#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM29	11086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	175896768	175896768	+	Missense_Mutation	SNP	C	C	T	rs544557652		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr4:175896768C>T	ENST00000359240.3	+	5	762	c.92C>T	c.(91-93)cCg>cTg	p.P31L	ADAM29_ENST00000404450.4_Missense_Mutation_p.P31L|ADAM29_ENST00000445694.1_Missense_Mutation_p.P31L|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.P31L	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	31			P -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P31L(2)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CACAGCCCTCCGGATGTGGTG	0.517																																					Ovarian(140;1727 1835 21805 25838 41440)												2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											82.0	81.0	81.0					4																	175896768		2203	4300	6503	SO:0001583	missense	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.92C>T	4.37:g.175896768C>T	ENSP00000352177:p.Pro31Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	C	7.389	0.630296	0.14257	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000502940;ENST00000502305;ENST00000404450;ENST00000514159	T;T;T;D;T;T	0.81579	4.66;4.66;0.9;-1.51;4.66;4.66	4.36	1.46	0.22682	.	.	.	.	.	D	0.85124	0.5625	M	0.71206	2.165	0.09310	N	1	D	0.89917	1.0	D	0.76575	0.988	T	0.71580	-0.4550	8	.	.	.	.	2.5819	0.04820	0.1935:0.5128:0.1878:0.1059	.	31	Q9UKF5	ADA29_HUMAN	L	31	ENSP00000352177:P31L;ENSP00000414544:P31L;ENSP00000427674:P31L;ENSP00000422537:P31L;ENSP00000384229:P31L;ENSP00000423517:P31L	.	P	+	2	0	ADAM29	176133343	0.003000	0.15002	0.098000	0.21074	0.004000	0.04260	0.096000	0.15147	0.156000	0.19299	0.637000	0.83480	CCG		0.517	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding				
IGHA2	3494	broad.mit.edu	37	14	106054693	106054693	+	RNA	SNP	C	C	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr14:106054693C>A	ENST00000390539.2	-	0	39				AL928742.2_ENST00000578042.1_RNA|AL928742.1_ENST00000581377.1_RNA			P01877	IGHA2_HUMAN	immunoglobulin heavy constant alpha 2 (A2m marker)						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										GGGGTGCTGTCGAGGCTCAGC	0.637																																																	0													58.0	65.0	63.0					14																	106054693		2084	4203	6287			8755			J00221		14q32.33	2012-10-02			ENSG00000211890	ENSG00000211890		"""Immunoglobulins / IGH locus"""	5479	other	immunoglobulin gene		147000					Standard	NG_001019		Approved			P01877	OTTHUMG00000152472		14.37:g.106054693C>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000390539.2	37																																																																																					0.637	IGHA2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene	OTTHUMT00000326338.1		NG_001019	
ALDH2	217	hgsc.bcm.edu	37	12	112229167	112229168	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:112229167_112229168insC	ENST00000261733.2	+	7	800_801	c.739_740insC	c.(739-741)gccfs	p.A247fs	RP11-162P23.2_ENST00000546840.2_Frame_Shift_Ins_p.P244fs|ALDH2_ENST00000416293.3_Frame_Shift_Ins_p.A200fs	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	247				A -> P (in Ref. 15; AAA62825). {ECO:0000305}.	alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	CACGGCTGGGGCCGCCATTGCC	0.599			T	HMGA2	leiomyoma																																			Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	0																																										SO:0001589	frameshift_variant	217			M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.741dupC	12.37:g.112229169_112229169dupC	ENSP00000261733:p.Ala247fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Frame_Shift_Ins	INS	ENST00000261733.2	37	CCDS9155.1																																																																																				0.599	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1		NM_000690	
ARHGAP28	79822	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	6859884	6859884	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr18:6859884G>T	ENST00000383472.4	+	5	818	c.714G>T	c.(712-714)agG>agT	p.R238S	ARHGAP28_ENST00000419673.2_Missense_Mutation_p.R79S|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.R79S|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.R186S|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.R79S|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.R74S|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.R61S|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.R238S			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	238					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.R79S(1)|p.R238S(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				CGGTTCCCAGGAGTGACTCTG	0.438																																																	2	Substitution - Missense(2)	kidney(2)											211.0	199.0	203.0					18																	6859884		2203	4300	6503	SO:0001583	missense	79822			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.714G>T	18.37:g.6859884G>T	ENSP00000372964:p.Arg238Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	37		.	.	.	.	.	.	.	.	.	.	G	4.004	-0.001868	0.07819	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.07567	3.35;3.3;3.25;3.25;3.25;3.18	4.44	-0.809	0.10864	.	1.064090	0.07122	N	0.844034	T	0.05318	0.0141	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.20988	0.0;0.001;0.002;0.05	B;B;B;B	0.21917	0.001;0.001;0.003;0.037	T	0.45745	-0.9240	10	0.07990	T	0.79	.	4.7305	0.12962	0.3489:0.1618:0.4894:0.0	.	238;70;79;186	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	S	238;186;79;74;79;79;70;61	ENSP00000382963:R238S;ENSP00000262227:R186S;ENSP00000392660:R79S;ENSP00000437262:R74S;ENSP00000313506:R79S;ENSP00000406907:R79S	ENSP00000262227:R186S	R	+	3	2	ARHGAP28	6849884	0.000000	0.05858	0.000000	0.03702	0.778000	0.44026	-0.063000	0.11655	-0.152000	0.11156	0.563000	0.77884	AGG		0.438	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3		XM_371108	
ARHGAP5	394	hgsc.bcm.edu;ucsc.edu	37	14	32561340	32561340	+	Missense_Mutation	SNP	G	G	A	rs78337553		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr14:32561340G>A	ENST00000345122.3	+	2	1780	c.1465G>A	c.(1465-1467)Gag>Aag	p.E489K	ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.E489K|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.E489K	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	489	FF 4.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.E489K(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCCAAAGAAGAGTTTCAAGA	0.343																																					NSCLC(9;77 350 3443 29227 41353)												1	Substitution - Missense(1)	stomach(1)											60.0	61.0	61.0					14																	32561340		2203	4298	6501	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1465G>A	14.37:g.32561340G>A	ENSP00000371897:p.Glu489Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741262	0.69304	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	6.02	6.02	0.97574	FF domain (2);	0.044905	0.85682	D	0.000000	T	0.39009	0.1062	N	0.22421	0.69	0.80722	D	1	P;P	0.42296	0.734;0.775	P;P	0.52066	0.562;0.689	T	0.11060	-1.0603	10	0.62326	D	0.03	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	489;489	Q13017-2;Q13017	.;RHG05_HUMAN	K	489	ENSP00000452222:E489K;ENSP00000441692:E489K;ENSP00000371897:E489K;ENSP00000393307:E489K	ENSP00000371897:E489K	E	+	1	0	ARHGAP5	31631091	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAG		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1		NM_001030055	
ARHGEF25	115557	hgsc.bcm.edu	37	12	58010627	58010628	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:58010627_58010628insC	ENST00000286494.4	+	15	2153_2154	c.1693_1694insC	c.(1693-1695)accfs	p.T565fs	AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Frame_Shift_Ins_p.T604fs|AC025165.8_ENST00000593846.1_RNA|ARHGEF25_ENST00000477314.1_3'UTR	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	565						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						AACTCCAAAAACCCCTCCCTGC	0.54																																																	0																																										SO:0001589	frameshift_variant	115557				CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1697dupC	12.37:g.58010631_58010631dupC	ENSP00000286494:p.Thr565fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Frame_Shift_Ins	INS	ENST00000286494.4	37	CCDS8947.1																																																																																				0.540	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1		NM_133483	
ATP1B4	23439	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	119500536	119500536	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chrX:119500536C>T	ENST00000218008.3	+	2	277	c.220C>T	c.(220-222)Caa>Taa	p.Q74*	ATP1B4_ENST00000361319.3_Nonsense_Mutation_p.Q74*|ATP1B4_ENST00000539306.1_Nonsense_Mutation_p.Q74*	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	74					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.Q74*(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						ggaagaggGTCAAGGTCAGCC	0.537																																																	1	Substitution - Nonsense(1)	kidney(1)											109.0	90.0	96.0					X																	119500536		2203	4300	6503	SO:0001587	stop_gained	23439			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.220C>T	X.37:g.119500536C>T	ENSP00000218008:p.Gln74*	Somatic		WXS	Illumina HiSeq	Phase_I	Q17RR0|Q9UN41	Nonsense_Mutation	SNP	ENST00000218008.3	37	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	C	8.276	0.814527	0.16607	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	.	.	.	4.42	2.62	0.31277	.	1.649970	0.02857	N	0.129774	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-19.8841	5.257	0.15552	0.0:0.6823:0.2032:0.1145	.	.	.	.	X	74	.	ENSP00000218008:Q74X	Q	+	1	0	ATP1B4	119384564	0.794000	0.28838	0.023000	0.16930	0.009000	0.06853	0.882000	0.28186	0.577000	0.29470	-0.222000	0.12452	CAA		0.537	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1		NM_001142447	
C11orf45	219833	broad.mit.edu;ucsc.edu	37	11	128772493	128772493	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr11:128772493G>T	ENST00000524878.1	-	4	567	c.397C>A	c.(397-399)Ccc>Acc	p.P133T	C11orf45_ENST00000310799.3_Missense_Mutation_p.P133T|KCNJ5_ENST00000529694.1_Intron|KCNJ5_ENST00000338350.4_Intron|C11orf45_ENST00000530168.1_5'UTR			Q8TAV5	CK045_HUMAN	chromosome 11 open reading frame 45	133						extracellular region (GO:0005576)		p.P133T(1)		endometrium(1)|kidney(1)|lung(2)|pancreas(1)|prostate(2)	7	all_hematologic(175;0.0641)	Lung NSC(97;0.00521)|Breast(109;0.00715)|all_lung(97;0.0111)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.00531)|LUSC - Lung squamous cell carcinoma(976;0.0193)|Lung(977;0.0195)		GCACTGAGGGGGTAGCCCAGG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											65.0	55.0	59.0					11																	128772493		2201	4297	6498	SO:0001583	missense	219833			AK125634	CCDS8478.1	11q24.3	2012-05-30			ENSG00000174370	ENSG00000174370			28584	protein-coding gene	gene with protein product							Standard	NM_001256088		Approved	MGC35558, FLJ43646	uc001qeu.3	Q8TAV5	OTTHUMG00000165796	ENST00000524878.1:c.397C>A	11.37:g.128772493G>T	ENSP00000431922:p.Pro133Thr	Somatic		WXS	Illumina GAIIx	Phase_I	B2RAD0	Missense_Mutation	SNP	ENST00000524878.1	37	CCDS8478.1	.	.	.	.	.	.	.	.	.	.	G	9.578	1.122702	0.20877	.	.	ENSG00000174370	ENST00000310799;ENST00000524878	.	.	.	2.88	-5.75	0.02384	.	.	.	.	.	T	0.14356	0.0347	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.20306	-1.0279	8	0.87932	D	0	.	2.8338	0.05508	0.2198:0.152:0.4777:0.1504	.	133	Q8TAV5	CK045_HUMAN	T	133	.	ENSP00000307879:P133T	P	-	1	0	C11orf45	128277703	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.012000	0.03649	-1.678000	0.01454	-0.290000	0.09829	CCC		0.622	C11orf45-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386243.1		NM_145013	
