#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACTN2	88	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	236891015	236891015	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr1:236891015C>T	ENST00000366578.4	+	6	740	c.574C>T	c.(574-576)Cga>Tga	p.R192*	ACTN2_ENST00000542672.1_Nonsense_Mutation_p.R192*|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	192	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.R192*(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CCTCATCCACCGACACCGGCC	0.547																																																	1	Substitution - Nonsense(1)	kidney(1)											174.0	142.0	153.0					1																	236891015		2203	4300	6503	SO:0001587	stop_gained	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.574C>T	1.37:g.236891015C>T	ENSP00000355537:p.Arg192*	Somatic		WXS	Illumina HiSeq	Phase_I	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Nonsense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	39	7.488167	0.98316	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	.	.	.	5.2	4.08	0.47627	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0964	0.53757	0.8494:0.1506:0.0:0.0	.	.	.	.	X	192	.	ENSP00000355537:R192X	R	+	1	2	ACTN2	234957638	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.691000	0.54720	0.817000	0.34445	-0.521000	0.04368	CGA		0.547	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1		NM_001103	
ALPK1	80216	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	113360933	113360933	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr4:113360933T>C	ENST00000458497.1	+	14	3722	c.3443T>C	c.(3442-3444)gTg>gCg	p.V1148A	ALPK1_ENST00000504176.2_Missense_Mutation_p.V1070A|ALPK1_ENST00000177648.9_Missense_Mutation_p.V1148A	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1148	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.V1148A(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		ACGAAAGTGGTGAAAACAGAA	0.358																																																	1	Substitution - Missense(1)	kidney(1)											84.0	82.0	83.0					4																	113360933		2203	4300	6503	SO:0001583	missense	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.3443T>C	4.37:g.113360933T>C	ENSP00000398048:p.Val1148Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	T	18.20	3.570861	0.65765	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.06371	3.31;3.31;3.31	5.05	3.82	0.43975	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.201663	0.42682	N	0.000668	T	0.21761	0.0524	M	0.76002	2.32	0.38210	D	0.940447	D;D;D	0.76494	0.983;0.999;0.998	P;D;D	0.79108	0.888;0.992;0.973	T	0.01341	-1.1380	10	0.87932	D	0	-14.0825	9.7223	0.40311	0.0:0.0902:0.0:0.9098	.	1070;1070;1148	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	A	1148;1148;1070	ENSP00000398048:V1148A;ENSP00000177648:V1148A;ENSP00000426044:V1070A	ENSP00000177648:V1148A	V	+	2	0	ALPK1	113580382	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	2.341000	0.43983	0.711000	0.32018	0.445000	0.29226	GTG		0.358	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2		NM_025144	
ANKRD40	91369	hgsc.bcm.edu	37	17	48777220	48777221	+	In_Frame_Ins	INS	-	-	TCA	rs377717183|rs138572332	byFrequency	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr17:48777220_48777221insTCA	ENST00000285243.6	-	3	586_587	c.317_318insTGA	c.(316-318)gac>gaTGAc	p.106_106D>DD		NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	106	Poly-Asp.									breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			GGGGGAGGTTGtcatcatcatc	0.406														235	0.0469249	0.0908	0.0807	5008	,	,		16671	0.0337		0.004	False		,,,				2504	0.0215																0																																										SO:0001652	inframe_insertion	91369			BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.315_317dupTGA	17.37:g.48777227_48777229dupTCA	ENSP00000285243:p.Asp106dup	Somatic		WXS	Illumina HiSeq	Phase_I	Q96E32	In_Frame_Ins	INS	ENST00000285243.6	37	CCDS11572.1																																																																																				0.406	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368201.2		NM_052855	
ARHGEF5	7984	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	144077075	144077075	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr7:144077075G>T	ENST00000056217.5	+	15	4894	c.4720G>T	c.(4720-4722)Gtc>Ttc	p.V1574F	ARHGEF5_ENST00000471847.2_Missense_Mutation_p.V496F	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1574					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V1574F(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CAACCCAGAGGTCCGTGCACA	0.572																																																	1	Substitution - Missense(1)	kidney(1)											124.0	123.0	123.0					7																	144077075		2203	4300	6503	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.4720G>T	7.37:g.144077075G>T	ENSP00000056217:p.Val1574Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.305323|4.305323	0.81247|0.81247	.|.	.|.	ENSG00000050327|ENSG00000050327	ENST00000474817|ENST00000056217;ENST00000344879;ENST00000471847	.|T;T	.|0.30981	.|1.51;1.51	5.33|5.33	4.46|4.46	0.54185|0.54185	.|.	.|0.229119	.|0.36234	.|N	.|0.002707	T|T	0.30293|0.30293	0.0760|0.0760	N|N	0.19112|0.19112	0.55|0.55	0.40832|0.40832	D|D	0.983599|0.983599	.|B;D	.|0.59767	.|0.251;0.986	.|B;P	.|0.52758	.|0.116;0.708	T|T	0.16424|0.16424	-1.0403|-1.0403	5|10	.|0.87932	.|D	.|0	-10.1297|-10.1297	11.8313|11.8313	0.52297|0.52297	0.0839:0.0:0.9161:0.0|0.0839:0.0:0.9161:0.0	.|.	.|375;1574	.|B3KQX6;Q12774	.|.;ARHG5_HUMAN	S|F	773|1574;375;496	.|ENSP00000056217:V1574F;ENSP00000418227:V496F	.|ENSP00000056217:V1574F	R|V	+|+	3|1	2|0	ARHGEF5|ARHGEF5	143708008|143708008	1.000000|1.000000	0.71417|0.71417	0.708000|0.708000	0.30435|0.30435	0.940000|0.940000	0.58332|0.58332	6.188000|6.188000	0.72045|0.72045	1.492000|1.492000	0.48499|0.48499	0.563000|0.563000	0.77884|0.77884	AGG|GTC		0.572	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1		NM_005435	
SOHLH2	54937	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	36776196	36776196	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr13:36776196G>T	ENST00000379881.3	-	2	171	c.83C>A	c.(82-84)aCt>aAt	p.T28N	SOHLH2_ENST00000554962.1_Missense_Mutation_p.T105N|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.T105N|SOHLH2_ENST00000317764.6_Missense_Mutation_p.T28N	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	28					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T28N(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GTAGCCCACAGTGACATCTCC	0.438																																																	1	Substitution - Missense(1)	kidney(1)											106.0	81.0	89.0					13																	36776196		2203	4300	6503	SO:0001583	missense	0			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.83C>A	13.37:g.36776196G>T	ENSP00000369210:p.Thr28Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102526	0.56183	.	.	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	T;T;T;T	0.52057	1.25;1.25;0.68;1.25	5.69	3.93	0.45458	.	0.116646	0.39274	N	0.001407	T	0.43255	0.1239	L	0.32530	0.975	0.30422	N	0.777986	D;D	0.60575	0.976;0.988	P;P	0.50934	0.654;0.654	T	0.48490	-0.9031	10	0.87932	D	0	7.7198	7.8029	0.29185	0.0864:0.1628:0.7508:0.0	.	105;28	B4DX90;Q9NX45	.;SOLH2_HUMAN	N	28;105;28;105	ENSP00000369210:T28N;ENSP00000451542:T105N;ENSP00000326838:T28N;ENSP00000421868:T105N	ENSP00000421868:T105N	T	-	2	0	CCDC169-SOHLH2;SOHLH2	35674196	0.966000	0.33281	0.660000	0.29694	0.863000	0.49368	2.175000	0.42491	0.745000	0.32763	0.655000	0.94253	ACT		0.438	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2		NM_017826	
ENKD1	84080	broad.mit.edu;hgsc.bcm.edu	37	16	67697841	67697841	+	Splice_Site	SNP	T	T	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr16:67697841T>G	ENST00000243878.4	-	4	899	c.578A>C	c.(577-579)aAg>aCg	p.K193T	ENKD1_ENST00000602644.1_Splice_Site_p.K193T|ENKD1_ENST00000602409.1_Intron|C16orf86_ENST00000403458.4_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	193						cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)		p.K193T(1)									TCCTCTCACCTTAGCTTCGGG	0.647																																																	1	Substitution - Missense(1)	kidney(1)											35.0	38.0	37.0					16																	67697841		2196	4299	6495	SO:0001630	splice_region_variant	0			BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.579+1A>C	16.37:g.67697841T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UWD7	Missense_Mutation	SNP	ENST00000243878.4	37	CCDS10844.1	.	.	.	.	.	.	.	.	.	.	t	11.21	1.572465	0.28092	.	.	ENSG00000124074	ENST00000243878	.	.	.	4.76	4.76	0.60689	.	0.255453	0.45361	D	0.000369	T	0.50752	0.1634	L	0.27053	0.805	0.39591	D	0.969586	D;P	0.69078	0.997;0.949	P;P	0.60789	0.879;0.51	T	0.46721	-0.9171	9	0.20046	T	0.44	-1.537	8.9404	0.35727	0.0:0.0:0.1874:0.8126	.	193;75	Q9H0I2;Q9H0I2-2	CP048_HUMAN;.	T	193	.	ENSP00000243878:K193T	K	-	2	0	C16orf48	66255342	0.612000	0.27000	0.998000	0.56505	0.407000	0.30961	1.333000	0.33816	1.908000	0.55244	0.444000	0.29173	AAG		0.647	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268884.1		NM_032140	Missense_Mutation
RUSC1	23623	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	155290610	155290610	+	5'Flank	SNP	T	T	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr1:155290610T>A	ENST00000368352.5	+	0	0				RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CAAAAGACGCTAAACGCTGGG	0.637																																																	0													32.0	36.0	35.0					1																	155290610		1974	4158	6132	SO:0001631	upstream_gene_variant	0			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910		1.37:g.155290610T>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																				0.637	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1			
C8orf37	157657	hgsc.bcm.edu;ucsc.edu	37	8	96275957	96275962	+	In_Frame_Del	DEL	AATAAG	AATAAG	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	AATAAG	AATAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr8:96275957_96275962delAATAAG	ENST00000286688.5	-	2	207_212	c.196_201delCTTATT	c.(196-201)cttattdel	p.LI66del		NM_177965.3	NP_808880.1	Q96NL8	CH037_HUMAN	chromosome 8 open reading frame 37	66						cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(5)	7	Breast(36;3.41e-05)					GTATTTCATTAATAAGACTGTCAAGA	0.316																																																	0																																										SO:0001651	inframe_deletion	157657			AK055162	CCDS6268.1	8q22.1	2014-01-28			ENSG00000156172	ENSG00000156172			27232	protein-coding gene	gene with protein product		614477				22177090	Standard	NM_177965		Approved	FLJ30600, CORD16, RP64	uc003yho.2	Q96NL8	OTTHUMG00000164663	ENST00000286688.5:c.196_201delCTTATT	8.37:g.96275957_96275962delAATAAG	ENSP00000286688:p.Leu66_Ile67del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000286688.5	37	CCDS6268.1																																																																																				0.316	C8orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379672.1		NM_177965	
