#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABL1	25	broad.mit.edu	37	9	133589643	133589643	+	IGR	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr9:133589643C>T								EXOSC2 (9395 upstream) : ABL1 (120809 downstream)																							TTTCCCTCTACGCTCGCTGAC	0.453																																																	0																																										SO:0001628	intergenic_variant	25																															9.37:g.133589643C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Translation_Start_Site	SNP		37																																																																																				0	0.453									
ADAMDEC1	27299	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	24242084	24242084	+	Missense_Mutation	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr8:24242084T>C	ENST00000256412.4	+	1	287	c.67T>C	c.(67-69)Tgg>Cgg	p.W23R	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|ADAMDEC1_ENST00000522298.1_5'UTR|ADAMDEC1_ENST00000538205.1_5'UTR	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	23					immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.W23R(1)		NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		GCCTGTACTTTGGCTCATTGT	0.433																																					Ovarian(147;687 1849 3699 25981 31337)												1	Substitution - Missense(1)	kidney(1)											151.0	113.0	126.0					8																	24242084		2203	4300	6503	SO:0001583	missense	27299			Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.67T>C	8.37:g.24242084T>C	ENSP00000256412:p.Trp23Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	37	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	T	5.581	0.292078	0.10567	.	.	ENSG00000134028	ENST00000256412	T	0.02631	4.22	4.63	2.13	0.27403	.	0.927551	0.09259	N	0.826886	T	0.03136	0.0092	L	0.29908	0.895	0.51767	D	0.999939	B	0.23128	0.08	B	0.28916	0.096	T	0.44205	-0.9343	10	0.27785	T	0.31	-0.9605	8.8028	0.34918	0.0:0.0:0.3756:0.6244	.	23	O15204	ADEC1_HUMAN	R	23	ENSP00000256412:W23R	ENSP00000256412:W23R	W	+	1	0	ADAMDEC1	24298029	0.013000	0.17824	0.545000	0.28153	0.150000	0.21749	0.004000	0.13106	0.469000	0.27268	0.533000	0.62120	TGG		0.433	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2		NM_014479	
ANKRD30A	91074	broad.mit.edu;hgsc.bcm.edu	37	10	37422855	37422855	+	Missense_Mutation	SNP	T	T	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr10:37422855T>G	ENST00000602533.1	+	5	560	c.461T>G	c.(460-462)aTg>aGg	p.M154R	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.M154R|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.M154R|RNU6-811P_ENST00000384069.1_RNA			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	210					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M154R(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACAGCCCTCATGCTTGCTGTA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											170.0	157.0	161.0					10																	37422855		1910	4127	6037	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.461T>G	10.37:g.37422855T>G	ENSP00000473551:p.Met154Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	.	11.65	1.703107	0.30232	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.66995	-0.24;-0.18	1.43	1.43	0.22495	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.69672	0.3137	M	0.82193	2.58	0.26028	N	0.981775	P	0.43826	0.818	P	0.47102	0.537	T	0.60239	-0.7302	9	0.44086	T	0.13	.	5.019	0.14352	0.0:0.0:0.0:1.0	.	210	Q9BXX3	AN30A_HUMAN	R	154	ENSP00000354432:M154R;ENSP00000363792:M154R	ENSP00000354432:M154R	M	+	2	0	ANKRD30A	37462861	1.000000	0.71417	0.336000	0.25522	0.149000	0.21700	2.947000	0.49058	0.677000	0.31305	0.240000	0.17902	ATG		0.373	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2		NM_052997	
ANKRD34C	390616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	79585881	79585881	+	Silent	SNP	C	C	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr15:79585881C>A	ENST00000558647.2	+	1	255	c.255C>A	c.(253-255)ggC>ggA	p.G85G	ANKRD34C_ENST00000421388.2_Silent_p.G85G			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	85								p.G85G(1)		endometrium(3)|kidney(1)|skin(1)	5						ATAAGTCTGGCAAGACTGCCC	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											75.0	66.0	69.0					15																	79585881		685	1584	2269	SO:0001819	synonymous_variant	390616				CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.255C>A	15.37:g.79585881C>A		Somatic		WXS	Illumina HiSeq	Phase_I	H3BNM1	Silent	SNP	ENST00000558647.2	37	CCDS53965.1																																																																																				0.517	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2		NM_001146341	
BCL9L	283149	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118774132	118774132	+	Missense_Mutation	SNP	C	C	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr11:118774132C>A	ENST00000334801.3	-	4	1526	c.562G>T	c.(562-564)Gcc>Tcc	p.A188S	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	188					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.A188S(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AGCTGTGGGGCCGCCATGGCT	0.647																																																	2	Substitution - Missense(2)	kidney(2)											14.0	20.0	18.0					11																	118774132		2167	4286	6453	SO:0001583	missense	283149			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.562G>T	11.37:g.118774132C>A	ENSP00000335320:p.Ala188Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742451	0.30865	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085	T	0.64260	-0.09	5.09	2.09	0.27110	.	0.286388	0.24859	N	0.035021	T	0.43010	0.1228	N	0.22421	0.69	0.22771	N	0.998758	B;B	0.13594	0.008;0.005	B;B	0.18871	0.023;0.01	T	0.22347	-1.0219	10	0.23891	T	0.37	-9.6222	8.875	0.35340	0.0:0.6955:0.0:0.3045	.	183;188	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	S	188;151;188;188	ENSP00000335320:A188S	ENSP00000335320:A188S	A	-	1	0	BCL9L	118279342	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.671000	0.37513	0.708000	0.31955	0.650000	0.86243	GCC		0.647	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1		NM_182557	
BMS1	9790	broad.mit.edu	37	10	43288427	43288427	+	Silent	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr10:43288427T>C	ENST00000374518.5	+	8	987	c.924T>C	c.(922-924)agT>agC	p.S308S		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	308					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.S308S(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTGCCGTGAGTGACATCAGTT	0.473																																																	1	Substitution - coding silent(1)	kidney(1)											128.0	130.0	129.0					10																	43288427		2203	4300	6503	SO:0001819	synonymous_variant	9790			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.924T>C	10.37:g.43288427T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q5QPT5|Q86XJ9	Silent	SNP	ENST00000374518.5	37	CCDS7199.1																																																																																				0.473	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2		NM_014753	
BRCA2	675	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	32900684	32900684	+	Missense_Mutation	SNP	G	G	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr13:32900684G>C	ENST00000380152.3	+	7	798	c.565G>C	c.(565-567)Gat>Cat	p.D189H	BRCA2_ENST00000544455.1_Missense_Mutation_p.D189H			P51587	BRCA2_HUMAN	breast cancer 2, early onset	189					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.D189H(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGCTGAGGTGGATCCTGATAT	0.383			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	2	Substitution - Missense(2)	kidney(2)											120.0	117.0	118.0					13																	32900684		2203	4300	6503	SO:0001583	missense	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.565G>C	13.37:g.32900684G>C	ENSP00000369497:p.Asp189His	Somatic		WXS	Illumina HiSeq	Phase_I	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366047	0.82463	.	.	ENSG00000139618	ENST00000380152;ENST00000544455;ENST00000530893	T;T	0.01369	4.97;4.97	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000004	T	0.08626	0.0214	M	0.65498	2.005	0.45883	D	0.998739	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.936	T	0.01195	-1.1422	10	0.87932	D	0	.	19.2691	0.94002	0.0:0.0:1.0:0.0	.	189;189	P51587;A1YBP1	BRCA2_HUMAN;.	H	189;189;187	ENSP00000369497:D189H;ENSP00000439902:D189H	ENSP00000369497:D189H	D	+	1	0	BRCA2	31798684	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.440000	0.59975	2.551000	0.86045	0.462000	0.41574	GAT		0.383	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2		NM_000059	
