;951;949	ENSP00000369400:P1107A;ENSP00000381170:P951A	ENSP00000369397:P949A	P	+	1	0	NHS	17655529	0.336000	0.24757	0.993000	0.49108	0.265000	0.26407	2.157000	0.42320	1.249000	0.43950	0.544000	0.68410	CCA		0.403	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1		NM_198270	
NLRX1	79671	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	119050726	119050726	+	Missense_Mutation	SNP	G	G	A	rs566863085	byFrequency	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr11:119050726G>A	ENST00000409109.1	+	7	2583	c.1996G>A	c.(1996-1998)Ggc>Agc	p.G666S	NLRX1_ENST00000525863.1_Missense_Mutation_p.G666S|NLRX1_ENST00000409991.1_Missense_Mutation_p.G666S|NLRX1_ENST00000292199.2_Missense_Mutation_p.G666S|NLRX1_ENST00000409265.4_Missense_Mutation_p.G666S	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	666	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)	p.G666S(2)		cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGGCAAGCTGGGCCGGCAGGT	0.607													G|||	4	0.000798722	0.0	0.0	5008	,	,		18348	0.0		0.0	False		,,,				2504	0.0041																2	Substitution - Missense(2)	kidney(2)											25.0	26.0	25.0					11																	119050726		2199	4292	6491	SO:0001583	missense	79671			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1996G>A	11.37:g.119050726G>A	ENSP00000387334:p.Gly666Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	37	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	G	8.488	0.861290	0.17178	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T	0.69806	-0.32;-0.32;-0.43;-0.32;-0.43	5.33	4.36	0.52297	.	0.220594	0.39834	N	0.001242	T	0.30823	0.0777	N	0.02916	-0.46	0.36620	D	0.87569	B;B	0.33940	0.433;0.1	B;B	0.26310	0.068;0.012	T	0.42068	-0.9473	10	0.08837	T	0.75	.	5.8745	0.18822	0.194:0.1621:0.6439:0.0	.	666;666	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	S	666	ENSP00000386851:G666S;ENSP00000292199:G666S;ENSP00000386858:G666S;ENSP00000387334:G666S;ENSP00000433442:G666S	ENSP00000292199:G666S	G	+	1	0	NLRX1	118555936	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.235000	0.51328	2.503000	0.84419	0.561000	0.74099	GGC		0.607	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1		NM_170722	
NPBWR2	2832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	62737383	62737383	+	Missense_Mutation	SNP	C	C	T	rs140478149		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr20:62737383C>T	ENST00000369768.1	-	1	1141	c.802G>A	c.(802-804)Gtg>Atg	p.V268M		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	268					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)	p.V268M(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					AGGAGGCACACGGCCAGCACG	0.677																																																	1	Substitution - Missense(1)	kidney(1)						C	MET/VAL	0,4398		0,0,2199	108.0	80.0	90.0		802	1.9	0.0	20	dbSNP_134	90	3,8589	3.0+/-9.4	0,3,4293	yes	missense	NPBWR2	NM_005286.2	21	0,3,6492	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	268/334	62737383	3,12987	2199	4296	6495	SO:0001583	missense	2832			U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.802G>A	20.37:g.62737383C>T	ENSP00000358783:p.Val268Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	ENST00000369768.1	37	CCDS13557.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201571	0.58234	0.0	3.49E-4	ENSG00000125522	ENST00000369768	T	0.75821	-0.97	4.01	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000005	D	0.84669	0.5523	M	0.83118	2.625	0.39548	D	0.96893	D	0.89917	1.0	D	0.79784	0.993	D	0.84614	0.0680	10	0.87932	D	0	.	10.4213	0.44352	0.0:0.8301:0.0:0.1699	.	268	P48146	NPBW2_HUMAN	M	268	ENSP00000358783:V268M	ENSP00000358783:V268M	V	-	1	0	NPBWR2	62207827	0.889000	0.30405	0.005000	0.12908	0.668000	0.39293	3.245000	0.51407	0.132000	0.18615	0.491000	0.48974	GTG		0.677	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080300.1		NM_005286	
NRF1	4899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	129297261	129297261	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr7:129297261G>A	ENST00000393232.1	+	2	187	c.70G>A	c.(70-72)Gtg>Atg	p.V24M	NRF1_ENST00000223190.4_Missense_Mutation_p.V24M|NRF1_ENST00000393230.2_Missense_Mutation_p.V24M|NRF1_ENST00000539636.1_5'UTR|NRF1_ENST00000311967.2_Missense_Mutation_p.V24M|NRF1_ENST00000393231.3_Missense_Mutation_p.V24M|NRF1_ENST00000353868.4_Missense_Mutation_p.V24M	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	24	Dimerization.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.V24M(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						GGCCCAGCAAGTGCAGCAGGT	0.493																																																	1	Substitution - Missense(1)	kidney(1)											123.0	111.0	115.0					7																	129297261		2203	4300	6503	SO:0001583	missense	4899			L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.70G>A	7.37:g.129297261G>A	ENSP00000376924:p.Val24Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	ENST00000393232.1	37	CCDS5813.2	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781580	0.90282	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000454688;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	N	0.08118	0	0.80722	D	1	D;D	0.61697	0.99;0.99	D;D	0.70487	0.969;0.969	T	0.67979	-0.5530	9	0.56958	D	0.05	-22.9168	18.4511	0.90704	0.0:0.0:1.0:0.0	.	24;24	Q96AN2;Q16656	.;NRF1_HUMAN	M	24	.	ENSP00000223190:V24M	V	+	1	0	NRF1	129084497	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	6.825000	0.75293	2.617000	0.88574	0.585000	0.79938	GTG		0.493	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1		NM_001040110	