SWSAP1	126074	hgsc.bcm.edu;ucsc.edu	37	19	11486464	11486464	+	Missense_Mutation	SNP	C	C	G	rs11542550	byFrequency	TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr19:11486464C>G	ENST00000312423.2	+	2	521	c.462C>G	c.(460-462)caC>caG	p.H154Q	CTD-2342J14.6_ENST00000590399.1_RNA	NM_175871.3	NP_787067.2	Q6NVH7	SWAP1_HUMAN	SWIM-type zinc finger 7 associated protein 1	154					ATP catabolic process (GO:0006200)|double-strand break repair via homologous recombination (GO:0000724)|protein stabilization (GO:0050821)	nucleus (GO:0005634)|Shu complex (GO:0097196)	ATPase activity (GO:0016887)|single-stranded DNA binding (GO:0003697)										ACGTCCTGCACCTGGCACTGC	0.672																																																	0													73.0	67.0	69.0					19																	11486464		2203	4300	6503	SO:0001583	missense	0			AK092438	CCDS12259.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000173928	ENSG00000173928			26638	protein-coding gene	gene with protein product	"""zinc finger, SWIM-type containing 7 associated protein 1"", ""SWS1-associated protein 1"""	614536	"""chromosome 19 open reading frame 39"""	C19orf39		21965664	Standard	NM_175871		Approved	FLJ35119, ZSWIM7AP1, SWS1AP1	uc002mrg.1	Q6NVH7		ENST00000312423.2:c.462C>G	19.37:g.11486464C>G	ENSP00000310008:p.His154Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAM1	Missense_Mutation	SNP	ENST00000312423.2	37	CCDS12259.1	.	.	.	.	.	.	.	.	.	.	C	0.490	-0.875684	0.02550	.	.	ENSG00000173928	ENST00000312423	T	0.36878	1.23	5.08	0.093	0.14474	.	0.371717	0.23386	N	0.048743	T	0.10981	0.0268	N	0.01168	-0.975	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29150	-1.0021	10	0.24483	T	0.36	-0.5031	7.894	0.29695	0.0:0.2617:0.3056:0.4327	.	154	Q6NVH7	CS039_HUMAN	Q	154	ENSP00000310008:H154Q	ENSP00000310008:H154Q	H	+	3	2	C19orf39	11347464	0.616000	0.27035	0.008000	0.14137	0.545000	0.35147	0.732000	0.26072	-0.136000	0.11475	-1.058000	0.02302	CAC		0.672	SWSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458789.1		NM_175871	
LRIF1	55791	hgsc.bcm.edu;ucsc.edu	37	1	111490650	111490652	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr1:111490650_111490652delTCT	ENST00000369763.4	-	4	2629_2631	c.2239_2241delAGA	c.(2239-2241)agadel	p.R747del	LRIF1_ENST00000485275.2_In_Frame_Del_p.R211del|RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_In_Frame_Del_p.R211del	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	747					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CCTGCTTAAGTCTTCTTATTTTT	0.355																																																	0																																										SO:0001651	inframe_deletion	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.2239_2241delAGA	1.37:g.111490653_111490655delTCT	ENSP00000358778:p.Arg747del	Somatic		WXS	Illumina HiSeq	Phase_I	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	In_Frame_Del	DEL	ENST00000369763.4	37	CCDS30800.1																																																																																				0.355	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2		NM_018372	
TLDC2	140711	broad.mit.edu;ucsc.edu	37	20	35507457	35507457	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr20:35507457T>G	ENST00000217320.3	+	3	247	c.203T>G	c.(202-204)tTc>tGc	p.F68C	TLDC2_ENST00000602922.1_Missense_Mutation_p.F68C	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	68								p.F68C(1)									AGCTTTCACTTCCCACCAAGA	0.617																																																	1	Substitution - Missense(1)	kidney(1)											124.0	97.0	106.0					20																	35507457		2203	4300	6503	SO:0001583	missense	140711			AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.203T>G	20.37:g.35507457T>G	ENSP00000217320:p.Phe68Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B3KVU8	Missense_Mutation	SNP	ENST00000217320.3	37	CCDS33465.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460572	0.43736	.	.	ENSG00000101342	ENST00000217320	T	0.30448	1.53	5.09	5.09	0.68999	TLDc (1);	0.126462	0.53938	D	0.000041	T	0.20941	0.0504	N	0.14661	0.345	0.30273	N	0.792068	P	0.44344	0.833	B	0.42087	0.375	T	0.11542	-1.0583	10	0.87932	D	0	-5.5437	11.187	0.48662	0.0:0.0:0.0:1.0	.	68	A0PJX2	CT118_HUMAN	C	68	ENSP00000217320:F68C	ENSP00000217320:F68C	F	+	2	0	C20orf118	34940871	1.000000	0.71417	0.999000	0.59377	0.430000	0.31655	5.934000	0.70138	2.150000	0.67090	0.533000	0.62120	TTC		0.617	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079060.2		NM_080628	
C5orf47	133491	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	173426710	173426710	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:173426710T>G	ENST00000340147.6	+	3	524	c.419T>G	c.(418-420)gTa>gGa	p.V140G	C5orf47_ENST00000522195.1_Intron	NM_001144954.1	NP_001138426.1	Q569G3	CE047_HUMAN	chromosome 5 open reading frame 47	140								p.V140G(1)		kidney(1)|prostate(1)	2						AAGGTTTTAGTATGGAATAGA	0.338																																																	1	Substitution - Missense(1)	kidney(1)											142.0	115.0	123.0					5																	173426710		692	1588	2280	SO:0001583	missense	133491				CCDS47343.1	5q35.2	2012-02-24			ENSG00000185056	ENSG00000185056			27026	protein-coding gene	gene with protein product						12477932	Standard	NM_001144954		Approved	LOC133491	uc003mcw.4	Q569G3	OTTHUMG00000163349	ENST00000340147.6:c.419T>G	5.37:g.173426710T>G	ENSP00000340887:p.Val140Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYU7	Missense_Mutation	SNP	ENST00000340147.6	37	CCDS47343.1	.	.	.	.	.	.	.	.	.	.	T	11.29	1.595826	0.28445	.	.	ENSG00000185056	ENST00000340147	.	.	.	4.5	0.83	0.18854	.	.	.	.	.	T	0.41305	0.1153	L	0.34521	1.04	0.25598	N	0.986629	D	0.71674	0.998	D	0.64776	0.929	T	0.21793	-1.0235	8	0.87932	D	0	-5.6429	6.1755	0.20441	0.0:0.3133:0.0:0.6867	.	140	Q569G3	CE047_HUMAN	G	140	.	ENSP00000340887:V140G	V	+	2	0	C5orf47	173359316	0.711000	0.27906	0.099000	0.21106	0.450000	0.32258	0.346000	0.19997	0.063000	0.16370	-0.256000	0.11100	GTA		0.338	C5orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372926.1		NM_001144954	
CCDC81	60494	broad.mit.edu;ucsc.edu	37	11	86097128	86097128	+	Missense_Mutation	SNP	G	G	A	rs576072834		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr11:86097128G>A	ENST00000445632.2	+	2	387	c.115G>A	c.(115-117)Gtg>Atg	p.V39M	CCDC81_ENST00000354755.1_Missense_Mutation_p.V39M|CCDC81_ENST00000278487.3_5'UTR	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	39								p.V39M(2)		kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				ATCAGAATTTGTGAGACGGCA	0.294																																																	2	Substitution - Missense(2)	kidney(2)											57.0	54.0	55.0					11																	86097128		2202	4297	6499	SO:0001583	missense	60494			AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.115G>A	11.37:g.86097128G>A	ENSP00000415528:p.Val39Met	Somatic		WXS	Illumina GAIIx	Phase_I	A0AVL7|Q53FW3|Q9H5E5	Missense_Mutation	SNP	ENST00000445632.2	37	CCDS53691.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992807	0.35131	.	.	ENSG00000149201	ENST00000354755;ENST00000531271;ENST00000445632	T;T	0.60040	0.22;0.51	5.08	4.17	0.49024	.	0.179933	0.33938	N	0.004409	T	0.68531	0.3011	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.67440	-0.5670	9	.	.	.	-10.2503	8.9384	0.35713	0.1728:0.0:0.8272:0.0	.	39;39	Q6ZN84;Q6ZN84-2	CCD81_HUMAN;.	M	39	ENSP00000346800:V39M;ENSP00000415528:V39M	.	V	+	1	0	CCDC81	85774776	1.000000	0.71417	0.998000	0.56505	0.177000	0.22998	3.779000	0.55379	1.260000	0.44134	0.655000	0.94253	GTG		0.294	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1		NM_021827	
CEP164	22897	broad.mit.edu	37	11	117280564	117280564	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr11:117280564G>A	ENST00000278935.3	+	30	4126	c.3979G>A	c.(3979-3981)Gct>Act	p.A1327T	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1327					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.A1327T(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CTTATCATCTGCTACACCCAC	0.642																																																	1	Substitution - Missense(1)	kidney(1)											104.0	100.0	101.0					11																	117280564		2201	4296	6497	SO:0001583	missense	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3979G>A	11.37:g.117280564G>A	ENSP00000278935:p.Ala1327Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.534418	0.27475	.	.	ENSG00000110274	ENST00000278935	T	0.24350	1.86	4.58	1.99	0.26369	.	1.877400	0.02834	N	0.127179	T	0.26593	0.0650	L	0.60455	1.87	0.09310	N	1	B;B	0.17268	0.021;0.021	B;B	0.14023	0.01;0.01	T	0.19257	-1.0311	10	0.41790	T	0.15	3.1945	3.4786	0.07594	0.2946:0.2041:0.5012:0.0	.	1327;1322	Q9UPV0;Q9UPV0-2	CE164_HUMAN;.	T	1327	ENSP00000278935:A1327T	ENSP00000278935:A1327T	A	+	1	0	CEP164	116785774	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	0.914000	0.28624	0.581000	0.29539	0.561000	0.74099	GCT		0.642	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1		NM_014956	
CHMP2B	25978	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	87302584	87302584	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr3:87302584G>A	ENST00000263780.4	+	5	693	c.455G>A	c.(454-456)gGt>gAt	p.G152D	CHMP2B_ENST00000471660.1_Missense_Mutation_p.G111D|CHMP2B_ENST00000494980.1_Missense_Mutation_p.G122D|CHMP2B_ENST00000472024.1_3'UTR	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	152					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)	p.G152D(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		ATCTTTGACGGTTCTGATGAC	0.358																																																	1	Substitution - Missense(1)	kidney(1)											118.0	111.0	114.0					3																	87302584		2203	4299	6502	SO:0001583	missense	25978			BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.455G>A	3.37:g.87302584G>A	ENSP00000263780:p.Gly152Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJG8|Q53HC7|Q9Y4U6	Missense_Mutation	SNP	ENST00000263780.4	37	CCDS2918.1	.	.	.	.	.	.	.	.	.	.	G	7.190	0.591257	0.13812	.	.	ENSG00000083937	ENST00000471660;ENST00000263780;ENST00000494980	T;T;T	0.70164	-0.46;-0.46;-0.46	5.8	5.8	0.92144	.	0.272984	0.41823	D	0.000813	T	0.33235	0.0856	N	0.01431	-0.87	0.42558	D	0.993138	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.41858	-0.9485	10	0.07482	T	0.82	-2.0316	9.1578	0.37002	0.077:0.2609:0.662:0.0	.	111;152	B4DJG8;Q9UQN3	.;CHM2B_HUMAN	D	111;152;122	ENSP00000419998:G111D;ENSP00000263780:G152D;ENSP00000418920:G122D	ENSP00000263780:G152D	G	+	2	0	CHMP2B	87385274	0.192000	0.23301	1.000000	0.80357	0.864000	0.49448	0.620000	0.24403	2.734000	0.93682	0.650000	0.86243	GGT		0.358	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352779.2		NM_014043	