BTNL3	10917	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	180432814	180432814	+	Missense_Mutation	SNP	C	C	T	rs201813197		TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:180432814C>T	ENST00000342868.6	+	8	1527	c.1343C>T	c.(1342-1344)gCg>gTg	p.A448V	RNU6-1036P_ENST00000383959.1_RNA	NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	448	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)		p.A448V(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			ATCCAGCATGCGATGTATGAC	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		20078	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(1)|endometrium(1)						C	VAL/ALA	0,3898		0,0,1949	80.0	74.0	76.0		1343	-4.4	0.0	5		76	5,8281		0,5,4138	yes	missense	BTNL3	NM_197975.2	64	0,5,6087	TT,TC,CC		0.0603,0.0,0.041	benign	448/467	180432814	5,12179	1949	4143	6092	SO:0001583	missense	10917			AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.1343C>T	5.37:g.180432814C>T	ENSP00000341787:p.Ala448Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q496L7|Q9Y2C7	Missense_Mutation	SNP	ENST00000342868.6	37	CCDS47358.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.001	-3.030549	0.00041	0.0	6.03E-4	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.60548	0.18	2.2	-4.4	0.03600	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.33235	0.0856	L	0.32530	0.975	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.0	T	0.23190	-1.0195	9	0.12766	T	0.61	.	0.6801	0.00873	0.163:0.1973:0.2502:0.3895	.	414;448	C9JDC2;Q6UXE8	.;BTNL3_HUMAN	V	448;414	ENSP00000341787:A448V	ENSP00000341787:A448V	A	+	2	0	BTNL3	180365420	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.340000	0.01101	-2.964000	0.00289	-2.769000	0.00120	GCG		0.493	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2		NM_197975	
KIAA1551	55196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	32134405	32134405	+	Silent	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr12:32134405T>C	ENST00000312561.4	+	4	930	c.516T>C	c.(514-516)aaT>aaC	p.N172N	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	172								p.N172N(1)									TCCCTTCTAATTCTACACGAC	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											98.0	92.0	94.0					12																	32134405		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.516T>C	12.37:g.32134405T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	37	CCDS8725.2																																																																																				0.413	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2		NM_018169	
C8B	732	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	57415368	57415368	+	Missense_Mutation	SNP	G	G	A	rs150146785	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr1:57415368G>A	ENST00000371237.4	-	6	790	c.724C>T	c.(724-726)Cgc>Tgc	p.R242C	C8B_ENST00000543257.1_Missense_Mutation_p.R190C|C8B_ENST00000535057.1_Missense_Mutation_p.R180C	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	242	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.R242C(1)|p.R242G(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						GTGACATTGCGTTCAAAATCT	0.338													G|||	5	0.000998403	0.003	0.0014	5008	,	,		21122	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	ovary(1)|kidney(1)						G	CYS/ARG	10,4394	16.8+/-37.8	0,10,2192	88.0	87.0	87.0		724	3.2	0.1	1	dbSNP_134	87	0,8598		0,0,4299	yes	missense	C8B	NM_000066.2	180	0,10,6491	AA,AG,GG		0.0,0.2271,0.0769	probably-damaging	242/592	57415368	10,12992	2202	4299	6501	SO:0001583	missense	732			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.724C>T	1.37:g.57415368G>A	ENSP00000360281:p.Arg242Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	15.89	2.967081	0.53507	0.002271	0.0	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.29142	1.74;1.75;1.58	5.19	3.19	0.36642	Membrane attack complex component/perforin (MACPF) domain (1);	1.053100	0.07284	N	0.871299	T	0.35711	0.0941	L	0.50333	1.59	0.09310	N	0.999997	D;D;D	0.60160	0.987;0.987;0.978	P;P;B	0.46825	0.528;0.528;0.328	T	0.24476	-1.0159	10	0.72032	D	0.01	-0.8703	9.8148	0.40846	0.0801:0.0:0.7048:0.2151	.	190;180;242	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	C	242;190;180	ENSP00000360281:R242C;ENSP00000442548:R190C;ENSP00000440113:R180C	ENSP00000360281:R242C	R	-	1	0	C8B	57187956	0.009000	0.17119	0.125000	0.21846	0.376000	0.30014	-0.028000	0.12350	1.318000	0.45170	0.591000	0.81541	CGC		0.338	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2			
CACNA1S	779	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	201029869	201029869	+	Missense_Mutation	SNP	C	C	T	rs200558548		TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr1:201029869C>T	ENST00000362061.3	-	26	3557	c.3331G>A	c.(3331-3333)Gtg>Atg	p.V1111M	CACNA1S_ENST00000367338.3_Missense_Mutation_p.V1111M	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1111					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.V1111M(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGTACCACACCTGGTACTGG	0.527													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22203	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											294.0	282.0	286.0					1																	201029869		2203	4300	6503	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3331G>A	1.37:g.201029869C>T	ENSP00000355192:p.Val1111Met	Somatic		WXS	Illumina HiSeq	Phase_I	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	19.43	3.825921	0.71143	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96459	-4.02;-3.94	5.17	5.17	0.71159	.	0.183297	0.47455	D	0.000225	D	0.96713	0.8927	M	0.61703	1.905	0.40942	D	0.984471	P	0.52692	0.955	P	0.58454	0.839	D	0.96736	0.9543	10	0.72032	D	0.01	.	10.6754	0.45783	0.0:0.8754:0.0:0.1246	.	1111	Q13698	CAC1S_HUMAN	M	1111	ENSP00000355192:V1111M;ENSP00000356307:V1111M	ENSP00000355192:V1111M	V	-	1	0	CACNA1S	199296492	0.943000	0.32029	1.000000	0.80357	0.991000	0.79684	0.878000	0.28126	2.545000	0.85829	0.655000	0.94253	GTG		0.527	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1		NM_000069	
CADPS2	93664	hgsc.bcm.edu;ucsc.edu	37	7	122114547	122114547	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr7:122114547delC	ENST00000449022.2	-	13	1905	c.1886delG	c.(1885-1887)ggtfs	p.G629fs	CADPS2_ENST00000412584.2_Frame_Shift_Del_p.G626fs|CADPS2_ENST00000313070.7_Frame_Shift_Del_p.G626fs|CADPS2_ENST00000334010.7_Frame_Shift_Del_p.G630fs	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	629					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						CTCATCCATACCATGTTTCTG	0.383																																																	0													89.0	86.0	87.0					7																	122114547		1881	4114	5995	SO:0001589	frameshift_variant	93664				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1886delG	7.37:g.122114547delC	ENSP00000398481:p.Gly629fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Frame_Shift_Del	DEL	ENST00000449022.2	37	CCDS55158.1																																																																																				0.383	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2		NM_017954	
CENPC	1060	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	68358686	68358686	+	Missense_Mutation	SNP	G	G	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:68358686G>C	ENST00000273853.6	-	15	2570	c.2320C>G	c.(2320-2322)Cca>Gca	p.P774A		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	774					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)	p.P774A(1)									ATTGTGTCTGGAGATAGTACT	0.299																																																	1	Substitution - Missense(1)	kidney(1)											78.0	63.0	67.0					4																	68358686		1785	4020	5805	SO:0001583	missense	1060			M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2320C>G	4.37:g.68358686G>C	ENSP00000273853:p.Pro774Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.467156	0.26335	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.65	4.65	0.58169	.	0.345212	0.25106	N	0.033096	T	0.61899	0.2384	L	0.57536	1.79	0.33672	D	0.611064	P	0.52463	0.953	P	0.57152	0.814	T	0.67699	-0.5603	9	0.34782	T	0.22	-16.9008	13.3355	0.60515	0.0:0.0:1.0:0.0	.	774	Q03188	CENPC_HUMAN	A	774	.	ENSP00000273853:P774A	P	-	1	0	CENPC1	68041281	1.000000	0.71417	0.978000	0.43139	0.012000	0.07955	5.085000	0.64468	2.854000	0.98071	0.655000	0.94253	CCA		0.299	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2			
CLDN12	9069	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	90042424	90042424	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr7:90042424C>G	ENST00000287916.4	+	3	721	c.434C>G	c.(433-435)aCt>aGt	p.T145S	CLDN12_ENST00000394605.2_Missense_Mutation_p.T145S|CTB-13L3.1_ENST00000480135.1_RNA|CLDN12_ENST00000535571.1_Missense_Mutation_p.T145S	NM_001185073.2|NM_012129.4	NP_001172002.1|NP_036261.1	P56749	CLD12_HUMAN	claudin 12	145					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.T145S(2)		breast(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)	15						CTGGCAGGTACTGTGAGCCTC	0.488																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)											159.0	147.0	151.0					7																	90042424		2203	4300	6503	SO:0001583	missense	9069			AJ250713	CCDS5618.1	7q21	2008-07-18			ENSG00000157224	ENSG00000157224		"""Claudins"""	2034	protein-coding gene	gene with protein product		611232					Standard	NM_001185072		Approved		uc003ukr.3	P56749	OTTHUMG00000156612	ENST00000287916.4:c.434C>G	7.37:g.90042424C>G	ENSP00000287916:p.Thr145Ser	Somatic		WXS	Illumina HiSeq	Phase_I	D6W5Q4|Q7LDZ0	Missense_Mutation	SNP	ENST00000287916.4	37	CCDS5618.1	.	.	.	.	.	.	.	.	.	.	C	9.208	1.030135	0.19512	.	.	ENSG00000157224	ENST00000422604;ENST00000416322;ENST00000496677;ENST00000287916;ENST00000535571;ENST00000394604;ENST00000394605	T;T;T;T;T;T	0.73363	-0.56;-0.74;-0.74;-0.74;-0.52;-0.74	5.45	0.15	0.14883	.	0.272379	0.42053	D	0.000771	T	0.48960	0.1529	N	0.14661	0.345	0.22858	N	0.998641	B	0.06786	0.001	B	0.04013	0.001	T	0.34403	-0.9830	10	0.56958	D	0.05	-9.0432	1.863	0.03193	0.132:0.4083:0.1298:0.3299	.	145	P56749	CLD12_HUMAN	S	145	ENSP00000411399:T145S;ENSP00000419053:T145S;ENSP00000287916:T145S;ENSP00000443476:T145S;ENSP00000378102:T145S;ENSP00000378103:T145S	ENSP00000287916:T145S	T	+	2	0	CLDN12	89880360	0.605000	0.26941	0.989000	0.46669	0.809000	0.45718	1.118000	0.31246	0.119000	0.18210	-0.136000	0.14681	ACT		0.488	CLDN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059221.1		NM_012129	
