#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AKAP9	10142	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	91632376	91632376	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr7:91632376A>T	ENST00000359028.2	+	9	3406	c.3181A>T	c.(3181-3183)Atg>Ttg	p.M1061L	AKAP9_ENST00000356239.3_Missense_Mutation_p.M1049L|AKAP9_ENST00000358100.2_Missense_Mutation_p.M1061L			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1061					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.M1061L(1)|p.M1049L(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATCAAAAATAATGGTGGAAGA	0.343			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Missense(2)	kidney(2)											48.0	51.0	50.0					7																	91632376		2203	4299	6502	SO:0001583	missense	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3181A>T	7.37:g.91632376A>T	ENSP00000351922:p.Met1061Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	A	4.103	0.017215	0.07959	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.02944	4.11;4.11;4.1	5.72	-1.52	0.08637	.	0.665589	0.13234	N	0.403420	T	0.03477	0.0100	M	0.62723	1.935	0.09310	N	1	B;B;B;B	0.10296	0.001;0.002;0.002;0.003	B;B;B;B	0.10450	0.001;0.002;0.002;0.005	T	0.41124	-0.9526	10	0.23891	T	0.37	.	7.9312	0.29904	0.4237:0.1225:0.4538:0.0	.	1061;1049;1049;1061	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	L	1049;1061;1061;1061;1061	ENSP00000348573:M1049L;ENSP00000351922:M1061L;ENSP00000350813:M1061L	ENSP00000348573:M1049L	M	+	1	0	AKAP9	91470312	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	0.026000	0.13599	-0.096000	0.12329	0.528000	0.53228	ATG		0.343	AKAP9-202	KNOWN	basic	protein_coding	protein_coding			NM_005751	
ALK	238	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	29917822	29917822	+	Missense_Mutation	SNP	G	G	C	rs56116528	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:29917822G>C	ENST00000389048.3	-	3	1752	c.846C>G	c.(844-846)gaC>gaG	p.D282E	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	282	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D282E(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GGTTCCTGAGGTCATGCAGTG	0.572			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	1	Substitution - Missense(1)	kidney(1)											99.0	96.0	97.0					2																	29917822		2203	4300	6503	SO:0001583	missense	238	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.846C>G	2.37:g.29917822G>C	ENSP00000373700:p.Asp282Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	G	9.548	1.115282	0.20795	.	.	ENSG00000171094	ENST00000389048	T	0.02631	4.22	5.97	-1.07	0.09968	Concanavalin A-like lectin/glucanase (1);MAM domain (1);	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.49031	-0.8981	8	.	.	.	.	1.9603	0.03385	0.1588:0.1158:0.2758:0.4497	.	282	Q9UM73	ALK_HUMAN	E	282	ENSP00000373700:D282E	.	D	-	3	2	ALK	29771326	0.015000	0.18098	0.001000	0.08648	0.281000	0.26958	0.088000	0.14979	-0.092000	0.12417	-0.126000	0.14955	GAC		0.572	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1		NM_004304	
ATIC	471	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	216184411	216184411	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:216184411G>T	ENST00000236959.9	+	4	573	c.247G>T	c.(247-249)Gaa>Taa	p.E83*	ATIC_ENST00000435675.1_Nonsense_Mutation_p.E82*|ATIC_ENST00000540518.1_Nonsense_Mutation_p.E24*	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	83					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)	p.E83*(1)	ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	TAATATTCCAGAAGATAATGC	0.323			T	ALK	ALCL																																			Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	1	Substitution - Nonsense(1)	kidney(1)											78.0	80.0	80.0					2																	216184411		2203	4300	6503	SO:0001587	stop_gained	471				CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.247G>T	2.37:g.216184411G>T	ENSP00000236959:p.Glu83*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K202|E9PBU3|Q13856|Q53S28	Nonsense_Mutation	SNP	ENST00000236959.9	37	CCDS2398.1	.	.	.	.	.	.	.	.	.	.	G	40	8.073581	0.98640	.	.	ENSG00000138363	ENST00000236959;ENST00000540518;ENST00000435675;ENST00000413174	.	.	.	5.61	5.61	0.85477	.	0.284451	0.39834	N	0.001246	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-9.2783	15.6137	0.76748	0.0:0.1377:0.8623:0.0	.	.	.	.	X	83;24;82;24	.	ENSP00000236959:E83X	E	+	1	0	ATIC	215892656	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.395000	0.52558	2.657000	0.90304	0.655000	0.94253	GAA		0.323	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256610.1		NM_004044	
ACSM6	142827	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	96954310	96954310	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr10:96954310A>T	ENST00000394005.3	+	1	77	c.68A>T	c.(67-69)tAt>tTt	p.Y23F	C10orf129_ENST00000430183.1_5'UTR|C10orf129_ENST00000341686.3_Missense_Mutation_p.Y23F			Q6P461	ACSM6_HUMAN		23					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.Y23F(1)		breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GCCTGCTGCTATCCAAACCAA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											117.0	99.0	105.0					10																	96954310		692	1591	2283	SO:0001583	missense	142827																														ENST00000394005.3:c.68A>T	10.37:g.96954310A>T	ENSP00000377573:p.Tyr23Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Missense_Mutation	SNP	ENST00000394005.3	37	CCDS7440.2	.	.	.	.	.	.	.	.	.	.	A	7.844	0.722601	0.15439	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000394005	T;T	0.19806	2.12;2.12	1.48	0.102	0.14522	.	.	.	.	.	T	0.06188	0.0160	N	0.08118	0	0.09310	N	0.999997	P	0.35139	0.486	B	0.19946	0.027	T	0.32214	-0.9915	9	0.10902	T	0.67	.	3.7724	0.08647	0.7511:0.0:0.2489:0.0	.	23	Q6P461	ACSM6_HUMAN	F	23	ENSP00000340296:Y23F;ENSP00000377573:Y23F	ENSP00000328491:Y23F	Y	+	2	0	C10orf129	96944300	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	0.501000	0.22578	-0.136000	0.11475	0.246000	0.17985	TAT		0.478	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049506.2			
C18orf21	83608	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	33557546	33557546	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr18:33557546C>A	ENST00000592875.1	+	4	1120	c.474C>A	c.(472-474)agC>agA	p.S158R	C18orf21_ENST00000333234.5_Missense_Mutation_p.S70R	NM_031446.4	NP_113634.3	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21	158								p.S158R(1)		endometrium(1)|kidney(1)|large_intestine(1)|skin(2)	5						AAGGCAAGAGCCCAGCATCGG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											88.0	85.0	86.0					18																	33557546		2203	4300	6503	SO:0001583	missense	83608			BC025950	CCDS11916.2, CCDS56064.1, CCDS74212.1	18q12.2	2004-05-05			ENSG00000141428	ENSG00000141428			28802	protein-coding gene	gene with protein product						12477932	Standard	NM_031446		Approved	PNAS-131, PNAS-124, HsT3108	uc002kzc.3	Q32NC0	OTTHUMG00000128531	ENST00000592875.1:c.474C>A	18.37:g.33557546C>A	ENSP00000465517:p.Ser158Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6GW03|Q9BXV6|Q9BXW2	Missense_Mutation	SNP	ENST00000592875.1	37	CCDS11916.2	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282570	0.40394	.	.	ENSG00000141428	ENST00000333234;ENST00000269194	T	0.54479	0.57	5.52	-0.964	0.10326	.	0.320112	0.40554	N	0.001075	T	0.66005	0.2746	M	0.78637	2.42	0.34168	D	0.669421	D	0.89917	1.0	D	0.87578	0.998	T	0.70568	-0.4836	10	0.87932	D	0	.	7.4546	0.27258	0.0:0.5663:0.1164:0.3173	.	158	Q32NC0	CR021_HUMAN	R	158;70	ENSP00000269194:S70R	ENSP00000269194:S70R	S	+	3	2	C18orf21	31811544	0.807000	0.29009	0.978000	0.43139	0.262000	0.26303	-0.440000	0.06888	-0.151000	0.11176	-1.334000	0.01262	AGC		0.413	C18orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250364.1		NM_031446	
C5orf52	100190949	hgsc.bcm.edu;ucsc.edu	37	5	157102208	157102208	+	Splice_Site	DEL	G	G	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr5:157102208delG	ENST00000409999.3	+	2	383	c.321delG	c.(319-321)gag>ga	p.E107fs		NM_001145132.1	NP_001138604.1	A6NGY3	CE052_HUMAN	chromosome 5 open reading frame 52	107										endometrium(2)|lung(1)	3						ATGAGATGGAGGTAAAGTAGC	0.413																																																	0													57.0	59.0	58.0					5																	157102208		692	1591	2283	SO:0001630	splice_region_variant	100190949			BG721329	CCDS47329.1	5q33.3	2012-02-24			ENSG00000187658	ENSG00000187658			35121	protein-coding gene	gene with protein product							Standard	NM_001145132		Approved		uc011ddt.2	A6NGY3	OTTHUMG00000154518	ENST00000409999.3:c.321+1G>-	5.37:g.157102208delG		Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000409999.3	37	CCDS47329.1																																																																																				0.413	C5orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335664.1		NM_001145132	Frame_Shift_Del
CCHCR1	54535	broad.mit.edu	37	6	31112818	31112826	+	In_Frame_Del	DEL	CCACCTTGC	CCACCTTGC	-	rs2073720	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	CCACCTTGC	CCACCTTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr6:31112818_31112826delCCACCTTGC	ENST00000376266.5	-	14	1756_1764	c.1634_1642delGCAAGGTGG	c.(1633-1644)agcaaggtggcc>acc	p.545_548SKVA>T	CCHCR1_ENST00000451521.2_In_Frame_Del_p.598_601SKVA>T|CCHCR1_ENST00000396268.3_In_Frame_Del_p.634_637SKVA>T|CCHCR1_ENST00000396263.2_In_Frame_Del_p.492_495SKVA>T	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	545			K -> R (in dbSNP:rs2073720).		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						AGCTGCTGGGCCACCTTGCTCAGCTGCTG	0.656																																																	0																																										SO:0001651	inframe_deletion	54535			AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1634_1642delGCAAGGTGG	6.37:g.31112818_31112826delCCACCTTGC	ENSP00000365442:p.Ser545_Ala548delinsThr	Somatic		WXS	Illumina GAIIx	Phase_I	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	In_Frame_Del	DEL	ENST00000376266.5	37	CCDS4695.1																																																																																				0.656	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076190.5		NM_019052	
CLCN7	1186	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	1509163	1509163	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr16:1509163G>A	ENST00000382745.4	-	7	1225	c.620C>T	c.(619-621)cCc>cTc	p.P207L	CLCN7_ENST00000262318.8_Missense_Mutation_p.P183L|CLCN7_ENST00000448525.1_Missense_Mutation_p.P183L	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	207					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.P207L(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				CTTGATCTGGGGGATTCCGCT	0.682																																																	1	Substitution - Missense(1)	kidney(1)											45.0	45.0	45.0					16																	1509163		2198	4300	6498	SO:0001583	missense	1186			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.620C>T	16.37:g.1509163G>A	ENSP00000372193:p.Pro207Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	ENST00000382745.4	37	CCDS32361.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.634038	0.67130	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.83163	-1.69;-1.69	4.67	4.67	0.58626	Chloride channel, core (2);	0.107038	0.64402	D	0.000004	D	0.93841	0.8030	H	0.97186	3.955	0.80722	D	1	D;D	0.61697	0.983;0.99	D;P	0.66979	0.948;0.814	D	0.95956	0.8958	10	0.87932	D	0	-37.9223	16.4947	0.84236	0.0:0.0:1.0:0.0	.	183;207	E9PDB9;P51798	.;CLCN7_HUMAN	L	183;160;207;149	ENSP00000410907:P183L;ENSP00000372193:P207L	ENSP00000262318:P160L	P	-	2	0	CLCN7	1449164	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	7.555000	0.82223	2.314000	0.78098	0.655000	0.94253	CCC		0.682	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2		NM_001287	