NTN4	59277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	96181160	96181161	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr12:96181160_96181161delAG	ENST00000343702.4	-	2	589_590	c.141_142delCT	c.(139-144)ctctggfs	p.W48fs	NTN4_ENST00000344911.4_Frame_Shift_Del_p.W11fs|NTN4_ENST00000553059.1_Frame_Shift_Del_p.W48fs|NTN4_ENST00000538383.1_Frame_Shift_Del_p.W11fs	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	48	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GTGTCTGCCCAGAGTTTTCGCC	0.52																																																	0																																										SO:0001589	frameshift_variant	59277			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.141_142delCT	12.37:g.96181162_96181163delAG	ENSP00000340998:p.Trp48fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Frame_Shift_Del	DEL	ENST00000343702.4	37	CCDS9054.1																																																																																				0.520	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1		NM_021229	
NVL	4931	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	224491542	224491542	+	Silent	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:224491542G>A	ENST00000281701.6	-	9	1102	c.843C>T	c.(841-843)ctC>ctT	p.L281L	NVL_ENST00000482491.1_5'UTR|RNU6-1008P_ENST00000384160.1_RNA|NVL_ENST00000391875.2_Silent_p.L175L|NVL_ENST00000361463.3_Silent_p.L175L|NVL_ENST00000469075.1_Silent_p.L190L|NVL_ENST00000340871.4_Silent_p.L65L	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	281						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.L281L(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		GCATGTGTATGAGCATCTTGC	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											73.0	68.0	70.0					1																	224491542		2203	4300	6503	SO:0001819	synonymous_variant	4931			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.843C>T	1.37:g.224491542G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DMC4|B4DP98|Q96EM7	Silent	SNP	ENST00000281701.6	37	CCDS1541.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439588	0.43326	.	.	ENSG00000143748	ENST00000469968	.	.	.	4.96	-0.979	0.10276	.	.	.	.	.	T	0.60011	0.2236	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61505	-0.7049	5	0.66056	D	0.02	-9.3369	7.558	0.27835	0.2524:0.387:0.3607:0.0	.	.	.	.	Y	164	.	ENSP00000419930:H256Y	H	-	1	0	NVL	222558165	0.972000	0.33761	0.283000	0.24790	0.905000	0.53344	0.162000	0.16501	0.146000	0.19002	-0.339000	0.08088	CAT		0.498	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2		NM_002533	
OR1A1	8383	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	3119395	3119395	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr17:3119395C>A	ENST00000304094.1	+	1	481	c.481C>A	c.(481-483)Ctg>Atg	p.L161M		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L161M(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						CCCCCACACTCTGCTCACAGC	0.502																																																	1	Substitution - Missense(1)	kidney(1)											149.0	128.0	135.0					17																	3119395		2203	4300	6503	SO:0001583	missense	8383			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.481C>A	17.37:g.3119395C>A	ENSP00000305207:p.Leu161Met	Somatic		WXS	Illumina HiSeq	Phase_I	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	ENST00000304094.1	37	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486540	0.44249	.	.	ENSG00000172146	ENST00000304094	T	0.41758	0.99	4.96	2.93	0.34026	GPCR, rhodopsin-like superfamily (1);	0.187668	0.26355	N	0.024860	T	0.60843	0.2300	M	0.82193	2.58	0.19300	N	0.999971	D	0.53745	0.962	D	0.65233	0.933	T	0.52711	-0.8539	10	0.72032	D	0.01	.	7.9625	0.30079	0.3239:0.5191:0.157:0.0	.	161	Q9P1Q5	OR1A1_HUMAN	M	161	ENSP00000305207:L161M	ENSP00000305207:L161M	L	+	1	2	OR1A1	3066145	0.000000	0.05858	1.000000	0.80357	0.933000	0.57130	-2.087000	0.01360	0.660000	0.30964	0.436000	0.28706	CTG		0.502	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1		NM_014565	
OR2T1	26696	hgsc.bcm.edu;ucsc.edu	37	1	248569296	248569297	+	Start_Codon_Ins	INS	-	-	TGTG			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:248569296_248569297insTGTG	ENST00000366474.1	+	0	1_2					NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCAGTCTCAATGTGGCAAGAA	0.302																																																	0																																										SO:0001582	initiator_codon_variant	26696			U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.2_5dupTGTG	1.37:g.248569297_248569300dupTGTG		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEZ9	Frame_Shift_Ins	INS	ENST00000366474.1	37	CCDS31115.1																																																																																				0.302	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2			
PBRM1	55193	hgsc.bcm.edu	37	3	52676063	52676063	+	Splice_Site	SNP	T	T	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr3:52676063T>A	ENST00000296302.7	-	10	997		c.e10-2		PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTTTTATTACTACAAAAAAAA	0.343			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													122.0	118.0	119.0					3																	52676063		2203	4300	6503	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.996-2A>T	3.37:g.52676063T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	22.2	4.254422	0.80135	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9893	0.80188	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52651103	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.357000	0.79456	2.181000	0.69327	0.528000	0.53228	.		0.343	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Intron