CYB5A	1528	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	71930704	71930704	+	Silent	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr18:71930704A>G	ENST00000340533.4	-	2	278	c.138T>C	c.(136-138)ggT>ggC	p.G46G	CYB5A_ENST00000397914.4_Silent_p.G46G|CYB5A_ENST00000494131.2_Silent_p.G46G|CYB5A_ENST00000299438.9_5'UTR|CYB5A_ENST00000579064.1_5'Flank	NM_148923.3	NP_683725.1	P00167	CYB5_HUMAN	cytochrome b5 type A (microsomal)	46	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				hydrogen ion transmembrane transport (GO:1902600)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	aldo-keto reductase (NADP) activity (GO:0004033)|cytochrome-c oxidase activity (GO:0004129)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)	p.G46G(1)		kidney(1)|large_intestine(1)|lung(1)|skin(1)	4		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)				CTTCTTCCCCACCAGGATGCT	0.413																																					NSCLC(176;1530 2076 2606 27426 50572)|Ovarian(151;328 1870 2837 37860 52175)												1	Substitution - coding silent(1)	kidney(1)											100.0	94.0	96.0					18																	71930704		2203	4300	6503	SO:0001819	synonymous_variant	1528			M22865	CCDS12004.1, CCDS12005.1, CCDS54188.1	18q23	2006-01-30	2006-01-30	2006-01-30	ENSG00000166347	ENSG00000166347		"""Cytochrome b genes"""	2570	protein-coding gene	gene with protein product		613218	"""cytochrome b-5"", ""cytochrome b5 (microsomal)"""	CYB5		1840560	Standard	NM_148923		Approved		uc002lli.3	P00167	OTTHUMG00000132843	ENST00000340533.4:c.138T>C	18.37:g.71930704A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MV91|F8WEU4|Q6IB14	Silent	SNP	ENST00000340533.4	37	CCDS12004.1																																																																																				0.413	CYB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256316.1		NM_001914, NM_148923	
DAXX	1616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33287883	33287883	+	Missense_Mutation	SNP	T	T	A	rs200567881	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr6:33287883T>A	ENST00000374542.5	-	5	1574	c.1370A>T	c.(1369-1371)gAg>gTg	p.E457V	DAXX_ENST00000477162.1_5'UTR|ZBTB22_ENST00000431845.2_5'Flank|ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000266000.6_Missense_Mutation_p.E457V|DAXX_ENST00000414083.2_Missense_Mutation_p.E382V	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	457	Asp/Glu-rich (acidic).|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.E457V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						ATCTGTGGcctcctcctcttc	0.552			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	1	Substitution - Missense(1)	kidney(1)											150.0	112.0	125.0					6																	33287883		2203	4300	6503	SO:0001583	missense	1616			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1370A>T	6.37:g.33287883T>A	ENSP00000363668:p.Glu457Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	T	12.46	1.945297	0.34283	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	T;T	0.08193	3.12;3.12	4.31	4.31	0.51392	Armadillo-like helical (1);	0.291758	0.31381	N	0.007743	T	0.12135	0.0295	L	0.57536	1.79	0.43936	D	0.996591	D;D	0.56746	0.977;0.977	P;P	0.62298	0.9;0.9	T	0.00708	-1.1600	10	0.62326	D	0.03	-0.0089	9.7983	0.40748	0.0:0.0:0.0:1.0	.	469;457	B4E1C1;Q9UER7	.;DAXX_HUMAN	V	457;457;382	ENSP00000266000:E457V;ENSP00000363668:E457V	ENSP00000266000:E457V	E	-	2	0	DAXX	33395861	0.999000	0.42202	0.791000	0.31998	0.919000	0.55068	4.679000	0.61649	1.808000	0.52836	0.443000	0.29094	GAG		0.552	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1			
DDX4	54514	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	55086409	55086409	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:55086409G>A	ENST00000505374.1	+	16	1270	c.1178G>A	c.(1177-1179)tGt>tAt	p.C393Y	DDX4_ENST00000514278.2_Missense_Mutation_p.C373Y|DDX4_ENST00000354991.5_Missense_Mutation_p.C359Y|DDX4_ENST00000511853.1_Missense_Mutation_p.C244Y|DDX4_ENST00000353507.5_Missense_Mutation_p.C359Y	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	393	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.C244Y(1)|p.C393Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				AATAGGACTTGTGTAAGAGCT	0.318																																																	2	Substitution - Missense(2)	kidney(2)											95.0	100.0	99.0					5																	55086409		2203	4300	6503	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1178G>A	5.37:g.55086409G>A	ENSP00000424838:p.Cys393Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832535	0.71258	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.86	5.86	0.93980	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.41650	0.1168	N	0.01576	-0.805	0.52501	D	0.999957	B;D;B;D	0.89917	0.251;0.999;0.126;1.0	B;D;B;D	0.91635	0.159;0.99;0.07;0.999	T	0.65232	-0.6218	10	0.66056	D	0.02	-21.6212	20.2019	0.98263	0.0:0.0:1.0:0.0	.	373;244;359;393	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	Y	359;373;393;373;359;244	ENSP00000334167:C359Y;ENSP00000425359:C373Y;ENSP00000424838:C393Y;ENSP00000427167:C373Y;ENSP00000347087:C359Y;ENSP00000423123:C244Y	ENSP00000334167:C359Y	C	+	2	0	DDX4	55122166	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.241000	0.78201	2.776000	0.95493	0.655000	0.94253	TGT		0.318	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2		NM_024415	
DNAJB6	10049	hgsc.bcm.edu	37	7	157160099	157160100	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr7:157160099_157160100insGA	ENST00000262177.4	+	5	473_474	c.268_269insGA	c.(268-270)ggcfs	p.G90fs	DNAJB6_ENST00000452797.2_Frame_Shift_Ins_p.G41fs|DNAJB6_ENST00000429029.2_Frame_Shift_Ins_p.G90fs|DNAJB6_ENST00000443280.1_Frame_Shift_Ins_p.G90fs	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	90	Gly/Phe-rich.|Interaction with HSP70.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		ATTTGAATTTGGCTTCACATTC	0.386																																					Esophageal Squamous(46;195 967 1350 20350 43814)												0																																										SO:0001589	frameshift_variant	10049			AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	Exception_encountered	7.37:g.157160099_157160100insGA	ENSP00000262177:p.Gly90fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Frame_Shift_Ins	INS	ENST00000262177.4	37	CCDS5946.1																																																																																				0.386	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2			
DNAJC14	85406	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	56216895	56216895	+	Silent	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr12:56216895T>C	ENST00000357606.3	-	5	1882	c.1593A>G	c.(1591-1593)gcA>gcG	p.A531A	RP11-762I7.5_ENST00000552719.1_5'Flank|DNAJC14_ENST00000317269.3_Silent_p.A531A|DNAJC14_ENST00000317287.5_Silent_p.A531A|RP11-762I7.5_ENST00000546837.1_Missense_Mutation_p.N161D			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	531					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.A531A(1)		breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						TAGTATTCATTGCCTCCTTGA	0.438																																																	1	Substitution - coding silent(1)	kidney(1)											175.0	146.0	155.0					12																	56216895		2203	4300	6503	SO:0001819	synonymous_variant	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.1593A>G	12.37:g.56216895T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Silent	SNP	ENST00000357606.3	37	CCDS8894.1	.	.	.	.	.	.	.	.	.	.	T	9.526	1.109501	0.20714	.	.	ENSG00000257390	ENST00000546837	.	.	.	5.85	1.77	0.24775	.	.	.	.	.	T	0.45994	0.1370	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28713	-1.0035	4	.	.	.	-6.7037	3.5614	0.07884	0.1201:0.0785:0.1675:0.634	.	.	.	.	D	161	.	.	N	-	1	0	RP11-762I7.5	54503162	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.843000	0.48238	0.513000	0.28278	0.533000	0.62120	AAT		0.438	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1		NM_032364	