CLCNKA	1187	broad.mit.edu;hgsc.bcm.edu	37	1	16353083	16353083	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr1:16353083G>A	ENST00000331433.4	+	6	570	c.551G>A	c.(550-552)cGc>cAc	p.R184H	CLCNKA_ENST00000375692.1_Missense_Mutation_p.R184H|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000439316.2_Missense_Mutation_p.R141H|CLCNKA_ENST00000420078.1_Missense_Mutation_p.R184H			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	184					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)	p.R184H(1)		breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GGCCGTGTGCGCACCACGACC	0.642																																																	1	Substitution - Missense(1)	kidney(1)											78.0	69.0	72.0					1																	16353083		2203	4300	6503	SO:0001583	missense	1187				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.551G>A	1.37:g.16353083G>A	ENSP00000332771:p.Arg184His	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	ENST00000331433.4	37	CCDS167.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329100	0.24167	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000439316;ENST00000331433	D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14	3.19	2.26	0.28386	Chloride channel, core (2);	0.352028	0.30302	N	0.009933	D	0.85600	0.5734	L	0.52364	1.645	0.29722	N	0.838577	B;B;B	0.16603	0.018;0.018;0.018	B;B;B	0.18561	0.022;0.022;0.022	T	0.71351	-0.4619	10	0.15066	T	0.55	.	5.251	0.15522	0.1103:0.0:0.689:0.2007	.	141;184;184	E7EPH6;Q5T5Q4;P51800	.;.;CLCKA_HUMAN	H	184;184;141;184	ENSP00000364844:R184H;ENSP00000410353:R184H;ENSP00000414445:R141H;ENSP00000332771:R184H	ENSP00000332771:R184H	R	+	2	0	CLCNKA	16225670	0.822000	0.29219	0.916000	0.36221	0.308000	0.27856	1.181000	0.32017	0.674000	0.31244	0.305000	0.20034	CGC		0.642	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1			
DDHD1	80821	broad.mit.edu	37	14	53619480	53619481	+	In_Frame_Ins	INS	-	-	GCCGCC	rs140904345|rs55671452|rs200797826	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr14:53619480_53619481insGCCGCC	ENST00000323669.5	-	1	335_336	c.336_337insGGCGGC	c.(334-339)ggcagc>ggcGGCGGCagc	p.111_112insGG	DDHD1_ENST00000395606.1_In_Frame_Ins_p.111_112insGG|RP11-547D23.1_ENST00000554235.1_RNA|AL356020.1_ENST00000584587.1_RNA|DDHD1_ENST00000357758.3_In_Frame_Ins_p.111_112insGG	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	111					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GACAAGGAGCTGCCGCCGCCGC	0.703														3933	0.785343	0.4962	0.8718	5008	,	,		9770	0.9673		0.833	False		,,,				2504	0.8783																0																																										SO:0001652	inframe_insertion	80821			AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.331_336dupGGCGGC	14.37:g.53619481_53619486dupGCCGCC	ENSP00000327104:p.Gly110_Gly111dup	Somatic		WXS	Illumina GAIIx	Phase_I	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	In_Frame_Ins	INS	ENST00000323669.5	37	CCDS53895.1																																																																																				0.703	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1			
DNAH10	196385	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	124408962	124408962	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr12:124408962delC	ENST00000409039.3	+	66	11420	c.11395delC	c.(11395-11397)cagfs	p.Q3799fs	CCDC92_ENST00000544798.1_Intron|RP11-380L11.4_ENST00000602952.1_RNA	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3799					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGAGAATAATCAGACTGTCTG	0.473																																																	0													63.0	67.0	66.0					12																	124408962		1944	4139	6083	SO:0001589	frameshift_variant	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11395delC	12.37:g.124408962delC	ENSP00000386770:p.Gln3799fs	Somatic		WXS	Illumina HiSeq	Phase_I	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Frame_Shift_Del	DEL	ENST00000409039.3	37	CCDS9255.2																																																																																				0.473	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			
DTX2	113878	hgsc.bcm.edu	37	7	76112183	76112183	+	Silent	SNP	C	C	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr7:76112183C>T	ENST00000324432.5	+	5	1137	c.627C>T	c.(625-627)ccC>ccT	p.P209P	DTX2_ENST00000446600.1_Silent_p.P118P|DTX2_ENST00000446820.2_Silent_p.P209P|DTX2_ENST00000413936.2_Silent_p.P209P|DTX2_ENST00000430490.2_Silent_p.P209P|DTX2_ENST00000307569.8_Silent_p.P209P	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	209					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GAACTGGCCCCGTGTCAGGCC	0.677																																																	0													58.0	65.0	63.0					7																	76112183		2203	4300	6503	SO:0001819	synonymous_variant	113878				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.627C>T	7.37:g.76112183C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	CCDS5587.1																																																																																				0.677	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2			
EIF4A2	1974	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	186505633	186505633	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr3:186505633T>G	ENST00000323963.5	+	10	1105	c.1041T>G	c.(1039-1041)aaT>aaG	p.N347K	EIF4A2_ENST00000356531.5_Missense_Mutation_p.N252K|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.N348K|SNORA63_ENST00000363548.1_RNA|SNORD2_ENST00000459163.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	347	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.N347K(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TGGTTATAAATTATGATCTAC	0.353			T	BCL6	NHL																																			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	1	Substitution - Missense(1)	kidney(1)											82.0	84.0	83.0					3																	186505633		2203	4299	6502	SO:0001583	missense	1974			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.1041T>G	3.37:g.186505633T>G	ENSP00000326381:p.Asn347Lys	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739682	0.69304	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.05717	3.4;3.4;3.4	5.43	2.6	0.31112	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.38904	0.1058	H	0.99464	4.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;1.0	T	0.47898	-0.9081	10	0.87932	D	0	-2.5463	7.5881	0.28004	0.0:0.6385:0.0:0.3615	.	252;348;347	Q9NZE6;Q14240-2;Q14240	.;.;IF4A2_HUMAN	K	347;348;252	ENSP00000326381:N347K;ENSP00000398370:N348K;ENSP00000348925:N252K	ENSP00000326381:N347K	N	+	3	2	EIF4A2	187988327	0.990000	0.36364	1.000000	0.80357	0.951000	0.60555	0.306000	0.19279	0.761000	0.33130	-0.468000	0.05107	AAT		0.353	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1		NM_001967	
FAM111A	63901	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	58920102	58920102	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr11:58920102A>G	ENST00000528737.1	+	5	3779	c.961A>G	c.(961-963)Aaa>Gaa	p.K321E	FAM111A_ENST00000420244.1_Missense_Mutation_p.K321E|FAM111A_ENST00000361723.3_Missense_Mutation_p.K321E|FAM111A_ENST00000531147.1_Missense_Mutation_p.K321E|FAM111A_ENST00000533703.1_Missense_Mutation_p.K321E			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	321					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.K321E(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				AATGAAAGTAAAAAATGGGGA	0.328																																																	1	Substitution - Missense(1)	kidney(1)											36.0	42.0	40.0					11																	58920102		2191	4292	6483	SO:0001583	missense	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.961A>G	11.37:g.58920102A>G	ENSP00000434435:p.Lys321Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	ENST00000528737.1	37	CCDS7973.1	.	.	.	.	.	.	.	.	.	.	A	9.501	1.103215	0.20632	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	5.65	-0.584	0.11702	Peptidase cysteine/serine, trypsin-like (1);	2.568420	0.01005	N	0.003754	T	0.43634	0.1256	L	0.50333	1.59	0.09310	N	1	B	0.18863	0.031	B	0.11329	0.006	T	0.21793	-1.0235	10	0.25106	T	0.35	-12.5339	9.8394	0.40989	0.6223:0.0:0.3777:0.0	.	321	Q96PZ2	F111A_HUMAN	E	321	ENSP00000434435:K321E;ENSP00000406683:K321E;ENSP00000355264:K321E;ENSP00000433154:K321E;ENSP00000431631:K321E	ENSP00000355264:K321E	K	+	1	0	FAM111A	58676678	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.442000	0.06871	-0.058000	0.13177	0.528000	0.53228	AAA		0.328	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1		NM_022074	
FAM81B	153643	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	94783997	94783997	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr5:94783997G>C	ENST00000283357.5	+	9	1100	c.1054G>C	c.(1054-1056)Gaa>Caa	p.E352Q		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	352						nucleus (GO:0005634)		p.E352Q(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		TAAAATGGAAGAAAAACTGCT	0.294																																																	1	Substitution - Missense(1)	kidney(1)											54.0	49.0	51.0					5																	94783997		1802	4070	5872	SO:0001583	missense	153643				CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.1054G>C	5.37:g.94783997G>C	ENSP00000283357:p.Glu352Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000283357.5	37	CCDS43341.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949011	0.53186	.	.	ENSG00000153347	ENST00000283357;ENST00000512365	T	0.21031	2.03	5.63	4.75	0.60458	.	0.282543	0.34676	N	0.003769	T	0.39009	0.1062	L	0.59436	1.845	0.22639	N	0.998907	D	0.67145	0.996	D	0.63793	0.918	T	0.10753	-1.0616	10	0.49607	T	0.09	-16.0692	13.8603	0.63557	0.076:0.0:0.924:0.0	.	352	Q96LP2	FA81B_HUMAN	Q	352;27	ENSP00000283357:E352Q	ENSP00000283357:E352Q	E	+	1	0	FAM81B	94809753	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	2.755000	0.47540	2.660000	0.90430	0.558000	0.71614	GAA		0.294	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1		NM_152548	
FANCI	55215	hgsc.bcm.edu;ucsc.edu	37	15	89859678	89859678	+	Silent	SNP	A	A	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr15:89859678A>G	ENST00000310775.7	+	38	4061	c.3975A>G	c.(3973-3975)aaA>aaG	p.K1325K	POLG_ENST00000268124.5_3'UTR|POLG_ENST00000442287.2_3'UTR|FANCI_ENST00000300027.8_Silent_p.K1265K	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	1325					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CCAAGAAGAAAAGGAAAAAAT	0.443								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													40.0	39.0	39.0					15																	89859678		2200	4299	6499	SO:0001819	synonymous_variant	55215	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3975A>G	15.37:g.89859678A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Silent	SNP	ENST00000310775.7	37	CCDS45346.1																																																																																				0.443	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1		NM_018193	
FCHSD1	89848	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	141028860	141028860	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr5:141028860G>A	ENST00000435817.2	-	6	441	c.391C>T	c.(391-393)Cag>Tag	p.Q131*	FCHSD1_ENST00000522783.1_Nonsense_Mutation_p.Q129*|FCHSD1_ENST00000522126.1_Nonsense_Mutation_p.Q55*|FCHSD1_ENST00000519800.1_Nonsense_Mutation_p.Q129*|FCHSD1_ENST00000523856.1_5'Flank	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	131								p.Q131*(1)	FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGCCCTCTGGAGGTTCTCT	0.577																																																	1	Substitution - Nonsense(1)	kidney(1)											152.0	172.0	165.0					5																	141028860		2117	4245	6362	SO:0001587	stop_gained	89848			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.391C>T	5.37:g.141028860G>A	ENSP00000399259:p.Gln131*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UX75|Q86Y77|Q9NXX8	Nonsense_Mutation	SNP	ENST00000435817.2	37	CCDS47295.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046513	0.75846	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000522783;ENST00000519800	.	.	.	4.93	4.93	0.64822	.	0.081844	0.48767	D	0.000166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-19.3678	15.9158	0.79517	0.0:0.0:1.0:0.0	.	.	.	.	X	131;55;129;129	.	ENSP00000399259:Q131X	Q	-	1	0	FCHSD1	141009044	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.804000	0.62554	2.265000	0.75225	0.561000	0.74099	CAG		0.577	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2		NM_033449	
FEN1	2237	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	61563635	61563636	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr11:61563635_61563636insAC	ENST00000305885.2	+	2	1215_1216	c.802_803insAC	c.(802-804)tacfs	p.Y268fs	FADS2_ENST00000574708.1_Intron	NM_004111.5	NP_004102.1			flap structure-specific endonuclease 1											endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						CCCCAACAAGTACCCTGTGCCA	0.579								Editing and processing nucleases																																									0																																										SO:0001589	frameshift_variant	2237			L37374	CCDS8010.1	11q12	2013-05-08			ENSG00000168496	ENSG00000168496			3650	protein-coding gene	gene with protein product	"""maturation factor-1"", ""DNase IV"""	600393		RAD2		7774922	Standard	NM_004111		Approved	FEN-1, MF1	uc001nsg.3	P39748	OTTHUMG00000168162	ENST00000305885.2:c.803_804dupAC	11.37:g.61563636_61563637dupAC	ENSP00000305480:p.Tyr268fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000305885.2	37	CCDS8010.1																																																																																				0.579	FEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398526.1		NM_004111	