PHKA2	5256	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	18970644	18970644	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chrX:18970644T>A	ENST00000379942.4	-	3	918	c.253A>T	c.(253-255)Atg>Ttg	p.M85L		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	85					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.M85L(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					AGACCTCGCATCAGCTTCACC	0.512																																																	1	Substitution - Missense(1)	kidney(1)											180.0	110.0	134.0					X																	18970644		2203	4300	6503	SO:0001583	missense	5256				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.253A>T	X.37:g.18970644T>A	ENSP00000369274:p.Met85Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	T	33	5.245624	0.95272	.	.	ENSG00000044446	ENST00000379942	D	0.91068	-2.78	5.74	5.74	0.90152	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.94098	0.8108	M	0.88105	2.93	0.80722	D	1	P	0.44309	0.832	P	0.49477	0.612	D	0.94555	0.7757	10	0.59425	D	0.04	-31.8502	14.9586	0.71138	0.0:0.0:0.0:1.0	.	85	P46019	KPB2_HUMAN	L	85	ENSP00000369274:M85L	ENSP00000369274:M85L	M	-	1	0	PHKA2	18880565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.795000	0.85887	1.915000	0.55452	0.486000	0.48141	ATG		0.512	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1		NM_000292	
POC1B	282809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	89885726	89885726	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr12:89885726delC	ENST00000313546.3	-	4	567	c.439delG	c.(439-441)gtafs	p.V147fs	POC1B_ENST00000549504.1_Frame_Shift_Del_p.V17fs|POC1B_ENST00000549035.1_Frame_Shift_Del_p.V105fs|POC1B_ENST00000378528.2_Frame_Shift_Del_p.V17fs|POC1B_ENST00000541909.1_Frame_Shift_Del_p.V17fs|POC1B_ENST00000393179.4_Frame_Shift_Del_p.V17fs	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	147					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						GCACAGCGTACCCAGTGTGTA	0.418																																																	0													120.0	115.0	117.0					12																	89885726		2203	4300	6503	SO:0001589	frameshift_variant	282809			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.439delG	12.37:g.89885726delC	ENSP00000323302:p.Val147fs	Somatic		WXS	Illumina HiSeq	Phase_I	G3V1X0	Frame_Shift_Del	DEL	ENST00000313546.3	37	CCDS31869.1																																																																																				0.418	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406637.1		NM_172240	
PPEF1	5475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	18836212	18836212	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chrX:18836212C>T	ENST00000361511.4	+	16	1944	c.1450C>T	c.(1450-1452)Cga>Tga	p.R484*	PPEF1_ENST00000543630.1_Missense_Mutation_p.T374M|PPEF1_ENST00000359763.6_Nonsense_Mutation_p.R431*|PPEF1_ENST00000349874.5_Nonsense_Mutation_p.R422*|PPEF1_ENST00000544635.1_Nonsense_Mutation_p.R419*	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	484	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.R484*(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AGTGATTTCACGAAAAAGTGA	0.343																																																	1	Substitution - Nonsense(1)	kidney(1)											126.0	112.0	117.0					X																	18836212		2203	4300	6503	SO:0001587	stop_gained	5475			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1450C>T	X.37:g.18836212C>T	ENSP00000354871:p.Arg484*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Nonsense_Mutation	SNP	ENST00000361511.4	37	CCDS14188.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.563860|6.563860	0.97667|0.97667	.|.	.|.	ENSG00000086717|ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000349874;ENST00000544635|ENST00000543630	.|T	.|0.24151	.|1.87	5.23|5.23	4.36|4.36	0.52297|0.52297	.|.	0.922092|.	0.08983|.	N|.	0.865505|.	.|T	.|0.35508	.|0.0934	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.45264	.|-0.9273	.|4	0.07030|.	T|.	0.85|.	-5.9262|-5.9262	13.4038|13.4038	0.60898|0.60898	0.1579:0.8421:0.0:0.0|0.1579:0.8421:0.0:0.0	.|.	.|.	.|.	.|.	X|M	484;431;422;419|374	.|ENSP00000437785:T374M	ENSP00000341892:R422X|.	R|T	+|+	1|2	2|0	PPEF1|PPEF1	18746133|18746133	0.988000|0.988000	0.35896|0.35896	0.963000|0.963000	0.40424|0.40424	0.041000|0.041000	0.13682|0.13682	1.991000|1.991000	0.40727|0.40727	1.077000|1.077000	0.40990|0.40990	0.422000|0.422000	0.28245|0.28245	CGA|ACG		0.343	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3		NM_006240	
PRKDC	5591	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	48694798	48694798	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr8:48694798C>T	ENST00000314191.2	-	81	11467	c.11411G>A	c.(11410-11412)tGg>tAg	p.W3804*	PRKDC_ENST00000338368.3_Intron|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3805	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.W3805*(1)|p.W3804*(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATTTTCAAGCCACTCAATTAA	0.473								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												2	Substitution - Nonsense(2)	kidney(2)											71.0	72.0	72.0					8																	48694798		1921	4128	6049	SO:0001587	stop_gained	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.11411G>A	8.37:g.48694798C>T	ENSP00000313420:p.Trp3804*	Somatic		WXS	Illumina HiSeq	Phase_I	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	C	52	19.908571	0.99925	.	.	ENSG00000253729	ENST00000314191	.	.	.	4.94	4.06	0.47325	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3912	0.60825	0.0:0.9237:0.0:0.0763	.	.	.	.	X	3804	.	ENSP00000313420:W3804X	W	-	2	0	PRKDC	48857351	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.083000	0.64456	1.216000	0.43427	0.655000	0.94253	TGG		0.473	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001081640	