EFCAB6	64800	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	44004465	44004465	+	Missense_Mutation	SNP	C	C	A	rs55698170	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr22:44004465C>A	ENST00000262726.7	-	22	2831	c.2578G>T	c.(2578-2580)Gat>Tat	p.D860Y	EFCAB6_ENST00000396231.2_Missense_Mutation_p.D708Y	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	860	EF-hand 9. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.D860Y(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CCCTCATTATCGGTTTCTAGA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											132.0	105.0	114.0					22																	44004465		2203	4300	6503	SO:0001583	missense	64800			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2578G>T	22.37:g.44004465C>A	ENSP00000262726:p.Asp860Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630499	0.46944	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.30182	1.54;1.54	4.73	4.73	0.59995	EF-hand-like domain (1);	0.065911	0.64402	D	0.000019	T	0.45716	0.1356	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.45071	-0.9286	10	0.87932	D	0	-38.6255	16.4373	0.83880	0.0:1.0:0.0:0.0	.	860	Q5THR3	EFCB6_HUMAN	Y	708;860	ENSP00000379533:D708Y;ENSP00000262726:D860Y	ENSP00000262726:D860Y	D	-	1	0	EFCAB6	42335798	0.990000	0.36364	0.065000	0.19835	0.412000	0.31113	4.774000	0.62339	2.607000	0.88179	0.655000	0.94253	GAT		0.413	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1		NM_022785	
EIF4G3	8672	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	21226401	21226401	+	Silent	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr1:21226401T>C	ENST00000264211.8	-	10	1814	c.1620A>G	c.(1618-1620)gtA>gtG	p.V540V	EIF4G3_ENST00000374935.3_Silent_p.V260V|EIF4G3_ENST00000536266.1_Silent_p.V144V|EIF4G3_ENST00000537738.1_5'UTR|EIF4G3_ENST00000602326.1_Silent_p.V546V|EIF4G3_ENST00000544689.1_Silent_p.V83V|EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000374937.3_Silent_p.V546V|EIF4G3_ENST00000400422.1_Silent_p.V540V	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	540					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.V546V(1)|p.V540V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CAGATTCAAGTACTTTGTCAA	0.358																																																	2	Substitution - coding silent(2)	kidney(2)											120.0	130.0	127.0					1																	21226401		2203	4300	6503	SO:0001819	synonymous_variant	8672			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1620A>G	1.37:g.21226401T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Silent	SNP	ENST00000264211.8	37	CCDS214.1																																																																																				0.358	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3		NM_003760	
ERI1	90459	hgsc.bcm.edu	37	8	8887543	8887545	+	Stop_Codon_Del	DEL	AAC	AAC	-	rs200590562|rs66532380|rs140242735|rs201293350	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr8:8887543_8887545delAAC	ENST00000523898.1	+	0	1728_1730				ERI1_ENST00000519292.1_Stop_Codon_Del|ERI1_ENST00000520332.1_Intron|ERI1_ENST00000250263.7_Stop_Codon_Del			Q8IV48	ERI1_HUMAN	exoribonuclease 1						gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						TTTAGAAAGTAACAACAGTTTTG	0.409														2197	0.438698	0.1112	0.5648	5008	,	,		20640	0.6944		0.4364	False		,,,				2504	0.5307																0										724,3540		54,616,1462						4.7	1.0		dbSNP_130	68	3689,4565		828,2033,1266	no	coding	ERI1	NM_153332.3		882,2649,2728	A1A1,A1R,RR		44.6935,16.9794,35.2532				4413,8105				SO:0001567	stop_retained_variant	90459			BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	Exception_encountered	8.37:g.8887546_8887548delAAC		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4U7|Q9NSX3	In_Frame_Del	DEL	ENST00000523898.1	37	CCDS5972.1																																																																																				0.409	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251471.2		NM_153332	
FBN2	2201	hgsc.bcm.edu;ucsc.edu	37	5	127647000	127647000	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:127647000delA	ENST00000508053.1	-	45	6040	c.5066delT	c.(5065-5067)atcfs	p.I1689fs	FBN2_ENST00000262464.4_Frame_Shift_Del_p.I1689fs			P35556	FBN2_HUMAN	fibrillin 2	1689	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACCTTCACAGATGCGGGTATC	0.498																																																	0													70.0	58.0	62.0					5																	127647000		2203	4300	6503	SO:0001589	frameshift_variant	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5066delT	5.37:g.127647000delA	ENSP00000424571:p.Ile1689fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DU01|Q59ES6	Frame_Shift_Del	DEL	ENST00000508053.1	37	CCDS34222.1																																																																																				0.498	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
FAM13B	51306	broad.mit.edu;ucsc.edu	37	5	137278882	137278882	+	Silent	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:137278882C>T	ENST00000033079.3	-	20	2749	c.2298G>A	c.(2296-2298)agG>agA	p.R766R	FAM13B_ENST00000420893.2_Silent_p.R738R|FAM13B_ENST00000425075.2_Silent_p.R642R	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	766					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R766R(1)|p.R642R(1)		endometrium(4)|kidney(2)|lung(5)	11						ACATCTGACCCCTTCGCTTGG	0.338																																																	2	Substitution - coding silent(2)	kidney(2)											111.0	111.0	111.0					5																	137278882		2203	4300	6503	SO:0001819	synonymous_variant	51306			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.2298G>A	5.37:g.137278882C>T		Somatic		WXS	Illumina GAIIx	Phase_I	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Silent	SNP	ENST00000033079.3	37	CCDS4195.1																																																																																				0.338	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1			
FBXO41	150726	broad.mit.edu;hgsc.bcm.edu	37	2	73496700	73496700	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr2:73496700C>T	ENST00000521871.1	-	2	474	c.59G>A	c.(58-60)cGg>cAg	p.R20Q	FBXO41_ENST00000295133.5_Missense_Mutation_p.R81Q|FBXO41_ENST00000520186.1_5'Flank|FBXO41_ENST00000520530.2_Missense_Mutation_p.R20Q			Q8TF61	FBX41_HUMAN	F-box protein 41	20								p.R20Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						CGACAGGCTCCGGAAGCGCTT	0.736																																																	1	Substitution - Missense(1)	kidney(1)											7.0	10.0	8.0					2																	73496700		1424	2593	4017	SO:0001583	missense	150726			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.59G>A	2.37:g.73496700C>T	ENSP00000428646:p.Arg20Gln	Somatic		WXS	Illumina HiSeq	Phase_I	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	ENST00000521871.1	37	CCDS46337.2	.	.	.	.	.	.	.	.	.	.	c	25.7	4.662529	0.88251	.	.	ENSG00000163013	ENST00000295133;ENST00000521871;ENST00000520530	.	.	.	5.15	4.26	0.50523	Zinc finger, C2H2-like (1);	0.068973	0.64402	D	0.000014	T	0.55226	0.1907	L	0.55481	1.735	0.80722	D	1	P	0.49862	0.929	B	0.42798	0.398	T	0.60791	-0.7193	9	0.54805	T	0.06	-7.7665	14.7315	0.69386	0.0:0.8539:0.1461:0.0	.	20	Q8TF61	FBX41_HUMAN	Q	81;20;81	.	ENSP00000295133:R81Q	R	-	2	0	FBXO41	73350208	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	7.320000	0.79064	1.296000	0.44742	0.175000	0.17021	CGG		0.736	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377381.1			
FNIP2	57600	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	159789573	159789573	+	Silent	SNP	G	G	C	rs143166945	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:159789573G>C	ENST00000264433.6	+	13	1860	c.1785G>C	c.(1783-1785)ccG>ccC	p.P595P	FNIP2_ENST00000379346.3_Silent_p.P618P	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	595	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P595P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		ACCCCTGGCCGACAGGGTTTC	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											54.0	58.0	57.0					4																	159789573		1956	4146	6102	SO:0001819	synonymous_variant	57600			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.1785G>C	4.37:g.159789573G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q05DC3|Q96I31|Q9H994	Silent	SNP	ENST00000264433.6	37	CCDS47155.1																																																																																				0.562	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1		NM_020840	
FUS	2521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	31193930	31193931	+	Missense_Mutation	DNP	GG	GG	AC			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr16:31193930_31193931GG>AC	ENST00000254108.7	+	3	240_241	c.135_136GG>AC	c.(133-138)acGGac>acACac	p.D46H	FUS_ENST00000568685.1_Missense_Mutation_p.D46H|FUS_ENST00000380244.3_Missense_Mutation_p.D46H|RP11-388M20.6_ENST00000564743.1_RNA	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	46	Gln/Gly/Ser/Tyr-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D46H(1)|p.T45T(1)	FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		GCCAGTCCACGGACACTTCAGG	0.545			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																			Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)																																								SO:0001583	missense	2521			AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	Exception_encountered	16.37:g.31193930_31193931delinsAC	ENSP00000254108:p.Asp46His	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H4A8	Silent|Missense_Mutation	SNP	ENST00000254108.7	37	CCDS10707.1																																																																																				0.545	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2		NM_004960	