CCDC68	80323	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	52575020	52575020	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr18:52575020G>A	ENST00000591504.1	-	11	1221	c.947C>T	c.(946-948)aCa>aTa	p.T316I	CCDC68_ENST00000337363.4_Missense_Mutation_p.T316I|CCDC68_ENST00000432185.1_Missense_Mutation_p.T316I	NM_025214.2	NP_079490.1	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	316								p.T316I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|stomach(1)	14				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		ACCTTACCTTGTAGAGACAGC	0.403																																																	1	Substitution - Missense(1)	kidney(1)											201.0	181.0	188.0					18																	52575020		2203	4300	6503	SO:0001583	missense	80323				CCDS11959.1	18q21	2006-02-07			ENSG00000166510	ENSG00000166510			24350	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma associated antigen"""					11149944, 15142679	Standard	NM_025214		Approved	SE57-1	uc002lft.3	Q9H2F9	OTTHUMG00000132708	ENST00000591504.1:c.947C>T	18.37:g.52575020G>A	ENSP00000466690:p.Thr316Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9I3	Missense_Mutation	SNP	ENST00000591504.1	37	CCDS11959.1	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912024	0.72983	.	.	ENSG00000166510	ENST00000337363;ENST00000432185	T;T	0.24350	1.86;1.86	5.5	5.5	0.81552	.	0.000000	0.56097	D	0.000023	T	0.34483	0.0899	L	0.29908	0.895	0.37416	D	0.913432	D	0.69078	0.997	D	0.63033	0.91	T	0.07214	-1.0784	10	0.20519	T	0.43	.	15.2545	0.73573	0.0:0.0:1.0:0.0	.	316	Q9H2F9	CCD68_HUMAN	I	316	ENSP00000337209:T316I;ENSP00000413406:T316I	ENSP00000337209:T316I	T	-	2	0	CCDC68	50726018	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	4.270000	0.58896	2.733000	0.93635	0.650000	0.86243	ACA		0.403	CCDC68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256006.1		NM_025214	
CD163	9332	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7636081	7636081	+	Silent	SNP	C	C	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr12:7636081C>G	ENST00000359156.4	-	12	3172	c.2970G>C	c.(2968-2970)ccG>ccC	p.P990P	CD163_ENST00000432237.2_Silent_p.P990P|CD163_ENST00000539632.1_5'UTR|CD163_ENST00000396620.3_Silent_p.P1023P|CD163_ENST00000541972.1_Silent_p.P978P	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	990	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.P990P(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TGAGCCATATCGGTCCAGTCC	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											160.0	130.0	140.0					12																	7636081		2203	4300	6503	SO:0001819	synonymous_variant	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2970G>C	12.37:g.7636081C>G		Somatic		WXS	Illumina HiSeq	Phase_I	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Silent	SNP	ENST00000359156.4	37	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	8.254	0.809586	0.16537	.	.	ENSG00000177575	ENST00000537626	.	.	.	5.4	0.317	0.15861	.	.	.	.	.	T	0.53514	0.1801	.	.	.	0.41104	D	0.985696	.	.	.	.	.	.	T	0.44452	-0.9327	4	.	.	.	.	6.9248	0.24410	0.2947:0.1205:0.5849:0.0	.	.	.	.	P	3	.	.	R	-	2	0	CD163	7527348	0.050000	0.20438	0.630000	0.29268	0.988000	0.76386	-0.569000	0.05902	0.079000	0.16929	-0.235000	0.12190	CGA		0.522	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2		NM_004244, NM_203416	
CTNND2	1501	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	11346669	11346676	+	Frame_Shift_Del	DEL	GGCATTCT	GGCATTCT	-	rs140702980		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	GGCATTCT	GGCATTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:11346669_11346676delGGCATTCT	ENST00000304623.8	-	9	1625_1632	c.1436_1443delAGAATGCC	c.(1435-1443)cagaatgccfs	p.QNA479fs	CTNND2_ENST00000359640.2_Frame_Shift_Del_p.QNA479fs|CTNND2_ENST00000511377.1_Frame_Shift_Del_p.QNA388fs|CTNND2_ENST00000503622.1_Frame_Shift_Del_p.QNA142fs|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Frame_Shift_Del_p.QNA46fs	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	479					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q479H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGGCCGCGGCGGCATTCTGTGGGCCGTG	0.611																																																	1	Substitution - Missense(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1436_1443delAGAATGCC	5.37:g.11346669_11346676delGGCATTCT	ENSP00000307134:p.Gln479fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Frame_Shift_Del	DEL	ENST00000304623.8	37	CCDS3881.1																																																																																				0.611	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1		NM_001332	
DAXX	1616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33286892	33286892	+	Missense_Mutation	SNP	G	G	C	rs377663648		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr6:33286892G>C	ENST00000374542.5	-	7	2249	c.2045C>G	c.(2044-2046)tCc>tGc	p.S682C	DAXX_ENST00000414083.2_Missense_Mutation_p.S607C|ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000266000.6_Missense_Mutation_p.S682C|ZBTB22_ENST00000431845.2_5'Flank|DAXX_ENST00000477162.1_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	682	Interaction with SPOP.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.S682C(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						CCTCGTGGAGGAATCAGCAAC	0.592			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	1	Substitution - Missense(1)	kidney(1)											80.0	85.0	84.0					6																	33286892		2203	4300	6503	SO:0001583	missense	1616			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.2045C>G	6.37:g.33286892G>C	ENSP00000363668:p.Ser682Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998850	0.54147	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	5.26	5.26	0.73747	.	0.291039	0.28241	N	0.016072	T	0.71500	0.3347	M	0.63428	1.95	0.45066	D	0.998087	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.73591	-0.3934	9	0.72032	D	0.01	-14.1399	14.2357	0.65925	0.0:0.0:1.0:0.0	.	694;682	B4E1C1;Q9UER7	.;DAXX_HUMAN	C	682;682;607	.	ENSP00000266000:S682C	S	-	2	0	DAXX	33394870	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	4.219000	0.58561	2.736000	0.93811	0.643000	0.83706	TCC		0.592	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1			
DSCAML1	57453	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	117374716	117374717	+	Missense_Mutation	DNP	AC	AC	TG			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr11:117374716_117374717AC>TG	ENST00000321322.6	-	11	2383_2384	c.2382_2383GT>CA	c.(2380-2385)caGTac>caCAac	p.794_795QY>HN	DSCAML1_ENST00000527706.1_Missense_Mutation_p.524_525QY>HN	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	734	Ig-like C2-type 9.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.Q794_Y795>HN(1)|p.Q794H(1)|p.Y795N(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ACAGGGTGGTACTGCTGGGGGT	0.629																																																	3	Substitution - Missense(2)|Complex - compound substitution(1)	kidney(3)																																								SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2382_2383delinsTG	11.37:g.117374716_117374717delinsTG	ENSP00000315465:p.Q794_Y795delinsHN	Somatic		WXS	Illumina HiSeq	Phase_I	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1																																																																																				0.629	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2		NM_020693	
ERLIN1	10613	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	101923759	101923759	+	Splice_Site	SNP	A	A	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr10:101923759A>G	ENST00000421367.2	-	8	3363		c.e8+1		ERLIN1_ENST00000407654.3_Splice_Site	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)		p.?(1)					Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		AAATCCAAGTACCTATAACTG	0.398																																																	1	Unknown(1)	kidney(1)											258.0	224.0	235.0					10																	101923759		2201	4299	6500	SO:0001630	splice_region_variant	10613			AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.655+1T>C	10.37:g.101923759A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B0QZ42|Q53HV0	Splice_Site	SNP	ENST00000421367.2	37	CCDS7487.2	.	.	.	.	.	.	.	.	.	.	A	14.42	2.531323	0.45073	.	.	ENSG00000107566	ENST00000421367;ENST00000407654;ENST00000370410;ENST00000370408	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5583	0.61773	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERLIN1	101913749	1.000000	0.71417	1.000000	0.80357	0.395000	0.30598	7.535000	0.82014	2.140000	0.66376	0.460000	0.39030	.		0.398	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2		NM_006459	Intron
FAM64A	54478	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	6348680	6348680	+	Missense_Mutation	SNP	G	G	A	rs151147808		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr17:6348680G>A	ENST00000250056.8	+	2	333	c.250G>A	c.(250-252)Gct>Act	p.A84T	FAM64A_ENST00000572447.1_Missense_Mutation_p.A84T|FAM64A_ENST00000576056.1_Missense_Mutation_p.A84T|FAM64A_ENST00000570337.2_Missense_Mutation_p.A84T|FAM64A_ENST00000571373.1_Missense_Mutation_p.A84T|FAM64A_ENST00000572595.2_Missense_Mutation_p.A84T	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	84					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.A84T(1)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		GGGCCTCCAGGCTGCAGCTCG	0.582																																																	1	Substitution - Missense(1)	kidney(1)						G	THR/ALA,THR/ALA	0,4406		0,0,2203	50.0	56.0	54.0		250,250	4.1	1.0	17	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FAM64A	NM_001195228.1,NM_019013.2	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	84/249,84/239	6348680	1,13005	2203	4300	6503	SO:0001583	missense	54478				CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.250G>A	17.37:g.6348680G>A	ENSP00000250056:p.Ala84Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	ENST00000250056.8	37	CCDS56016.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579138	0.65878	0.0	1.16E-4	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.52295	0.67	5.08	4.07	0.47477	.	0.567298	0.16830	N	0.197818	T	0.57621	0.2066	M	0.65975	2.015	0.29014	N	0.886698	P;P	0.49447	0.924;0.906	P;P	0.55785	0.784;0.677	T	0.51124	-0.8745	10	0.34782	T	0.22	-0.8349	10.8709	0.46883	0.0:0.0:0.8134:0.1866	.	84;84	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	T	84	ENSP00000250056:A84T	ENSP00000250056:A84T	A	+	1	0	FAM64A	6289404	0.990000	0.36364	1.000000	0.80357	0.274000	0.26718	2.029000	0.41098	2.652000	0.90054	0.655000	0.94253	GCT		0.582	FAM64A-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000439156.1		NM_019013	