FKBP7	51661	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179341870	179341870	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:179341870T>G	ENST00000424785.2	-	2	350	c.292A>C	c.(292-294)Att>Ctt	p.I98L	FKBP7_ENST00000464248.1_5'UTR|FKBP7_ENST00000434643.2_Missense_Mutation_p.I98L	NM_001135212.1|NM_181342.2	NP_001128684.1|NP_851939.1	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7	98	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.I98L(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GTCATAGCAATGTCTAGGCCT	0.393																																					Melanoma(26;682 927 5286 17599 46613)												1	Substitution - Missense(1)	kidney(1)											92.0	92.0	92.0					2																	179341870		2203	4300	6503	SO:0001583	missense	51661			AF092137	CCDS2280.1, CCDS46462.1	2q31.2	2013-01-10	2001-11-28		ENSG00000079150	ENSG00000079150		"""EF-hand domain containing"""	3723	protein-coding gene	gene with protein product		607062	"""FK506-binding protein 7"""			9806833	Standard	NM_181342		Approved	FKBP23	uc002umk.3	Q9Y680	OTTHUMG00000132577	ENST00000424785.2:c.292A>C	2.37:g.179341870T>G	ENSP00000413152:p.Ile98Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q4ZG70|Q6V3B2|Q86U65|Q96DA4|Q9Y6B0	Missense_Mutation	SNP	ENST00000424785.2	37	CCDS2280.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.358578	0.61403	.	.	ENSG00000079150	ENST00000424785;ENST00000350591;ENST00000434643	D;D	0.85556	-2.0;-2.0	5.82	5.82	0.92795	.	0.217467	0.53938	D	0.000057	T	0.78201	0.4246	N	0.21448	0.665	0.49389	D	0.999787	P;B;B	0.35551	0.509;0.131;0.009	B;B;B	0.37091	0.241;0.033;0.019	T	0.76675	-0.2872	10	0.29301	T	0.29	-29.3586	16.19	0.81981	0.0:0.0:0.0:1.0	.	98;98;98	B4DRE2;Q9Y680-3;Q9Y680-2	.;.;.	L	98	ENSP00000413152:I98L;ENSP00000415486:I98L	ENSP00000233092:I98L	I	-	1	0	FKBP7	179050116	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.896000	0.56266	2.225000	0.72522	0.460000	0.39030	ATT		0.393	FKBP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255783.1		NM_181342	
G3BP1	10146	hgsc.bcm.edu;ucsc.edu	37	5	151183616	151183617	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr5:151183616_151183617insT	ENST00000394123.3	+	12	1510_1511	c.1365_1366insT	c.(1366-1368)tttfs	p.F456fs	G3BP1_ENST00000543466.1_Frame_Shift_Ins_p.F274fs|G3BP1_ENST00000356245.3_Frame_Shift_Ins_p.F456fs			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	456	Gly-rich.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			AGAAACCAGGATTTGGAGTGGG	0.574																																																	0																																										SO:0001589	frameshift_variant	10146			BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.1368dupT	5.37:g.151183619_151183619dupT	ENSP00000377681:p.Phe456fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5HYE9	Frame_Shift_Ins	INS	ENST00000394123.3	37	CCDS4319.1																																																																																				0.574	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252431.1		NM_005754	
GPR110	266977	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	46969278	46969278	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr6:46969278delT	ENST00000371253.2	-	14	2834	c.2619delA	c.(2617-2619)aaafs	p.K873fs	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Frame_Shift_Del_p.K676fs	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	873					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						AGAATTTGGGTTTGGCAGATA	0.338																																																	0													174.0	162.0	166.0					6																	46969278		2203	4300	6503	SO:0001589	frameshift_variant	266977			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2619delA	6.37:g.46969278delT	ENSP00000360299:p.Lys873fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Frame_Shift_Del	DEL	ENST00000371253.2	37	CCDS34471.1																																																																																				0.338	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2		NM_153840	
HHIP	64399	broad.mit.edu	37	4	145568088	145568088	+	Silent	SNP	A	A	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr4:145568088A>C	ENST00000296575.3	+	1	916	c.261A>C	c.(259-261)ctA>ctC	p.L87L	HHIP-AS1_ENST00000508269.1_RNA|HHIP-AS1_ENST00000503066.1_RNA|HHIP-AS1_ENST00000512359.1_RNA|HHIP_ENST00000434550.2_Silent_p.L87L	NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	87					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.L87L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		GCCCGGGGCTAGGGCGCCTGG	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	48.0	47.0					4																	145568088		2203	4300	6503	SO:0001819	synonymous_variant	64399			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.261A>C	4.37:g.145568088A>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Silent	SNP	ENST00000296575.3	37	CCDS3762.1																																																																																				0.632	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2			
HMCN1	83872	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	185984500	185984500	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr1:185984500G>C	ENST00000271588.4	+	31	5069	c.4840G>C	c.(4840-4842)Gca>Cca	p.A1614P	HMCN1_ENST00000367492.2_Missense_Mutation_p.A1614P	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1614	Ig-like C2-type 13.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.A1614P(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCTGATTCAGCAACATATAC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											102.0	99.0	100.0					1																	185984500		2203	4299	6502	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4840G>C	1.37:g.185984500G>C	ENSP00000271588:p.Ala1614Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733224	0.69189	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67865	-0.29;-0.29	5.5	3.58	0.41010	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.159977	0.53938	D	0.000050	T	0.80824	0.4697	M	0.76002	2.32	0.32325	N	0.561873	D	0.89917	1.0	D	0.91635	0.999	D	0.85687	0.1304	10	0.87932	D	0	.	14.8783	0.70513	0.0:0.0:0.7373:0.2627	.	1614	Q96RW7	HMCN1_HUMAN	P	1614	ENSP00000271588:A1614P;ENSP00000356462:A1614P	ENSP00000271588:A1614P	A	+	1	0	HMCN1	184251123	1.000000	0.71417	0.970000	0.41538	0.850000	0.48378	5.853000	0.69496	0.759000	0.33084	-0.188000	0.12872	GCA		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
HNF1B	6928	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	36091725	36091725	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr17:36091725G>C	ENST00000225893.4	-	4	1267	c.906C>G	c.(904-906)aaC>aaG	p.N302K	HNF1B_ENST00000427275.2_Missense_Mutation_p.N276K|HNF1B_ENST00000560016.1_Missense_Mutation_p.N302K|HNF1B_ENST00000561193.1_Missense_Mutation_p.N276K	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	302					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N302K(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CCTTCCTGCGGTTTGCAAACC	0.612																																					Colon(71;102 1179 9001 27917 43397)												2	Substitution - Missense(2)	kidney(2)											140.0	113.0	122.0					17																	36091725		2203	4300	6503	SO:0001583	missense	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.906C>G	17.37:g.36091725G>C	ENSP00000225893:p.Asn302Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKM3|E0YMJ9	Missense_Mutation	SNP	ENST00000225893.4	37	CCDS11324.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366508	0.82463	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.99329	-5.75;-5.75	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.178173	0.64402	D	0.000011	D	0.99309	0.9758	M	0.80616	2.505	0.80722	D	1	D;D;P	0.59357	0.968;0.985;0.891	P;P;B	0.61658	0.791;0.892;0.412	D	0.99208	1.0875	10	0.87932	D	0	-0.2386	17.7156	0.88336	0.0:0.0:1.0:0.0	.	276;302;302	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	K	302;276;302;190	ENSP00000225893:N302K;ENSP00000412212:N276K	ENSP00000225893:N302K	N	-	3	2	HNF1B	33165838	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.334000	0.59291	2.775000	0.95449	0.655000	0.94253	AAC		0.612	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3		NM_000458	
IKBIP	121457	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	99007799	99007799	+	Missense_Mutation	SNP	A	A	G	rs142312833	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr12:99007799A>G	ENST00000342502.2	-	3	1028	c.617T>C	c.(616-618)gTa>gCa	p.V206A	IKBIP_ENST00000420861.1_Missense_Mutation_p.V100A|IKBIP_ENST00000393042.3_3'UTR	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein	206					response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.V206A(1)		NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						ATTTTTTTCTACTTTCTCTAT	0.318													A|||	2	0.000399361	0.0015	0.0	5008	,	,		18510	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						A	ALA/VAL,	4,4398	8.1+/-20.4	0,4,2197	48.0	48.0	48.0		617,	1.7	0.8	12	dbSNP_134	48	0,8594		0,0,4297	yes	missense,utr-3	IKBIP	NM_201612.1,NM_201613.1	64,	0,4,6494	GG,GA,AA		0.0,0.0909,0.0308	,	206/351,	99007799	4,12992	2201	4297	6498	SO:0001583	missense	121457			AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.617T>C	12.37:g.99007799A>G	ENSP00000343471:p.Val206Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	ENST00000342502.2	37	CCDS9067.1	.	.	.	.	.	.	.	.	.	.	A	4.751	0.139642	0.09083	9.09E-4	0.0	ENSG00000166130	ENST00000342502;ENST00000420861	T;T	0.51325	0.75;0.71	5.34	1.69	0.24217	.	.	.	.	.	T	0.23054	0.0557	N	0.17082	0.46	0.20563	N	0.99989	B	0.06786	0.001	B	0.06405	0.002	T	0.29181	-1.0020	9	0.02654	T	1	.	5.0815	0.14659	0.4715:0.1719:0.3567:0.0	.	206	Q70UQ0	IKIP_HUMAN	A	206;100	ENSP00000343471:V206A;ENSP00000398023:V100A	ENSP00000343471:V206A	V	-	2	0	IKBIP	97531930	0.992000	0.36948	0.825000	0.32803	0.843000	0.47879	1.012000	0.29924	0.350000	0.24002	0.533000	0.62120	GTA		0.318	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2		NM_153687	
JAK3	3718	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17952457	17952457	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr19:17952457G>C	ENST00000527670.1	-	6	1005	c.976C>G	c.(976-978)Cag>Gag	p.Q326E	JAK3_ENST00000458235.1_Missense_Mutation_p.Q326E|JAK3_ENST00000526008.1_5'UTR|JAK3_ENST00000534444.1_Missense_Mutation_p.Q326E			P52333	JAK3_HUMAN	Janus kinase 3	326	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.Q326E(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	ACTAAAATCTGGTTGTCTGTC	0.617		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	2	Substitution - Missense(2)	kidney(2)											48.0	54.0	52.0					19																	17952457		2202	4299	6501	SO:0001583	missense	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.976C>G	19.37:g.17952457G>C	ENSP00000432511:p.Gln326Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556525	0.27827	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.58506	0.33;0.33;0.33	4.72	0.83	0.18854	FERM domain (1);	0.582409	0.16222	N	0.224018	T	0.46092	0.1375	L	0.39898	1.24	0.22435	N	0.999101	B;B;B	0.18610	0.014;0.004;0.029	B;B;B	0.16289	0.006;0.015;0.015	T	0.50642	-0.8804	10	0.72032	D	0.01	-20.7379	10.9386	0.47260	0.0:0.0:0.4651:0.5349	.	326;326;326	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	E	326	ENSP00000391676:Q326E;ENSP00000432511:Q326E;ENSP00000436421:Q326E	ENSP00000413248:Q326E	Q	-	1	0	JAK3	17813457	1.000000	0.71417	0.993000	0.49108	0.272000	0.26649	1.073000	0.30691	0.947000	0.37659	0.205000	0.17691	CAG		0.617	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1		NM_000215	
ZSWIM8	23053	hgsc.bcm.edu;ucsc.edu	37	10	75557166	75557168	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr10:75557166_75557168delAAC	ENST00000605216.1	+	18	3667_3669	c.3450_3452delAAC	c.(3448-3453)gaaaca>gaa	p.T1152del	ZSWIM8_ENST00000604729.1_In_Frame_Del_p.T1157del|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000398706.2_In_Frame_Del_p.T1157del|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000603114.1_In_Frame_Del_p.T1119del|ZSWIM8_ENST00000604524.1_In_Frame_Del_p.T1152del	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1152	Ser-rich.						zinc ion binding (GO:0008270)										GTGCCCCTGAAACAACATCGGAT	0.567																																																	0																																										SO:0001651	inframe_deletion	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3450_3452delAAC	10.37:g.75557169_75557171delAAC	ENSP00000474748:p.Thr1152del	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	In_Frame_Del	DEL	ENST00000605216.1	37																																																																																					0.567	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1		NM_001242487	