GNPTAB	79158	hgsc.bcm.edu;ucsc.edu	37	12	102158580	102158580	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr12:102158580delT	ENST00000299314.7	-	13	2377	c.2115delA	c.(2113-2115)aaafs	p.K705fs	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	705	DMAP-interaction.				carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						ACTGGGCGTCTTTTGGAAGGA	0.423																																																	0													69.0	72.0	71.0					12																	102158580		2203	4300	6503	SO:0001589	frameshift_variant	79158			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.2115delA	12.37:g.102158580delT	ENSP00000299314:p.Lys705fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Frame_Shift_Del	DEL	ENST00000299314.7	37	CCDS9088.1																																																																																				0.423	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1			
HOXB4	3214	broad.mit.edu;ucsc.edu	37	17	46654168	46654168	+	Silent	SNP	G	G	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr17:46654168G>C	ENST00000332503.5	-	2	2463	c.672C>G	c.(670-672)ccC>ccG	p.P224P	HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000490677.1_5'Flank|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000311626.4_5'Flank|HOXB3_ENST00000485909.2_5'Flank|HOXB3_ENST00000460160.1_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	224					anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P224P(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						TCTTGGTGTTGGGCAACTTGT	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	66.0	65.0					17																	46654168		2203	4300	6503	SO:0001819	synonymous_variant	3214				CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.672C>G	17.37:g.46654168G>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q9NTA0	Silent	SNP	ENST00000332503.5	37	CCDS11529.1																																																																																				0.677	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2			
IGSF1	3547	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	130410026	130410026	+	Silent	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chrX:130410026C>T	ENST00000361420.3	-	15	2884	c.2805G>A	c.(2803-2805)gaG>gaA	p.E935E	IGSF1_ENST00000370904.1_Silent_p.E926E|IGSF1_ENST00000370903.3_Silent_p.E940E|IGSF1_ENST00000467244.1_5'UTR|IGSF1_ENST00000370910.1_Silent_p.E926E			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	935	Ig-like C2-type 9.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.E935E(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCCCAGAGTCCTCTGCTCCAA	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											97.0	74.0	82.0					X																	130410026		2203	4300	6503	SO:0001819	synonymous_variant	3547			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2805G>A	X.37:g.130410026C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	ENST00000361420.3	37	CCDS14629.1																																																																																				0.512	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			
KATNB1	10300	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	57785950	57785950	+	Silent	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr16:57785950C>T	ENST00000379661.3	+	8	1007	c.615C>T	c.(613-615)gcC>gcT	p.A205A		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1									p.A205A(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				ACCTCCTGGCCTCCGGCAGCT	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											67.0	44.0	51.0					16																	57785950		2198	4300	6498	SO:0001819	synonymous_variant	10300			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.615C>T	16.37:g.57785950C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000379661.3	37	CCDS10788.1																																																																																				0.602	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3			
KDM5C	8242	hgsc.bcm.edu;ucsc.edu	37	X	53247129	53247135	+	Frame_Shift_Del	DEL	CCACCTT	CCACCTT	-			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	CCACCTT	CCACCTT	CCACCTT	-	CCACCTT	CCACCTT	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chrX:53247129_53247135delCCACCTT	ENST00000375401.3	-	4	897_903	c.365_371delAAGGTGG	c.(364-372)gaaggtggtfs	p.EGG122fs	KDM5C_ENST00000452825.3_Frame_Shift_Del_p.EGG55fs|KDM5C_ENST00000375379.3_Frame_Shift_Del_p.EGG122fs|KDM5C_ENST00000375383.3_Frame_Shift_Del_p.EGG81fs|KDM5C_ENST00000404049.3_Frame_Shift_Del_p.EGG122fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	122	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.?(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AGCTTCATAACCACCTTCCTCCACCAC	0.498			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Unknown(1)	kidney(1)																																								SO:0001589	frameshift_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.365_371delAAGGTGG	X.37:g.53247129_53247135delCCACCTT	ENSP00000364550:p.Glu122fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Del	DEL	ENST00000375401.3	37	CCDS14351.1																																																																																				0.498	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
VWA8	23078	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	42461433	42461433	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr13:42461433A>G	ENST00000379310.3	-	6	784	c.716T>C	c.(715-717)aTt>aCt	p.I239T	VWA8_ENST00000281496.6_Missense_Mutation_p.I239T	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	239						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.I239T(1)									GCCCAAGGCAATCACTCGGAA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											71.0	75.0	74.0					13																	42461433		2203	4300	6503	SO:0001583	missense	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.716T>C	13.37:g.42461433A>G	ENSP00000368612:p.Ile239Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.227775	0.79576	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496;ENST00000398857	T;T	0.52057	0.68;0.68	5.11	5.11	0.69529	ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	D	0.000001	T	0.75679	0.3882	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82719	-0.0318	10	0.87932	D	0	.	15.2341	0.73416	1.0:0.0:0.0:0.0	.	239	A3KMH1	K0564_HUMAN	T	143;239;239;239	ENSP00000368612:I239T;ENSP00000281496:I239T	ENSP00000251030:I143T	I	-	2	0	KIAA0564	41359433	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	9.218000	0.95166	2.054000	0.61138	0.528000	0.53228	ATT		0.408	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2		NM_015058	
KIAA0586	9786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	58954685	58954685	+	Missense_Mutation	SNP	T	T	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr14:58954685T>G	ENST00000556134.1	+	24	3614	c.3340T>G	c.(3340-3342)Ttt>Gtt	p.F1114V	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Missense_Mutation_p.F1085V|KIAA0586_ENST00000354386.6_Missense_Mutation_p.F1182V|KIAA0586_ENST00000261244.5_Missense_Mutation_p.F1053V	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1114					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.F1182V(1)|p.F1053V(1)		endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGCGGCAGTTTTTACCCCAAC	0.443																																																	2	Substitution - Missense(2)	kidney(2)											53.0	53.0	53.0					14																	58954685		1837	4083	5920	SO:0001583	missense	9786			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.3340T>G	14.37:g.58954685T>G	ENSP00000452351:p.Phe1114Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	T	0.534	-0.856569	0.02630	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.18	3.32	0.38043	.	0.454311	0.23206	N	0.050723	T	0.29355	0.0731	L	0.36672	1.1	0.24705	N	0.993234	B;B;B;B;B;B	0.29988	0.0;0.0;0.008;0.264;0.0;0.0	B;B;B;B;B;B	0.28011	0.001;0.001;0.002;0.085;0.001;0.001	T	0.14448	-1.0472	10	0.18710	T	0.47	.	9.7676	0.40570	0.0:0.767:0.153:0.08	.	989;989;1182;1053;1114;1085	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	V	1182;1114;1085;1053;989	ENSP00000346359:F1182V;ENSP00000452351:F1114V;ENSP00000399427:F1085V;ENSP00000261244:F1053V	ENSP00000261244:F1053V	F	+	1	0	KIAA0586	58024438	0.992000	0.36948	1.000000	0.80357	0.121000	0.20230	0.891000	0.28309	0.658000	0.30925	-0.484000	0.04775	TTT		0.443	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1		NM_014749	