FKBPL	63943	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	32097079	32097079	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr6:32097079A>C	ENST00000375156.3	-	2	749	c.479T>G	c.(478-480)aTa>aGa	p.I160R	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	160					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.I160R(1)									GCATTTCTCTATGAGCTCCCC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											180.0	189.0	186.0					6																	32097079		2203	4300	6503	SO:0001583	missense	63943			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.479T>G	6.37:g.32097079A>C	ENSP00000364298:p.Ile160Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	ENST00000375156.3	37	CCDS4738.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.999278	0.35226	.	.	ENSG00000204315	ENST00000375156	D	0.82619	-1.63	5.38	2.94	0.34122	.	1.314610	0.05242	N	0.512293	T	0.53384	0.1793	N	0.14661	0.345	0.09310	N	1	B	0.29716	0.255	B	0.26517	0.07	T	0.54146	-0.8337	10	0.87932	D	0	1.2559	8.2524	0.31735	0.8349:0.0:0.1651:0.0	.	160	Q9UIM3	FKBPL_HUMAN	R	160	ENSP00000364298:I160R	ENSP00000364298:I160R	I	-	2	0	FKBPL	32205057	0.010000	0.17322	0.270000	0.24601	0.993000	0.82548	1.281000	0.33214	0.469000	0.27268	0.379000	0.24179	ATA		0.577	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2			
FZD10	11211	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	130649146	130649146	+	Silent	SNP	C	C	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr12:130649146C>T	ENST00000229030.4	+	1	2143	c.1659C>T	c.(1657-1659)agC>agT	p.S553S	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_3'UTR			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	553					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S553S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TGATCACCAGCGGTGGGATTT	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											32.0	37.0	35.0					12																	130649146		2203	4300	6503	SO:0001819	synonymous_variant	11211			AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1659C>T	12.37:g.130649146C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000229030.4	37	CCDS9267.1																																																																																				0.562	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
GBA2	57704	hgsc.bcm.edu;ucsc.edu	37	9	35738845	35738845	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr9:35738845delC	ENST00000378103.3	-	12	2374	c.1851delG	c.(1849-1851)tggfs	p.W617fs	GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000545786.1_Frame_Shift_Del_p.W623fs|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378094.4_Frame_Shift_Del_p.W617fs	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	617					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCAGGTCCTTCCAATCAGCAG	0.483																																																	0													113.0	102.0	106.0					9																	35738845		2203	4300	6503	SO:0001589	frameshift_variant	57704			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1851delG	9.37:g.35738845delC	ENSP00000367343:p.Trp617fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Frame_Shift_Del	DEL	ENST00000378103.3	37	CCDS6589.1																																																																																				0.483	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1		NM_020944	
GLG1	2734	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	74530491	74530491	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr16:74530491T>C	ENST00000422840.2	-	5	825	c.826A>G	c.(826-828)Aaa>Gaa	p.K276E	GLG1_ENST00000205061.5_Missense_Mutation_p.K276E|GLG1_ENST00000447066.2_Missense_Mutation_p.K265E	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	276					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.K276E(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TCTGCTTCTTTCACCAGGCCT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											144.0	146.0	145.0					16																	74530491		2198	4300	6498	SO:0001583	missense	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.826A>G	16.37:g.74530491T>C	ENSP00000405984:p.Lys276Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.804135	0.50315	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.73	5.73	0.89815	.	0.106321	0.64402	D	0.000009	T	0.43986	0.1272	N	0.19112	0.55	0.58432	D	0.999997	B;B;B	0.25850	0.075;0.134;0.136	B;B;B	0.27608	0.032;0.067;0.081	T	0.33189	-0.9878	9	0.19147	T	0.46	-4.9287	16.0337	0.80603	0.0:0.0:0.0:1.0	.	276;276;265	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	E	276;265;276	.	ENSP00000205061:K276E	K	-	1	0	GLG1	73087992	0.869000	0.29996	1.000000	0.80357	0.958000	0.62258	2.652000	0.46682	2.189000	0.69895	0.528000	0.53228	AAA		0.413	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1		NM_012201	
SLC52A2	79581	hgsc.bcm.edu	37	8	145584534	145584535	+	Frame_Shift_Ins	INS	-	-	G	rs144821688		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr8:145584534_145584535insG	ENST00000532887.1	+	5	1780_1781	c.1197_1198insG	c.(1198-1200)gggfs	p.G400fs	SLC52A2_ENST00000540505.1_Frame_Shift_Ins_p.G312fs|SLC52A2_ENST00000527078.1_Frame_Shift_Ins_p.G400fs|SLC52A2_ENST00000530047.1_Frame_Shift_Ins_p.G400fs|SLC52A2_ENST00000526752.1_Frame_Shift_Ins_p.R68fs|SLC52A2_ENST00000329994.2_Frame_Shift_Ins_p.G400fs|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000402965.1_Frame_Shift_Ins_p.G400fs|FBXL6_ENST00000455319.2_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	400					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	TGCTGCATGGCGGGGGCCGGCC	0.653																																																	0																																										SO:0001589	frameshift_variant	0			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.1202dupG	8.37:g.145584539_145584539dupG	ENSP00000436768:p.Gly400fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Frame_Shift_Ins	INS	ENST00000532887.1	37	CCDS6423.1																																																																																				0.653	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382405.1		NM_024531	
GPRASP1	9737	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	101911040	101911041	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chrX:101911040_101911041insG	ENST00000361600.5	+	5	3000_3001	c.2199_2200insG	c.(2200-2202)gggfs	p.G734fs	GPRASP1_ENST00000415986.1_Frame_Shift_Ins_p.G734fs|GPRASP1_ENST00000444152.1_Frame_Shift_Ins_p.G734fs|GPRASP1_ENST00000537097.1_Frame_Shift_Ins_p.G734fs|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	734	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GTAATATAGATGGGACTGGAGA	0.441																																																	0																																										SO:0001589	frameshift_variant	9737			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2202dupG	X.37:g.101911043_101911043dupG	ENSP00000355146:p.Gly734fs	Somatic		WXS	Illumina HiSeq	Phase_I	O43168|Q96LA1	Frame_Shift_Ins	INS	ENST00000361600.5	37	CCDS35352.1																																																																																				0.441	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2		NM_014710	
HMHA1	23526	broad.mit.edu;ucsc.edu	37	19	1074667	1074667	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr19:1074667T>A	ENST00000313093.2	+	9	1279	c.1048T>A	c.(1048-1050)Ttc>Atc	p.F350I	HMHA1_ENST00000586866.1_Missense_Mutation_p.F354I|HMHA1_ENST00000536472.1_Missense_Mutation_p.F190I|HMHA1_ENST00000590577.1_5'Flank|HMHA1_ENST00000590214.1_Missense_Mutation_p.F377I|HMHA1_ENST00000543365.1_Missense_Mutation_p.F233I|HMHA1_ENST00000539243.2_Missense_Mutation_p.F366I	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	350					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)	p.F350I(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACCTGGAGTTCGGCCACAG	0.701																																																	1	Substitution - Missense(1)	kidney(1)											20.0	24.0	23.0					19																	1074667		2199	4296	6495	SO:0001583	missense	23526			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.1048T>A	19.37:g.1074667T>A	ENSP00000316772:p.Phe350Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	37	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.286350	0.40494	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	4.63	3.61	0.41365	Fps/Fes/Fer/CIP4 homology (1);	0.447401	0.23854	N	0.043903	T	0.37571	0.1008	L	0.59436	1.845	0.29760	N	0.835614	P;P;P;P	0.47302	0.646;0.893;0.589;0.704	B;B;B;B	0.44085	0.44;0.396;0.361;0.223	T	0.26849	-1.0091	10	0.22706	T	0.39	-3.7191	7.1213	0.25446	0.0:0.2667:0.0:0.7333	.	190;366;233;350	F5H4A3;F6QP70;F5H1R4;Q92619	.;.;.;HMHA1_HUMAN	I	366;350;350;190;344;233	ENSP00000439601:F366I;ENSP00000316772:F350I;ENSP00000445109:F190I;ENSP00000438979:F233I	ENSP00000316772:F350I	F	+	1	0	HMHA1	1025667	1.000000	0.71417	0.646000	0.29493	0.834000	0.47266	1.407000	0.34657	0.647000	0.30713	0.454000	0.30748	TTC		0.701	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1			
IQCE	23288	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	2645633	2645633	+	Splice_Site	SNP	T	T	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr7:2645633T>A	ENST00000402050.2	+	20	2049		c.e20+2		IQCE_ENST00000404984.1_Splice_Site|IQCE_ENST00000438376.2_Splice_Site|IQCE_ENST00000325979.7_Splice_Site	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E							mitochondrion (GO:0005739)		p.?(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CAGGCACAGGTGAGTCAGGGT	0.697																																																	1	Unknown(1)	kidney(1)											27.0	33.0	31.0					7																	2645633		2119	4241	6360	SO:0001630	splice_region_variant	23288			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1865+2T>A	7.37:g.2645633T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Splice_Site	SNP	ENST00000402050.2	37	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	T	14.01	2.408816	0.42715	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000423196	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5193	0.44910	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	IQCE	2612159	1.000000	0.71417	0.822000	0.32727	0.440000	0.31957	3.588000	0.53964	1.805000	0.52779	0.459000	0.35465	.		0.697	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2		NM_152558	Intron
ITGA2	3673	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	52363017	52363017	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:52363017G>T	ENST00000296585.5	+	16	2156	c.2013G>T	c.(2011-2013)aaG>aaT	p.K671N		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	671					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.K671N(2)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGGTCAACAAGAATGCTCAGA	0.368																																																	2	Substitution - Missense(2)	kidney(2)											98.0	93.0	95.0					5																	52363017		2203	4300	6503	SO:0001583	missense	3673				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2013G>T	5.37:g.52363017G>T	ENSP00000296585:p.Lys671Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393053	0.62066	.	.	ENSG00000164171	ENST00000296585	T	0.66638	-0.22	4.79	3.02	0.34903	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.74824	0.3767	L	0.60455	1.87	0.46874	D	0.999232	D;D	0.89917	0.999;1.0	D;D	0.91635	0.992;0.999	T	0.69989	-0.4995	10	0.28530	T	0.3	.	10.1544	0.42814	0.2015:0.0:0.7985:0.0	.	671;671	E7ESP4;P17301	.;ITA2_HUMAN	N	671	ENSP00000296585:K671N	ENSP00000296585:K671N	K	+	3	2	ITGA2	52398774	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.266000	0.51569	0.572000	0.29383	0.655000	0.94253	AAG		0.368	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2		NM_002203	