COL15A1	1306	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	101818627	101818627	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr9:101818627G>T	ENST00000375001.3	+	35	3701	c.3278G>T	c.(3277-3279)gGt>gTt	p.G1093V		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1093	Triple-helical region 8 (COL8).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.G1093V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GGAAGACCTGGTGATCCTGGG	0.637																																																	1	Substitution - Missense(1)	kidney(1)											48.0	51.0	50.0					9																	101818627		2203	4300	6503	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3278G>T	9.37:g.101818627G>T	ENSP00000364140:p.Gly1093Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678035	0.68042	.	.	ENSG00000204291	ENST00000375001	D	0.98221	-4.8	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.99342	0.9769	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98863	1.0763	10	0.87932	D	0	-13.0975	17.5802	0.87965	0.0:0.0:1.0:0.0	.	1093	P39059	COFA1_HUMAN	V	1093	ENSP00000364140:G1093V	ENSP00000364140:G1093V	G	+	2	0	COL15A1	100858448	1.000000	0.71417	0.980000	0.43619	0.982000	0.71751	8.010000	0.88615	2.894000	0.99253	0.655000	0.94253	GGT		0.637	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3		NM_001855	
COL22A1	169044	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	139845296	139845296	+	Silent	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr8:139845296C>T	ENST00000303045.6	-	5	1277	c.831G>A	c.(829-831)gtG>gtA	p.V277V	COL22A1_ENST00000435777.1_Silent_p.V277V	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	277	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.V277V(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TACTTTGCACCACAGGGAAGG	0.512										HNSCC(7;0.00092)																																							1	Substitution - coding silent(1)	kidney(1)											135.0	107.0	117.0					8																	139845296		2203	4300	6503	SO:0001819	synonymous_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.831G>A	8.37:g.139845296C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																				0.512	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2		XM_291257	
COL6A3	1293	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	238277320	238277320	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr2:238277320C>T	ENST00000295550.4	-	10	5238	c.4786G>A	c.(4786-4788)Gtg>Atg	p.V1596M	COL6A3_ENST00000472056.1_Missense_Mutation_p.V989M|COL6A3_ENST00000347401.3_Missense_Mutation_p.V1395M|COL6A3_ENST00000409809.1_Missense_Mutation_p.V1390M|COL6A3_ENST00000353578.4_Missense_Mutation_p.V1390M|COL6A3_ENST00000346358.4_Missense_Mutation_p.V1396M	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1596	Nonhelical region.|VWFA 8. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V1596M(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AACTCTCGCACTGTGAAGACC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											188.0	169.0	175.0					2																	238277320		2203	4300	6503	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4786G>A	2.37:g.238277320C>T	ENSP00000295550:p.Val1596Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669365	0.47677	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39;-1.39	5.36	3.53	0.40419	von Willebrand factor, type A (3);	0.145434	0.31290	N	0.007918	D	0.88782	0.6530	M	0.89287	3.02	0.29667	N	0.8428	D;D;D	0.89917	1.0;0.999;0.993	D;D;D	0.81914	0.995;0.986;0.938	T	0.83291	-0.0033	10	0.40728	T	0.16	.	7.7095	0.28669	0.0:0.7239:0.1342:0.1419	.	989;1390;1596	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	M	1596;1395;1390;989;1390;1396	ENSP00000295550:V1596M;ENSP00000315609:V1395M;ENSP00000315873:V1390M;ENSP00000418285:V989M;ENSP00000386844:V1390M;ENSP00000295546:V1396M	ENSP00000295550:V1596M	V	-	1	0	COL6A3	237942059	0.912000	0.30974	0.886000	0.34754	0.964000	0.63967	2.140000	0.42159	1.246000	0.43901	0.655000	0.94253	GTG		0.552	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2		NM_004369	
DFNA5	1687	hgsc.bcm.edu;ucsc.edu	37	7	24756899	24756899	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr7:24756899delA	ENST00000342947.3	-	5	1096	c.671delT	c.(670-672)ttafs	p.L224fs	DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000409970.1_Frame_Shift_Del_p.L60fs|DFNA5_ENST00000409775.3_Frame_Shift_Del_p.L224fs|DFNA5_ENST00000545231.1_Frame_Shift_Del_p.L60fs|DFNA5_ENST00000419307.1_Frame_Shift_Del_p.L60fs	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	224					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TTTCACGTATAACTCAATGAC	0.577																																					GBM(78;184 1250 20134 20900 23600)												0													155.0	113.0	127.0					7																	24756899		2203	4300	6503	SO:0001589	frameshift_variant	1687			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.671delT	7.37:g.24756899delA	ENSP00000339587:p.Leu224fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Frame_Shift_Del	DEL	ENST00000342947.3	37	CCDS5389.1																																																																																				0.577	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2		NM_004403	
DPYSL3	1809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	146798117	146798117	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:146798117C>A	ENST00000398514.3	-	3	577	c.206G>T	c.(205-207)gGc>gTc	p.G69V	DPYSL3_ENST00000343218.5_Missense_Mutation_p.G183V|DPYSL3_ENST00000534907.1_Intron	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	69					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)	p.G69V(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACATCGATGCCTCCAGGGAT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											213.0	211.0	212.0					5																	146798117		2059	4224	6283	SO:0001583	missense	1809			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.206G>T	5.37:g.146798117C>A	ENSP00000381526:p.Gly69Val	Somatic		WXS	Illumina HiSeq	Phase_I	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	C	34	5.344838	0.95807	.	.	ENSG00000113657	ENST00000398514;ENST00000343218;ENST00000512722	D;D;D	0.90444	-2.67;-2.67;-2.18	6.17	6.17	0.99709	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.96833	0.8966	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96682	0.9504	10	0.87932	D	0	-10.6645	20.8794	0.99867	0.0:1.0:0.0:0.0	.	183;69	B3SXQ8;Q14195	.;DPYL3_HUMAN	V	69;183;69	ENSP00000381526:G69V;ENSP00000343690:G183V;ENSP00000426720:G69V	ENSP00000343690:G183V	G	-	2	0	DPYSL3	146778310	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	GGC		0.473	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2		NM_001387	
ERICH6	131831	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	150384662	150384662	+	Missense_Mutation	SNP	C	C	A	rs150155678		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr3:150384662C>A	ENST00000295910.6	-	13	1692	c.1640G>T	c.(1639-1641)gGa>gTa	p.G547V	FAM194A_ENST00000491361.1_Missense_Mutation_p.G401V	NM_152394.3	NP_689607.2												p.G547V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GATGCGGACTCCAATATAACG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											124.0	120.0	121.0					3																	150384662		2203	4300	6503	SO:0001583	missense	131831																														ENST00000295910.6:c.1640G>T	3.37:g.150384662C>A	ENSP00000295910:p.Gly547Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000295910.6	37	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048614	0.75846	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.11495	2.77;2.77	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000007	T	0.33614	0.0869	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.02184	-1.1199	10	0.72032	D	0.01	-23.3866	17.9829	0.89147	0.0:1.0:0.0:0.0	.	547	Q7L0X2	F194A_HUMAN	V	547;401;505	ENSP00000295910:G547V;ENSP00000419366:G401V	ENSP00000295910:G547V	G	-	2	0	FAM194A	151867352	1.000000	0.71417	0.887000	0.34795	0.993000	0.82548	5.067000	0.64357	2.544000	0.85801	0.655000	0.94253	GGA		0.413	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1			
FASTKD3	79072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	7867988	7867988	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:7867988C>T	ENST00000264669.5	-	2	345	c.209G>A	c.(208-210)gGa>gAa	p.G70E	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000341013.6_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	70					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.G70E(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AAGGTCATTTCCATTTTTCGA	0.443																																																	1	Substitution - Missense(1)	kidney(1)											93.0	91.0	91.0					5																	7867988		2203	4300	6503	SO:0001583	missense	79072			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.209G>A	5.37:g.7867988C>T	ENSP00000264669:p.Gly70Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	37	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.941073	0.34283	.	.	ENSG00000124279	ENST00000264669;ENST00000504695;ENST00000507572	T;T;T	0.45668	0.89;0.89;0.89	5.05	5.05	0.67936	.	0.095587	0.41605	D	0.000845	T	0.42426	0.1202	M	0.69823	2.125	0.23953	N	0.996363	P	0.47106	0.89	B	0.38954	0.286	T	0.53229	-0.8468	10	0.66056	D	0.02	-26.1483	13.2711	0.60161	0.0:0.8408:0.1592:0.0	.	70	Q14CZ7	FAKD3_HUMAN	E	70;70;53	ENSP00000264669:G70E;ENSP00000426008:G70E;ENSP00000422443:G53E	ENSP00000264669:G70E	G	-	2	0	FASTKD3	7920988	0.007000	0.16637	0.477000	0.27303	0.637000	0.38172	1.992000	0.40737	2.644000	0.89710	0.655000	0.94253	GGA		0.443	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1		NM_024091	
FBN2	2201	hgsc.bcm.edu	37	5	127607734	127607735	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:127607734_127607735insC	ENST00000508053.1	-	68	8890_8891	c.7916_7917insG	c.(7915-7917)tgcfs	p.C2639fs	FBN2_ENST00000262464.4_Frame_Shift_Ins_p.C2639fs			P35556	FBN2_HUMAN	fibrillin 2	2639	EGF-like 45; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGCCTTGGGGGCAGCCACATCT	0.515																																																	0																																										SO:0001589	frameshift_variant	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7917dupG	5.37:g.127607735_127607735dupC	ENSP00000424571:p.Cys2639fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DU01|Q59ES6	Frame_Shift_Ins	INS	ENST00000508053.1	37	CCDS34222.1																																																																																				0.515	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