KIAA1109	84162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	123150305	123150305	+	Silent	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:123150305T>C	ENST00000264501.4	+	25	3325	c.2952T>C	c.(2950-2952)acT>acC	p.T984T	KIAA1109_ENST00000388738.3_Silent_p.T984T|KIAA1109_ENST00000455637.1_Silent_p.T984T|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	984					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T984T(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTTGTCCAACTTCAGATGATT	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											207.0	193.0	198.0					4																	123150305		1864	4109	5973	SO:0001819	synonymous_variant	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.2952T>C	4.37:g.123150305T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	T	9.396	1.076650	0.20227	.	.	ENSG00000138688	ENST00000424425	.	.	.	5.33	-0.0113	0.13993	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22521	-1.0214	4	.	.	.	.	0.9972	0.01470	0.4442:0.207:0.1147:0.2341	.	.	.	.	L	816	.	.	F	+	1	0	KIAA1109	123369755	0.878000	0.30173	1.000000	0.80357	0.992000	0.81027	-0.019000	0.12546	0.060000	0.16281	-0.496000	0.04628	TTC		0.323	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1		NM_020797	
KIAA1109	84162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	123150307	123150307	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:123150307C>A	ENST00000264501.4	+	25	3327	c.2954C>A	c.(2953-2955)tCa>tAa	p.S985*	KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.S985*|KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.S985*|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	985					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S985*(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGTCCAACTTCAGATGATTTG	0.323																																																	1	Substitution - Nonsense(1)	kidney(1)											208.0	193.0	198.0					4																	123150307		1865	4113	5978	SO:0001587	stop_gained	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.2954C>A	4.37:g.123150307C>A	ENSP00000264501:p.Ser985*	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.478903|6.478903	0.97598|0.97598	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000424425|ENST00000264501;ENST00000388738;ENST00000455637;ENST00000449251	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|2.031630	.|0.03178	.|N	.|0.171716	T|.	0.41511|.	0.1162|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.25916|.	-1.0118|.	3|.	.|0.02654	.|T	.|1	.|.	19.3889|19.3889	0.94570|0.94570	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	816|985;985;985;150	.|.	.|ENSP00000264501:S985X	F|S	+|+	3|2	2|0	KIAA1109|KIAA1109	123369757|123369757	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.605000|7.605000	0.82844|0.82844	2.637000|2.637000	0.89404|0.89404	0.561000|0.561000	0.74099|0.74099	TTC|TCA		0.323	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1		NM_020797	
KIF20A	10112	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137519224	137519224	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:137519224A>G	ENST00000394894.3	+	9	1319	c.1093A>G	c.(1093-1095)Aac>Gac	p.N365D	KIF20A_ENST00000508792.1_Missense_Mutation_p.N347D	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	365	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)	p.N365D(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GGGTCGTAAGAACCAGAGCTT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											88.0	92.0	91.0					5																	137519224		2203	4300	6503	SO:0001583	missense	10112			AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.1093A>G	5.37:g.137519224A>G	ENSP00000378356:p.Asn365Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DL79|D3DQB6	Missense_Mutation	SNP	ENST00000394894.3	37	CCDS4199.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218062	0.79352	.	.	ENSG00000112984	ENST00000394894;ENST00000508792	T;T	0.76316	-1.01;-1.01	4.88	4.88	0.63580	Kinesin, motor domain (4);	0.000000	0.48767	D	0.000172	D	0.90652	0.7068	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	D	0.92990	0.6414	10	0.72032	D	0.01	-18.6504	14.6592	0.68858	1.0:0.0:0.0:0.0	.	347;365	B4DL79;O95235	.;KI20A_HUMAN	D	365;347	ENSP00000378356:N365D;ENSP00000420880:N347D	ENSP00000378356:N365D	N	+	1	0	KIF20A	137547123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.761000	0.91691	2.061000	0.61500	0.533000	0.62120	AAC		0.498	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251272.1		NM_005733	
LBP	3929	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	36978015	36978015	+	Silent	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr20:36978015C>T	ENST00000217407.2	+	2	350	c.189C>T	c.(187-189)acC>acT	p.T63T		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	63					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)	p.T63T(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CTGACTTCACCGGGGACTTGA	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											33.0	32.0	32.0					20																	36978015		2203	4300	6503	SO:0001819	synonymous_variant	3929				CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.189C>T	20.37:g.36978015C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R938|O43438|Q92672|Q9H403|Q9UD66	Silent	SNP	ENST00000217407.2	37	CCDS13304.1																																																																																				0.617	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2		NM_004139	
LDB3	11155	broad.mit.edu	37	10	88476170	88476170	+	Missense_Mutation	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr10:88476170T>C	ENST00000361373.4	+	9	1339	c.1318T>C	c.(1318-1320)Tcc>Ccc	p.S440P	LDB3_ENST00000458213.2_Missense_Mutation_p.S330P|LDB3_ENST00000352360.5_Missense_Mutation_p.S183P|LDB3_ENST00000263066.6_Missense_Mutation_p.S330P|LDB3_ENST00000429277.2_Missense_Mutation_p.S445P	NM_007078.2	NP_009009.1			LIM domain binding 3									p.S445P(1)|p.S440P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						ctacaccccctcccctgcccc	0.637																																																	2	Substitution - Missense(2)	kidney(2)											16.0	16.0	16.0					10																	88476170		2192	4270	6462	SO:0001583	missense	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1318T>C	10.37:g.88476170T>C	ENSP00000355296:p.Ser440Pro	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000361373.4	37	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	T	11.25	1.582485	0.28180	.	.	ENSG00000122367	ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	T;T;T;T;T	0.55234	0.79;0.63;0.53;0.63;0.58	4.47	3.23	0.37069	.	0.700777	0.11047	N	0.605444	T	0.60983	0.2311	L	0.43152	1.355	0.25136	N	0.990534	B;D;P;B;B	0.63046	0.396;0.992;0.531;0.396;0.378	B;D;B;B;B	0.73708	0.092;0.981;0.189;0.092;0.102	T	0.46884	-0.9159	10	0.29301	T	0.29	.	9.0613	0.36436	0.0:0.0:0.1851:0.8149	.	445;377;183;440;330	B4E3K3;F5H0C2;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	P	445;330;183;330;440	ENSP00000401437:S445P;ENSP00000409148:S330P;ENSP00000263067:S183P;ENSP00000263066:S330P;ENSP00000355296:S440P	ENSP00000263066:S330P	S	+	1	0	LDB3	88466150	0.512000	0.26186	0.883000	0.34634	0.132000	0.20833	3.008000	0.49544	1.763000	0.52060	0.528000	0.53228	TCC		0.637	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			
MACROD2	140733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	15967710	15967710	+	Splice_Site	SNP	G	G	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr20:15967710G>C	ENST00000310348.4	+	15	1060		c.e15-1		MACROD2_ENST00000402914.1_Splice_Site|MACROD2_ENST00000407045.3_Splice_Site|MACROD2_ENST00000217246.4_Splice_Site|MACROD2_ENST00000378058.3_Splice_Site			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2						brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.?(4)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ATTCTATTTAGAACTTTCATC	0.388																																																	4	Unknown(4)	breast(2)|kidney(2)											143.0	138.0	140.0					20																	15967710		2203	4300	6503	SO:0001630	splice_region_variant	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1061-1G>C	20.37:g.15967710G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Splice_Site	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665454	0.47677	.	.	ENSG00000172264	ENST00000217246;ENST00000310348;ENST00000402914;ENST00000378058;ENST00000407045	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.105	0.86660	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MACROD2	15915710	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	5.643000	0.67895	2.783000	0.95769	0.591000	0.81541	.		0.388	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_080676	Intron
MAP3K2	10746	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	128066323	128066323	+	Missense_Mutation	SNP	C	C	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr2:128066323C>A	ENST00000409947.1	-	16	1754	c.1472G>T	c.(1471-1473)cGa>cTa	p.R491L	MAP3K2_ENST00000344908.5_Missense_Mutation_p.R491L			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	491	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.R491L(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	TGTTGAATCTCGCAGGATATT	0.428																																																	1	Substitution - Missense(1)	kidney(1)											87.0	85.0	86.0					2																	128066323		1892	4119	6011	SO:0001583	missense	10746			AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1472G>T	2.37:g.128066323C>A	ENSP00000387246:p.Arg491Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	37	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576318	0.65878	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.58940	0.3;0.3	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.27384	0.0672	N	0.00101	-2.135	0.80722	D	1	B	0.27625	0.183	B	0.35550	0.205	T	0.49409	-0.8943	10	0.30078	T	0.28	.	19.7201	0.96139	0.0:1.0:0.0:0.0	.	491	Q9Y2U5	M3K2_HUMAN	L	491	ENSP00000387246:R491L;ENSP00000343463:R491L	ENSP00000343463:R491L	R	-	2	0	MAP3K2	127782793	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	7.731000	0.84895	2.661000	0.90470	0.561000	0.74099	CGA		0.428	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1		NM_006609	