ICE1	23379	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	5464188	5464188	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:5464188A>T	ENST00000296564.7	+	13	4963	c.4741A>T	c.(4741-4743)Agt>Tgt	p.S1581C		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1581					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.S1581C(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AACTCATCAGAGTGAAGTTGC	0.383																																																	1	Substitution - Missense(1)	kidney(1)											41.0	40.0	40.0					5																	5464188		1838	4097	5935	SO:0001583	missense	23379																														ENST00000296564.7:c.4741A>T	5.37:g.5464188A>T	ENSP00000296564:p.Ser1581Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.408085	0.62399	.	.	ENSG00000164151	ENST00000296564	T	0.10573	2.86	5.05	-0.193	0.13244	.	.	.	.	.	T	0.10852	0.0265	N	0.22421	0.69	0.09310	N	1	D	0.69078	0.997	P	0.54460	0.753	T	0.21655	-1.0239	9	0.62326	D	0.03	-2.0E-4	3.9365	0.09309	0.3879:0.2147:0.3974:0.0	.	1581	Q9Y2F5	K0947_HUMAN	C	1581	ENSP00000296564:S1581C	ENSP00000296564:S1581C	S	+	1	0	KIAA0947	5517188	0.000000	0.05858	0.000000	0.03702	0.806000	0.45545	-0.275000	0.08525	-0.009000	0.14296	0.377000	0.23210	AGT		0.383	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			
JAKMIP2	9832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	147040551	147040551	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:147040551G>A	ENST00000265272.5	-	3	1054	c.587C>T	c.(586-588)tCg>tTg	p.S196L	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.S196L|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.S154L	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	196						Golgi apparatus (GO:0005794)		p.S196L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGATCTTCGAGATGGCTTC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											152.0	141.0	145.0					5																	147040551		2203	4300	6503	SO:0001583	missense	9832			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.587C>T	5.37:g.147040551G>A	ENSP00000265272:p.Ser196Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017212	0.75161	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.08102	3.13;3.13;3.13	5.13	5.13	0.70059	.	0.115750	0.64402	D	0.000010	T	0.07773	0.0195	L	0.38175	1.15	0.58432	D	0.999992	P;P;P;B	0.37398	0.593;0.593;0.593;0.44	B;B;B;B	0.23018	0.043;0.043;0.043;0.043	T	0.26467	-1.0102	10	0.41790	T	0.15	.	19.4753	0.94985	0.0:0.0:1.0:0.0	.	154;196;196;196	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	L	196;196;154;196	ENSP00000421398:S196L;ENSP00000265272:S196L;ENSP00000328989:S154L	ENSP00000265272:S196L	S	-	2	0	JAKMIP2	147020744	1.000000	0.71417	0.986000	0.45419	0.990000	0.78478	6.587000	0.74071	2.777000	0.95525	0.655000	0.94253	TCG		0.517	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1		NM_014790	
LRP2	4036	broad.mit.edu;hgsc.bcm.edu	37	2	170177379	170177379	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr2:170177379T>C	ENST00000263816.3	-	2	380	c.95A>G	c.(94-96)cAt>cGt	p.H32R	LRP2_ENST00000443831.1_Missense_Mutation_p.H32R	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	32	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.H32R(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACAGCGAAAATGCGCACTGTC	0.393																																																	1	Substitution - Missense(1)	kidney(1)											115.0	98.0	104.0					2																	170177379		2203	4300	6503	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.95A>G	2.37:g.170177379T>C	ENSP00000263816:p.His32Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	6.143	0.394610	0.11638	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.95272	-3.66;-3.66	5.68	1.89	0.25635	.	1.041740	0.07443	N	0.897600	D	0.87116	0.6097	N	0.16790	0.44	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.13407	0.009;0.003	T	0.73557	-0.3945	9	.	.	.	.	4.644	0.12563	0.1291:0.2078:0.0:0.6631	.	32;32	E9PC35;P98164	.;LRP2_HUMAN	R	32	ENSP00000263816:H32R;ENSP00000409813:H32R	.	H	-	2	0	LRP2	169885625	0.402000	0.25311	0.001000	0.08648	0.028000	0.11728	2.741000	0.47426	0.075000	0.16796	-0.250000	0.11733	CAT		0.393	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2		NM_004525	
LRRC36	55282	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	67404969	67404969	+	Silent	SNP	C	C	T	rs558910990		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr16:67404969C>T	ENST00000329956.6	+	9	1337	c.1318C>T	c.(1318-1320)Ctg>Ttg	p.L440L	LRRC36_ENST00000290940.7_Silent_p.L172L|LRRC36_ENST00000541146.1_5'UTR|LRRC36_ENST00000435835.3_Silent_p.L319L|LRRC36_ENST00000563189.1_Silent_p.L319L	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	440								p.L440L(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		CAACGCTGTCCTGGGAAACAG	0.478																																																	1	Substitution - coding silent(1)	kidney(1)											113.0	101.0	105.0					16																	67404969		2198	4300	6498	SO:0001819	synonymous_variant	55282			BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.1318C>T	16.37:g.67404969C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Silent	SNP	ENST00000329956.6	37	CCDS32467.1																																																																																				0.478	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1		NM_018296	
MACF1	23499	broad.mit.edu;hgsc.bcm.edu	37	1	39788664	39788664	+	Missense_Mutation	SNP	G	G	A	rs148253091		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	G	A	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr1:39788664G>A	ENST00000372915.3	+	32	4322	c.4235G>A	c.(4234-4236)cGt>cAt	p.R1412H	MACF1_ENST00000361689.2_Missense_Mutation_p.R1412H|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Missense_Mutation_p.R1412H|MACF1_ENST00000564288.1_Missense_Mutation_p.R1407H|MACF1_ENST00000539005.1_Missense_Mutation_p.R1412H|MACF1_ENST00000317713.7_Missense_Mutation_p.R1412H|MACF1_ENST00000567887.1_Missense_Mutation_p.R1444H			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1412					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.R1412H(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCACTCCGGCGTCTGGAGGAG	0.488													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19724	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						G	HIS/ARG	0,4406		0,0,2203	110.0	108.0	109.0		4235	5.9	1.0	1	dbSNP_134	109	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MACF1	NM_012090.4	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1412/5431	39788664	1,13005	2203	4300	6503	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.4235G>A	1.37:g.39788664G>A	ENSP00000362006:p.Arg1412His	Somatic		WXS	Illumina HiSeq	Phase_I	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	35	5.423960	0.96111	0.0	1.16E-4	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262	T;T;T;T;T;T;T	0.65178	-0.11;-0.09;-0.11;-0.14;0.05;1.79;1.79	5.9	5.9	0.94986	.	.	.	.	.	T	0.80171	0.4574	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.993	D;D;P	0.91635	0.999;0.938;0.888	T	0.80158	-0.1499	9	0.66056	D	0.02	.	20.2704	0.98474	0.0:0.0:1.0:0.0	.	1412;1412;1377	F8W8Q1;Q9UPN3-2;Q9UPN3-3	.;.;.	H	1412;1412;1412;1412;1412;1370;1561	ENSP00000439537:R1412H;ENSP00000362006:R1412H;ENSP00000354573:R1412H;ENSP00000313438:R1412H;ENSP00000444364:R1412H;ENSP00000435070:R1370H;ENSP00000437059:R1561H	ENSP00000313438:R1412H	R	+	2	0	MACF1	39561251	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.776000	0.99001	2.793000	0.96121	0.591000	0.81541	CGT		0.488	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1		NM_033044	
MED7	9443	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	156565914	156565914	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:156565914G>T	ENST00000286317.5	-	2	910	c.529C>A	c.(529-531)Cat>Aat	p.H177N	MED7_ENST00000420343.1_Missense_Mutation_p.H177N	NM_004270.4	NP_004261.1	O43513	MED7_HUMAN	mediator complex subunit 7	177					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)	p.H177N(1)		kidney(1)|large_intestine(1)|lung(3)|urinary_tract(2)	7	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTTCTGAATGAGGCAAATCA	0.398																																																	1	Substitution - Missense(1)	kidney(1)											153.0	146.0	148.0					5																	156565914		2203	4300	6503	SO:0001583	missense	9443			AF104251	CCDS4334.1	5q33.3	2008-02-05	2007-07-30	2007-07-30	ENSG00000155868	ENSG00000155868			2378	protein-coding gene	gene with protein product		605045	"""cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa"""	CRSP9		9989412	Standard	NM_004270		Approved	CRSP33	uc003lwm.4	O43513	OTTHUMG00000130243	ENST00000286317.5:c.529C>A	5.37:g.156565914G>T	ENSP00000286317:p.His177Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000286317.5	37	CCDS4334.1	.	.	.	.	.	.	.	.	.	.	G	9.040	0.989465	0.18966	.	.	ENSG00000155868	ENST00000286317;ENST00000420343;ENST00000524289	.	.	.	5.81	4.94	0.65067	.	0.906772	0.09689	N	0.768725	T	0.41003	0.1140	L	0.36672	1.1	0.24433	N	0.994566	B	0.22683	0.073	B	0.20577	0.03	T	0.26326	-1.0106	9	0.18710	T	0.47	-0.7444	14.804	0.69938	0.069:0.0:0.931:0.0	.	177	O43513	MED7_HUMAN	N	177	.	ENSP00000286317:H177N	H	-	1	0	MED7	156498492	1.000000	0.71417	0.062000	0.19696	0.966000	0.64601	7.355000	0.79434	1.446000	0.47643	0.655000	0.94253	CAT		0.398	MED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252567.2		NM_004270	
MICB	4277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	31475252	31475252	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr6:31475252T>A	ENST00000252229.6	+	5	1047	c.968T>A	c.(967-969)aTt>aAt	p.I323N	MICB_ENST00000538442.1_Missense_Mutation_p.I291N|MICB_ENST00000399150.3_Missense_Mutation_p.I280N	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B									p.I323N(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						TTTGTTATTATTATTATTCTC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											107.0	108.0	108.0					6																	31475252		1918	4127	6045	SO:0001583	missense	4277				CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.968T>A	6.37:g.31475252T>A	ENSP00000252229:p.Ile323Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000252229.6	37	CCDS43449.1	.	.	.	.	.	.	.	.	.	.	-	10.66	1.411532	0.25465	.	.	ENSG00000204516	ENST00000538442;ENST00000399150;ENST00000252229	T;T;T	0.01043	5.41;5.5;5.52	1.42	-1.97	0.07503	.	.	.	.	.	T	0.00666	0.0022	L	0.32530	0.975	0.09310	N	1	D;P;P	0.61080	0.989;0.913;0.913	P;P;P	0.56514	0.8;0.536;0.536	T	0.49725	-0.8909	9	0.87932	D	0	.	2.3702	0.04329	0.0:0.2086:0.2991:0.4923	.	291;280;323	F5H7Q8;A2AC57;Q29980	.;.;MICB_HUMAN	N	291;280;323	ENSP00000442345:I291N;ENSP00000382103:I280N;ENSP00000252229:I323N	ENSP00000252229:I323N	I	+	2	0	MICB	31583231	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.060000	0.01392	-0.461000	0.06993	-0.973000	0.02599	ATT		0.443	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076102.3		NM_005931	