FBN2	2201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	127664442	127664442	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:127664442G>A	ENST00000508053.1	-	40	5391	c.4417C>T	c.(4417-4419)Cgc>Tgc	p.R1473C	FBN2_ENST00000507835.1_Missense_Mutation_p.R323C|FBN2_ENST00000262464.4_Missense_Mutation_p.R1473C|FBN2_ENST00000508989.1_Missense_Mutation_p.R1440C			P35556	FBN2_HUMAN	fibrillin 2	1473	EGF-like 24; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R1473C(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CACTCGCAGCGATATGCACCC	0.478																																																	2	Substitution - Missense(2)	kidney(2)											176.0	134.0	148.0					5																	127664442		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4417C>T	5.37:g.127664442G>A	ENSP00000424571:p.Arg1473Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.823158	0.71143	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92545	-1.77;-1.77;-3.06;-3.06	4.97	4.03	0.46877	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.202654	0.35291	N	0.003307	D	0.96222	0.8768	M	0.90425	3.115	0.52501	D	0.999951	D;D	0.89917	0.999;1.0	D;D	0.70935	0.94;0.971	D	0.96232	0.9169	10	0.72032	D	0.01	.	13.468	0.61266	0.0:0.0:0.7479:0.2521	.	1440;1473	D6RJI3;P35556	.;FBN2_HUMAN	C	1473;1473;323;1440	ENSP00000262464:R1473C;ENSP00000424571:R1473C;ENSP00000426839:R323C;ENSP00000425596:R1440C	ENSP00000262464:R1473C	R	-	1	0	FBN2	127692341	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	5.287000	0.65645	2.742000	0.94016	0.655000	0.94253	CGC		0.478	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
GALNTL5	168391	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	151684265	151684265	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr7:151684265A>C	ENST00000392800.2	+	5	811	c.557A>C	c.(556-558)gAc>gCc	p.D186A	GALNTL5_ENST00000431418.2_Missense_Mutation_p.D186A	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	186	Catalytic subdomain A.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.D186A(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GAAAAACTAGACTATCACCTG	0.353																																																	1	Substitution - Missense(1)	kidney(1)											42.0	46.0	45.0					7																	151684265		2203	4300	6503	SO:0001583	missense	168391			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.557A>C	7.37:g.151684265A>C	ENSP00000376548:p.Asp186Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	a	14.42	2.530543	0.45073	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.58797	0.31;0.31	4.3	3.14	0.36123	Glycosyl transferase, family 2 (1);	0.457119	0.18618	N	0.135975	T	0.66607	0.2806	M	0.73430	2.235	0.09310	N	1	D	0.54601	0.967	P	0.55713	0.782	T	0.57820	-0.7745	10	0.59425	D	0.04	.	8.2881	0.31941	0.9038:0.0:0.0962:0.0	.	186	Q7Z4T8	GLTL5_HUMAN	A	186	ENSP00000392582:D186A;ENSP00000376548:D186A	ENSP00000376548:D186A	D	+	2	0	GALNTL5	151315198	0.362000	0.24980	0.002000	0.10522	0.708000	0.40852	2.736000	0.47385	0.794000	0.33899	0.454000	0.30748	GAC		0.353	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1		NM_145292	
GALT	2592	broad.mit.edu;ucsc.edu	37	9	34648884	34648884	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr9:34648884G>T	ENST00000378842.3	+	8	855	c.813G>T	c.(811-813)gaG>gaT	p.E271D	GALT_ENST00000450095.2_Missense_Mutation_p.E162D|GALT_ENST00000556278.1_Intron|IL11RA_ENST00000555003.1_5'Flank	NM_000155.3	NP_000146.2	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	271					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)|UDP-glucose catabolic process (GO:0006258)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	UDP-glucose:hexose-1-phosphate uridylyltransferase activity (GO:0008108)|zinc ion binding (GO:0008270)	p.E271D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(2)|lung(5)|upper_aerodigestive_tract(1)	16	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CCCCTGCTGAGCGTGATGGTC	0.617									Galactosemia																																								1	Substitution - Missense(1)	kidney(1)											67.0	68.0	68.0					9																	34648884		2203	4300	6503	SO:0001583	missense	2592	Familial Cancer Database	Galactose-1-Phosphate Uridyltransferase Deficiency	M60091	CCDS6565.1, CCDS59122.1	9p13	2013-01-08			ENSG00000213930	ENSG00000213930	2.7.7.12		4135	protein-coding gene	gene with protein product		606999					Standard	NM_000155		Approved		uc003zve.4	P07902	OTTHUMG00000019836	ENST00000378842.3:c.813G>T	9.37:g.34648884G>T	ENSP00000368119:p.Glu271Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B4E097|E7ET32|Q14355|Q14356|Q14357|Q14358|Q14359|Q14360|Q14361|Q14363|Q14364|Q14365|Q14369|Q14370|Q14371|Q14372|Q14373|Q14374|Q14375|Q14377|Q14378|Q14380|Q14381|Q14382|Q14383|Q14384|Q14385|Q14386|Q14387|Q14389|Q16766|Q53XK1|Q5VZ81|Q96BY1	Missense_Mutation	SNP	ENST00000378842.3	37	CCDS6565.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928476	0.52759	.	.	ENSG00000213930	ENST00000450095;ENST00000378842	D;D	0.99394	-5.82;-5.82	5.78	1.9	0.25705	Histidine triad motif (1);Galactose-1-phosphate uridyl transferase, C-terminal (1);Histidine triad-like motif (1);	0.143271	0.46442	U	0.000288	D	0.99260	0.9742	M	0.86864	2.845	0.52099	D	0.999946	D;B;P	0.89917	1.0;0.267;0.569	D;B;P	0.87578	0.998;0.169;0.518	D	0.99278	1.0895	9	.	.	.	-13.337	8.9079	0.35535	0.2981:0.0:0.7019:0.0	.	223;162;271	B4DT62;E7ET32;P07902	.;.;GALT_HUMAN	D	162;271	ENSP00000401956:E162D;ENSP00000368119:E271D	.	E	+	3	2	GALT	34638884	0.991000	0.36638	1.000000	0.80357	0.551000	0.35334	0.614000	0.24314	0.811000	0.34303	-0.150000	0.13652	GAG		0.617	GALT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052231.1		NM_000155	
GOLGA3	2802	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	133359043	133359043	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:133359043G>A	ENST00000450791.2	-	16	3487	c.3304C>T	c.(3304-3306)Cgc>Tgc	p.R1102C	GOLGA3_ENST00000204726.3_Missense_Mutation_p.R1102C|GOLGA3_ENST00000456883.2_Missense_Mutation_p.R1102C			Q08378	GOGA3_HUMAN	golgin A3	1102					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.R1102C(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TCCTCAAGGCGTTTTATCTTC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											135.0	135.0	135.0					12																	133359043		2203	4300	6503	SO:0001583	missense	2802			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3304C>T	12.37:g.133359043G>A	ENSP00000410378:p.Arg1102Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497328	0.44455	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883	T;T;T	0.35048	1.33;1.33;1.35	6.07	4.25	0.50352	.	0.298149	0.41712	D	0.000840	T	0.55577	0.1929	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65874	0.939;0.927	T	0.58792	-0.7574	10	0.72032	D	0.01	.	13.4141	0.60958	0.1281:0.0:0.8719:0.0	.	1102;1102	Q08378-2;Q08378	.;GOGA3_HUMAN	C	1102	ENSP00000204726:R1102C;ENSP00000410378:R1102C;ENSP00000409303:R1102C	ENSP00000204726:R1102C	R	-	1	0	GOLGA3	131869116	1.000000	0.71417	0.991000	0.47740	0.004000	0.04260	4.717000	0.61923	0.896000	0.36366	-0.150000	0.13652	CGC		0.473	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2		NM_005895	
HCN1	348980	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	45262590	45262590	+	Silent	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:45262590C>T	ENST00000303230.4	-	8	2163	c.2106G>A	c.(2104-2106)gcG>gcA	p.A702A		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	702					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.A702A(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GGCTGCAGACCGCGGTGGTGT	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											64.0	62.0	63.0					5																	45262590		2203	4300	6503	SO:0001819	synonymous_variant	348980			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2106G>A	5.37:g.45262590C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000303230.4	37	CCDS3952.1																																																																																				0.647	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1		NM_021072	
HSF4	3299	broad.mit.edu	37	16	67200251	67200251	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr16:67200251G>T	ENST00000521374.1	+	5	514	c.514G>T	c.(514-516)Gtg>Ttg	p.V172L	HSF4_ENST00000421453.1_Missense_Mutation_p.V172L|HSF4_ENST00000517867.1_3'UTR|HSF4_ENST00000584272.1_Missense_Mutation_p.V172L|HSF4_ENST00000264009.8_Missense_Mutation_p.V172L			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	172	Hydrophobic repeat HR-A/B.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V172L(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GCGGGAGGTGGTGACACTTCG	0.627																																																	1	Substitution - Missense(1)	kidney(1)											28.0	38.0	34.0					16																	67200251		2111	4207	6318	SO:0001583	missense	3299			D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.514G>T	16.37:g.67200251G>T	ENSP00000430947:p.Val172Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.77|11.77	1.738482|1.738482	0.30774|0.30774	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000517750|ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729	.|.	.|.	.|.	4.74|4.74	1.68|1.68	0.24146|0.24146	.|.	.|0.366017	.|0.27971	.|N	.|0.017108	T|T	0.62877|0.62877	0.2464|0.2464	L|L	0.42245|0.42245	1.32|1.32	0.39216|0.39216	D|D	0.963414|0.963414	.|B;D	.|0.64830	.|0.009;0.994	.|B;D	.|0.70716	.|0.019;0.97	T|T	0.60682|0.60682	-0.7215|-0.7215	5|9	.|0.37606	.|T	.|0.19	-8.1525|-8.1525	9.2774|9.2774	0.37707|0.37707	0.2461:0.0:0.7539:0.0|0.2461:0.0:0.7539:0.0	.|.	.|172;172	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	V|L	18|172;172;172;172;109	.|.	.|ENSP00000264009:V172L	G|V	+|+	2|1	0|0	HSF4|HSF4	65757752|65757752	1.000000|1.000000	0.71417|0.71417	0.922000|0.922000	0.36590|0.36590	0.393000|0.393000	0.30537|0.30537	2.986000|2.986000	0.49370|0.49370	0.600000|0.600000	0.29862|0.29862	0.655000|0.655000	0.94253|0.94253	GGT|GTG		0.627	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1		NM_001538	
IFT88	8100	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	21205163	21205163	+	Missense_Mutation	SNP	G	G	T	rs368723884		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr13:21205163G>T	ENST00000319980.6	+	18	1662	c.1335G>T	c.(1333-1335)gaG>gaT	p.E445D	IFT88_ENST00000382778.4_Missense_Mutation_p.E445D|IFT88_ENST00000537103.1_Missense_Mutation_p.E417D|IFT88_ENST00000351808.5_Missense_Mutation_p.E436D|IFT88_ENST00000461115.1_3'UTR	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	445					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.E445D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		AGGCTGTAGAGATCTTAAAAG	0.383																																																	1	Substitution - Missense(1)	kidney(1)											96.0	97.0	97.0					13																	21205163		2203	4300	6503	SO:0001583	missense	8100			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1335G>T	13.37:g.21205163G>T	ENSP00000323580:p.Glu445Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404428	0.25378	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.77877	-1.13;0.65;0.65;0.65	5.12	0.375	0.16188	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.134719	0.56097	N	0.000036	T	0.59307	0.2184	L	0.39326	1.205	0.54753	D	0.999983	B;B;B;B	0.16802	0.001;0.019;0.001;0.001	B;B;B;B	0.15870	0.005;0.014;0.005;0.002	T	0.35895	-0.9770	10	0.21014	T	0.42	-5.4017	1.5623	0.02597	0.2798:0.1225:0.432:0.1658	.	417;445;243;445	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	D	445;308;436;445;417	ENSP00000372228:E445D;ENSP00000261632:E436D;ENSP00000323580:E445D;ENSP00000437719:E417D	ENSP00000323580:E445D	E	+	3	2	IFT88	20103163	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	0.756000	0.26419	0.178000	0.19917	0.655000	0.94253	GAG		0.383	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3		NM_006531	