PRRC2A	7916	broad.mit.edu;hgsc.bcm.edu	37	6	31599655	31599655	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr6:31599655G>A	ENST00000376033.2	+	16	3439	c.3205G>A	c.(3205-3207)Ggg>Agg	p.G1069R	PRRC2A_ENST00000376007.4_Missense_Mutation_p.G1069R	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1069	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G1069R(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GCGTGGAGGTGGGACAGGGGG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											22.0	19.0	20.0					6																	31599655		1507	2707	4214	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3205G>A	6.37:g.31599655G>A	ENSP00000365201:p.Gly1069Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	8.736	0.917801	0.17982	.	.	ENSG00000204469	ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01705	4.68;4.68	5.04	3.22	0.36961	.	0.269330	0.26995	N	0.021455	T	0.00637	0.0021	L	0.39898	1.24	0.30200	N	0.798682	B	0.10296	0.003	B	0.09377	0.004	T	0.47598	-0.9105	10	0.87932	D	0	-3.1063	4.2837	0.10844	0.2533:0.1728:0.5739:0.0	.	1069	P48634	PRC2A_HUMAN	R	1069;1069;294	ENSP00000365175:G1069R;ENSP00000365201:G1069R	ENSP00000365175:G1069R	G	+	1	0	PRRC2A	31707634	0.848000	0.29623	0.723000	0.30687	0.763000	0.43281	2.086000	0.41643	0.699000	0.31761	0.655000	0.94253	GGG		0.657	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1		NM_080686	
RABGAP1	23637	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	125865394	125865394	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr9:125865394G>A	ENST00000373647.4	+	26	3246	c.3112G>A	c.(3112-3114)Gcc>Acc	p.A1038T	RABGAP1_ENST00000373643.5_Missense_Mutation_p.A377T	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	1038					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.A1038T(1)|p.A966T(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TTTAGGGCTTGCCCTCAATGA	0.527											OREG0019466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - Missense(2)	kidney(2)											105.0	88.0	94.0					9																	125865394		2203	4300	6503	SO:0001583	missense	23637			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.3112G>A	9.37:g.125865394G>A	ENSP00000362751:p.Ala1038Thr	Somatic	1545	WXS	Illumina HiSeq	Phase_I	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	SNP	ENST00000373647.4	37	CCDS6848.2	.	.	.	.	.	.	.	.	.	.	G	10.10	1.257758	0.22965	.	.	ENSG00000011454	ENST00000373647;ENST00000373643	T;T	0.17054	3.42;2.3	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.12092	0.0294	N	0.17872	0.535	0.80722	D	1	B	0.25441	0.126	B	0.18263	0.021	T	0.13335	-1.0513	10	0.11794	T	0.64	-5.9797	19.0066	0.92854	0.0:0.0:1.0:0.0	.	1038	Q9Y3P9	RBGP1_HUMAN	T	1038;377	ENSP00000362751:A1038T;ENSP00000362747:A377T	ENSP00000362747:A377T	A	+	1	0	RABGAP1	124905215	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.263000	0.95617	2.718000	0.92993	0.650000	0.86243	GCC		0.527	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3		NM_012197	
RANBP2	5903	broad.mit.edu;hgsc.bcm.edu	37	2	109384143	109384143	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr2:109384143A>G	ENST00000283195.6	+	20	7274	c.7148A>G	c.(7147-7149)aAt>aGt	p.N2383S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2383	RanBD1 3. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.N2383S(4)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTTTGTGCCAATCACAGAATA	0.353																																																	4	Substitution - Missense(4)	endometrium(2)|kidney(2)											106.0	121.0	116.0					2																	109384143		2147	4153	6300	SO:0001583	missense	5903			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.7148A>G	2.37:g.109384143A>G	ENSP00000283195:p.Asn2383Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.358736	0.61403	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.62498	0.02	5.47	5.47	0.80525	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	D	0.85097	0.5619	H	0.95816	3.725	0.39394	D	0.966465	D	0.76494	0.999	D	0.79784	0.993	D	0.90368	0.4378	9	0.87932	D	0	-38.5236	15.8507	0.78927	1.0:0.0:0.0:0.0	.	2383	P49792	RBP2_HUMAN	S	1407;2383	ENSP00000283195:N2383S	ENSP00000283195:N2383S	N	+	2	0	RANBP2	108750575	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.261000	0.95576	2.209000	0.71365	0.254000	0.18369	AAT		0.353	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1		NM_006267	
RBM14	10432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	66391778	66391778	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr11:66391778T>G	ENST00000310137.4	+	2	570	c.431T>G	c.(430-432)gTg>gGg	p.V144G	RBM4_ENST00000503028.2_Intron|RBM14_ENST00000409738.4_Intron|RBM14_ENST00000443702.1_3'UTR|RBM14-RBM4_ENST00000412278.2_Intron|RBM14_ENST00000393979.3_Missense_Mutation_p.V144G|RBM14_ENST00000409372.1_3'UTR|RBM14_ENST00000461478.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000500635.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	144	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.V144G(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CGCATCAACGTGGAACTCTCC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											72.0	68.0	69.0					11																	66391778		2200	4295	6495	SO:0001583	missense	10432			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.431T>G	11.37:g.66391778T>G	ENSP00000311747:p.Val144Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511496	0.64522	.	.	ENSG00000239306	ENST00000310137;ENST00000393979	D;D	0.84298	-1.83;-1.83	5.67	5.67	0.87782	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.167328	0.39341	N	0.001399	D	0.95424	0.8514	H	0.98612	4.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96950	0.9694	10	0.87932	D	0	-4.2429	13.8694	0.63610	0.0:0.0:0.0:1.0	.	144;144	Q96PK6-2;Q96PK6	.;RBM14_HUMAN	G	144	ENSP00000311747:V144G;ENSP00000377548:V144G	ENSP00000311747:V144G	V	+	2	0	RBM14	66148354	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.722000	0.74735	2.170000	0.68504	0.533000	0.62120	GTG		0.567	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1		NM_006328	