KISS1R	84634	broad.mit.edu	37	19	918608	918608	+	Silent	SNP	C	C	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr19:918608C>T	ENST00000234371.5	+	2	462	c.309C>T	c.(307-309)taC>taT	p.Y103Y	KISS1R_ENST00000606939.1_Silent_p.Y103Y	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	103					activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)	p.Y103Y(1)		cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTGCTGTACCCGCTGCCCG	0.697																																																	1	Substitution - coding silent(1)	kidney(1)											33.0	21.0	25.0					19																	918608		2089	4121	6210	SO:0001819	synonymous_variant	84634			AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.309C>T	19.37:g.918608C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A5D8U2|B2RTV1|Q96QG0	Silent	SNP	ENST00000234371.5	37	CCDS12049.1																																																																																				0.697	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3		NM_032551	
KRT38	8687	hgsc.bcm.edu	37	17	39595484	39595484	+	Nonsense_Mutation	SNP	G	G	A	rs148768443	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr17:39595484G>A	ENST00000246646.3	-	3	702	c.703C>T	c.(703-705)Cag>Tag	p.Q235*		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	235	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.Q235*(2)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				AGGGAGAGCTGCTCCTCCTTC	0.667																																																	2	Substitution - Nonsense(2)	breast(1)|central_nervous_system(1)											58.0	53.0	54.0					17																	39595484		2203	4298	6501	SO:0001587	stop_gained	8687			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.703C>T	17.37:g.39595484G>A	ENSP00000246646:p.Gln235*	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRM5|Q6A164	Nonsense_Mutation	SNP	ENST00000246646.3	37	CCDS11392.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158641	0.57368	.	.	ENSG00000171360	ENST00000246646	.	.	.	4.31	1.01	0.19927	.	0.526305	0.15723	N	0.247837	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.0787	0.30731	0.0815:0.0:0.5477:0.3708	.	.	.	.	X	235	.	ENSP00000246646:Q235X	Q	-	1	0	KRT38	36849010	0.779000	0.28652	0.994000	0.49952	0.627000	0.37826	0.894000	0.28350	1.013000	0.39391	0.484000	0.47621	CAG		0.667	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2		NM_006771	
MAMLD1	10046	broad.mit.edu;hgsc.bcm.edu	37	X	149639659	149639659	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chrX:149639659A>T	ENST00000370401.2	+	4	2124	c.1814A>T	c.(1813-1815)cAg>cTg	p.Q605L	MAMLD1_ENST00000455522.2_Missense_Mutation_p.Q86L|MAMLD1_ENST00000262858.5_Missense_Mutation_p.Q605L|MAMLD1_ENST00000426613.2_Missense_Mutation_p.Q580L|MAMLD1_ENST00000432680.2_Missense_Mutation_p.Q580L			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	605	Poly-Gln.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q605L(1)|p.Q532L(1)|p.Q580L(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					caacagcagcagcagcCTGAC	0.602																																																	3	Substitution - Missense(3)	kidney(3)											83.0	72.0	76.0					X																	149639659		2203	4300	6503	SO:0001583	missense	10046			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1814A>T	X.37:g.149639659A>T	ENSP00000359428:p.Gln605Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	A	7.723	0.697663	0.15106	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613;ENST00000455522	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3	4.62	2.14	0.27477	.	0.411362	0.20092	U	0.099429	T	0.70613	0.3244	M	0.68952	2.095	0.37689	D	0.923764	P;P;P;B	0.51351	0.9;0.9;0.944;0.13	P;P;P;B	0.52957	0.628;0.628;0.714;0.109	T	0.68769	-0.5321	10	0.31617	T	0.26	-11.1169	10.9504	0.47325	0.6508:0.3492:0.0:0.0	.	477;580;580;605	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	L	477;605;580;605;580;86	ENSP00000359428:Q605L;ENSP00000414517:Q580L;ENSP00000262858:Q605L;ENSP00000397438:Q580L;ENSP00000389106:Q86L	ENSP00000262858:Q605L	Q	+	2	0	MAMLD1	149390317	0.881000	0.30235	0.103000	0.21229	0.289000	0.27227	0.337000	0.19841	0.031000	0.15407	0.158000	0.16466	CAG		0.602	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2		NM_005491	
MBTPS1	8720	hgsc.bcm.edu;ucsc.edu	37	16	84103636	84103636	+	Frame_Shift_Del	DEL	T	T	-	rs201149007		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr16:84103636delT	ENST00000343411.3	-	14	2285	c.1790delA	c.(1789-1791)aatfs	p.N597fs	MBTPS1_ENST00000569770.1_5'Flank	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	597					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TTCTGCACCATTTTTTGACTA	0.383																																																	0													90.0	98.0	96.0					16																	84103636		2200	4300	6500	SO:0001589	frameshift_variant	8720			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1790delA	16.37:g.84103636delT	ENSP00000344223:p.Asn597fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6V8|Q24JQ2|Q9UF67	Frame_Shift_Del	DEL	ENST00000343411.3	37	CCDS10941.1																																																																																				0.383	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2		NM_003791	
MEAF6	64769	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	37975131	37975131	+	Silent	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr1:37975131G>A	ENST00000296214.5	-	3	246	c.219C>T	c.(217-219)agC>agT	p.S73S	MEAF6_ENST00000373075.2_Silent_p.S73S|MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000373074.1_Silent_p.S51S|MEAF6_ENST00000448519.2_Silent_p.S73S|MEAF6_ENST00000373073.4_Silent_p.S73S	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	73					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S73S(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						GATCATTTTTGCTATTGGAGT	0.473																																																	1	Substitution - coding silent(1)	kidney(1)											142.0	141.0	142.0					1																	37975131		2203	4300	6503	SO:0001819	synonymous_variant	64769			BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.219C>T	1.37:g.37975131G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1AK64|Q4F967|Q7Z311|Q86WE3	Silent	SNP	ENST00000296214.5	37	CCDS59196.1																																																																																				0.473	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012161.1		NM_022756	
MICAL1	64780	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	109769530	109769530	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr6:109769530C>A	ENST00000358807.3	-	13	2042	c.1731G>T	c.(1729-1731)gaG>gaT	p.E577D	MICAL1_ENST00000368952.4_Missense_Mutation_p.E596D|MICAL1_ENST00000358577.3_Missense_Mutation_p.E491D	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	577	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.E577D(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CCAGCTCATTCTCTGCCACCT	0.592																																																	1	Substitution - Missense(1)	kidney(1)											173.0	163.0	166.0					6																	109769530		2203	4300	6503	SO:0001583	missense	64780			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1731G>T	6.37:g.109769530C>A	ENSP00000351664:p.Glu577Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.01|17.01	3.278559|3.278559	0.59758|0.59758	.|.	.|.	ENSG00000135596|ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957|ENST00000433205	T;T;T|.	0.62232|.	0.04;0.04;0.04|.	5.38|5.38	-0.227|-0.227	0.13102|0.13102	Calponin homology domain (5);|.	0.059518|0.059518	0.64402|0.64402	D|D	0.000004|0.000004	T|.	0.46541|.	0.1398|.	L|L	0.55990|0.55990	1.75|1.75	0.36886|0.36886	D|D	0.889628|0.889628	P;P;D|.	0.53312|.	0.956;0.949;0.959|.	D;P;D|.	0.70716|.	0.97;0.871;0.921|.	T|.	0.52041|.	-0.8628|.	10|.	0.66056|0.62326	D|D	0.02|0.03	.|.	10.1646|10.1646	0.42873|0.42873	0.0:0.5666:0.0:0.4334|0.0:0.5666:0.0:0.4334	.|.	596;491;577|.	B7Z3R5;Q8TDZ2-2;Q8TDZ2|.	.;.;MICA1_HUMAN|.	D|X	577;596;491;101|139	ENSP00000351664:E577D;ENSP00000357948:E596D;ENSP00000351385:E491D|.	ENSP00000351385:E491D|ENSP00000408924:E139X	E|E	-|-	3|1	2|0	MICAL1|MICAL1	109876223|109876223	0.996000|0.996000	0.38824|0.38824	0.992000|0.992000	0.48379|0.48379	0.399000|0.399000	0.30720|0.30720	0.500000|0.500000	0.22562|0.22562	0.005000|0.005000	0.14708|0.14708	0.561000|0.561000	0.74099|0.74099	GAG|GAA		0.592	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2		NM_022765	
KMT2D	8085	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	49440459	49440459	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr12:49440459T>A	ENST00000301067.7	-	15	4350	c.4351A>T	c.(4351-4353)Agc>Tgc	p.S1451C		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1451	Cys-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.S1178C(1)|p.S1451C(1)									GTGTGGTAGCTAATATCACAG	0.597																																																	2	Substitution - Missense(2)	kidney(2)											91.0	97.0	95.0					12																	49440459		2093	4215	6308	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4351A>T	12.37:g.49440459T>A	ENSP00000301067:p.Ser1451Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.607247	0.46527	.	.	ENSG00000167548	ENST00000301067	T	0.57595	0.39	5.23	5.23	0.72850	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.43919	D	0.000513	T	0.71821	0.3385	M	0.74389	2.26	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.75935	-0.3142	10	0.87932	D	0	.	14.1176	0.65164	0.0:0.0:0.0:1.0	.	1451	O14686	MLL2_HUMAN	C	1451	ENSP00000301067:S1451C	ENSP00000301067:S1451C	S	-	1	0	MLL2	47726726	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.040000	0.89188	1.974000	0.57490	0.533000	0.62120	AGC		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			
Unknown	0	broad.mit.edu	37	1	16976585	16976585	+	IGR	SNP	C	C	T	rs1135350		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr1:16976585C>T								CROCCP2 (15531 upstream) : RNU1-3 (16694 downstream)																							TACGGGGGCCCACTTGCCTGC	0.567																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16976585C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.567									
MXD1	4084	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	70148882	70148882	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:70148882delA	ENST00000264444.2	+	3	448	c.188delA	c.(187-189)gaafs	p.E63fs	MXD1_ENST00000540449.1_Intron	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	63	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						ACTCACAATGAAATGGAGAAG	0.373																																																	0													107.0	96.0	100.0					2																	70148882		2203	4300	6503	SO:0001589	frameshift_variant	4084				CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.188delA	2.37:g.70148882delA	ENSP00000264444:p.Glu63fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Frame_Shift_Del	DEL	ENST00000264444.2	37	CCDS1896.1																																																																																				0.373	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251845.3		NM_002357	
MYOCD	93649	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	12647585	12647585	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr17:12647585A>G	ENST00000343344.4	+	8	803	c.803A>G	c.(802-804)tAc>tGc	p.Y268C	AC005358.1_ENST00000609971.1_Missense_Mutation_p.Y172C|MYOCD_ENST00000425538.1_Missense_Mutation_p.Y268C|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	268					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.Y268C(2)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TATCACCAGTACATTCCCCCA	0.522																																																	2	Substitution - Missense(2)	kidney(2)											122.0	104.0	110.0					17																	12647585		2203	4300	6503	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.803A>G	17.37:g.12647585A>G	ENSP00000341835:p.Tyr268Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158174	0.78114	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	D	0.84730	-1.89	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.92938	0.7753	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.93843	0.7138	10	0.62326	D	0.03	-29.8825	14.3994	0.67031	1.0:0.0:0.0:0.0	.	172;268;268	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	C	268;268;172	ENSP00000341835:Y268C	ENSP00000341835:Y268C	Y	+	2	0	MYOCD	12588310	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.296000	0.96104	2.059000	0.61396	0.459000	0.35465	TAC		0.522	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1		NM_153604	