IP6K1	9807	broad.mit.edu;ucsc.edu	37	3	49775709	49775709	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr3:49775709G>A	ENST00000321599.4	-	3	671	c.370C>T	c.(370-372)Cgg>Tgg	p.R124W	IP6K1_ENST00000460540.1_5'UTR|IP6K1_ENST00000468463.1_Missense_Mutation_p.R124W|IP6K1_ENST00000395238.1_5'UTR	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	124					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.R124W(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						CTGCCTGACCGGTGCAGGCTC	0.557																																																	1	Substitution - Missense(1)	kidney(1)											132.0	108.0	116.0					3																	49775709		2203	4300	6503	SO:0001583	missense	9807			D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.370C>T	3.37:g.49775709G>A	ENSP00000323780:p.Arg124Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K157|A8MUX4|Q7L3I7|Q96E38	Missense_Mutation	SNP	ENST00000321599.4	37	CCDS33760.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164771	0.94727	.	.	ENSG00000176095	ENST00000321599;ENST00000468463	T;T	0.64260	-0.09;-0.09	5.93	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.61426	0.2346	L	0.48362	1.52	0.80722	D	1	D;B	0.76494	0.999;0.028	P;B	0.50082	0.63;0.01	T	0.64407	-0.6415	10	0.72032	D	0.01	-17.4589	10.3589	0.43980	0.0716:0.0:0.7841:0.1442	.	124;124	C9JNA8;Q92551	.;IP6K1_HUMAN	W	124	ENSP00000323780:R124W;ENSP00000420467:R124W	ENSP00000323780:R124W	R	-	1	2	IP6K1	49750713	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.876000	0.69667	2.814000	0.96858	0.563000	0.77884	CGG		0.557	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1		NM_153273	
JAK1	3716	hgsc.bcm.edu;ucsc.edu	37	1	65330477	65330479	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr1:65330477_65330479delTTG	ENST00000342505.4	-	8	1415_1417	c.1167_1169delCAA	c.(1165-1170)aacaag>aag	p.N389del		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	389	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TACCATTTTCTTGTTGTCCTGCT	0.419			Mis		ALL																																			Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0																																										SO:0001651	inframe_deletion	3716			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1167_1169delCAA	1.37:g.65330480_65330482delTTG	ENSP00000343204:p.Asn389del	Somatic		WXS	Illumina HiSeq	Phase_I	Q59GQ2|Q9UD26	In_Frame_Del	DEL	ENST00000342505.4	37	CCDS41346.1																																																																																				0.419	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1		NM_002227	
KIAA0040	9674	hgsc.bcm.edu	37	1	175129955	175129955	+	Missense_Mutation	SNP	G	G	C	rs386636937|rs3208835|rs57794404|rs71563271		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr1:175129955G>C	ENST00000423313.1	-	4	731	c.195C>G	c.(193-195)aaC>aaG	p.N65K	KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000444639.1_Missense_Mutation_p.N65K|KIAA0040_ENST00000545251.2_Missense_Mutation_p.N65K	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tcttcttcttgttcttctCTG	0.522																																																	0													65.0	53.0	56.0					1																	175129955		692	1591	2283	SO:0001583	missense	9674			D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.195C>G	1.37:g.175129955G>C	ENSP00000462172:p.Asn65Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	37																																																																																					0.522	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3		NM_014656	
KLHL10	317719	broad.mit.edu;hgsc.bcm.edu	37	17	40001990	40001990	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr17:40001990G>T	ENST00000293303.4	+	3	1450	c.1297G>T	c.(1297-1299)Ggg>Tgg	p.G433W	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	433					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.G433W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				AACACTTTATGGGAAGGTAAA	0.502																																																	1	Substitution - Missense(1)	kidney(1)											44.0	44.0	44.0					17																	40001990		2088	4219	6307	SO:0001583	missense	317719			AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1297G>T	17.37:g.40001990G>T	ENSP00000293303:p.Gly433Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676285	0.47886	.	.	ENSG00000161594	ENST00000293303	D	0.82619	-1.63	6.07	6.07	0.98685	Galactose oxidase, beta-propeller (1);	0.252433	0.44902	D	0.000412	D	0.94807	0.8323	H	0.97707	4.06	0.48395	D	0.999648	D;D	0.76494	0.998;0.999	D;D	0.79784	0.976;0.993	D	0.95876	0.8895	9	.	.	.	.	19.2231	0.93806	0.0:0.0:1.0:0.0	.	427;433	B4DXV2;Q6JEL2	.;KLH10_HUMAN	W	433	ENSP00000293303:G433W	.	G	+	1	0	KLHL10	37255516	0.999000	0.42202	0.944000	0.38274	0.204000	0.24138	3.124000	0.50461	2.885000	0.99019	0.655000	0.94253	GGG		0.502	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1		NM_152467	
LRCH1	23143	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	47303069	47303069	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr13:47303069C>T	ENST00000389798.3	+	17	2049	c.1852C>T	c.(1852-1854)Cac>Tac	p.H618Y	LRCH1_ENST00000311191.6_Missense_Mutation_p.H618Y|LRCH1_ENST00000389797.3_Missense_Mutation_p.H653Y	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	618	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.							p.H618Y(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		TCTGGTCAACCACATCCGCCC	0.517																																																	2	Substitution - Missense(2)	kidney(2)											137.0	121.0	126.0					13																	47303069		2203	4300	6503	SO:0001583	missense	23143			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1852C>T	13.37:g.47303069C>T	ENSP00000374448:p.His618Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	37	CCDS31972.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917397	0.92249	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	D;D;D	0.94537	-3.45;-3.45;-3.45	5.81	5.81	0.92471	Calponin homology domain (5);	0.049641	0.85682	D	0.000000	D	0.97145	0.9067	M	0.79475	2.455	0.80722	D	1	P;D;D	0.76494	0.73;0.999;0.997	P;D;D	0.85130	0.556;0.997;0.926	D	0.96940	0.9687	10	0.52906	T	0.07	0.3534	17.5566	0.87892	0.0:1.0:0.0:0.0	.	618;653;618	Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;LRCH1_HUMAN	Y	618;618;653	ENSP00000308493:H618Y;ENSP00000374448:H618Y;ENSP00000374447:H653Y	ENSP00000308493:H618Y	H	+	1	0	LRCH1	46201070	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.452000	0.66638	2.745000	0.94114	0.655000	0.94253	CAC		0.517	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2		NM_015116	
MAK16	84549	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	33354168	33354168	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr8:33354168T>C	ENST00000360128.6	+	8	1005	c.548T>C	c.(547-549)aTt>aCt	p.I183T	TTI2_ENST00000519356.1_Intron	NM_032509.3	NP_115898.2	Q9BXY0	MAK16_HUMAN	MAK16 homolog (S. cerevisiae)	183						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I183T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	8						AACTTCCCCATTCATGCCTTC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											159.0	134.0	143.0					8																	33354168		2203	4300	6503	SO:0001583	missense	84549			AF251062	CCDS6089.1	8p12	2011-10-13	2008-06-04	2008-06-04	ENSG00000198042	ENSG00000198042		"""RNA binding motif (RRM) containing"""	13703	protein-coding gene	gene with protein product			"""RNA binding motif protein 13"""	RBM13			Standard	NM_032509		Approved	MAK16L	uc003xjj.3	Q9BXY0	OTTHUMG00000163957	ENST00000360128.6:c.548T>C	8.37:g.33354168T>C	ENSP00000353246:p.Ile183Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RB44|Q5U5T1|Q86UC4|Q96SY6	Missense_Mutation	SNP	ENST00000360128.6	37	CCDS6089.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057392	0.36277	.	.	ENSG00000198042	ENST00000360128	T	0.40225	1.04	5.8	5.8	0.92144	.	0.048895	0.85682	D	0.000000	T	0.32912	0.0845	L	0.29908	0.895	0.58432	D	0.999991	B	0.21452	0.056	B	0.22152	0.038	T	0.10200	-1.0640	10	0.18710	T	0.47	-8.3933	15.8221	0.78662	0.0:0.0:0.0:1.0	.	183	Q9BXY0	MAK16_HUMAN	T	183	ENSP00000353246:I183T	ENSP00000353246:I183T	I	+	2	0	MAK16	33473710	1.000000	0.71417	0.981000	0.43875	0.958000	0.62258	5.924000	0.70054	2.227000	0.72691	0.460000	0.39030	ATT		0.408	MAK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376559.3		NM_032509	
MAP4K4	9448	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	102460601	102460601	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr2:102460601G>A	ENST00000347699.4	+	12	1061	c.1061G>A	c.(1060-1062)cGa>cAa	p.R354Q	MAP4K4_ENST00000302217.5_Missense_Mutation_p.R207Q|MAP4K4_ENST00000413150.2_Missense_Mutation_p.R354Q|MAP4K4_ENST00000456652.1_Missense_Mutation_p.R207Q|MAP4K4_ENST00000425019.1_Missense_Mutation_p.R354Q|MAP4K4_ENST00000324219.4_Missense_Mutation_p.R354Q|MAP4K4_ENST00000350878.4_Missense_Mutation_p.R334Q|MAP4K4_ENST00000350198.4_Missense_Mutation_p.R354Q	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	354					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R354Q(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						ACTCTTCGCCGAGATTTCCTG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											68.0	62.0	64.0					2																	102460601		1934	4134	6068	SO:0001583	missense	9448			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1061G>A	2.37:g.102460601G>A	ENSP00000314363:p.Arg354Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O75172|Q9NST7	Missense_Mutation	SNP	ENST00000347699.4	37	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	G	31	5.065933	0.93898	.	.	ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878	T;T;T;T;T;T;T;T;T	0.75367	1.03;-0.77;1.01;-0.44;1.01;-0.45;-0.75;-0.93;-0.76	5.72	5.72	0.89469	.	0.060184	0.64402	D	0.000002	D	0.87669	0.6235	M	0.83012	2.62	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.994;1.0;0.994;0.994;1.0;0.997;0.997	D;D;D;D;D;D;D;D;D;D	0.80764	0.98;0.987;0.98;0.921;0.991;0.921;0.921;0.994;0.964;0.964	D	0.86713	0.1937	10	0.42905	T	0.14	.	19.8673	0.96808	0.0:0.0:1.0:0.0	.	334;354;334;207;354;354;354;354;354;354	B7Z388;B7Z3V5;E7ESS2;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948	.;.;.;.;.;M4K4_HUMAN;.;.;.;.	Q	354;354;354;207;354;207;354;316;334	ENSP00000392830:R354Q;ENSP00000313644:R354Q;ENSP00000281111:R354Q;ENSP00000303600:R207Q;ENSP00000389752:R354Q;ENSP00000387370:R207Q;ENSP00000314363:R354Q;ENSP00000409720:R316Q;ENSP00000343658:R334Q	ENSP00000303600:R207Q	R	+	2	0	MAP4K4	101827033	1.000000	0.71417	0.969000	0.41365	0.993000	0.82548	9.864000	0.99589	2.698000	0.92095	0.655000	0.94253	CGA		0.512	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1		NM_004834	