RHPN2	85415	broad.mit.edu;hgsc.bcm.edu	37	19	33493761	33493761	+	Silent	SNP	A	A	G			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr19:33493761A>G	ENST00000254260.3	-	8	941	c.906T>C	c.(904-906)aaT>aaC	p.N302N	RHPN2_ENST00000400226.4_Silent_p.N151N	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	302	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.N302N(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TGAAGAATTCATTCCGGATCC	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	59.0	59.0					19																	33493761		2203	4300	6503	SO:0001819	synonymous_variant	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.906T>C	19.37:g.33493761A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	ENST00000254260.3	37	CCDS12427.1																																																																																				0.542	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2		NM_033103	
RSPO1	284654	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	38079542	38079542	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:38079542C>T	ENST00000401069.1	-	6	1171	c.459G>A	c.(457-459)tgG>tgA	p.W153*	RSPO1_ENST00000356545.2_Nonsense_Mutation_p.W153*|RSPO1_ENST00000401068.1_Nonsense_Mutation_p.W153*|RSPO1_ENST00000401070.1_Intron|RSPO1_ENST00000373059.1_Nonsense_Mutation_p.W126*|RSPO1_ENST00000401071.2_Intron	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	153	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.W153*(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCACGGAGACCACTCGCTCA	0.622																																					GBM(122;680 2230 27822 42821)												1	Substitution - Nonsense(1)	kidney(1)											55.0	58.0	57.0					1																	38079542		1958	4148	6106	SO:0001587	stop_gained	284654			AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.459G>A	1.37:g.38079542C>T	ENSP00000383847:p.Trp153*	Somatic		WXS	Illumina HiSeq	Phase_I	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Nonsense_Mutation	SNP	ENST00000401069.1	37	CCDS41304.1	.	.	.	.	.	.	.	.	.	.	C	40	8.155355	0.98680	.	.	ENSG00000169218	ENST00000373059;ENST00000356545;ENST00000401069;ENST00000401068	.	.	.	5.75	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8204	0.85744	0.0:0.8718:0.1282:0.0	.	.	.	.	X	126;153;153;153	.	ENSP00000348944:W153X	W	-	3	0	RSPO1	37852129	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	5.386000	0.66238	2.711000	0.92665	0.655000	0.94253	TGG		0.622	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2		NM_173640	
SHANK2	22941	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	70332433	70332433	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr11:70332433G>C	ENST00000423696.2	-	15	2864	c.2828C>G	c.(2827-2829)aCt>aGt	p.T943S	SHANK2_ENST00000409161.1_Missense_Mutation_p.T726S|SHANK2_ENST00000449833.2_Missense_Mutation_p.T727S|SHANK2_ENST00000338508.4_Missense_Mutation_p.T1323S			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	943					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.T727S(1)|p.T1323S(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GTCCAGCTTAGTGGCGTCCAC	0.587																																																	2	Substitution - Missense(2)	kidney(2)											119.0	105.0	109.0					11																	70332433		2200	4294	6494	SO:0001583	missense	22941			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2828C>G	11.37:g.70332433G>C	ENSP00000394536:p.Thr943Ser	Somatic		WXS	Illumina HiSeq	Phase_I	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.	.	.	.	.	.	.	.	.	.	G	8.529	0.870646	0.17322	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24;2.24	5.24	4.33	0.51752	.	0.662733	0.12892	U	0.430521	T	0.14098	0.0341	N	0.22421	0.69	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.13407	0.001;0.009;0.003	T	0.04281	-1.0963	10	0.44086	T	0.13	.	13.7719	0.63032	0.0743:0.0:0.9257:0.0	.	943;1322;727	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	S	727;726;601;1323;943;961;946	ENSP00000399423:T727S;ENSP00000386491:T726S;ENSP00000402944:T601S;ENSP00000345193:T1323S;ENSP00000394536:T943S;ENSP00000294018:T946S	ENSP00000294018:T946S	T	-	2	0	SHANK2	70010081	0.183000	0.23186	0.086000	0.20670	0.323000	0.28346	2.791000	0.47829	1.196000	0.43129	0.561000	0.74099	ACT		0.587	SHANK2-203	KNOWN	basic	protein_coding	protein_coding			NM_012309	
SMARCA2	6595	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	2116050	2116050	+	Splice_Site	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr9:2116050G>A	ENST00000382203.1	+	25	3893		c.e25+1		SMARCA2_ENST00000357248.2_Splice_Site|SMARCA2_ENST00000382194.1_Splice_Site|SMARCA2_ENST00000349721.2_Splice_Site			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2						aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.?(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GGAAAATGAGGTATTAGAGAA	0.463											OREG0019074	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Unknown(2)	kidney(2)											26.0	29.0	28.0					9																	2116050		2203	4300	6503	SO:0001630	splice_region_variant	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3684+1G>A	9.37:g.2116050G>A		Somatic	601	WXS	Illumina HiSeq	Phase_I	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Splice_Site	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658359	0.88154	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1086	0.97902	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMARCA2	2106050	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.869000	0.99810	2.756000	0.94617	0.563000	0.77884	.		0.463	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1		NM_003070	Intron