N4BP1	9683	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	48596270	48596270	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr16:48596270T>G	ENST00000262384.3	-	2	520	c.284A>C	c.(283-285)gAg>gCg	p.E95A	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	95					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)		p.E142A(1)|p.E95A(1)		breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AAACAGGCTCTCTGCCCCAAC	0.438																																																	2	Substitution - Missense(2)	kidney(2)											55.0	56.0	56.0					16																	48596270		1942	4128	6070	SO:0001583	missense	9683			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.284A>C	16.37:g.48596270T>G	ENSP00000262384:p.Glu95Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.134970	0.37728	.	.	ENSG00000102921	ENST00000262384	T	0.42513	0.97	5.45	4.36	0.52297	.	0.113842	0.64402	D	0.000008	T	0.24661	0.0598	N	0.08118	0	0.26785	N	0.969517	B	0.17038	0.02	B	0.16722	0.016	T	0.21518	-1.0243	10	0.72032	D	0.01	-2.2318	11.4499	0.50147	0.0:0.0708:0.0:0.9292	.	95	O75113	N4BP1_HUMAN	A	95	ENSP00000262384:E95A	ENSP00000262384:E95A	E	-	2	0	N4BP1	47153771	1.000000	0.71417	0.982000	0.44146	0.999000	0.98932	5.659000	0.68010	1.013000	0.39391	0.533000	0.62120	GAG		0.438	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1		NM_014664	
NLRP6	171389	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	285235	285235	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr11:285235T>A	ENST00000312165.5	+	8	2610	c.2610T>A	c.(2608-2610)gaT>gaA	p.D870E	RP11-326C3.2_ENST00000525217.1_RNA|RP11-326C3.2_ENST00000533924.1_RNA|RP11-326C3.2_ENST00000534742.1_RNA|NLRP6_ENST00000534750.1_Missense_Mutation_p.D869E	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	870					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)	p.D870E(1)		breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAAAGCCGGATCTGGTCATCA	0.612																																																	1	Substitution - Missense(1)	kidney(1)											85.0	69.0	75.0					11																	285235		2203	4297	6500	SO:0001583	missense	171389			AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.2610T>A	11.37:g.285235T>A	ENSP00000309767:p.Asp870Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	t	0.378	-0.930094	0.02359	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.73469	-0.75;-0.72	2.17	-2.08	0.07254	.	.	.	.	.	T	0.46190	0.1380	N	0.17312	0.475	0.09310	N	1	B;B	0.29037	0.07;0.231	B;B	0.22753	0.041;0.026	T	0.27839	-1.0062	9	0.15952	T	0.53	.	0.6723	0.00861	0.2083:0.1366:0.1824:0.4726	.	869;870	E9PJZ8;P59044	.;NALP6_HUMAN	E	869;870	ENSP00000433617:D869E;ENSP00000309767:D870E	ENSP00000309767:D870E	D	+	3	2	NLRP6	275235	0.000000	0.05858	0.011000	0.14972	0.018000	0.09664	-4.458000	0.00230	-0.519000	0.06444	-0.470000	0.05040	GAT		0.612	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1		NM_138329	
NMNAT3	349565	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	139279898	139279898	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr3:139279898G>T	ENST00000296202.7	-	6	1094	c.713C>A	c.(712-714)aCc>aAc	p.T238N	NMNAT3_ENST00000413939.2_Missense_Mutation_p.T149N|RP11-319G6.1_ENST00000515247.1_RNA|NMNAT3_ENST00000339837.5_Missense_Mutation_p.T201N|NMNAT3_ENST00000511444.1_3'UTR|NMNAT3_ENST00000406164.1_Missense_Mutation_p.T201N|RP11-319G6.1_ENST00000381790.3_RNA|NMNAT3_ENST00000406824.1_Missense_Mutation_p.T128N|NMNAT3_ENST00000507242.1_5'Flank			Q96T66	NMNA3_HUMAN	nicotinamide nucleotide adenylyltransferase 3	238					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)	p.T201N(1)|p.T149N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)	9						GCCTTTCCAGGTACTGCCCTT	0.582																																																	2	Substitution - Missense(2)	kidney(2)											212.0	175.0	188.0					3																	139279898		2203	4300	6503	SO:0001583	missense	349565			AF345564	CCDS3111.1, CCDS56282.1	3q23	2013-09-20			ENSG00000163864	ENSG00000163864			20989	protein-coding gene	gene with protein product		608702				12574164	Standard	NM_178177		Approved	PNAT3	uc003etk.3	Q96T66	OTTHUMG00000159951	ENST00000296202.7:c.713C>A	3.37:g.139279898G>T	ENSP00000296202:p.Thr238Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVR6|D3DNF2|D3DNF3|Q8N4G1	Missense_Mutation	SNP	ENST00000296202.7	37		.	.	.	.	.	.	.	.	.	.	G	12.80	2.045551	0.36085	.	.	ENSG00000163864	ENST00000406164;ENST00000406824;ENST00000339837;ENST00000413939;ENST00000296202	D;D;D;D;D	0.97752	-4.2;-4.52;-4.2;-4.52;-4.42	4.82	3.87	0.44632	.	1.422500	0.04039	N	0.302836	D	0.95220	0.8450	L	0.32530	0.975	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.12837	0.008;0.006	D	0.86130	0.1574	10	0.30078	T	0.28	-4.9701	9.84	0.40993	0.0:0.0:0.7957:0.2043	.	149;238	B3KVR6;Q96T66	.;NMNA3_HUMAN	N	201;128;201;149;238	ENSP00000384319:T201N;ENSP00000384684:T128N;ENSP00000340523:T201N;ENSP00000412953:T149N;ENSP00000296202:T238N	ENSP00000296202:T238N	T	-	2	0	NMNAT3	140762588	0.584000	0.26766	0.231000	0.23993	0.168000	0.22595	2.017000	0.40981	2.399000	0.81585	0.655000	0.94253	ACC		0.582	NMNAT3-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000358469.1		NM_178177	
NPBWR1	2831	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	53853305	53853305	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr8:53853305C>A	ENST00000331251.3	+	1	2315	c.838C>A	c.(838-840)Ccg>Acg	p.P280T		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	280					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)	p.P280T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				CACCGACCTCCCGCAGACGCC	0.642																																																	1	Substitution - Missense(1)	kidney(1)											56.0	44.0	48.0					8																	53853305		2203	4300	6503	SO:0001583	missense	2831			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.838C>A	8.37:g.53853305C>A	ENSP00000330284:p.Pro280Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NTC7	Missense_Mutation	SNP	ENST00000331251.3	37	CCDS6151.1	.	.	.	.	.	.	.	.	.	.	c	23.0	4.362354	0.82353	.	.	ENSG00000183729	ENST00000331251	T	0.71341	-0.56	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000053	D	0.83562	0.5281	M	0.73962	2.25	0.49051	D	0.999744	D	0.69078	0.997	D	0.66602	0.945	D	0.84979	0.0887	10	0.66056	D	0.02	.	18.8759	0.92334	0.0:1.0:0.0:0.0	.	280	P48145	NPBW1_HUMAN	T	280	ENSP00000330284:P280T	ENSP00000330284:P280T	P	+	1	0	NPBWR1	54015858	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.496000	0.53288	2.700000	0.92200	0.556000	0.70494	CCG		0.642	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378047.1		NM_005285	
NPC1	4864	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	21140211	21140211	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr18:21140211C>A	ENST00000269228.5	-	6	1419	c.865G>T	c.(865-867)Gca>Tca	p.A289S	NPC1_ENST00000412552.2_Missense_Mutation_p.A22S|NPC1_ENST00000540608.1_5'UTR	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	289					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)	p.A289S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CACCACACTGCAAAAAATGCT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											112.0	105.0	108.0					18																	21140211		2203	4300	6503	SO:0001583	missense	4864			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.865G>T	18.37:g.21140211C>A	ENSP00000269228:p.Ala289Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971038	0.34754	.	.	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.93189	-3.18;-3.1	5.67	4.61	0.57282	.	0.291406	0.36703	N	0.002452	D	0.85470	0.5704	N	0.11201	0.11	0.22389	N	0.999144	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.007	T	0.70011	-0.4989	10	0.22109	T	0.4	-19.0322	15.5079	0.75757	0.0:0.9227:0.0:0.0773	.	300;289	Q59GR1;O15118	.;NPC1_HUMAN	S	289;22;134	ENSP00000269228:A289S;ENSP00000408606:A22S	ENSP00000269228:A289S	A	-	1	0	NPC1	19394209	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.028000	0.57246	2.679000	0.91253	0.655000	0.94253	GCA		0.463	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2		NM_000271	
TENM4	26011	hgsc.bcm.edu	37	11	78523290	78523291	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr11:78523290_78523291insC	ENST00000278550.7	-	14	2316_2317	c.1854_1855insG	c.(1852-1857)tggaaafs	p.K619fs		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	619	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TCAGCGCCTTTCCAGCCACTGT	0.594																																																	0																																										SO:0001589	frameshift_variant	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.1855dupG	11.37:g.78523292_78523292dupC	ENSP00000278550:p.Lys619fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Frame_Shift_Ins	INS	ENST00000278550.7	37	CCDS44688.1																																																																																				0.594	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			
OTOF	9381	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	26698883	26698883	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:26698883C>A	ENST00000272371.2	-	24	3016	c.2890G>T	c.(2890-2892)Gcg>Tcg	p.A964S	OTOF_ENST00000402415.3_Missense_Mutation_p.A274S|OTOF_ENST00000338581.6_Missense_Mutation_p.A217S|OTOF_ENST00000339598.3_Missense_Mutation_p.A217S|OTOF_ENST00000403946.3_Missense_Mutation_p.A964S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	964	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.		A -> E (in AUNB1). {ECO:0000269|PubMed:18381613}.		membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.A217S(1)|p.A274S(1)|p.A964S(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACATGTGCGCTCGGAGCTGG	0.642																																					GBM(102;732 1451 20652 24062 31372)												3	Substitution - Missense(3)	kidney(3)											42.0	38.0	40.0					2																	26698883		2201	4298	6499	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2890G>T	2.37:g.26698883C>A	ENSP00000272371:p.Ala964Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	33	5.245146	0.95272	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.41	5.41	0.78517	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.046345	0.85682	D	0.000000	D	0.83362	0.5238	M	0.84846	2.72	0.80722	D	1	D;D;D;P	0.69078	0.975;0.997;0.995;0.915	P;D;P;P	0.66497	0.842;0.944;0.886;0.773	D	0.85426	0.1146	10	0.59425	D	0.04	-36.0976	18.7824	0.91939	0.0:1.0:0.0:0.0	.	964;217;274;217	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	S	217;217;274;964;964	ENSP00000345137:A217S;ENSP00000344521:A217S;ENSP00000383906:A274S;ENSP00000272371:A964S;ENSP00000385255:A964S	ENSP00000272371:A964S	A	-	1	0	OTOF	26552387	0.993000	0.37304	0.824000	0.32777	0.972000	0.66771	4.803000	0.62546	2.546000	0.85860	0.561000	0.74099	GCG		0.642	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			
PARD6B	84612	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	49367001	49367001	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr20:49367001A>T	ENST00000371610.2	+	3	1338	c.1095A>T	c.(1093-1095)gaA>gaT	p.E365D	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	365					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.E365D(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						TCTTAGAAGAAGATGGAACAA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											48.0	46.0	46.0					20																	49367001		2203	4300	6503	SO:0001583	missense	84612			AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.1095A>T	20.37:g.49367001A>T	ENSP00000360672:p.Glu365Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	37	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.448405	0.84101	.	.	ENSG00000124171	ENST00000371610	T	0.23552	1.9	5.73	-1.8	0.07907	.	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	M	0.77820	2.39	0.80722	D	1	D	0.63880	0.993	D	0.70016	0.967	T	0.31503	-0.9941	10	0.52906	T	0.07	-32.9314	11.0173	0.47696	0.6111:0.0:0.3889:0.0	.	365	Q9BYG5	PAR6B_HUMAN	D	365	ENSP00000360672:E365D	ENSP00000360672:E365D	E	+	3	2	PARD6B	48800408	1.000000	0.71417	0.867000	0.34043	0.861000	0.49209	0.941000	0.29005	-0.650000	0.05423	0.482000	0.46254	GAA		0.383	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2		NM_032521	