NDUFV3	4731	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	44323941	44323941	+	Intron	SNP	A	A	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr21:44323941A>G	ENST00000340344.4	+	3	235				NDUFV3_ENST00000354250.2_Silent_p.R273R|NDUFV3_ENST00000460259.1_3'UTR	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)	p.R273R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		AAACATTTAGATTAAATGAAA	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											82.0	99.0	93.0					21																	44323941		2203	4300	6503	SO:0001627	intron_variant	4731				CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.170-5033A>G	21.37:g.44323941A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Silent	SNP	ENST00000340344.4	37	CCDS33573.1																																																																																				0.398	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2			
SLC9B2	133308	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	103988700	103988700	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr4:103988700T>C	ENST00000394785.3	-	2	639	c.8A>G	c.(7-9)gAt>gGt	p.D3G	SLC9B2_ENST00000503103.1_Missense_Mutation_p.D3G|SLC9B2_ENST00000503230.1_Missense_Mutation_p.D3G|SLC9B2_ENST00000362026.3_Missense_Mutation_p.D3G|SLC9B2_ENST00000339611.4_Missense_Mutation_p.D3G|SLC9B2_ENST00000505838.1_5'UTR	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	3					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)	p.D3G(2)									TTTATCTTCATCCCCCATTAT	0.358																																																	2	Substitution - Missense(2)	kidney(2)											183.0	157.0	166.0					4																	103988700		2203	4300	6503	SO:0001583	missense	0			AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.8A>G	4.37:g.103988700T>C	ENSP00000378265:p.Asp3Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B5ME52|Q6ZMD8|Q96D95	Missense_Mutation	SNP	ENST00000394785.3	37	CCDS3662.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.530584	0.27387	.	.	ENSG00000164038	ENST00000362026;ENST00000339611;ENST00000394785;ENST00000503103;ENST00000503230;ENST00000503818	T;T;T;T;T	0.29655	1.83;1.77;1.83;1.56;1.63	3.84	2.61	0.31194	.	0.932865	0.08981	N	0.865743	T	0.24812	0.0602	L	0.40543	1.245	0.09310	N	1	B;B;B	0.24186	0.099;0.099;0.099	B;B;B	0.19946	0.027;0.017;0.017	T	0.25328	-1.0135	10	0.59425	D	0.04	-11.1297	6.4008	0.21638	0.218:0.0:0.0:0.782	.	3;3;3	B7Z676;E9PE63;Q86UD5	.;.;SL9B2_HUMAN	G	3	ENSP00000354574:D3G;ENSP00000345241:D3G;ENSP00000378265:D3G;ENSP00000425385:D3G;ENSP00000422477:D3G	ENSP00000345241:D3G	D	-	2	0	SLC9B2	104208149	0.007000	0.16637	0.001000	0.08648	0.052000	0.14988	1.547000	0.36190	0.792000	0.33850	0.533000	0.62120	GAT		0.358	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253805.1		NM_178833	
OR5M8	219484	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	56258051	56258051	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr11:56258051A>C	ENST00000327216.2	-	1	820	c.796T>G	c.(796-798)Tct>Gct	p.S266A		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S266A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					TGTTCAACAGATTCCTTTGAG	0.383																																																	1	Substitution - Missense(1)	kidney(1)											43.0	48.0	46.0					11																	56258051		2201	4295	6496	SO:0001583	missense	219484			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.796T>G	11.37:g.56258051A>C	ENSP00000323354:p.Ser266Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	ENST00000327216.2	37	CCDS31533.1	.	.	.	.	.	.	.	.	.	.	A	4.733	0.136340	0.09032	.	.	ENSG00000181371	ENST00000327216	T	0.00235	8.48	3.73	3.73	0.42828	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38111	U	0.001820	T	0.00210	0.0006	M	0.62016	1.91	0.09310	N	1	B	0.23735	0.09	B	0.31245	0.126	T	0.31943	-0.9925	10	0.66056	D	0.02	-28.1087	5.8978	0.18949	0.8808:0.0:0.1192:0.0	.	266	Q8NGP6	OR5M8_HUMAN	A	266	ENSP00000323354:S266A	ENSP00000323354:S266A	S	-	1	0	OR5M8	56014627	0.002000	0.14202	0.790000	0.31976	0.114000	0.19823	1.188000	0.32102	1.710000	0.51325	0.462000	0.41574	TCT		0.383	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1		NM_001005282	
OR10G7	390265	broad.mit.edu;hgsc.bcm.edu	37	11	123909221	123909221	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr11:123909221A>T	ENST00000330487.5	-	1	496	c.488T>A	c.(487-489)tTc>tAc	p.F163Y		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F163Y(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGGCAAATGGAAAGTCAATAT	0.572																																																	1	Substitution - Missense(1)	kidney(1)											162.0	154.0	157.0					11																	123909221		2200	4296	6496	SO:0001583	missense	390265			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.488T>A	11.37:g.123909221A>T	ENSP00000329689:p.Phe163Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	A	9.385	1.074034	0.20147	.	.	ENSG00000182634	ENST00000330487	T	0.00258	8.41	3.24	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000154	T	0.00468	0.0015	M	0.82132	2.575	0.09310	N	1	D	0.76494	0.999	D	0.91635	0.999	T	0.39014	-0.9634	10	0.87932	D	0	.	5.6685	0.17709	0.7786:0.0:0.2214:0.0	.	163	Q8NGN6	O10G7_HUMAN	Y	163	ENSP00000329689:F163Y	ENSP00000329689:F163Y	F	-	2	0	OR10G7	123414431	0.000000	0.05858	0.052000	0.19188	0.112000	0.19704	1.316000	0.33620	1.490000	0.48466	0.374000	0.22700	TTC		0.572	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1		NM_001004463	
PCDHB6	56130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140530050	140530050	+	Missense_Mutation	SNP	G	G	C	rs3836745		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:140530050G>C	ENST00000231136.1	+	1	212	c.212G>C	c.(211-213)aGa>aCa	p.R71T	PCDHB6_ENST00000543635.1_Intron	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	71	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R71T(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAAGGGAACAGACAACATTTG	0.537																																																	1	Substitution - Missense(1)	kidney(1)											86.0	95.0	92.0					5																	140530050		2203	4300	6503	SO:0001583	missense	56130			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.212G>C	5.37:g.140530050G>C	ENSP00000231136:p.Arg71Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	9.348	1.064855	0.20067	.	.	ENSG00000113211	ENST00000231136	T	0.26518	1.73	4.97	-0.904	0.10530	Cadherin, N-terminal (1);Cadherin (2);	.	.	.	.	T	0.19366	0.0465	N	0.21617	0.685	0.09310	N	1	B	0.29955	0.263	B	0.39465	0.3	T	0.41484	-0.9506	9	0.87932	D	0	.	5.9842	0.19423	0.5148:0.1352:0.3501:0.0	.	71	Q9Y5E3	PCDB6_HUMAN	T	71	ENSP00000231136:R71T	ENSP00000231136:R71T	R	+	2	0	PCDHB6	140510234	0.000000	0.05858	0.305000	0.25099	0.674000	0.39518	-0.179000	0.09768	-0.039000	0.13602	0.561000	0.74099	AGA		0.537	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2		NM_018939	
PDE3A	5139	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	20792854	20792854	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:20792854T>A	ENST00000359062.3	+	10	2254	c.2214T>A	c.(2212-2214)taT>taA	p.Y738*	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	738	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.Y738*(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TTATGAATTATTTTCATGCTT	0.308																																																	1	Substitution - Nonsense(1)	kidney(1)											86.0	86.0	86.0					12																	20792854		2202	4299	6501	SO:0001587	stop_gained	5139				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2214T>A	12.37:g.20792854T>A	ENSP00000351957:p.Tyr738*	Somatic		WXS	Illumina HiSeq	Phase_I	O60865|Q13348|Q17RD1	Nonsense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	T	38	7.211576	0.98139	.	.	ENSG00000172572	ENST00000359062	.	.	.	5.03	-1.36	0.09085	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9372	0.64032	0.0:0.7208:0.0:0.2792	.	.	.	.	X	738	.	ENSP00000351957:Y738X	Y	+	3	2	PDE3A	20684121	0.999000	0.42202	0.991000	0.47740	0.986000	0.74619	0.558000	0.23469	-0.396000	0.07703	-0.515000	0.04445	TAT		0.308	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			
PDE1B	5153	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	54970410	54970410	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:54970410G>A	ENST00000243052.3	+	14	1868	c.1432G>A	c.(1432-1434)Gtg>Atg	p.V478M	PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000550620.1_Missense_Mutation_p.V458M|PPP1R1A_ENST00000547431.1_3'UTR|PDE1B_ENST00000538346.1_Missense_Mutation_p.V437M	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	478	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.V478M(2)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CAACCCTGATGTGGTCAGCTT	0.582																																																	2	Substitution - Missense(2)	ovary(1)|kidney(1)											79.0	66.0	71.0					12																	54970410		2203	4300	6503	SO:0001583	missense	5153			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1432G>A	12.37:g.54970410G>A	ENSP00000243052:p.Val478Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613025	0.46631	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.69561	-0.41;-0.4;-0.4	4.86	2.91	0.33838	.	0.000000	0.38897	N	0.001527	T	0.38852	0.1056	N	0.08118	0	0.80722	D	1	B;B	0.16166	0.016;0.004	B;B	0.13407	0.009;0.004	T	0.32052	-0.9921	10	0.35671	T	0.21	.	4.1359	0.10170	0.1921:0.2062:0.6017:0.0	.	458;478	Q01064-2;Q01064	.;PDE1B_HUMAN	M	478;437;458	ENSP00000243052:V478M;ENSP00000442559:V437M;ENSP00000448519:V458M	ENSP00000243052:V478M	V	+	1	0	PDE1B	53256677	0.989000	0.36119	0.997000	0.53966	0.915000	0.54546	2.222000	0.42926	2.403000	0.81681	0.561000	0.74099	GTG		0.582	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	32088407	32088407	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr5:32088407C>A	ENST00000438447.1	+	20	5241	c.4853C>A	c.(4852-4854)cCc>cAc	p.P1618H	PDZD2_ENST00000282493.3_Missense_Mutation_p.P1618H			O15018	PDZD2_HUMAN	PDZ domain containing 2	1618					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.P1618H(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GCTCATCTTCCCACCCAGGCT	0.552																																																	1	Substitution - Missense(1)	kidney(1)											109.0	115.0	113.0					5																	32088407		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.4853C>A	5.37:g.32088407C>A	ENSP00000402033:p.Pro1618His	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147684	0.57151	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.32515	1.45;1.45	5.08	-1.48	0.08745	.	0.000000	0.46442	D	0.000288	T	0.30885	0.0779	L	0.42245	1.32	0.09310	N	1	D	0.76494	0.999	D	0.63488	0.915	T	0.15896	-1.0421	10	0.29301	T	0.29	.	1.1078	0.01698	0.3811:0.3037:0.1368:0.1784	.	1618	O15018	PDZD2_HUMAN	H	1618;1419;1618	ENSP00000402033:P1618H;ENSP00000282493:P1618H	ENSP00000282493:P1618H	P	+	2	0	PDZD2	32124164	0.000000	0.05858	0.000000	0.03702	0.275000	0.26752	-0.138000	0.10374	0.160000	0.19432	0.655000	0.94253	CCC		0.552	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PEPD	5184	broad.mit.edu	37	19	33878351	33878351	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr19:33878351C>T	ENST00000244137.7	-	15	1414	c.1381G>A	c.(1381-1383)Ggc>Agc	p.G461S	PEPD_ENST00000591968.1_5'UTR|PEPD_ENST00000436370.3_Missense_Mutation_p.G397S|PEPD_ENST00000397032.4_Missense_Mutation_p.G420S	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	461					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)	p.G461S(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					AGCTCTATGCCGCTGTCAGTC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											92.0	94.0	93.0					19																	33878351		2109	4252	6361	SO:0001583	missense	5184			BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.1381G>A	19.37:g.33878351C>T	ENSP00000244137:p.Gly461Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	37	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	C	35	5.588771	0.96590	.	.	ENSG00000124299	ENST00000244137;ENST00000397032;ENST00000436370	D;D;D	0.84070	-1.8;-1.8;-1.8	5.83	5.83	0.93111	Peptidase M24, structural domain (2);	0.000000	0.85682	D	0.000000	D	0.92870	0.7732	M	0.88640	2.97	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93517	0.6858	10	0.87932	D	0	-49.2597	19.0962	0.93253	0.0:1.0:0.0:0.0	.	397;420;461;461	E9PCE8;A8MX47;P12955;A8K3Z1	.;.;PEPD_HUMAN;.	S	461;420;397	ENSP00000244137:G461S;ENSP00000380226:G420S;ENSP00000391890:G397S	ENSP00000244137:G461S	G	-	1	0	PEPD	38570191	1.000000	0.71417	0.957000	0.39632	0.863000	0.49368	5.567000	0.67378	2.746000	0.94184	0.561000	0.74099	GGC		0.592	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3		NM_000285	