MED13	9969	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	60140520	60140520	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr17:60140520C>T	ENST00000397786.2	-	2	285	c.209G>A	c.(208-210)cGg>cAg	p.R70Q		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	70					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R70Q(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TTGATCTCGCCGCCAAACACC	0.468																																																	1	Substitution - Missense(1)	kidney(1)											142.0	144.0	143.0					17																	60140520		1862	4095	5957	SO:0001583	missense	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.209G>A	17.37:g.60140520C>T	ENSP00000380888:p.Arg70Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	C	37	6.144740	0.97324	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.81821	-1.54	5.67	5.67	0.87782	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.000000	0.85682	D	0.000000	D	0.90242	0.6949	M	0.78223	2.4	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.90548	0.4507	10	0.66056	D	0.02	0.7596	19.7607	0.96316	0.0:1.0:0.0:0.0	.	70	Q9UHV7	MED13_HUMAN	Q	70	ENSP00000380888:R70Q	ENSP00000262436:R70Q	R	-	2	0	MED13	57495302	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.786000	0.85741	2.658000	0.90341	0.655000	0.94253	CGG		0.468	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1		NM_005121	
MYO5A	4644	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	52645836	52645836	+	Missense_Mutation	SNP	A	A	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr15:52645836A>C	ENST00000399231.3	-	27	3830	c.3587T>G	c.(3586-3588)aTt>aGt	p.I1196S	MYO5A_ENST00000399233.2_Missense_Mutation_p.I1196S|MYO5A_ENST00000358212.6_Missense_Mutation_p.I1196S|MYO5A_ENST00000356338.6_Missense_Mutation_p.I1196S|MYO5A_ENST00000553916.1_Missense_Mutation_p.I1196S	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1196					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.I1196S(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TGCACCTCTAATTTGTGGTCT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											105.0	101.0	103.0					15																	52645836		1806	4075	5881	SO:0001583	missense	4644				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3587T>G	15.37:g.52645836A>C	ENSP00000382177:p.Ile1196Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338924	0.41398	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;D;T;D	0.86164	3.69;3.69;-2.08;3.69;-2.07	5.92	5.92	0.95590	.	0.212557	0.49916	D	0.000138	T	0.71702	0.3371	N	0.08118	0	0.41204	D	0.986392	B;B	0.11235	0.001;0.004	B;B	0.10450	0.002;0.005	T	0.66952	-0.5793	10	0.08599	T	0.76	.	10.6656	0.45728	0.929:0.0:0.071:0.0	.	1196;1196	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	S	1196;730;1196;1196;1196;826;1196	ENSP00000382177:I1196S;ENSP00000382179:I1196S;ENSP00000348693:I1196S;ENSP00000350945:I1196S;ENSP00000451109:I1196S	ENSP00000348693:I1196S	I	-	2	0	MYO5A	50433128	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	5.860000	0.69546	2.266000	0.75297	0.533000	0.62120	ATT		0.358	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1		NM_000259	
MNS1	55329	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	56735643	56735643	+	Nonsense_Mutation	SNP	A	A	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr15:56735643A>C	ENST00000260453.3	-	7	1160	c.996T>G	c.(994-996)taT>taG	p.Y332*	TEX9_ENST00000352903.2_Intron|TEX9_ENST00000537232.1_Intron	NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	332	Glu-rich.				cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)	p.Y332*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		GCTTGCTCTTATATATTTCAG	0.313																																																	1	Substitution - Nonsense(1)	kidney(1)											120.0	115.0	117.0					15																	56735643		2192	4290	6482	SO:0001587	stop_gained	55329			AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.996T>G	15.37:g.56735643A>C	ENSP00000260453:p.Tyr332*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYT6|Q9NUP4	Nonsense_Mutation	SNP	ENST00000260453.3	37	CCDS10158.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.367673	0.61513	.	.	ENSG00000138587	ENST00000260453	.	.	.	5.76	-7.7	0.01259	.	1.546290	0.03345	N	0.195348	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	12.8479	7.2336	0.26057	0.179:0.1941:0.5281:0.0988	.	.	.	.	X	332	.	ENSP00000260453:Y332X	Y	-	3	2	MNS1	54522935	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.395000	0.02516	-1.671000	0.01466	-0.276000	0.10085	TAT		0.313	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255047.2		NM_018365	
OR6A2	8590	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6816240	6816240	+	Missense_Mutation	SNP	G	G	A	rs2741745		TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr11:6816240G>A	ENST00000332601.3	-	1	888	c.700C>T	c.(700-702)Cct>Tct	p.P234S		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	234					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P234S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCAGCCGAAGGAATGTGCATC	0.493																																																	1	Substitution - Missense(1)	kidney(1)											98.0	100.0	99.0					11																	6816240		2201	4296	6497	SO:0001583	missense	8590			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.700C>T	11.37:g.6816240G>A	ENSP00000330384:p.Pro234Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187028	0.38609	.	.	ENSG00000184933	ENST00000332601	T	0.36878	1.23	5.07	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000034	T	0.34106	0.0886	L	0.51422	1.61	0.20926	N	0.999829	B	0.17038	0.02	B	0.24701	0.055	T	0.31971	-0.9924	10	0.54805	T	0.06	.	11.4282	0.50022	0.0876:0.0:0.9124:0.0	rs2741745	234	O95222	OR6A2_HUMAN	S	234	ENSP00000330384:P234S	ENSP00000330384:P234S	P	-	1	0	OR6A2	6772816	0.146000	0.22672	0.578000	0.28575	0.877000	0.50540	2.843000	0.48238	1.517000	0.48917	0.655000	0.94253	CCT		0.493	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1		NM_003696	
OR9K2	441639	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	55523606	55523606	+	Silent	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr12:55523606A>G	ENST00000305377.5	+	1	142	c.54A>G	c.(52-54)caA>caG	p.Q18Q		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q18Q(1)		NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						GTGCCTCTCAACAGGTTTCTA	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											144.0	144.0	144.0					12																	55523606		2203	4300	6503	SO:0001819	synonymous_variant	441639			BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.54A>G	12.37:g.55523606A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B9EH19|Q6IFD6	Silent	SNP	ENST00000305377.5	37	CCDS31814.1																																																																																				0.413	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1			
PCDHB8	56128	broad.mit.edu	37	5	140559035	140559035	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:140559035G>A	ENST00000239444.2	+	1	1665	c.1420G>A	c.(1420-1422)Gtc>Atc	p.V474I	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	474	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V474I(2)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATCGGCAGCGTCAGCGCCAC	0.662																																																	2	Substitution - Missense(2)	endometrium(1)|kidney(1)											80.0	122.0	108.0					5																	140559035		2203	4293	6496	SO:0001583	missense	56128			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1420G>A	5.37:g.140559035G>A	ENSP00000239444:p.Val474Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260842	0.23051	.	.	ENSG00000120322	ENST00000239444	T	0.02787	4.16	4.26	1.9	0.25705	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03520	0.0101	L	0.51853	1.615	0.09310	N	0.999999	B	0.21071	0.051	B	0.24006	0.05	T	0.43081	-0.9413	9	0.25106	T	0.35	.	7.5775	0.27944	0.4462:0.0:0.5538:0.0	.	474	Q9UN66	PCDB8_HUMAN	I	474	ENSP00000239444:V474I	ENSP00000239444:V474I	V	+	1	0	PCDHB8	140539219	0.020000	0.18652	0.998000	0.56505	0.970000	0.65996	0.204000	0.17335	0.466000	0.27193	0.305000	0.20034	GTC		0.662	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2		NM_019120	