SPAG17	200162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	118598450	118598450	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:118598450T>A	ENST00000336338.5	-	19	2693	c.2628A>T	c.(2626-2628)aaA>aaT	p.K876N		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	876						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.K876N(2)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TCCTGATGATTTTCTCATTCA	0.313																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											128.0	130.0	129.0					1																	118598450		2203	4296	6499	SO:0001583	missense	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2628A>T	1.37:g.118598450T>A	ENSP00000337804:p.Lys876Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	T	12.79	2.044378	0.36085	.	.	ENSG00000155761	ENST00000336338	T	0.18502	2.21	5.35	-0.899	0.10547	.	0.238912	0.40064	N	0.001196	T	0.01940	0.0061	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39722	-0.9600	10	0.72032	D	0.01	.	3.2481	0.06804	0.2329:0.2714:0.0:0.4957	.	876	Q6Q759	SPG17_HUMAN	N	876	ENSP00000337804:K876N	ENSP00000337804:K876N	K	-	3	2	SPAG17	118399973	0.217000	0.23597	0.054000	0.19295	0.006000	0.05464	0.202000	0.17295	-0.296000	0.08947	0.477000	0.44152	AAA		0.313	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1		NM_206996	
SUN1	23353	broad.mit.edu;ucsc.edu	37	7	912892	912892	+	Missense_Mutation	SNP	G	G	A	rs199515429	byFrequency	TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr7:912892G>A	ENST00000405266.1	+	20	2417	c.2393G>A	c.(2392-2394)cGg>cAg	p.R798Q	SUN1_ENST00000425407.2_Missense_Mutation_p.R678Q|SUN1_ENST00000389574.3_Missense_Mutation_p.R678Q|SUN1_ENST00000401592.1_Missense_Mutation_p.R761Q|SUN1_ENST00000413514.2_Missense_Mutation_p.R559Q|SUN1_ENST00000452783.2_Missense_Mutation_p.R658Q|SUN1_ENST00000456758.2_Missense_Mutation_p.R950Q			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	788	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)		p.R678Q(1)|p.R761Q(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTGGAACTTCGGATTTTTTCT	0.408											OREG0017816	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	4	0.000798722	0.0	0.0	5008	,	,		20042	0.0		0.001	False		,,,				2504	0.0031																2	Substitution - Missense(2)	kidney(2)						G	GLN/ARG,GLN/ARG,GLN/ARG	0,3658		0,0,1829	170.0	159.0	162.0		2282,1973,2033	4.7	1.0	7		162	2,8182		0,2,4090	yes	missense,missense,missense	SUN1	NM_001130965.2,NM_001171944.1,NM_025154.5	43,43,43	0,2,5919	AA,AG,GG		0.0244,0.0,0.0169	probably-damaging,probably-damaging,probably-damaging	761/786,658/683,678/703	912892	2,11840	1829	4092	5921	SO:0001583	missense	23353			AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.2393G>A	7.37:g.912892G>A	ENSP00000384116:p.Arg798Gln	Somatic	591	WXS	Illumina GAIIx	Phase_I	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	ENST00000405266.1	37		.	.	.	.	.	.	.	.	.	.	G	32	5.183280	0.94885	0.0	2.44E-4	ENSG00000164828	ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514	T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.6	4.72	0.59763	Sad1/UNC-like, C-terminal (2);	0.171178	0.51477	N	0.000089	T	0.58452	0.2123	L	0.49256	1.55	0.80722	D	1	D;D;D;D;D;D	0.89917	0.977;0.978;1.0;0.988;1.0;0.973	P;P;D;P;D;B	0.85130	0.697;0.451;0.987;0.765;0.997;0.406	T	0.60929	-0.7165	10	0.62326	D	0.03	-45.9846	14.2249	0.65853	0.0721:0.0:0.9279:0.0	.	559;658;761;950;788;678	E7EP45;E9PDU4;E9PF23;A4D2Q0;O94901;O94901-5	.;.;.;.;SUN1_HUMAN;.	Q	950;678;658;798;761;788;678;686;559	ENSP00000388743:R950Q;ENSP00000374225:R678Q;ENSP00000413439:R658Q;ENSP00000384116:R798Q;ENSP00000384015:R761Q;ENSP00000392309:R678Q;ENSP00000409909:R686Q;ENSP00000389313:R559Q	ENSP00000297445:R788Q	R	+	2	0	SUN1	879418	1.000000	0.71417	0.990000	0.47175	0.932000	0.56968	6.415000	0.73328	1.363000	0.46019	0.563000	0.77884	CGG		0.408	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1		NM_025154	
TLR4	7099	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	120475390	120475390	+	Silent	SNP	T	T	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr9:120475390T>C	ENST00000355622.6	+	3	1085	c.984T>C	c.(982-984)taT>taC	p.Y328Y	TLR4_ENST00000394487.4_Silent_p.Y288Y|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	328					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.Y328Y(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACTTTTCTTATAATTTCGGAT	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											61.0	69.0	66.0					9																	120475390		2203	4299	6502	SO:0001819	synonymous_variant	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.984T>C	9.37:g.120475390T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Silent	SNP	ENST00000355622.6	37	CCDS6818.1																																																																																				0.323	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3		NM_138554	
TLR8	51311	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	12939545	12939545	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chrX:12939545C>A	ENST00000218032.6	+	2	2473	c.2386C>A	c.(2386-2388)Ccc>Acc	p.P796T	TLR8_ENST00000311912.5_Missense_Mutation_p.P814T	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	796	LRRCT.				cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.P814T(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TGTCAAAATTCCCAGACTGGT	0.433																																																	1	Substitution - Missense(1)	kidney(1)											120.0	101.0	108.0					X																	12939545		2203	4300	6503	SO:0001583	missense	51311			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.2386C>A	X.37:g.12939545C>A	ENSP00000218032:p.Pro796Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399650	0.42512	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.33216	1.42;1.6	5.82	5.82	0.92795	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.40469	N	0.001081	T	0.62024	0.2394	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66436	-0.5924	10	0.72032	D	0.01	.	19.1282	0.93394	0.0:1.0:0.0:0.0	.	796;814	Q9NR97;D1CS70	TLR8_HUMAN;.	T	796;814	ENSP00000218032:P796T;ENSP00000312082:P814T	ENSP00000218032:P796T	P	+	1	0	TLR8	12849466	1.000000	0.71417	0.114000	0.21550	0.008000	0.06430	5.978000	0.70501	2.467000	0.83353	0.600000	0.82982	CCC		0.433	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2		NM_016610	