PBRM1	55193	broad.mit.edu;ucsc.edu	37	3	52692235	52692235	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr3:52692235G>A	ENST00000296302.7	-	5	626	c.625C>T	c.(625-627)Cag>Tag	p.Q209*	PBRM1_ENST00000394830.3_Nonsense_Mutation_p.Q209*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.Q209*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.Q209*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.Q209*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.Q209*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.Q209*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.Q209*			Q86U86	PB1_HUMAN	polybromo 1	209	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q209*(6)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGCAGTTTCTGAAAAAGTTCG	0.378			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	6	Substitution - Nonsense(6)	kidney(6)											93.0	92.0	92.0					3																	52692235		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.625C>T	3.37:g.52692235G>A	ENSP00000296302:p.Gln209*	Somatic		WXS	Illumina GAIIx	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	36	5.691022	0.96793	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103;ENST00000431678	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-0.8984	18.8333	0.92150	0.0:0.0:1.0:0.0	.	.	.	.	X	209;209;209;209;209;209;209;209;209;153;209	.	ENSP00000296302:Q209X	Q	-	1	0	PBRM1	52667275	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.312000	0.96287	2.447000	0.82792	0.644000	0.83932	CAG		0.378	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
POLI	11201	hgsc.bcm.edu;ucsc.edu	37	18	51809374	51809374	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr18:51809374delG	ENST00000579534.1	+	6	1107	c.964delG	c.(964-966)ggafs	p.G322fs	POLI_ENST00000406285.3_Frame_Shift_Del_p.G243fs|POLI_ENST00000217800.5_Frame_Shift_Del_p.G196fs|POLI_ENST00000579434.1_Frame_Shift_Del_p.G219fs	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	322					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		GATACTCTCAGGACCACCTCA	0.338								DNA polymerases (catalytic subunits)																																									0													45.0	43.0	44.0					18																	51809374		2203	4300	6503	SO:0001589	frameshift_variant	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.964delG	18.37:g.51809374delG	ENSP00000462664:p.Gly322fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N590|Q9H0S1|Q9NYH6	Frame_Shift_Del	DEL	ENST00000579534.1	37	CCDS11954.2																																																																																				0.338	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3		NM_007195	
POLM	27434	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	44118355	44118355	+	Missense_Mutation	SNP	C	C	A	rs151259046		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr7:44118355C>A	ENST00000242248.5	-	5	799	c.698G>T	c.(697-699)aGg>aTg	p.R233M	POLM_ENST00000395831.3_Splice_Site_p.R233M|POLM_ENST00000492971.1_5'Flank|POLM_ENST00000335195.6_Missense_Mutation_p.R233M	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	233					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.R233M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GGTCTGGTACCTCTCTGAGCG	0.612								DNA polymerases (catalytic subunits)																																									1	Substitution - Missense(1)	kidney(1)											149.0	101.0	117.0					7																	44118355		2203	4300	6503	SO:0001583	missense	27434			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.698G>T	7.37:g.44118355C>A	ENSP00000242248:p.Arg233Met	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	37	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725736	0.69074	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831	T;T;T	0.45668	2.33;0.89;1.48	5.91	5.91	0.95273	DNA-directed DNA polymerase X (1);DNA polymerase lambda, fingers domain (1);	0.096296	0.64402	D	0.000001	T	0.63768	0.2539	M	0.67397	2.05	0.47547	D	0.99945	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.951;0.989;0.999;0.971;0.968	T	0.64841	-0.6312	10	0.87932	D	0	-38.628	15.7858	0.78300	0.0:1.0:0.0:0.0	.	200;233;233;233;233	B4DG75;Q6PIY2;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;DPOLM_HUMAN	M	233	ENSP00000335141:R233M;ENSP00000242248:R233M;ENSP00000379174:R233M	ENSP00000242248:R233M	R	-	2	0	POLM	44084880	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.838000	0.55828	2.803000	0.96430	0.650000	0.86243	AGG		0.612	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1		NM_013284	
PRPF39	55015	broad.mit.edu;hgsc.bcm.edu	37	14	45581684	45581684	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr14:45581684A>C	ENST00000355765.6	+	11	1906	c.1736A>C	c.(1735-1737)gAt>gCt	p.D579A	SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	579					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.D458A(1)|p.D579A(1)		breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						TTTCTTGAAGATTTTGGTTCC	0.269																																																	2	Substitution - Missense(2)	kidney(2)											37.0	41.0	39.0					14																	45581684		2199	4291	6490	SO:0001583	missense	55015			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1736A>C	14.37:g.45581684A>C	ENSP00000348010:p.Asp579Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	37	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.292550	0.80914	.	.	ENSG00000185246	ENST00000355765	T	0.34472	1.36	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.59197	0.2176	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.965;0.975	T	0.58470	-0.7631	10	0.19590	T	0.45	-20.9908	14.6176	0.68560	1.0:0.0:0.0:0.0	.	183;579	Q86UA1-2;Q86UA1	.;PRP39_HUMAN	A	579	ENSP00000348010:D579A	ENSP00000348010:D579A	D	+	2	0	PRPF39	44651434	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.664000	0.91139	2.131000	0.65755	0.383000	0.25322	GAT		0.269	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2			
RIMS1	22999	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	72960119	72960119	+	Silent	SNP	T	T	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr6:72960119T>A	ENST00000521978.1	+	13	2328	c.2328T>A	c.(2326-2328)cgT>cgA	p.R776R	RIMS1_ENST00000491071.2_Silent_p.R776R|RIMS1_ENST00000517960.1_Silent_p.R776R|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000348717.5_Silent_p.R776R|RIMS1_ENST00000520567.1_Silent_p.R776R|RIMS1_ENST00000264839.7_Silent_p.R776R|RIMS1_ENST00000518273.1_Silent_p.R776R|RIMS1_ENST00000517827.1_Silent_p.R235R|RIMS1_ENST00000401910.3_Silent_p.R250R|RIMS1_ENST00000522291.1_Silent_p.R776R|RIMS1_ENST00000425662.2_Silent_p.R169R|RIMS1_ENST00000523963.1_Silent_p.R250R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	776	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.R776R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TAGATGGACGTCCTCGAAATC	0.353																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	71.0	73.0					6																	72960119		1839	4088	5927	SO:0001819	synonymous_variant	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2328T>A	6.37:g.72960119T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	T	8.771	0.925870	0.18056	.	.	ENSG00000079841	ENST00000517433	.	.	.	5.28	-2.73	0.05950	.	.	.	.	.	T	0.26268	0.0641	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35076	-0.9803	4	.	.	.	-15.9688	4.0115	0.09624	0.092:0.2367:0.4319:0.2394	.	.	.	.	T	350	.	.	S	+	1	0	RIMS1	73016840	0.404000	0.25328	0.997000	0.53966	0.710000	0.40934	-0.319000	0.08039	-0.145000	0.11294	-0.334000	0.08254	TCC		0.353	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			
SELENBP1	8991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151342244	151342244	+	Splice_Site	SNP	A	A	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr1:151342244A>C	ENST00000368868.5	-	2	97	c.6T>G	c.(4-6)gcT>gcG	p.A2A	SELENBP1_ENST00000426705.2_Silent_p.A44A|SELENBP1_ENST00000447402.3_Splice_Site_p.A2A|SELENBP1_ENST00000473693.1_5'UTR|SELENBP1_ENST00000435071.1_5'UTR	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1	2					protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)	p.A2A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACATTTCGTAGCTGTGGAAG	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											53.0	44.0	47.0					1																	151342244		2142	4151	6293	SO:0001630	splice_region_variant	8991			U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.5-1T>G	1.37:g.151342244A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Silent	SNP	ENST00000368868.5	37	CCDS995.1	.	.	.	.	.	.	.	.	.	.	A	9.580	1.123296	0.20959	.	.	ENSG00000143416	ENST00000424475	.	.	.	4.56	-1.15	0.09709	.	.	.	.	.	T	0.22742	0.0549	.	.	.	0.51767	D	0.999939	.	.	.	.	.	.	T	0.27088	-1.0084	4	.	.	.	-1.3796	1.2893	0.02057	0.3326:0.1602:0.35:0.1573	.	.	.	.	R	25	.	.	L	-	2	0	SELENBP1	149608868	0.007000	0.16637	0.100000	0.21137	0.244000	0.25665	-0.784000	0.04633	-0.216000	0.10048	0.379000	0.24179	CTA		0.607	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034904.4			Silent
SFXN4	119559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	120900805	120900805	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr10:120900805T>A	ENST00000355697.2	-	14	982	c.963A>T	c.(961-963)aaA>aaT	p.K321N	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.K312N	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	321					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.K321N(1)		central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		GAGACTGAATTTTCTCTTCAA	0.338																																																	1	Substitution - Missense(1)	kidney(1)											141.0	145.0	144.0					10																	120900805		2203	4300	6503	SO:0001583	missense	119559				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.963A>T	10.37:g.120900805T>A	ENSP00000347924:p.Lys321Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6WSU4|Q86TD9	Missense_Mutation	SNP	ENST00000355697.2	37	CCDS7610.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.465316	0.43839	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875	T;T	0.30714	1.52;1.52	4.95	-2.27	0.06846	.	0.356315	0.27294	N	0.020029	T	0.16428	0.0395	L	0.36672	1.1	0.28805	N	0.898537	P	0.34864	0.473	B	0.34991	0.193	T	0.12218	-1.0556	10	0.72032	D	0.01	-3.205	0.2338	0.00183	0.2782:0.1936:0.1441:0.3841	.	321	Q6P4A7	SFXN4_HUMAN	N	321;312;204	ENSP00000347924:K321N;ENSP00000333200:K312N	ENSP00000333200:K312N	K	-	3	2	SFXN4	120890795	0.531000	0.26338	0.843000	0.33291	0.011000	0.07611	-0.437000	0.06914	-0.628000	0.05582	-0.309000	0.09137	AAA		0.338	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3		XM_058406	
SIRPB2	284759	broad.mit.edu;hgsc.bcm.edu	37	20	1460664	1460664	+	Silent	SNP	G	G	T	rs376849298		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr20:1460664G>T	ENST00000359801.3	-	2	168	c.132C>A	c.(130-132)ccC>ccA	p.P44P	SIRPB2_ENST00000444444.2_Silent_p.P44P|SIRPB2_ENST00000537284.1_5'UTR|SIRPB2_ENST00000608747.1_5'UTR	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	37	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P44P(1)|p.P143P(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGGGGCCCTCGGGCTGTAGCA	0.547																																																	2	Substitution - coding silent(2)	kidney(2)											41.0	40.0	40.0					20																	1460664		1568	3582	5150	SO:0001819	synonymous_variant	284759			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.132C>A	20.37:g.1460664G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000359801.3	37	CCDS42849.1																																																																																				0.547	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077544.1		NM_178459	
SLC35F5	80255	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	114500419	114500419	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:114500419C>A	ENST00000245680.2	-	7	1013	c.600G>T	c.(598-600)atG>atT	p.M200I	SLC35F5_ENST00000409342.1_Missense_Mutation_p.M194I	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	200					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.M200I(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						GTCGAATCTCCATGATATTAC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											129.0	119.0	122.0					2																	114500419		2203	4300	6503	SO:0001583	missense	80255			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.600G>T	2.37:g.114500419C>A	ENSP00000245680:p.Met200Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H6P8|Q9H7D8	Missense_Mutation	SNP	ENST00000245680.2	37	CCDS2119.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735372	0.69189	.	.	ENSG00000115084	ENST00000245680;ENST00000409106;ENST00000409342	T;T	0.45276	0.9;0.91	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.42426	0.1202	L	0.38175	1.15	0.58432	D	0.999994	D;P;P	0.59357	0.985;0.885;0.779	P;P;B	0.48795	0.543;0.59;0.262	T	0.08472	-1.0720	10	0.19590	T	0.45	-16.6553	18.9114	0.92487	0.0:1.0:0.0:0.0	.	200;194;200	B2RDY0;B8ZZV6;Q8WV83	.;.;S35F5_HUMAN	I	200;194;194	ENSP00000245680:M200I;ENSP00000386754:M194I	ENSP00000245680:M200I	M	-	3	0	SLC35F5	114216889	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.010000	0.76353	2.772000	0.95346	0.655000	0.94253	ATG		0.388	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1		NM_025181	