KMT2C	58508	broad.mit.edu	37	7	151834021	151834022	+	Intron	DEL	AA	AA	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	AA	AA	AA	-	AA	AA	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr7:151834021_151834022delAA	ENST00000262189.6	-	59	14862				KMT2C_ENST00000355193.2_Intron|KMT2C_ENST00000485655.2_Intron	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C						histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGCCCACGGCAAAGACACAGGG	0.465																																																	0																																										SO:0001627	intron_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14644-12TT>-	7.37:g.151834021_151834022delAA		Somatic		WXS	Illumina GAIIx	Phase_I	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Intron	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																				0.465	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			
MXD4	10608	broad.mit.edu;hgsc.bcm.edu	37	4	2254186	2254186	+	Silent	SNP	G	G	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr4:2254186G>A	ENST00000337190.2	-	4	571	c.258C>T	c.(256-258)agC>agT	p.S86S	MXD4_ENST00000515378.1_5'Flank|MIR4800_ENST00000537353.2_RNA	NM_006454.2	NP_006445.1	Q14582	MAD4_HUMAN	MAX dimerization protein 4	86	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)	p.S86S(1)		breast(1)|endometrium(1)|kidney(1)|lung(3)	6						TGTGGCGGGTGCTGTCGGGGC	0.627																																																	1	Substitution - coding silent(1)	kidney(1)											90.0	87.0	88.0					4																	2254186		2203	4300	6503	SO:0001819	synonymous_variant	10608				CCDS3361.1	4p16.3	2008-08-19			ENSG00000123933	ENSG00000123933		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	13906	protein-coding gene	gene with protein product						8521822	Standard	NM_006454		Approved	MAD4, MSTP149, MST149, bHLHc12	uc003geu.1	Q14582	OTTHUMG00000090243	ENST00000337190.2:c.258C>T	4.37:g.2254186G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2A335|Q5TZX4	Silent	SNP	ENST00000337190.2	37	CCDS3361.1																																																																																				0.627	MXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206519.1		NM_006454	
OR5K2	402135	hgsc.bcm.edu	37	3	98216592	98216592	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr3:98216592delT	ENST00000427338.1	+	1	145	c.68delT	c.(67-69)ctgfs	p.L23fs		NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CACCCTGAGCTGAAGACTCTG	0.413																																																	0													100.0	100.0	100.0					3																	98216592		2203	4297	6500	SO:0001589	frameshift_variant	402135			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.68delT	3.37:g.98216592delT	ENSP00000393889:p.Leu23fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN70|Q6IF47	Frame_Shift_Del	DEL	ENST00000427338.1	37	CCDS33804.1																																																																																				0.413	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359020.2			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52662984	52662984	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr3:52662984C>A	ENST00000296302.7	-	12	1370	c.1369G>T	c.(1369-1371)Gaa>Taa	p.E457*	PBRM1_ENST00000356770.4_Nonsense_Mutation_p.E425*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.E457*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.E457*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.E457*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.E457*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.E457*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.E457*			Q86U86	PB1_HUMAN	polybromo 1	457	Bromo 3. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E457*(2)|p.E425*(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTGGCATTTTCAAACATTAAA	0.333			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Nonsense(3)	kidney(3)											104.0	94.0	97.0					3																	52662984		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1369G>T	3.37:g.52662984C>A	ENSP00000296302:p.Glu457*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	38	6.970254	0.97971	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-42.765	19.1736	0.93590	0.0:1.0:0.0:0.0	.	.	.	.	X	425;457;457;457;457;457;457;457;457;401	.	ENSP00000296302:E457X	E	-	1	0	PBRM1	52638024	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.539000	0.85634	0.563000	0.77884	GAA		0.333	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PEX26	55670	broad.mit.edu;ucsc.edu	37	22	18566233	18566233	+	Silent	SNP	T	T	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr22:18566233T>G	ENST00000329627.7	+	4	608	c.402T>G	c.(400-402)ccT>ccG	p.P134P	PEX26_ENST00000399744.3_Silent_p.P134P|PEX26_ENST00000428061.2_Silent_p.P134P	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	134					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.P134P(1)		breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TGCAAGAGCCTGGAGCTGTGC	0.493																																																	1	Substitution - coding silent(1)	kidney(1)											115.0	135.0	128.0					22																	18566233		2203	4300	6503	SO:0001819	synonymous_variant	55670			AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.402T>G	22.37:g.18566233T>G		Somatic		WXS	Illumina GAIIx	Phase_I	F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Silent	SNP	ENST00000329627.7	37	CCDS13750.1																																																																																				0.493	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314644.3		NM_017929	
PGC	5225	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	41712242	41712242	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr6:41712242A>C	ENST00000373025.3	-	3	283	c.221T>G	c.(220-222)tTt>tGt	p.F74C	PGC_ENST00000425343.2_Missense_Mutation_p.F74C	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	74					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.F74C(2)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GATCTCACCAAAGTAGGCAGC	0.607																																																	2	Substitution - Missense(2)	kidney(2)											51.0	53.0	52.0					6																	41712242		2203	4300	6503	SO:0001583	missense	5225				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.221T>G	6.37:g.41712242A>C	ENSP00000362116:p.Phe74Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	ENST00000373025.3	37	CCDS4859.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.819538	0.32145	.	.	ENSG00000096088	ENST00000373025;ENST00000394278;ENST00000425343;ENST00000415707	T;T;T	0.59502	1.43;0.26;0.26	4.79	2.14	0.27477	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.211530	0.40818	N	0.001019	T	0.73048	0.3537	H	0.96547	3.84	0.25645	N	0.986153	D	0.89917	1.0	D	0.77004	0.989	T	0.65199	-0.6226	10	0.87932	D	0	.	8.5626	0.33520	0.4607:0.0:0.0:0.5393	.	74	P20142	PEPC_HUMAN	C	74;74;74;78	ENSP00000362116:F74C;ENSP00000405094:F74C;ENSP00000399429:F78C	ENSP00000362116:F74C	F	-	2	0	PGC	41820220	1.000000	0.71417	0.552000	0.28243	0.007000	0.05969	1.501000	0.35693	0.843000	0.35070	0.477000	0.44152	TTT		0.607	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2			
PKD1	5310	broad.mit.edu	37	16	2161786	2161786	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr16:2161786A>T	ENST00000262304.4	-	15	3590	c.3382T>A	c.(3382-3384)Tcc>Acc	p.S1128T	PKD1_ENST00000423118.1_Missense_Mutation_p.S1128T|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1128	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.|PKD 6. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.S1128T(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACAGCCACGGAGGGCAGGGAG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											19.0	20.0	20.0					16																	2161786		2185	4285	6470	SO:0001583	missense	5310			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3382T>A	16.37:g.2161786A>T	ENSP00000262304:p.Ser1128Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	a	8.379	0.837170	0.16891	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.65732	-0.17;-0.17	5.66	-8.08	0.01094	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (3);	0.701599	0.14556	N	0.312356	T	0.32763	0.0840	L	0.29908	0.895	0.09310	N	1	B;B	0.13145	0.007;0.002	B;B	0.10450	0.003;0.005	T	0.33111	-0.9881	10	0.12430	T	0.62	.	2.2063	0.03936	0.1742:0.3309:0.0987:0.3962	.	1128;1128	P98161-3;P98161	.;PKD1_HUMAN	T	1128;1128;843	ENSP00000262304:S1128T;ENSP00000399501:S1128T	ENSP00000262304:S1128T	S	-	1	0	PKD1	2101787	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.505000	0.06367	-1.131000	0.02910	-1.174000	0.01732	TCC		0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			
PRDM10	56980	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	129817095	129817095	+	Silent	SNP	C	C	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr11:129817095C>T	ENST00000360871.3	-	5	696	c.465G>A	c.(463-465)acG>acA	p.T155T	PRDM10_ENST00000304538.6_Silent_p.T69T|PRDM10_ENST00000528746.1_Silent_p.T129T|PRDM10_ENST00000358825.5_Silent_p.T155T|PRDM10_ENST00000423662.2_Silent_p.T69T|PRDM10_ENST00000526082.1_Silent_p.T69T	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.T155T(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CATCCAGATCCGTGTCCTCAC	0.597																																																	1	Substitution - coding silent(1)	kidney(1)											292.0	165.0	208.0					11																	129817095		2201	4297	6498	SO:0001819	synonymous_variant	56980			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.465G>A	11.37:g.129817095C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	37	CCDS8484.1																																																																																				0.597	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1		NM_199437	
PRKCE	5581	hgsc.bcm.edu	37	2	46203625	46203626	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr2:46203625_46203626insG	ENST00000306156.3	+	3	797_798	c.470_471insG	c.(469-474)caggggfs	p.QG157fs		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	157					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	AGGAAGCGGCAGGGGGCCGTCA	0.584																																																	0										4,4176		1,2,2087						4.5	1.0		dbSNP_130	65	4,8158		0,4,4077	no	frameshift	PRKCE	NM_005400.2		1,6,6164	A1A1,A1R,RR		0.049,0.0957,0.0648				8,12334				SO:0001589	frameshift_variant	5581				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.475dupG	2.37:g.46203630_46203630dupG	ENSP00000306124:p.Gln157fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Frame_Shift_Ins	INS	ENST00000306156.3	37	CCDS1824.1																																																																																				0.584	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2			