TXNDC12	51060	broad.mit.edu;ucsc.edu	37	1	52492991	52492991	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr1:52492991C>A	ENST00000371626.4	-	4	1315	c.241G>T	c.(241-243)Gaa>Taa	p.E81*	TXNDC12_ENST00000471493.1_5'Flank	NM_015913.3	NP_056997.1	O95881	TXD12_HUMAN	thioredoxin domain containing 12 (endoplasmic reticulum)	81					cell redox homeostasis (GO:0045454)	endoplasmic reticulum (GO:0005783)	protein-disulfide reductase (glutathione) activity (GO:0019153)	p.E81*(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7					Glutathione(DB00143)	TCTGAAATTTCCGTAGATTCT	0.338																																																	1	Substitution - Nonsense(1)	kidney(1)											64.0	68.0	67.0					1																	52492991		2203	4299	6502	SO:0001587	stop_gained	51060			AF131758	CCDS561.1	1p32.3	2011-10-19			ENSG00000117862	ENSG00000117862		"""Protein disulfide isomerases"""	24626	protein-coding gene	gene with protein product	"""endoplasmic reticulum thioredoxin superfamily member, 18 kDa"", ""anterior gradient homolog 1 (Xenopus laevis)"", ""protein disulfide isomerase family A, member 16"""	609448				8619474, 9110174	Standard	NM_015913		Approved	TLP19, ERP18, ERP19, hAG-1, AGR1, PDIA16	uc001cti.4	O95881	OTTHUMG00000008629	ENST00000371626.4:c.241G>T	1.37:g.52492991C>A	ENSP00000360688:p.Glu81*	Somatic		WXS	Illumina GAIIx	Phase_I	B3KQS0|Q5T1T4|Q96H50	Nonsense_Mutation	SNP	ENST00000371626.4	37	CCDS561.1	.	.	.	.	.	.	.	.	.	.	C	46	12.403890	0.99664	.	.	ENSG00000117862	ENST00000371626	.	.	.	5.93	5.93	0.95920	.	0.100755	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	18.5271	0.90976	0.0:1.0:0.0:0.0	.	.	.	.	X	81	.	ENSP00000360688:E81X	E	-	1	0	TXNDC12	52265579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.429000	0.73387	2.798000	0.96311	0.655000	0.94253	GAA		0.338	TXNDC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023818.1		NM_015913	
USP29	57663	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	57640818	57640818	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr19:57640818G>T	ENST00000254181.4	+	4	1229	c.775G>T	c.(775-777)Gaa>Taa	p.E259*	USP29_ENST00000598197.1_Nonsense_Mutation_p.E259*	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	259					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.E259*(1)|p.E259K(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCTCCATTGGAACCAGAGCA	0.478																																																	2	Substitution - Nonsense(1)|Substitution - Missense(1)	endometrium(1)|kidney(1)											84.0	86.0	85.0					19																	57640818		2203	4300	6503	SO:0001587	stop_gained	57663				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.775G>T	19.37:g.57640818G>T	ENSP00000254181:p.Glu259*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	36	5.609419	0.96637	.	.	ENSG00000131864	ENST00000254181	.	.	.	2.27	1.22	0.21188	.	1.324790	0.05844	U	0.619859	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	0.9359	4.6868	0.12762	0.1845:0.0:0.8155:0.0	.	.	.	.	X	259	.	ENSP00000254181:E259X	E	+	1	0	USP29	62332630	0.040000	0.19996	0.000000	0.03702	0.002000	0.02628	0.527000	0.22987	0.488000	0.27723	0.591000	0.81541	GAA		0.478	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			
VHL	7428	hgsc.bcm.edu	37	3	10183665	10183665	+	Missense_Mutation	SNP	C	C	T	rs199583685		TCGA-B0-5107-01A-01W-1475-10	TCGA-B0-5107-11A-01W-1475-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PacBio	.		Illumina GAIIx	12ca17d1-d74d-4927-81c0-16be4ee6febc	6b3be423-aa19-4913-9a56-8e814e0edec2	g.chr3:10183665C>T	ENST00000256474.2	+	1	974	c.134C>T	c.(133-135)cCg>cTg	p.P45L	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.P45L	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	45	8 X 5 AA tandem repeats of G-[PAVG]-E-E- [DAYSLE].				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)			adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GAGTCCGGCCCGGAGGAACTG	0.716		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia				C|||	1	0.000199681	0.0	0.0	5008	,	,		10527	0.001		0.0	False		,,,				2504	0.0					.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	0																																										SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.134C>T	3.37:g.10183665C>T	ENSP00000256474:p.Pro45Leu	Somatic		WXS	Illumina MiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.59	2.580733	0.46006	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.84298	-1.83;-1.83	3.53	0.582	0.17412	.	1.482540	0.04888	N	0.448902	T	0.73737	0.3625	N	0.19112	0.55	0.09310	N	1	B;B	0.22604	0.072;0.043	B;B	0.19666	0.026;0.012	T	0.61192	-0.7112	10	0.72032	D	0.01	0.0061	2.9019	0.05708	0.1708:0.3546:0.3717:0.1029	.	45;45	P40337-2;P40337	.;VHL_HUMAN	L	45	ENSP00000256474:P45L;ENSP00000344757:P45L	ENSP00000256474:P45L	P	+	2	0	VHL	10158665	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.435000	0.21510	0.107000	0.17824	0.555000	0.69702	CCG		0.716	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10183794	10183794	+	Missense_Mutation	SNP	G	G	T	rs119103277		TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina Miseq			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr3:10183794G>T	ENST00000256474.2	+	1	1103	c.263G>T	c.