SON	6651	hgsc.bcm.edu	37	21	34925612	34925635	+	In_Frame_Del	DEL	GTCCTGGAGTCTTCGGCTGTGACC	GTCCTGGAGTCTTCGGCTGTGACC	-	rs140276173|rs550454473|rs113673546	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	GTCCTGGAGTCTTCGGCTGTGACC	GTCCTGGAGTCTTCGGCTGTGACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr21:34925612_34925635delGTCCTGGAGTCTTCGGCTGTGACC	ENST00000356577.4	+	3	4550_4573	c.4075_4098delGTCCTGGAGTCTTCGGCTGTGACC	c.(4075-4098)gtcctggagtcttcggctgtgaccdel	p.VLESSAVT1359del	SON_ENST00000290239.6_In_Frame_Del_p.VLESSAVT1359del|SON_ENST00000381679.4_In_Frame_Del_p.VLESSAVT1359del|SON_ENST00000300278.4_In_Frame_Del_p.VLESSAVT1359del|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1359	4 X 8 AA tandem repeats of V-L-E-SS- [AVT]-VT.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AGCTATGGCTGTCCTGGAGTCTTCGGCTGTGACCGTCCTGGAGT	0.571																																																	0									,	21,4243		0,21,2111					,	-0.6	0.0			44	100,8154		0,100,4027	no	coding,coding	SON	NM_138927.1,NM_032195.1	,	0,121,6138	A1A1,A1R,RR		1.2115,0.4925,0.9666	,	,		121,12397				SO:0001651	inframe_deletion	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4075_4098delGTCCTGGAGTCTTCGGCTGTGACC	21.37:g.34925612_34925635delGTCCTGGAGTCTTCGGCTGTGACC	ENSP00000348984:p.Val1359_Thr1366del	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	In_Frame_Del	DEL	ENST00000356577.4	37	CCDS13629.1																																																																																				0.571	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2		NM_138927	
SRCAP	10847	broad.mit.edu	37	16	30750868	30750868	+	Silent	SNP	A	A	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr16:30750868A>G	ENST00000262518.4	+	34	9892	c.9507A>G	c.(9505-9507)gtA>gtG	p.V3169V	SRCAP_ENST00000395059.2_Silent_p.V3107V|SRCAP_ENST00000344771.4_Silent_p.V3011V|RP11-2C24.4_ENST00000483578.1_lincRNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	3169					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.V3169V(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGGGTTCAGTAGAGGAGTCTG	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											10.0	13.0	12.0					16																	30750868		2182	4280	6462	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.9507A>G	16.37:g.30750868A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				0.677	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1		NM_006662	
SREK1	140890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	65465917	65465917	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr5:65465917A>T	ENST00000380918.3	+	9	1352	c.692A>T	c.(691-693)gAc>gTc	p.D231V	SREK1_ENST00000334121.6_Missense_Mutation_p.D347V|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	231	Arg/Glu/Lys/Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D231V(1)|p.D347V(1)		breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						AGACAGAAAGACAGACGTAGA	0.348																																					GBM(10;31 347 27684 38976 41583)												2	Substitution - Missense(2)	kidney(2)											47.0	46.0	47.0					5																	65465917		2203	4300	6503	SO:0001583	missense	140890			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.692A>T	5.37:g.65465917A>T	ENSP00000370305:p.Asp231Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4FTW3|Q2M1J0|Q86X37	Missense_Mutation	SNP	ENST00000380918.3	37	CCDS3991.1	.	.	.	.	.	.	.	.	.	.	A	17.90	3.500885	0.64298	.	.	ENSG00000153914	ENST00000334121;ENST00000537482;ENST00000380918	T;T	0.11063	2.81;2.81	5.52	5.52	0.82312	.	0.432388	0.27306	N	0.019974	T	0.16171	0.0389	L	0.46157	1.445	0.80722	D	1	P;P;P	0.51791	0.89;0.89;0.948	B;B;P	0.46850	0.419;0.419;0.529	T	0.00690	-1.1608	10	0.49607	T	0.09	.	15.6198	0.76796	1.0:0.0:0.0:0.0	.	231;231;347	Q69YM5;Q8WXA9;Q8WXA9-2	.;SREK1_HUMAN;.	V	347;347;231	ENSP00000334538:D347V;ENSP00000370305:D231V	ENSP00000334538:D347V	D	+	2	0	SREK1	65501673	1.000000	0.71417	0.981000	0.43875	0.906000	0.53458	7.103000	0.77014	2.086000	0.62901	0.477000	0.44152	GAC		0.348	SREK1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381118.1		NM_001077199	
STK31	56164	broad.mit.edu	37	7	23749854	23749854	+	5'UTR	SNP	C	C	T	rs371224425|rs199961424		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr7:23749854C>T	ENST00000355870.3	+	0	69				STK31_ENST00000354639.3_5'Flank|STK31_ENST00000433467.2_5'Flank|STK31_ENST00000428484.1_5'Flank	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31							acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GAAGCTCACGCGGTAAGCCGC	0.657																																																	0								C	,	0,4406		0,0,2203	94.0	78.0	84.0		,	-0.2	0.1	7		84	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,utr-5	STK31	NM_001122833.1,NM_031414.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,	23749854	1,13005	2203	4300	6503	SO:0001623	5_prime_UTR_variant	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.-51C>T	7.37:g.23749854C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	5'UTR	SNP	ENST00000355870.3	37	CCDS5386.1																																																																																				0.657	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2		NM_031414	
TLR5	7100	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	223285445	223285445	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr1:223285445G>A	ENST00000540964.1	-	4	1390	c.929C>T	c.(928-930)aCa>aTa	p.T310I	TLR5_ENST00000342210.6_Missense_Mutation_p.T310I			O60602	TLR5_HUMAN	toll-like receptor 5	310					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)	p.T310I(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		ATCCTTGAGTGTCTCAAAGAC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											85.0	84.0	84.0					1																	223285445		2203	4300	6503	SO:0001583	missense	7100				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.929C>T	1.37:g.223285445G>A	ENSP00000440643:p.Thr310Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	37	CCDS31033.1	.	.	.	.	.	.	.	.	.	.	G	5.494	0.276064	0.10403	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	T;T;T	0.24538	1.85;1.85;1.85	5.27	1.2	0.21068	.	0.832928	0.11066	N	0.603429	T	0.16300	0.0392	L	0.29908	0.895	0.09310	N	1	B	0.22003	0.063	B	0.27170	0.077	T	0.33163	-0.9879	10	0.41790	T	0.15	.	1.9186	0.03302	0.1496:0.2959:0.3317:0.2227	.	310	O60602	TLR5_HUMAN	I	310	ENSP00000440643:T310I;ENSP00000355846:T310I;ENSP00000340089:T310I	ENSP00000340089:T310I	T	-	2	0	TLR5	221352068	0.000000	0.05858	0.009000	0.14445	0.260000	0.26232	0.739000	0.26173	-0.035000	0.13691	-0.150000	0.13652	ACA		0.443	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_003268	
TMEM105	284186	hgsc.bcm.edu;ucsc.edu	37	17	79288241	79288241	+	Frame_Shift_Del	DEL	C	C	-	rs201571116		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr17:79288241delC	ENST00000332900.1	-	2	571	c.22delG	c.(22-24)gcgfs	p.A8fs		NM_178520.3	NP_848615.1	Q8N8V8	TM105_HUMAN	transmembrane protein 105	8						integral component of membrane (GO:0016021)				NS(1)|large_intestine(3)|lung(1)|ovary(2)	7	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)			TTCAAGGACGCCCTCCTCACC	0.647																																																	0													52.0	41.0	45.0					17																	79288241		2200	4298	6498	SO:0001589	frameshift_variant	284186			AK096111	CCDS11781.1	17q25.3	2008-04-21	2008-04-21	2008-04-21		ENSG00000185332			26794	protein-coding gene	gene with protein product							Standard	NM_178520		Approved	FLJ38792	uc002kad.2	Q8N8V8		ENST00000332900.1:c.22delG	17.37:g.79288241delC	ENSP00000329795:p.Ala8fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000332900.1	37	CCDS11781.1																																																																																				0.647	TMEM105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439607.1		NM_178520	
TMEM44	93109	broad.mit.edu	37	3	194338403	194338403	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr3:194338403G>C	ENST00000392432.2	-	6	920	c.715C>G	c.(715-717)Cga>Gga	p.R239G	TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000347147.4_Intron|TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000381975.3_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	239						integral component of membrane (GO:0016021)		p.R239G(1)		breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		gcagcggctcgccaatgtccg	0.592																																																	1	Substitution - Missense(1)	kidney(1)											33.0	46.0	42.0					3																	194338403		692	1591	2283	SO:0001583	missense	93109			AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.715C>G	3.37:g.194338403G>C	ENSP00000376227:p.Arg239Gly	Somatic		WXS	Illumina GAIIx	Phase_I	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	37	CCDS54699.1	.	.	.	.	.	.	.	.	.	.	G	1.400	-0.578387	0.03854	.	.	ENSG00000145014	ENST00000392432	T	0.23950	1.88	2.03	-3.59	0.04583	.	.	.	.	.	T	0.09774	0.0240	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29971	-0.9994	9	0.23891	T	0.37	.	4.612	0.12408	0.3767:0.181:0.4423:0.0	.	239	Q2T9K0	TMM44_HUMAN	G	239	ENSP00000376227:R239G	ENSP00000376227:R239G	R	-	1	2	TMEM44	195819692	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.153000	0.01287	-1.167000	0.02779	-3.145000	0.00059	CGA		0.592	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1		NM_138399	
TTBK1	84630	hgsc.bcm.edu	37	6	43221356	43221356	+	Silent	SNP	G	G	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr6:43221356G>T	ENST00000259750.4	+	5	464	c.381G>T	c.(379-381)acG>acT	p.T127T	TTBK1_ENST00000304139.5_Silent_p.T76T	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	127	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T127T(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GCACCTTCACGCTGAGCACCA	0.637																																																	1	Substitution - coding silent(1)	lung(1)											50.0	41.0	44.0					6																	43221356		2203	4300	6503	SO:0001819	synonymous_variant	84630			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.381G>T	6.37:g.43221356G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	CCDS34455.1																																																																																				0.637	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			
TUBGCP2	10844	broad.mit.edu;hgsc.bcm.edu	37	10	135101707	135101707	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr10:135101707G>A	ENST00000252936.3	-	10	1687	c.1648C>T	c.(1648-1650)Cgc>Tgc	p.R550C	TUBGCP2_ENST00000543663.1_Missense_Mutation_p.R578C|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.R420C|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.R550C|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.R143C			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	550					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.R550C(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCTTCCAGGCGAGGGGGCGTG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											61.0	59.0	59.0					10																	135101707		2203	4300	6503	SO:0001583	missense	10844			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1648C>T	10.37:g.135101707G>A	ENSP00000252936:p.Arg550Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	g	19.26	3.792428	0.70452	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1	5.29	4.33	0.51752	.	0.053523	0.64402	D	0.000001	T	0.31979	0.0814	M	0.88105	2.93	0.54753	D	0.999987	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.68353	0.928;0.957;0.957	T	0.11916	-1.0568	10	0.72032	D	0.01	-26.9709	12.9584	0.58442	0.0:0.0:0.7716:0.2284	.	578;578;550	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	C	550;420;550;143;578	ENSP00000252936:R550C;ENSP00000395666:R420C;ENSP00000357551:R550C;ENSP00000357550:R143C;ENSP00000446093:R578C	ENSP00000252936:R550C	R	-	1	0	TUBGCP2	134951697	0.995000	0.38212	0.974000	0.42286	0.756000	0.42949	2.224000	0.42945	2.658000	0.90341	0.550000	0.68814	CGC		0.662	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1			