PTK7	5754	broad.mit.edu	37	6	43107148	43107148	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr6:43107148G>C	ENST00000230419.4	+	10	1724	c.1503G>C	c.(1501-1503)aaG>aaC	p.K501N	PTK7_ENST00000345201.2_Intron|PTK7_ENST00000481273.1_Missense_Mutation_p.K509N|PTK7_ENST00000352931.2_Missense_Mutation_p.K501N|PTK7_ENST00000349241.2_Intron	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	501					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.K501N(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AAACAGAAAAGCTCAAGTTCA	0.597																																																	1	Substitution - Missense(1)	kidney(1)											58.0	60.0	59.0					6																	43107148		2203	4300	6503	SO:0001583	missense	5754			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.1503G>C	6.37:g.43107148G>C	ENSP00000230419:p.Lys501Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	37	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199241	0.38806	.	.	ENSG00000112655	ENST00000230419;ENST00000352931;ENST00000481273	T;T;T	0.40476	1.03;1.03;1.03	5.44	1.58	0.23477	Immunoglobulin-like fold (1);	0.103795	0.64402	D	0.000005	T	0.11153	0.0272	N	0.20401	0.57	0.47308	D	0.999383	B;B;B	0.26975	0.058;0.165;0.014	B;B;B	0.27796	0.055;0.083;0.017	T	0.05517	-1.0880	10	0.42905	T	0.14	.	6.0571	0.19816	0.2888:0.0:0.5829:0.1284	.	509;501;501	E9PFZ5;Q13308-4;Q13308	.;.;PTK7_HUMAN	N	501;501;509	ENSP00000230419:K501N;ENSP00000326029:K501N;ENSP00000418754:K509N	ENSP00000230418:K501N	K	+	3	2	PTK7	43215126	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	1.106000	0.31098	0.430000	0.26230	0.591000	0.81541	AAG		0.597	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2			
RARRES1	5918	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	158415529	158415529	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr3:158415529C>G	ENST00000237696.5	-	6	1103	c.823G>C	c.(823-825)Gaa>Caa	p.E275Q	RP11-379F4.6_ENST00000606185.1_lincRNA	NM_206963.1	NP_996846.1	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene induced) 1	275					negative regulation of cell proliferation (GO:0008285)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E275Q(1)		NS(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	GAGGCTTCTTCTGGTGTCTGT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											108.0	108.0	108.0					3																	158415529		2203	4300	6503	SO:0001583	missense	5918			U27185	CCDS3184.1, CCDS54665.1	3q25.32	2013-07-29			ENSG00000118849	ENSG00000118849			9867	protein-coding gene	gene with protein product	"""latexin-like"""	605090				8601727, 9270552	Standard	NM_002888		Approved	TIG1, LXNL	uc003fci.3	P49788	OTTHUMG00000158834	ENST00000237696.5:c.823G>C	3.37:g.158415529C>G	ENSP00000237696:p.Glu275Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N1D7	Missense_Mutation	SNP	ENST00000237696.5	37	CCDS3184.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667290	0.67814	.	.	ENSG00000118849	ENST00000237696	T	0.27402	1.67	5.73	3.86	0.44501	.	0.364959	0.25294	N	0.031710	T	0.45236	0.1332	M	0.66939	2.045	0.23739	N	0.996979	D	0.53312	0.959	P	0.53035	0.716	T	0.39251	-0.9623	10	0.46703	T	0.11	.	15.3807	0.74654	0.0:0.7364:0.2635:0.0	.	275	P49788	TIG1_HUMAN	Q	275	ENSP00000237696:E275Q	ENSP00000237696:E275Q	E	-	1	0	RARRES1	159898223	0.026000	0.19158	0.043000	0.18650	0.997000	0.91878	1.848000	0.39309	1.392000	0.46585	0.650000	0.86243	GAA		0.413	RARRES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352358.1			
RPL3L	6123	broad.mit.edu;ucsc.edu	37	16	1997038	1997038	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr16:1997038C>A	ENST00000268661.7	-	6	844	c.750G>T	c.(748-750)aaG>aaT	p.K250N		NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	250					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.K250N(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						TGCAGGCCACCTTGCGCAGGC	0.667																																																	1	Substitution - Missense(1)	kidney(1)											57.0	59.0	58.0					16																	1997038		2199	4300	6499	SO:0001583	missense	6123			U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.750G>T	16.37:g.1997038C>A	ENSP00000268661:p.Lys250Asn	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000268661.7	37	CCDS10450.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922519	0.33908	.	.	ENSG00000140986	ENST00000268661	T	0.25579	1.79	4.92	-0.785	0.10950	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.58206	0.2106	H	0.98199	4.17	0.58432	D	0.999998	D	0.71674	0.998	D	0.77557	0.99	T	0.59627	-0.7419	10	0.87932	D	0	-13.1717	6.1944	0.20542	0.1194:0.4634:0.0:0.4172	.	250	Q92901	RL3L_HUMAN	N	250	ENSP00000268661:K250N	ENSP00000268661:K250N	K	-	3	2	RPL3L	1937039	0.998000	0.40836	0.998000	0.56505	0.022000	0.10575	0.635000	0.24629	-0.044000	0.13491	-0.895000	0.02911	AAG		0.667	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250582.2		NM_005061	
RSRC2	65117	hgsc.bcm.edu	37	12	123005002	123005002	+	Intron	SNP	A	A	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:123005002A>T	ENST00000331738.7	-	3	353				RSRC2_ENST00000354654.2_Intron	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2								poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		CCCTTAACTGATTTAAGATAT	0.269																																																	0													72.0	75.0	74.0					12																	123005002		2202	4299	6501	SO:0001627	intron_variant	65117			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.207+929T>A	12.37:g.123005002A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6N040|Q6NW16|Q9H864	RNA	SNP	ENST00000331738.7	37	CCDS31920.1																																																																																				0.269	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3		NM_023012	
RYR1	6261	broad.mit.edu	37	19	38976694	38976695	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr19:38976694_38976695insG	ENST00000359596.3	+	34	5399_5400	c.5399_5400insG	c.(5398-5403)cctgccfs	p.A1801fs	RYR1_ENST00000355481.4_Frame_Shift_Ins_p.A1801fs|RYR1_ENST00000360985.3_Frame_Shift_Ins_p.A1801fs			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1801	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGCCTCAGCCCTGCCATCCCGC	0.733																																																	0																																										SO:0001589	frameshift_variant	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		Exception_encountered	19.37:g.38976694_38976695insG	ENSP00000352608:p.Ala1801fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q16314|Q16368|Q9NPK1|Q9P1U4	Frame_Shift_Ins	INS	ENST00000359596.3	37	CCDS33011.1																																																																																				0.733	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			
SETD2	29072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	47164342	47164343	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	GA	GA	GA	-	GA	GA	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr3:47164342_47164343delGA	ENST00000409792.3	-	3	1825_1826	c.1783_1784delTC	c.(1783-1785)tcafs	p.S595fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	595					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ACTACCTTTTGAACAAGGTGTC	0.307			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0																																										SO:0001589	frameshift_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1783_1784delTC	3.37:g.47164342_47164343delGA	ENSP00000386759:p.Ser595fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	CCDS2749.2																																																																																				0.307	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
STEAP1	26872	broad.mit.edu	37	7	89791288	89791288	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr7:89791288G>T	ENST00000297205.2	+	4	858	c.658G>T	c.(658-660)Gtg>Ttg	p.V220L	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	220	Ferric oxidoreductase.				ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)	p.V220L(1)		kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					GGAGATTTATGTGTCTCTGGG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											193.0	172.0	179.0					7																	89791288		2203	4300	6503	SO:0001583	missense	26872			AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.658G>T	7.37:g.89791288G>T	ENSP00000297205:p.Val220Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A4D1E0|O95034	Missense_Mutation	SNP	ENST00000297205.2	37	CCDS5614.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615135	0.28712	.	.	ENSG00000164647	ENST00000297205	D	0.91407	-2.84	5.61	4.73	0.59995	Flavoprotein transmembrane component (1);	0.000000	0.64402	D	0.000015	D	0.90765	0.7101	N	0.21373	0.66	0.43719	D	0.996195	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.87768	0.2603	10	0.14656	T	0.56	-12.8408	15.8522	0.78940	0.0:0.0:0.863:0.137	.	220;220	B4E221;Q9UHE8	.;STEA1_HUMAN	L	220	ENSP00000297205:V220L	ENSP00000297205:V220L	V	+	1	0	STEAP1	89629224	0.990000	0.36364	1.000000	0.80357	0.833000	0.47200	1.399000	0.34566	1.349000	0.45751	-0.181000	0.13052	GTG		0.393	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059327.3		NM_012449	