PRKDC	5591	hgsc.bcm.edu	37	8	48805816	48805817	+	Splice_Site	INS	-	-	G	rs11411516|rs370106149|rs397814002		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr8:48805816_48805817insG	ENST00000314191.2	-	31	3785_3786		c.e31+1		PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Splice_Site	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TGGCCCCCGAAGTACAAGAGGG	0.589								Non-homologous end-joining					GG|G|GG|deletion	5008	1.0	1.0	1.0	5008	,	,		17564	1.0		1.0	False		,,,				2504	1.0				Esophageal Squamous(79;1091 1253 12329 31680 40677)												0									,	3696,6		1846,4,1					,	5.8	0.0		dbSNP_120	27	7889,3		3943,3,0	no	frameshift,frameshift	PRKDC	NM_006904.6,NM_001081640.1	,	5789,7,1	A1A1,A1R,RR		0.038,0.1621,0.0776	,	,		11585,9				SO:0001630	splice_region_variant	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3729+1->C	8.37:g.48805817_48805817dupG		Somatic		WXS	Illumina HiSeq	Phase_I	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Ins	INS	ENST00000314191.2	37																																																																																					0.589	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001081640	Intron
PTPN1	5770	broad.mit.edu;hgsc.bcm.edu	37	20	49196426	49196426	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr20:49196426G>T	ENST00000371621.3	+	8	1225	c.1051G>T	c.(1051-1053)Gga>Tga	p.G351*	RP4-530I15.9_ENST00000431019.1_RNA|PTPN1_ENST00000541713.1_Nonsense_Mutation_p.G278*	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	351					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)	p.G351*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	GGAAGAAAAAGGAAGCCCCTT	0.498											OREG0026029	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Nonsense(1)	kidney(1)											51.0	58.0	56.0					20																	49196426		2203	4300	6503	SO:0001587	stop_gained	5770				CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.1051G>T	20.37:g.49196426G>T	ENSP00000360683:p.Gly351*	Somatic	960	WXS	Illumina HiSeq	Phase_I	Q5TGD8|Q9BQV9|Q9NQQ4	Nonsense_Mutation	SNP	ENST00000371621.3	37	CCDS13430.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670262	0.88348	.	.	ENSG00000196396	ENST00000371621;ENST00000541713	.	.	.	6.01	2.29	0.28610	.	0.768919	0.12137	N	0.496251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	5.1652	0.15082	0.5537:0.2898:0.1565:0.0	.	.	.	.	X	351;278	.	ENSP00000360683:G351X	G	+	1	0	PTPN1	48629833	0.336000	0.24757	0.003000	0.11579	0.067000	0.16453	1.343000	0.33930	0.493000	0.27837	-0.312000	0.09012	GGA		0.498	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079694.2			
RSBN1L	222194	hgsc.bcm.edu;ucsc.edu	37	7	77379172	77379172	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr7:77379172delA	ENST00000334955.8	+	3	1162	c.1135delA	c.(1135-1137)aggfs	p.R379fs	RSBN1L_ENST00000445288.1_Frame_Shift_Del_p.R109fs	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	379						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGAGATGGAGAGGTTTGCAGA	0.448																																																	0													134.0	126.0	129.0					7																	77379172		1869	4113	5982	SO:0001589	frameshift_variant	222194			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.1135delA	7.37:g.77379172delA	ENSP00000334040:p.Arg379fs	Somatic		WXS	Illumina HiSeq	Phase_I	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Frame_Shift_Del	DEL	ENST00000334955.8	37	CCDS43607.1																																																																																				0.448	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340455.3		NM_198467	
SART3	9733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	108920274	108920274	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr12:108920274G>A	ENST00000228284.3	-	16	2206	c.1972C>T	c.(1972-1974)Caa>Taa	p.Q658*	SART3_ENST00000431469.2_Nonsense_Mutation_p.Q622*	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	658	Required for nuclear localization.				cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q658*(1)		NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						TCTACATTTTGTGTTTCTCCA	0.517									Porokeratosis																																								1	Substitution - Nonsense(1)	kidney(1)											91.0	90.0	90.0					12																	108920274		2203	4300	6503	SO:0001587	stop_gained	9733	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.1972C>T	12.37:g.108920274G>A	ENSP00000228284:p.Gln658*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Nonsense_Mutation	SNP	ENST00000228284.3	37	CCDS9117.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.477212|6.477212	0.97598|0.97598	.|.	.|.	ENSG00000075856|ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000546815|ENST00000412617	.|.	.|.	.|.	5.33|5.33	0.996|0.996	0.19844|0.19844	.|.	0.719825|.	0.13553|.	N|.	0.379317|.	.|T	.|0.38268	.|0.1034	.|.	.|.	.|.	0.21105|0.21105	N|N	0.999784|0.999784	.|B	.|0.20671	.|0.047	.|B	.|0.21360	.|0.034	.|T	.|0.37361	.|-0.9709	.|7	0.06236|0.72032	T|D	0.91|0.01	1.2769|1.2769	11.5161|11.5161	0.50522|0.50522	0.092:0.6702:0.2377:0.0|0.092:0.6702:0.2377:0.0	.|.	.|604	.|E7EMI4	.|.	X|I	658;622;234;676|604	.|.	ENSP00000228284:Q658X|ENSP00000400292:T604I	Q|T	-|-	1|2	0|0	SART3|SART3	107444404|107444404	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.013000|0.013000	0.08279|0.08279	1.095000|1.095000	0.30964|0.30964	0.181000|0.181000	0.19994|0.19994	0.491000|0.491000	0.48974|0.48974	CAA|ACA		0.517	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1			
SEC16A	9919	hgsc.bcm.edu	37	9	139370955	139370963	+	In_Frame_Del	DEL	AGCTCCTGA	AGCTCCTGA	-	rs545335424	byFrequency	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	AGCTCCTGA	AGCTCCTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr9:139370955_139370963delAGCTCCTGA	ENST00000371706.3	-	1	604_612	c.571_579delTCAGGAGCT	c.(571-579)tcaggagctdel	p.SGA191del	SEC16A_ENST00000313050.7_In_Frame_Del_p.SGA369del|SEC16A_ENST00000290037.6_In_Frame_Del_p.SGA191del|SEC16A_ENST00000431893.2_In_Frame_Del_p.SGA191del			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	191					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.S369_A371delSGA(1)		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		ACATCGCCAGAGCTCCTGAAGCTCCTGAG	0.574														13	0.00259585	0.0008	0.0014	5008	,	,		18859	0.0		0.004	False		,,,				2504	0.0072																1	Deletion - In frame(1)	breast(1)								7,3561		0,7,1777						1.9	0.0			19	42,7812		1,40,3886	no	coding	SEC16A	NM_014866.1		1,47,5663	A1A1,A1R,RR		0.5348,0.1962,0.429				49,11373				SO:0001651	inframe_deletion	9919			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.571_579delTCAGGAGCT	9.37:g.139370964_139370972delAGCTCCTGA	ENSP00000360771:p.Ser191_Ala193del	Somatic		WXS	Illumina HiSeq	Phase_I	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	In_Frame_Del	DEL	ENST00000371706.3	37																																																																																					0.574	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1		XM_088459	
SIPA1L3	23094	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	38609984	38609984	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr19:38609984G>C	ENST00000222345.6	+	9	2839	c.2330G>C	c.(2329-2331)gGc>gCc	p.G777A		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	777	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.G777A(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTCCTTTCGGCCCCCCCATC	0.532																																																	1	Substitution - Missense(1)	kidney(1)											66.0	73.0	71.0					19																	38609984		2203	4300	6503	SO:0001583	missense	23094			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.2330G>C	19.37:g.38609984G>C	ENSP00000222345:p.Gly777Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736543	0.89482	.	.	ENSG00000105738	ENST00000222345	D	0.94966	-3.57	5.22	5.22	0.72569	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.97623	0.9221	M	0.91561	3.22	0.80722	D	1	P	0.50617	0.937	P	0.62298	0.9	D	0.98212	1.0473	10	0.72032	D	0.01	-44.3645	17.7273	0.88369	0.0:0.0:1.0:0.0	.	777	O60292	SI1L3_HUMAN	A	777	ENSP00000222345:G777A	ENSP00000222345:G777A	G	+	2	0	SIPA1L3	43301824	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	7.717000	0.84732	2.725000	0.93324	0.655000	0.94253	GGC		0.532	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2		XM_032278	
SMAD2	4087	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr18:45368211G>T	ENST00000402690.2	-	11	1785	c.1391C>A	c.(1390-1392)tCa>tAa	p.S464*	SMAD2_ENST00000262160.6_Nonsense_Mutation_p.S464*|SMAD2_ENST00000586040.1_Nonsense_Mutation_p.S434*|SMAD2_ENST00000356825.4_Nonsense_Mutation_p.S434*	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	464	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.S464*(4)|p.R462fs*>4(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TGACATGCTTGAGCAACGCAC	0.423																																																	5	Substitution - Nonsense(4)|Deletion - Frameshift(1)	large_intestine(4)|kidney(1)											162.0	130.0	141.0					18																	45368211		2203	4300	6503	SO:0001587	stop_gained	4087			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1391C>A	18.37:g.45368211G>T	ENSP00000384449:p.Ser464*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	G	41	8.784024	0.98952	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	.	.	.	X	464;434;464	.	ENSP00000262160:S464X	S	-	2	0	SMAD2	43622209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.781000	0.99029	2.824000	0.97209	0.655000	0.94253	TCA		0.423	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1		NM_005901	
SORBS3	10174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	22423910	22423910	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr8:22423910G>T	ENST00000240123.7	+	13	1386	c.1003G>T	c.(1003-1005)Gcc>Tcc	p.A335S	SORBS3_ENST00000428103.1_5'UTR|RP11-582J16.3_ENST00000517384.1_RNA|SORBS3_ENST00000523740.1_3'UTR	NM_005775.4	NP_005766.3	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3	335					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of stress fiber assembly (GO:0051496)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.A335S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)	18		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CCTGGGTTCCGCCCGGTCCCT	0.647																																																	1	Substitution - Missense(1)	kidney(1)											86.0	83.0	84.0					8																	22423910		2203	4300	6503	SO:0001583	missense	10174				CCDS6031.1	8p21.3	2008-02-05			ENSG00000120896	ENSG00000120896			30907	protein-coding gene	gene with protein product		610795				9885244, 12510380	Standard	NM_001018003		Approved	SCAM-1, SH3D4, vinexin	uc003xbv.3	O60504	OTTHUMG00000131728	ENST00000240123.7:c.1003G>T	8.37:g.22423910G>T	ENSP00000240123:p.Ala335Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BJE4|Q6NX54|Q96FY4|Q9UQE4	Missense_Mutation	SNP	ENST00000240123.7	37	CCDS6031.1	.	.	.	.	.	.	.	.	.	.	G	6.539	0.467699	0.12402	.	.	ENSG00000120896	ENST00000240123	T	0.05649	3.41	4.75	-2.2	0.06994	.	1.377390	0.04897	N	0.450671	T	0.01592	0.0051	N	0.01352	-0.895	0.33953	D	0.644649	B	0.02656	0.0	B	0.01281	0.0	T	0.49799	-0.8901	10	0.02654	T	1	-2.192	0.9328	0.01338	0.1521:0.2755:0.1632:0.4092	.	335	O60504	VINEX_HUMAN	S	335	ENSP00000240123:A335S	ENSP00000240123:A335S	A	+	1	0	SORBS3	22479855	0.000000	0.05858	0.001000	0.08648	0.075000	0.17131	0.087000	0.14958	-0.544000	0.06232	-0.425000	0.05940	GCC		0.647	SORBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254647.3		NM_005775	