(262-264)tGg>tTg	p.W88L	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.W88L	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	88			W -> R (in VHLD; type I). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829911}.|W -> S (in VHLD; type I). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.W88*(6)|p.W88L(3)|p.W88fs*71(3)|p.V87_W88del(2)|p.W88S(2)|p.R60fs*35(1)|p.V84_E94>E(1)|p.V84fs*69(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGCCCGTATGGCTCAACTTC	0.726		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	19	Substitution - Nonsense(6)|Substitution - Missense(5)|Deletion - Frameshift(5)|Deletion - In frame(2)|Complex - deletion inframe(1)	kidney(17)|endometrium(1)|soft_tissue(1)	GRCh37	CM951277|HX971376	VHL	M|X	rs119103277						13.0	16.0	15.0					3																	10183794		2111	4166	6277	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.263G>T	3.37:g.10183794G>T	ENSP00000256474:p.Trp88Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	32	5.190572	0.94923	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99961	-9.37;-9.37	5.07	5.07	0.68467	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.000000	0.85682	D	0.000000	D	0.99963	0.9985	M	0.84773	2.715	0.41389	D	0.987602	D;D	0.76494	0.996;0.999	D;D	0.78314	0.991;0.975	D	0.94955	0.8103	10	0.59425	D	0.04	-1.5857	16.0203	0.80478	0.0:0.0:1.0:0.0	.	88;88	P40337-2;P40337	.;VHL_HUMAN	L	88	ENSP00000256474:W88L;ENSP00000344757:W88L	ENSP00000256474:W88L	W	+	2	0	VHL	10158794	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	5.961000	0.70356	2.368000	0.80403	0.479000	0.44913	TGG		0.726	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR37	22884	broad.mit.edu;hgsc.bcm.edu	37	10	1149775	1149775	+	Splice_Site	SNP	A	A	C			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr10:1149775A>C	ENST00000358220.1	+	10	1104	c.960A>C	c.(958-960)acA>acC	p.T320T	WDR37_ENST00000263150.4_Splice_Site_p.T320T			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	320								p.T320T(1)		breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ACTCTCTGACAGGTGCCTGGG	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											37.0	30.0	32.0					10																	1149775		2203	4300	6503	SO:0001630	splice_region_variant	22884			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.961+1A>C	10.37:g.1149775A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Silent	SNP	ENST00000358220.1	37	CCDS7057.1																																																																																				0.577	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1		NM_014023	Silent
WIF1	11197	hgsc.bcm.edu;ucsc.edu	37	12	65461562	65461562	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr12:65461562G>T	ENST00000286574.4	-	5	921	c.547C>A	c.(547-549)Cca>Aca	p.P183T		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	183	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.C182_P183>*(2)|p.P183T(2)		cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CACCCGCCTGGGCACTCAGCT	0.488			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)			Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	4	Substitution - Missense(2)|Complex - deletion inframe(2)	lung(4)											61.0	59.0	59.0					12																	65461562		2203	4300	6503	SO:0001583	missense	11197			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.547C>A	12.37:g.65461562G>T	ENSP00000286574:p.Pro183Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827064	0.32329	.	.	ENSG00000156076	ENST00000286574;ENST00000546001	T	0.65364	-0.15	5.64	4.74	0.60224	EGF, extracellular (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.116200	0.64402	D	0.000017	T	0.52125	0.1715	L	0.35487	1.065	0.58432	D	0.999997	P	0.38827	0.649	B	0.38683	0.279	T	0.49960	-0.8883	9	.	.	.	.	14.7726	0.69691	0.0694:0.0:0.9306:0.0	.	183	Q9Y5W5	WIF1_HUMAN	T	183;121	ENSP00000286574:P183T	.	P	-	1	0	WIF1	63747829	1.000000	0.71417	0.997000	0.53966	0.411000	0.31082	7.782000	0.85680	1.522000	0.49001	0.655000	0.94253	CCA		0.488	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2			
ZFPM2	23414	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	106813890	106813890	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5107-01A-01D-1421-08	TCGA-B0-5107-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2086a2e1-0451-45ba-9ca3-d4e5f61e590b	3120fe95-115c-4fea-acc0-40c37f8c24e8	g.chr8:106813890G>A	ENST00000407775.2	+	8	1830	c.1580G>A	c.(1579-1581)cGa>cAa	p.R527Q	RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.R395Q|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.R395Q|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.R258Q	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	527					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R527Q(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GTGCATCGGCGACTGAGGCAT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											92.0	94.0	93.0					8																	106813890		1938	4128	6066	SO:0001583	missense	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1580G>A	8.37:g.106813890G>A	ENSP00000384179:p.Arg527Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017101	0.93404	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.36699	1.24;1.77;1.77;2.98	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.55398	-0.8147	10	0.48119	T	0.1	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	527	Q8WW38	FOG2_HUMAN	Q	527;395;395;258	ENSP00000384179:R527Q;ENSP00000430757:R395Q;ENSP00000428720:R395Q;ENSP00000367733:R258Q	ENSP00000367733:R258Q	R	+	2	0	ZFPM2	106883066	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.836000	0.97738	0.655000	0.94253	CGA		0.473	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			