TGM6	343641	broad.mit.edu;ucsc.edu	37	20	2398051	2398051	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr20:2398051C>T	ENST00000202625.2	+	10	1571	c.1510C>T	c.(1510-1512)Cct>Tct	p.P504S	TGM6_ENST00000381423.1_Missense_Mutation_p.P504S	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	504					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.P504S(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GGTGCTAGAGCCTCCCATGCT	0.657																																																	1	Substitution - Missense(1)	kidney(1)											44.0	39.0	41.0					20																	2398051		2203	4300	6503	SO:0001583	missense	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1510C>T	20.37:g.2398051C>T	ENSP00000202625:p.Pro504Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980565	0.34942	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	T;T	0.66638	-0.22;-0.22	4.67	4.67	0.58626	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.128746	0.53938	D	0.000050	T	0.69797	0.3151	L	0.50919	1.6	0.40461	D	0.980245	D;D	0.67145	0.996;0.985	P;P	0.58820	0.846;0.749	T	0.64896	-0.6299	10	0.10902	T	0.67	-30.4276	12.9459	0.58371	0.0:1.0:0.0:0.0	.	504;504	O95932-2;O95932	.;TGM3L_HUMAN	S	504	ENSP00000202625:P504S;ENSP00000370831:P504S	ENSP00000202625:P504S	P	+	1	0	TGM6	2346051	0.986000	0.35501	0.997000	0.53966	0.660000	0.38997	0.870000	0.28010	2.437000	0.82529	0.655000	0.94253	CCT		0.657	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2		NM_198994	
TIMELESS	8914	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	56816773	56816773	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:56816773G>C	ENST00000553532.1	-	19	2446	c.2296C>G	c.(2296-2298)Cta>Gta	p.L766V	TIMELESS_ENST00000554616.1_Intron|TIMELESS_ENST00000229201.4_Missense_Mutation_p.L765V					timeless circadian clock									p.L766V(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						AAAGTCACTAGCTCCTGTAGG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											74.0	80.0	78.0					12																	56816773		2203	4300	6503	SO:0001583	missense	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2296C>G	12.37:g.56816773G>C	ENSP00000450607:p.Leu766Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630725	0.67015	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.16196	2.36;2.36	5.59	4.7	0.59300	Timeless C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.36303	0.0962	M	0.81112	2.525	0.80722	D	1	D	0.69078	0.997	P	0.61070	0.883	T	0.19289	-1.0310	10	0.62326	D	0.03	-9.3858	7.7945	0.29140	0.2426:0.0:0.7574:0.0	.	766	Q9UNS1	TIM_HUMAN	V	765;766	ENSP00000229201:L765V;ENSP00000450607:L766V	ENSP00000229201:L766V	L	-	1	2	TIMELESS	55103040	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	2.553000	0.45837	1.513000	0.48852	0.655000	0.94253	CTA		0.493	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1		NM_003920	
SCTR	6344	broad.mit.edu	37	2	120194742	120194742	+	IGR	SNP	T	T	C			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr2:120194742T>C	ENST00000019103.5	-	0	1865				TMEM37_ENST00000409826.1_Missense_Mutation_p.V112A|TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000306406.4_Missense_Mutation_p.V100A	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)	p.V100A(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	TTGGCCGTGGTGGCCGCCATT	0.632																																																	1	Substitution - Missense(1)	kidney(1)											91.0	86.0	88.0					2																	120194742		2203	4300	6503	SO:0001628	intergenic_variant	140738				CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194742T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	T	14.01	2.408628	0.42715	.	.	ENSG00000171227	ENST00000409826;ENST00000306406	.	.	.	4.74	3.59	0.41128	.	0.079777	0.48286	D	0.000181	T	0.43322	0.1242	L	0.46885	1.475	0.34148	D	0.667158	B	0.21753	0.06	B	0.20184	0.028	T	0.51896	-0.8647	9	0.49607	T	0.09	-24.6	8.5646	0.33531	0.0:0.1646:0.0:0.8354	.	100	Q8WXS4	CCGL_HUMAN	A	112;100	.	ENSP00000303148:V100A	V	+	2	0	TMEM37	119911212	1.000000	0.71417	0.869000	0.34112	0.854000	0.48673	3.501000	0.53325	0.854000	0.35336	0.459000	0.35465	GTG		0.632	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2			
Unknown	0	broad.mit.edu	37	14	73079138	73079139	+	IGR	INS	-	-	T	rs78960232		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr14:73079138_73079139insT								RP3-514A23.2 (17305 upstream) : DPF3 (6864 downstream)																							TGTTTCTGTCCTTTTTTTTTTT	0.436																																																	0																																										SO:0001628	intergenic_variant	0																															14.37:g.73079149_73079149dupT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS		37																																																																																				0	0.436									
MIR4477B	100616194	broad.mit.edu	37	9	68413553	68413553	+	RNA	SNP	T	T	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr9:68413553T>G	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		TCCACGTCCTTCAGCTCCCCC	0.597																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68413553T>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581659.1	37																																																																																					0.597	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
USP5	8078	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6969582	6969582	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr12:6969582G>A	ENST00000229268.8	+	11	1323	c.1271G>A	c.(1270-1272)gGc>gAc	p.G424D	USP5_ENST00000389231.5_Missense_Mutation_p.G424D	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	424	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)	p.G424D(2)		breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						ATCGGCAAGGGCCACCCTGAA	0.587																																																	2	Substitution - Missense(2)	kidney(2)											83.0	83.0	83.0					12																	6969582		2203	4300	6503	SO:0001583	missense	8078			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1271G>A	12.37:g.6969582G>A	ENSP00000229268:p.Gly424Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	37	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827435	0.90955	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.28895	1.59;1.59	5.13	5.13	0.70059	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.44808	0.1311	L	0.52266	1.64	0.80722	D	1	P;P	0.40534	0.632;0.72	P;P	0.51016	0.656;0.447	T	0.22730	-1.0208	10	0.48119	T	0.1	-7.2535	18.7864	0.91957	0.0:0.0:1.0:0.0	.	424;424	P45974;P45974-2	UBP5_HUMAN;.	D	424	ENSP00000229268:G424D;ENSP00000373883:G424D	ENSP00000229268:G424D	G	+	2	0	USP5	6839843	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.519000	0.98025	2.656000	0.90262	0.655000	0.94253	GGC		0.587	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1			
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191572	10191572	+	Nonsense_Mutation	SNP	G	G	T	rs121913345		TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr3:10191572G>T	ENST00000256474.2	+	3	1405	c.565G>T	c.(565-567)Gaa>Taa	p.E189*	VHL_ENST00000345392.2_Nonsense_Mutation_p.E148*|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	189					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.E189K(3)|p.E189*(2)|p.E189fs*12(1)|p.E189fs*13(1)|p.E189fs*25(1)|p.Y185fs*11(1)|p.L188>?(1)|p.D187_N193del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGAAGATCTGGAAGACCACCC	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	11	Deletion - Frameshift(4)|Substitution - Missense(3)|Substitution - Nonsense(2)|Complex(1)|Deletion - In frame(1)	kidney(11)	GRCh37	CD983007	VHL	D							77.0	70.0	72.0					3																	10191572		2203	4300	6503	SO:0001587	stop_gained	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.565G>T	3.37:g.10191572G>T	ENSP00000256474:p.Glu189*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.850148	0.91277	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.97	4.97	0.65823	.	0.057481	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-3.955	16.1249	0.81386	0.0:0.0:1.0:0.0	.	.	.	.	X	189;148;107	.	ENSP00000256474:E189X	E	+	1	0	VHL	10166572	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.062000	0.76706	2.735000	0.93741	0.655000	0.94253	GAA		0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZNF467	168544	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	149468119	149468119	+	Start_Codon_SNP	SNP	C	C	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr7:149468119C>G	ENST00000302017.3	-	2	416	c.3G>C	c.(1-3)atG>atC	p.M1I	ZNF467_ENST00000484747.1_Start_Codon_SNP_p.M1I	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M1I(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGTCTCTCTCATGGTAACCC	0.547																																																	1	Substitution - Missense(1)	kidney(1)											87.0	85.0	86.0					7																	149468119		2203	4300	6503	SO:0001582	initiator_codon_variant	168544			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.3G>C	7.37:g.149468119C>G	ENSP00000304769:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000302017.3	37	CCDS5899.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917822	0.52546	.	.	ENSG00000181444	ENST00000484747;ENST00000302017	T	0.07688	3.17	3.44	3.44	0.39384	.	.	.	.	.	T	0.24392	0.0591	.	.	.	0.39861	D	0.973376	P;D	0.67145	0.826;0.996	B;D	0.73708	0.341;0.981	T	0.01375	-1.1371	8	0.62326	D	0.03	-21.3416	10.671	0.45757	0.0:1.0:0.0:0.0	.	1;1	Q7Z7K2;C9JAX3	ZN467_HUMAN;.	I	1	ENSP00000304769:M1I	ENSP00000304769:M1I	M	-	3	0	ZNF467	149099052	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	3.011000	0.49567	2.224000	0.72417	0.650000	0.86243	ATG		0.547	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1		NM_207336	Missense_Mutation
ZRANB3	84083	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	135966529	135966529	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5402-01A-01D-1501-10	TCGA-B0-5402-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ca62bea0-a008-481e-8a91-d0f3a9598255	6e644c17-dc2b-4e7d-a73d-4d4d14695390	g.chr2:135966529C>G	ENST00000264159.6	-	18	2631	c.2515G>C	c.(2515-2517)Gtt>Ctt	p.V839L	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000536680.1_Missense_Mutation_p.V837L|ZRANB3_ENST00000401392.1_Missense_Mutation_p.V837L	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	839					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.V302L(1)|p.V839L(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GCTACGGCAACATCTTCTTTG	0.393																																																	2	Substitution - Missense(2)	kidney(2)											122.0	116.0	118.0					2																	135966529		1890	4115	6005	SO:0001583	missense	84083			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.2515G>C	2.37:g.135966529C>G	ENSP00000264159:p.Val839Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055686	0.75960	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.92752	-3.1;-3.09;-3.08	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.93184	0.7829	M	0.76002	2.32	0.40085	D	0.97618	D;D	0.63880	0.987;0.993	P;P	0.51193	0.46;0.662	D	0.93392	0.6752	10	0.56958	D	0.05	-20.7839	12.0209	0.53342	0.0:0.9203:0.0:0.0797	.	839;837	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	L	302;302;837;839;837	ENSP00000383979:V837L;ENSP00000264159:V839L;ENSP00000441320:V837L	ENSP00000264159:V839L	V	-	1	0	ZRANB3	135682999	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.653000	0.54446	2.709000	0.92574	0.655000	0.94253	GTT		0.393	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1		NM_032143	