SPINK5	11005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	147444913	147444913	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:147444913C>T	ENST00000256084.7	+	2	101	c.59C>T	c.(58-60)gCt>gTt	p.A20V	SPINK5_ENST00000359874.3_Missense_Mutation_p.A20V|SPINK5_ENST00000398454.1_Missense_Mutation_p.A20V	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	20				DAASKNEDQ -> GQCEKDSLS (in Ref. 2; CAB96877). {ECO:0000305}.	anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A20V(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCCAGATGCTGCCAGTAAG	0.328																																																	2	Substitution - Missense(2)	kidney(2)											108.0	99.0	102.0					5																	147444913		1819	4079	5898	SO:0001583	missense	11005			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.59C>T	5.37:g.147444913C>T	ENSP00000256084:p.Ala20Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749810	0.69533	.	.	ENSG00000133710	ENST00000521206;ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T;T	0.51071	0.92;0.73;0.72;0.83;0.72	5.6	3.43	0.39272	.	0.185581	0.26446	N	0.024334	T	0.37812	0.1017	L	0.33668	1.02	0.22017	N	0.999417	B;P;B;P	0.51537	0.007;0.801;0.392;0.946	B;P;B;P	0.50314	0.014;0.598;0.279;0.637	T	0.13045	-1.0524	10	0.15952	T	0.53	-9.6011	5.1561	0.15036	0.0:0.6616:0.2079:0.1305	.	20;20;20;20	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	V	20	ENSP00000430264:A20V;ENSP00000381472:A20V;ENSP00000352936:A20V;ENSP00000421519:A20V;ENSP00000256084:A20V	ENSP00000256084:A20V	A	+	2	0	SPINK5	147425106	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.531000	0.36018	1.493000	0.48517	0.655000	0.94253	GCT		0.328	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2		NM_001127698	
STXBP5L	9515	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	121097679	121097679	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr3:121097679C>T	ENST00000273666.6	+	22	2636	c.2365C>T	c.(2365-2367)Cga>Tga	p.R789*	STXBP5L_ENST00000471454.1_Nonsense_Mutation_p.R765*|STXBP5L_ENST00000492541.1_Nonsense_Mutation_p.R789*|STXBP5L_ENST00000497029.1_Intron|STXBP5L_ENST00000472879.1_Nonsense_Mutation_p.R765*	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	789					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R789*(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		ACCACCATTTCGAAAGGCCCA	0.403																																																	1	Substitution - Nonsense(1)	kidney(1)											54.0	51.0	52.0					3																	121097679		1849	4101	5950	SO:0001587	stop_gained	9515			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2365C>T	3.37:g.121097679C>T	ENSP00000273666:p.Arg789*	Somatic		WXS	Illumina HiSeq	Phase_I	Q4G1B4|Q6PIC3	Nonsense_Mutation	SNP	ENST00000273666.6	37	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	C	38	6.895893	0.97916	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000492541	.	.	.	5.07	4.16	0.48862	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-9.7102	12.5014	0.55957	0.3298:0.6702:0.0:0.0	.	.	.	.	X	789;765;765;789	.	ENSP00000273666:R789X	R	+	1	2	STXBP5L	122580369	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.664000	0.54525	1.200000	0.43188	0.585000	0.79938	CGA		0.403	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			
TET2	54790	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	106157368	106157368	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr4:106157368C>G	ENST00000540549.1	+	3	3129	c.2269C>G	c.(2269-2271)Ctc>Gtc	p.L757V	TET2_ENST00000380013.4_Missense_Mutation_p.L757V|TET2_ENST00000394764.1_Missense_Mutation_p.L757V|TET2_ENST00000305737.2_Missense_Mutation_p.L757V|TET2_ENST00000513237.1_Missense_Mutation_p.L778V|TET2_ENST00000413648.2_Missense_Mutation_p.L757V|TET2_ENST00000545826.1_Missense_Mutation_p.L757V			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	757	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.L757V(2)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGAGGAAATACTCCAGACTTT	0.398			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	2	Substitution - Missense(2)	kidney(2)											64.0	67.0	66.0					4																	106157368		2203	4300	6503	SO:0001583	missense	54790			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2269C>G	4.37:g.106157368C>G	ENSP00000442788:p.Leu757Val	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	37	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	C	3.466	-0.108913	0.06924	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	T;T;T;T;T;T;T	0.03889	3.77;4.44;3.77;4.44;4.44;3.77;3.78	5.91	0.804	0.18697	.	.	.	.	.	T	0.01976	0.0062	N	0.08118	0	0.09310	N	1	B;B;B	0.21147	0.018;0.018;0.052	B;B;B	0.18561	0.01;0.01;0.022	T	0.48364	-0.9042	9	0.10377	T	0.69	.	2.0139	0.03493	0.198:0.4475:0.1765:0.178	.	778;757;757	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	V	757;757;757;778;757;757;757	ENSP00000306705:L757V;ENSP00000442788:L757V;ENSP00000442867:L757V;ENSP00000425443:L778V;ENSP00000369351:L757V;ENSP00000378245:L757V;ENSP00000391448:L757V	ENSP00000265149:L757V	L	+	1	0	TET2	106376817	0.147000	0.22687	0.540000	0.28089	0.307000	0.27823	0.143000	0.16115	0.399000	0.25367	0.655000	0.94253	CTC		0.398	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2		NM_017628	
TMEFF2	23671	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	192818523	192818523	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr2:192818523C>G	ENST00000272771.5	-	9	2094	c.910G>C	c.(910-912)Gac>Cac	p.D304H	TMEFF2_ENST00000392314.1_Missense_Mutation_p.D304H|AC098617.1_ENST00000428980.2_RNA|AC098617.1_ENST00000424116.2_RNA	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	304	Required for shedding.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.D304H(1)		breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			ACACTGTAGTCCTTTTTTTCA	0.403																																					Pancreas(50;1277 1381 28487 47072)												1	Substitution - Missense(1)	kidney(1)											114.0	99.0	104.0					2																	192818523		2203	4300	6503	SO:0001583	missense	23671			AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.910G>C	2.37:g.192818523C>G	ENSP00000272771:p.Asp304His	Somatic		WXS	Illumina HiSeq	Phase_I	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Missense_Mutation	SNP	ENST00000272771.5	37	CCDS2314.1	.	.	.	.	.	.	.	.	.	.	C	32	5.156646	0.94686	.	.	ENSG00000144339	ENST00000392314;ENST00000272771	T;T	0.44881	0.91;0.91	5.86	5.86	0.93980	.	0.152247	0.64402	D	0.000018	T	0.68696	0.3029	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.71159	-0.4674	10	0.87932	D	0	-20.9761	20.1986	0.98248	0.0:1.0:0.0:0.0	.	304	Q9UIK5	TEFF2_HUMAN	H	304	ENSP00000376128:D304H;ENSP00000272771:D304H	ENSP00000272771:D304H	D	-	1	0	TMEFF2	192526768	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.436000	0.80404	2.781000	0.95711	0.650000	0.86243	GAC		0.403	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256065.2		NM_016192	
TRIM36	55521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	114499350	114499350	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr5:114499350T>A	ENST00000282369.3	-	2	284	c.163A>T	c.(163-165)Aaa>Taa	p.K55*	TRIM36_ENST00000515104.1_5'UTR|TRIM36_ENST00000514154.1_Intron|TRIM36_ENST00000513154.1_Nonsense_Mutation_p.K43*	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	55					acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K55*(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TTTACACATTTATGACAGATA	0.468																																																	1	Substitution - Nonsense(1)	kidney(1)											141.0	132.0	135.0					5																	114499350		2202	4300	6502	SO:0001587	stop_gained	55521			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.163A>T	5.37:g.114499350T>A	ENSP00000282369:p.Lys55*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Nonsense_Mutation	SNP	ENST00000282369.3	37	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	T	39	7.391634	0.98255	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000508894	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2521	0.73556	0.0:0.0:0.0:1.0	.	.	.	.	X	55;43;43	.	ENSP00000282369:K55X	K	-	1	0	TRIM36	114527249	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.746000	0.68681	1.996000	0.58369	0.533000	0.62120	AAA		0.468	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2		NM_018700	
TRIM39	56658	broad.mit.edu;hgsc.bcm.edu	37	6	30308093	30308093	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr6:30308093C>T	ENST00000396547.1	+	6	1008	c.848C>T	c.(847-849)cCa>cTa	p.P283L	TRIM39_ENST00000376656.4_Missense_Mutation_p.P283L|TRIM39_ENST00000540416.1_Intron|TRIM39_ENST00000396548.1_Intron|TRIM39-RPP21_ENST00000513556.1_Intron|TRIM39_ENST00000376659.5_Intron|TRIM39_ENST00000396551.3_Intron			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	283					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P283L(1)		ovary(3)	3						ACGATCTGTCCACGGGATCAT	0.453																																																	1	Substitution - Missense(1)	kidney(1)											66.0	63.0	64.0					6																	30308093		1509	2709	4218	SO:0001583	missense	56658			BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.848C>T	6.37:g.30308093C>T	ENSP00000379796:p.Pro283Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	CCDS34377.1	.	.	.	.	.	.	.	.	.	.	C	9.441	1.087945	0.20390	.	.	ENSG00000204599	ENST00000376656;ENST00000545104;ENST00000396547	T;T	0.61392	0.11;0.11	5.76	0.249	0.15531	.	0.831877	0.10078	N	0.718822	T	0.10809	0.0264	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30650	-0.9971	10	0.15066	T	0.55	.	4.0199	0.09660	0.2927:0.4741:0.0:0.2332	.	283	Q9HCM9	TRI39_HUMAN	L	283	ENSP00000365844:P283L;ENSP00000379796:P283L	ENSP00000365844:P283L	P	+	2	0	TRIM39	30416072	0.000000	0.05858	0.000000	0.03702	0.250000	0.25880	-0.388000	0.07352	-0.182000	0.10602	0.655000	0.94253	CCA		0.453	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2		NM_172016	
TSPAN19	144448	broad.mit.edu	37	12	85423550	85423550	+	Frame_Shift_Del	DEL	A	A	-	rs59822389	byFrequency	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr12:85423550delA	ENST00000532498.2	-	3	166	c.86delT	c.(85-87)atgfs	p.M29fs	TSPAN19_ENST00000547403.2_Intron	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	29						integral component of membrane (GO:0016021)				ovary(1)	1						ACCAAATCCCATGAATAAAAG	0.264													A|A|-|deletion	89	0.0177716	0.0666	0.0014	5008	,	,		15507	0.0		0.0	False		,,,				2504	0.0																0										214,3136		25,164,1486	29.0	28.0	28.0			-1.0	0.5	12	dbSNP_129	29	3,7583		0,3,3790	yes	frameshift	TSPAN19	NM_001100917.1		25,167,5276	A1A1,A1R,RR		0.0395,6.3881,1.9843			85423550	217,10719	1702	3957	5659	SO:0001589	frameshift_variant	144448				CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.86delT	12.37:g.85423550delA	ENSP00000433816:p.Met29fs	Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000532498.2	37	CCDS44949.1																																																																																				0.264	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388240.2		NM_001100917	