UNC45B	146862	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	33498340	33498340	+	Splice_Site	SNP	G	G	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr17:33498340G>C	ENST00000268876.5	+	13	1792		c.e13-1		UNC45B_ENST00000591048.1_Splice_Site|UNC45B_ENST00000433649.1_Splice_Site|UNC45B_ENST00000394570.2_Splice_Site|UNC45B_ENST00000378449.1_Splice_Site	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)						cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.?(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GTGCCTTCCAGACCAGTGACA	0.572											OREG0024327	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Unknown(1)	kidney(1)											116.0	95.0	102.0					17																	33498340		2203	4300	6503	SO:0001630	splice_region_variant	146862			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1696-1G>C	17.37:g.33498340G>C		Somatic	840	WXS	Illumina HiSeq	Phase_I	Q495Q8|Q495Q9	Splice_Site	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	G	34	5.318869	0.95682	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3504	0.94381	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC45B	30522453	1.000000	0.71417	0.998000	0.56505	0.720000	0.41350	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	.		0.572	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2		NM_173167	Intron
VNN1	8876	hgsc.bcm.edu	37	6	133015270	133015272	+	In_Frame_Del	DEL	GTT	GTT	-	rs2272996	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	GTT	GTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr6:133015270_133015272delGTT	ENST00000367928.4	-	3	404_406	c.391_393delAAC	c.(391-393)aacdel	p.N131del		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	131	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.		N -> S (in dbSNP:rs2272996). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.4}.		acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)			NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		CATAGATAGAGTTGTTCTTGGCC	0.438																																																	0																																										SO:0001651	inframe_deletion	8876			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.391_393delAAC	6.37:g.133015273_133015275delGTT	ENSP00000356905:p.Asn131del	Somatic		WXS	Illumina HiSeq	Phase_I	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	In_Frame_Del	DEL	ENST00000367928.4	37	CCDS5159.1																																																																																				0.438	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1			
WDR25	79446	broad.mit.edu;hgsc.bcm.edu	37	14	100996232	100996232	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr14:100996232G>T	ENST00000335290.6	+	7	1715	c.1489G>T	c.(1489-1491)Gtc>Ttc	p.V497F	WDR25_ENST00000557502.1_3'UTR|WDR25_ENST00000542471.2_Missense_Mutation_p.V240F|WDR25_ENST00000554998.1_Missense_Mutation_p.V497F|WDR25_ENST00000402312.3_Missense_Mutation_p.V497F	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	497								p.V497F(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				CGATGGCCGGGTCCTGATGTA	0.662																																																	1	Substitution - Missense(1)	kidney(1)											73.0	70.0	71.0					14																	100996232		2203	4300	6503	SO:0001583	missense	79446			BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.1489G>T	14.37:g.100996232G>T	ENSP00000334148:p.Val497Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	37	CCDS32157.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991272	0.74703	.	.	ENSG00000176473	ENST00000554998;ENST00000402312;ENST00000335290;ENST00000542471	T;T;T;T	0.01767	4.65;4.65;4.65;4.65	4.83	2.98	0.34508	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.402817	0.24321	N	0.039555	T	0.08714	0.0216	M	0.89030	3	0.45567	D	0.998515	P;D	0.53462	0.874;0.96	P;P	0.56648	0.466;0.803	T	0.00819	-1.1553	10	0.72032	D	0.01	-11.5456	10.2283	0.43238	0.168:0.0:0.832:0.0	.	240;497	Q64LD2-2;Q64LD2	.;WDR25_HUMAN	F	497;497;497;240	ENSP00000450661:V497F;ENSP00000385540:V497F;ENSP00000334148:V497F;ENSP00000441903:V240F	ENSP00000334148:V497F	V	+	1	0	WDR25	100065985	0.978000	0.34361	0.652000	0.29579	0.965000	0.64279	2.582000	0.46085	0.558000	0.29135	0.655000	0.94253	GTC		0.662	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1		NM_024515	
WDR73	84942	hgsc.bcm.edu	37	15	85186892	85186892	+	Missense_Mutation	SNP	C	C	T	rs11267906|rs372798651|rs199676984	byFrequency	TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr15:85186892C>T	ENST00000434634.2	-	8	1006	c.946G>A	c.(946-948)Gga>Aga	p.G316R	SCAND2P_ENST00000348993.5_RNA|WDR73_ENST00000398528.3_5'UTR	NM_032856.2	NP_116245.2	Q6P4I2	WDR73_HUMAN	WD repeat domain 73	316										cervix(1)|large_intestine(1)|lung(1)	3						CTCCGTGTTCCATCTTGGCTC	0.502																																																	0													99.0	98.0	98.0					15																	85186892		2049	4178	6227	SO:0001583	missense	84942			AK027200	CCDS45339.1	15q25.2	2013-01-09				ENSG00000177082		"""WD repeat domain containing"""	25928	protein-coding gene	gene with protein product						12477932	Standard	NM_032856		Approved	FLJ14888, HSPC264	uc002bkw.2	Q6P4I2		ENST00000434634.2:c.946G>A	15.37:g.85186892C>T	ENSP00000387982:p.Gly316Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q96JZ1|Q9P0B7	Missense_Mutation	SNP	ENST00000434634.2	37	CCDS45339.1	.	.	.	.	.	.	.	.	.	.	c	3.859	-0.030219	0.07543	.	.	ENSG00000177082	ENST00000398528;ENST00000434634	T	0.28895	1.59	.	.	.	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.14399	0.0348	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.16722	0.016	T	0.24261	-1.0165	7	0.72032	D	0.01	.	.	.	.	.	316	Q6P4I2	WDR73_HUMAN	R	324;316	ENSP00000387982:G316R	ENSP00000381539:G324R	G	-	1	0	WDR73	82987896	.	.	0.029000	0.17559	0.086000	0.17979	.	.	0.064000	0.16427	0.064000	0.15345	GGA		0.502	WDR73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418195.1		NM_032856	
WIPF2	147179	broad.mit.edu;ucsc.edu	37	17	38420798	38420798	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr17:38420798A>G	ENST00000323571.4	+	5	610	c.370A>G	c.(370-372)Agg>Ggg	p.R124G	WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000585043.1_Missense_Mutation_p.R124G|WIPF2_ENST00000583130.1_Missense_Mutation_p.R124G|WIPF2_ENST00000494757.1_3'UTR	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	124					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.R124G(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						TGCTGCCCCAAGGCCTCCAGT	0.577										HNSCC(43;0.11)																																							1	Substitution - Missense(1)	kidney(1)											58.0	67.0	64.0					17																	38420798		2203	4300	6503	SO:0001583	missense	147179			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.370A>G	17.37:g.38420798A>G	ENSP00000320924:p.Arg124Gly	Somatic		WXS	Illumina GAIIx	Phase_I	A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	ENST00000323571.4	37	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	a	17.56	3.419835	0.62622	.	.	ENSG00000171475	ENST00000323571	T	0.37058	1.22	5.16	4.05	0.47172	.	0.000000	0.85682	D	0.000000	T	0.37919	0.1021	M	0.68593	2.085	0.80722	D	1	B	0.29531	0.247	B	0.31016	0.123	T	0.27839	-1.0062	10	0.59425	D	0.04	-7.6056	11.7194	0.51672	0.5767:0.4233:0.0:0.0	.	124	Q8TF74	WIPF2_HUMAN	G	124	ENSP00000320924:R124G	ENSP00000320924:R124G	R	+	1	2	WIPF2	35674324	0.937000	0.31787	0.988000	0.46212	0.944000	0.59088	1.996000	0.40776	0.948000	0.37687	0.445000	0.29226	AGG		0.577	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2		NM_133264	
XIRP1	165904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	39229862	39229862	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr3:39229862C>T	ENST00000340369.3	-	2	1303	c.1075G>A	c.(1075-1077)Ggg>Agg	p.G359R	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.G359R	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	359					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.G359R(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCTTCGTCCCCCTTCAGAGTG	0.587																																																	1	Substitution - Missense(1)	kidney(1)											94.0	103.0	100.0					3																	39229862		2203	4300	6503	SO:0001583	missense	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1075G>A	3.37:g.39229862C>T	ENSP00000343140:p.Gly359Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707587	0.68615	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.06218	3.33;3.7	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	T	0.01484	-1.1343	10	0.87932	D	0	.	9.5717	0.39431	0.0:0.904:0.0:0.096	.	359;359	Q702N8;Q702N8-2	XIRP1_HUMAN;.	R	359	ENSP00000379550:G359R;ENSP00000343140:G359R	ENSP00000343140:G359R	G	-	1	0	XIRP1	39204866	1.000000	0.71417	0.966000	0.40874	0.891000	0.51852	4.643000	0.61390	2.442000	0.82660	0.655000	0.94253	GGG		0.587	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1		XM_093522	
XIRP2	129446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	167760331	167760331	+	Silent	SNP	C	C	T	rs377273154		TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr2:167760331C>T	ENST00000409728.1	+	2	428	c.339C>T	c.(337-339)gcC>gcT	p.A113A	XIRP2_ENST00000409756.2_Silent_p.A113A|XIRP2_ENST00000295237.9_Silent_p.A113A|XIRP2_ENST00000420519.1_Silent_p.A113A|XIRP2_ENST00000409043.1_Silent_p.A113A|XIRP2_ENST00000409195.1_Silent_p.A113A	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.A113A(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTTCCATTGCCCTTGATGAGC	0.498																																																	2	Substitution - coding silent(2)	kidney(2)						C	,,	0,4032		0,0,2016	125.0	128.0	127.0		339,339,339	2.4	0.9	2		127	1,8331		0,1,4165	no	coding-synonymous,coding-synonymous,coding-synonymous	XIRP2	NM_001079810.3,NM_001199143.1,NM_152381.5	,,	0,1,6181	TT,TC,CC		0.012,0.0,0.0081	,,	113/939,113/972,113/3550	167760331	1,12363	2016	4166	6182	SO:0001819	synonymous_variant	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.339C>T	2.37:g.167760331C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409728.1	37	CCDS56143.1																																																																																				0.498	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1		NM_152381	
ZNF462	58499	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	109689533	109689533	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr9:109689533T>C	ENST00000277225.5	+	3	3629	c.3340T>C	c.(3340-3342)Tac>Cac	p.Y1114H	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.Y1114H			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1114					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y1114H(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TACTGAGCTTTACTACTGCAA	0.488																																																	1	Substitution - Missense(1)	kidney(1)											66.0	67.0	66.0					9																	109689533		2203	4299	6502	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3340T>C	9.37:g.109689533T>C	ENSP00000277225:p.Tyr1114His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.107315	0.56291	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.12465	2.68;3.07	5.37	5.37	0.77165	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.33702	0.0872	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.994	T	0.01935	-1.1244	9	.	.	.	.	15.3692	0.74548	0.0:0.0:0.0:1.0	.	1114;1114	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	H	1114	ENSP00000277225:Y1114H;ENSP00000414570:Y1114H	.	Y	+	1	0	ZNF462	108729354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.933000	0.87642	2.033000	0.60031	0.459000	0.35465	TAC		0.488	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2		NM_021224	
ZNF608	57507	broad.mit.edu	37	5	124079966	124079966	+	Silent	SNP	C	C	G			TCGA-B0-5694-01A-11D-1534-10	TCGA-B0-5694-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6edbaa05-b935-4f82-b070-8fc80ea6b609	543454fe-3924-4a76-8c1d-527e6e1c2937	g.chr5:124079966C>G	ENST00000306315.5	-	1	1152	c.717G>C	c.(715-717)ggG>ggC	p.G239G	ZNF608_ENST00000504926.1_Intron	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	239							metal ion binding (GO:0046872)	p.G239G(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGCTCTTGGCCCCAAAGCCAT	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											41.0	48.0	46.0					5																	124079966		2202	4297	6499	SO:0001819	synonymous_variant	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.717G>C	5.37:g.124079966C>G		Somatic		WXS	Illumina GAIIx	Phase_I	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Silent	SNP	ENST00000306315.5	37	CCDS34219.1																																																																																				0.647	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1		XM_114432	