TTC14	151613	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	180322346	180322347	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr3:180322346_180322347GG>CT	ENST00000296015.4	+	5	784_785	c.652_653GG>CT	c.(652-654)GGt>CTt	p.G218L	RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000412756.2_Missense_Mutation_p.G218L|TTC14_ENST00000382584.4_Missense_Mutation_p.G218L	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	218							RNA binding (GO:0003723)	p.G218R(1)|p.G218V(1)|p.G218>?(1)		endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ACACCTATCTGGTATTAAATTA	0.342																																																	3	Substitution - Missense(2)|Complex(1)	kidney(3)																																								SO:0001583	missense	151613			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	Exception_encountered	3.37:g.180322346_180322347delinsCT	ENSP00000296015:p.Gly218Leu	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1																																																																																				0.342	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1		NM_133462	
UBAP1	51271	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	34241773	34241773	+	Silent	SNP	C	C	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr9:34241773C>G	ENST00000297661.4	+	4	985	c.750C>G	c.(748-750)tcC>tcG	p.S250S	UBAP1_ENST00000536252.1_Silent_p.S250S|UBAP1_ENST00000543944.1_Silent_p.S286S|UBAP1_ENST00000359544.2_Silent_p.S250S|UBAP1_ENST00000540348.1_Silent_p.S250S|UBAP1_ENST00000545103.1_Silent_p.S314S|UBAP1_ENST00000379186.4_Silent_p.S250S	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	250					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)	p.S314S(1)|p.S250S(1)		endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			CACTGTCTTCCAAAGTGTCCC	0.468																																					NSCLC(109;1074 1634 14978 20375 39620)												2	Substitution - coding silent(2)	kidney(2)											102.0	89.0	94.0					9																	34241773		2203	4300	6503	SO:0001819	synonymous_variant	51271			AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.750C>G	9.37:g.34241773C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Silent	SNP	ENST00000297661.4	37	CCDS6550.1																																																																																				0.468	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001084.1			
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10188227	10188227	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr3:10188227delA	ENST00000256474.2	+	2	1210	c.370delA	c.(370-372)acafs	p.T124fs	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	124	Involved in binding to CCT complex.				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.T124fs*35(3)|p.H125fs*6(2)|p.T124_H125>H(1)|p.T124fs*10(1)|p.R120fs*34(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGATGCAGGGACACACGATGG	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	8	Deletion - Frameshift(6)|Complex - deletion inframe(1)|Insertion - Frameshift(1)	kidney(8)											195.0	180.0	185.0					3																	10188227		2203	4300	6503	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.370delA	3.37:g.10188227delA	ENSP00000256474:p.Thr124fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VWF	7450	broad.mit.edu;hgsc.bcm.edu	37	12	6127588	6127588	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr12:6127588G>C	ENST00000261405.5	-	28	5250	c.4996C>G	c.(4996-4998)Ctg>Gtg	p.L1666V		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1666					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.L1666V(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CACCTCTGCAGCACCAGGTCA	0.642																																																	1	Substitution - Missense(1)	kidney(1)											23.0	23.0	23.0					12																	6127588		2196	4292	6488	SO:0001583	missense	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4996C>G	12.37:g.6127588G>C	ENSP00000261405:p.Leu1666Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	10.48	1.362828	0.24684	.	.	ENSG00000110799	ENST00000261405	T	0.78003	-1.14	4.82	3.93	0.45458	von Willebrand factor, type A (1);	0.476086	0.15688	N	0.249558	D	0.84880	0.5570	M	0.69823	2.125	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	D	0.83522	0.0086	10	0.56958	D	0.05	.	8.0835	0.30758	0.2512:0.0:0.7488:0.0	.	1666	P04275	VWF_HUMAN	V	1666	ENSP00000261405:L1666V	ENSP00000261405:L1666V	L	-	1	2	VWF	5997849	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	1.044000	0.30329	1.256000	0.44068	0.555000	0.69702	CTG		0.642	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1		NM_000552	
WBP11	51729	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	14943423	14943423	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr12:14943423G>A	ENST00000261167.2	-	10	1509	c.1276C>T	c.(1276-1278)Cca>Tca	p.P426S		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	426	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)	p.P426S(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						CCTGTAGGTGGCCCAGGAGGC	0.498																																																	1	Substitution - Missense(1)	kidney(1)											106.0	107.0	107.0					12																	14943423		2203	4300	6503	SO:0001583	missense	51729			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1276C>T	12.37:g.14943423G>A	ENSP00000261167:p.Pro426Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	37	CCDS8666.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698939	0.68501	.	.	ENSG00000084463	ENST00000261167	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.76026	0.3930	M	0.69823	2.125	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.73049	-0.4105	9	0.27082	T	0.32	-14.259	15.5207	0.75862	0.0:0.0:1.0:0.0	.	426	Q9Y2W2	WBP11_HUMAN	S	426	.	ENSP00000261167:P426S	P	-	1	0	WBP11	14834690	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.087000	0.89521	2.532000	0.85374	0.655000	0.94253	CCA		0.498	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1		NM_016312	
ZC3H7A	29066	hgsc.bcm.edu;ucsc.edu	37	16	11846601	11846602	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr16:11846601_11846602delTC	ENST00000396516.2	-	21	2846_2847	c.2649_2650delGA	c.(2647-2652)gagaagfs	p.K884fs	ZC3H7A_ENST00000355758.4_Frame_Shift_Del_p.K884fs|ZC3H7A_ENST00000575984.1_Frame_Shift_Del_p.K80fs			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	884						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TGGAAAACCTTCTCTTTGTGCT	0.485																																																	0																																										SO:0001589	frameshift_variant	29066			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2649_2650delGA	16.37:g.11846603_11846604delTC	ENSP00000379773:p.Lys884fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUG5|Q9NPE9	Frame_Shift_Del	DEL	ENST00000396516.2	37	CCDS10550.1																																																																																				0.485	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1		NM_014153	
ZNF20	7568	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	12243969	12243969	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr19:12243969A>T	ENST00000334213.5	-	4	1256	c.1032T>A	c.(1030-1032)tgT>tgA	p.C344*	ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000600335.1_Intron|ZNF20_ENST00000485451.1_5'Flank	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C391*(1)|p.C344*(1)		endometrium(1)|kidney(1)|lung(6)	8						AGGCTTTACCACATTGCCTAC	0.448																																																	2	Substitution - Nonsense(2)	kidney(2)											66.0	68.0	67.0					19																	12243969		2203	4299	6502	SO:0001587	stop_gained	7568			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1032T>A	19.37:g.12243969A>T	ENSP00000335437:p.Cys344*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N457|Q9UG41	Nonsense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	A	36	5.610343	0.96637	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	.	.	.	0.94	-0.266	0.12942	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4274	0.11511	0.77:0.0:0.23:0.0	.	.	.	.	X	344	.	ENSP00000292241:C344X	C	-	3	2	ZNF20	12104969	0.973000	0.33851	0.390000	0.26220	0.469000	0.32828	0.640000	0.24705	-0.169000	0.10834	0.260000	0.18958	TGT		0.448	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1		NM_021143	
ZNF432	9668	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52538204	52538204	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr19:52538204G>T	ENST00000594154.1	-	5	940	c.728C>A	c.(727-729)tCc>tAc	p.S243Y	ZNF432_ENST00000221315.5_Missense_Mutation_p.S243Y			O94892	ZN432_HUMAN	zinc finger protein 432	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S243Y(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GGACTTTCTGGAGAACACTTT	0.388																																																	1	Substitution - Missense(1)	kidney(1)											108.0	113.0	111.0					19																	52538204		2203	4300	6503	SO:0001583	missense	9668			AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.728C>A	19.37:g.52538204G>T	ENSP00000470488:p.Ser243Tyr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000594154.1	37	CCDS12848.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806351	0.31961	.	.	ENSG00000256087	ENST00000221315	T	0.07567	3.18	3.0	3.0	0.34707	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10294	0.0252	L	0.42529	1.33	0.20638	N	0.99988	D	0.60160	0.987	P	0.48627	0.584	T	0.20438	-1.0275	9	0.29301	T	0.29	.	8.0741	0.30706	0.1258:0.0:0.8742:0.0	.	243	O94892	ZN432_HUMAN	Y	243	ENSP00000221315:S243Y	ENSP00000221315:S243Y	S	-	2	0	ZNF432	57230016	0.001000	0.12720	0.999000	0.59377	0.858000	0.48976	0.321000	0.19558	1.694000	0.51137	0.591000	0.81541	TCC		0.388	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1		NM_014650	
ZNF320	162967	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	53384724	53384724	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f122b61c-d537-4456-84e8-54e541eec531	52d7031e-269c-432a-bbbb-ef02410e2412	g.chr19:53384724A>C	ENST00000595635.1	-	8	1156	c.655T>G	c.(655-657)Tgt>Ggt	p.C219G	ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.C219G|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C219G(1)		NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		CATTCATTACATGTGTAATGT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											113.0	102.0	106.0					19																	53384724		2203	4300	6503	SO:0001583	missense	162967			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.655T>G	19.37:g.53384724A>C	ENSP00000473091:p.Cys219Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	37	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	18.45	3.626745	0.66901	.	.	ENSG00000182986	ENST00000391781	D	0.85258	-1.96	1.74	1.74	0.24563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94568	0.8250	H	0.98866	4.355	0.33818	D	0.628674	D	0.89917	1.0	D	0.81914	0.995	D	0.94074	0.7338	9	0.87932	D	0	.	8.2974	0.31993	1.0:0.0:0.0:0.0	.	219	A2RRD8	ZN320_HUMAN	G	219	ENSP00000375660:C219G	ENSP00000375660:C219G	C	-	1	0	ZNF320	58076536	0.989000	0.36119	0.019000	0.16419	0.721000	0.41392	5.128000	0.64733	0.792000	0.33850	0.155000	0.16302	TGT		0.383	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1		NM_207333	