PDE6B	5158	broad.mit.edu;ucsc.edu	37	4	649741	649741	+	Silent	SNP	C	C	G	rs370605672		TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:649741C>G	ENST00000496514.1	+	7	1026	c.1005C>G	c.(1003-1005)gcC>gcG	p.A335A	RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000598370.1_RNA|PDE6B_ENST00000429163.2_Silent_p.A56A|PDE6B_ENST00000255622.6_Silent_p.A335A|RP11-1191J2.2_ENST00000599030.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	335	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.A335A(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CACCCTCAGCCGATCACTGGG	0.647																																					GBM(71;463 1194 9848 25922 46834)												1	Substitution - coding silent(1)	kidney(1)											83.0	76.0	79.0					4																	649741		2203	4300	6503	SO:0001819	synonymous_variant	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1005C>G	4.37:g.649741C>G		Somatic		WXS	Illumina GAIIx	Phase_I	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Silent	SNP	ENST00000496514.1	37	CCDS33932.1																																																																																				0.647	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1		NM_000283	
PGM2	55276	broad.mit.edu;ucsc.edu	37	4	37839173	37839173	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:37839173A>G	ENST00000381967.4	+	4	479	c.379A>G	c.(379-381)Aca>Gca	p.T127A	PGM2_ENST00000537241.1_Intron|PGM2_ENST00000544359.1_5'UTR	NM_018290.3	NP_060760.2	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	127					carbohydrate metabolic process (GO:0005975)|deoxyribose phosphate catabolic process (GO:0046386)|galactose catabolic process (GO:0019388)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)|phosphopentomutase activity (GO:0008973)	p.T127A(1)		breast(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	19						TGCTGCAACCACATTTATCAG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											214.0	196.0	202.0					4																	37839173		2203	4300	6503	SO:0001583	missense	55276			BC010087	CCDS3443.1	4p14	2012-10-02			ENSG00000169299	ENSG00000169299	5.4.2.2		8906	protein-coding gene	gene with protein product	"""phosphopentomutase"""	172000				9549096	Standard	NM_018290		Approved	FLJ10983	uc011byb.1	Q96G03	OTTHUMG00000097813	ENST00000381967.4:c.379A>G	4.37:g.37839173A>G	ENSP00000371393:p.Thr127Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B4E0G8|Q53FP5|Q5QTR0|Q9H0P9|Q9NV22	Missense_Mutation	SNP	ENST00000381967.4	37	CCDS3443.1	.	.	.	.	.	.	.	.	.	.	a	12.32	1.901732	0.33535	.	.	ENSG00000169299	ENST00000381967	T	0.62105	0.05	5.6	1.56	0.23342	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.261879	0.44483	N	0.000454	T	0.37571	0.1008	N	0.05554	-0.025	0.58432	D	0.999997	B	0.02656	0.0	B	0.10450	0.005	T	0.08391	-1.0724	10	0.32370	T	0.25	-3.9779	9.7799	0.40643	0.7643:0.0:0.2357:0.0	.	127	Q96G03	PGM2_HUMAN	A	127	ENSP00000371393:T127A	ENSP00000371393:T127A	T	+	1	0	PGM2	37515568	0.999000	0.42202	0.807000	0.32361	0.923000	0.55619	2.906000	0.48735	0.445000	0.26639	0.524000	0.50904	ACA		0.443	PGM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215079.2		NM_018290	
PHF8	23133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	54044120	54044120	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chrX:54044120G>T	ENST00000357988.5	-	5	894	c.536C>A	c.(535-537)aCt>aAt	p.T179N	PHF8_ENST00000338154.6_Missense_Mutation_p.T143N|PHF8_ENST00000338946.6_Missense_Mutation_p.T143N|PHF8_ENST00000322659.8_Missense_Mutation_p.T143N	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	179					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.T143I(2)|p.T143N(2)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						ATCCCTCACAGTGAATGATGG	0.483																																																	4	Substitution - Missense(4)	endometrium(2)|kidney(2)											158.0	105.0	123.0					X																	54044120		2203	4300	6503	SO:0001583	missense	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.536C>A	X.37:g.54044120G>T	ENSP00000350676:p.Thr179Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.69|15.69	2.909421|2.909421	0.52439|0.52439	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000396282|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	.|T;T;T;T	.|0.27402	.|2.27;2.02;2.05;1.67	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.149372	.|0.64402	.|D	.|0.000018	T|T	0.43344|0.43344	0.1243|0.1243	M|M	0.81497|0.81497	2.545|2.545	0.33282|0.33282	D|D	0.56243|0.56243	.|P;P;B	.|0.46020	.|0.796;0.871;0.396	.|B;B;B	.|0.42738	.|0.303;0.396;0.07	T|T	0.62011|0.62011	-0.6944|-0.6944	5|10	.|0.48119	.|T	.|0.1	-16.527|-16.527	17.9897|17.9897	0.89165|0.89165	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|143;179;179	.|B7Z911;Q9UPP1-3;Q9UPP1	.|.;.;PHF8_HUMAN	M|N	47|179;143;143;173;143	.|ENSP00000350676:T179N;ENSP00000338868:T143N;ENSP00000340051:T143N;ENSP00000319473:T143N	.|ENSP00000319473:T143N	L|T	-|-	1|2	2|0	PHF8|PHF8	54060845|54060845	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.056000|2.056000	0.41355|0.41355	2.524000|2.524000	0.85096|0.85096	0.600000|0.600000	0.82982|0.82982	CTG|ACT		0.483	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2		NM_015107	
PKHD1L1	93035	broad.mit.edu	37	8	110445335	110445335	+	Splice_Site	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr8:110445335G>A	ENST00000378402.5	+	28	3334	c.3230G>A	c.(3229-3231)gGg>gAg	p.G1077E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1077	IPT/TIG 4.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G1079E(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCATTTTTAGGGTCCTATGAA	0.318										HNSCC(38;0.096)																																							1	Substitution - Missense(1)	kidney(1)											183.0	174.0	176.0					8																	110445335		1805	4062	5867	SO:0001630	splice_region_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3230-1G>A	8.37:g.110445335G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.356097	0.82243	.	.	ENSG00000205038	ENST00000378402	T	0.81078	-1.45	5.51	5.51	0.81932	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90734	0.7092	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.91585	0.5282	9	.	.	.	.	15.2719	0.73708	0.0:0.0:1.0:0.0	.	1077	Q86WI1	PKHL1_HUMAN	E	1077	ENSP00000367655:G1077E	.	G	+	2	0	PKHD1L1	110514511	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.279000	0.65597	2.746000	0.94184	0.655000	0.94253	GGG		0.318	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	Missense_Mutation
PPFIA3	8541	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	49641602	49641602	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr19:49641602C>T	ENST00000334186.4	+	16	2343	c.1994C>T	c.(1993-1995)gCc>gTc	p.A665V	PPFIA3_ENST00000602351.1_Missense_Mutation_p.A665V	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	665					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)		p.A665V(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TCTACCCTTGCCAGCCCCTCC	0.677																																																	1	Substitution - Missense(1)	kidney(1)											27.0	29.0	28.0					19																	49641602		2203	4298	6501	SO:0001583	missense	8541			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1994C>T	19.37:g.49641602C>T	ENSP00000335614:p.Ala665Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	37	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415385	0.83449	.	.	ENSG00000177380	ENST00000334186	T	0.55052	0.54	4.23	4.23	0.50019	.	0.000000	0.47093	D	0.000247	T	0.70552	0.3237	M	0.78637	2.42	0.80722	D	1	P;D	0.69078	0.686;0.997	B;D	0.62955	0.317;0.909	T	0.76503	-0.2935	10	0.72032	D	0.01	-14.9642	15.7417	0.77901	0.0:1.0:0.0:0.0	.	665;665	O75145-2;O75145	.;LIPA3_HUMAN	V	665	ENSP00000335614:A665V	ENSP00000335614:A665V	A	+	2	0	PPFIA3	54333414	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.451000	0.60047	2.062000	0.61559	0.557000	0.71058	GCC		0.677	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1		NM_003660	
PRB1	5542	broad.mit.edu	37	12	11506399	11506399	+	Intron	SNP	T	T	C	rs111543911	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr12:11506399T>C	ENST00000500254.2	-	4	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGAGGAGATTGGGAACTTCG	0.612													N|||	1192	0.238019	0.1808	0.1816	5008	,	,		11447	0.3393		0.1759	False		,,,				2504	0.3149																0													11.0	7.0	9.0					12																	11506399		1009	1967	2976	SO:0001627	intron_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.314-75A>G	12.37:g.11506399T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																				0.612	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1		NM_005039	
PROX2	283571	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	75329252	75329252	+	Missense_Mutation	SNP	A	A	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr14:75329252A>C	ENST00000445876.1	-	1	1285	c.1286T>G	c.(1285-1287)cTg>cGg	p.L429R	PROX2_ENST00000556489.2_Missense_Mutation_p.L429R|PROX2_ENST00000556084.2_Intron			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	429					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L429R(1)		kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		AGAGAAAGGCAGTGCCTCCAT	0.507																																																	1	Substitution - Missense(1)	kidney(1)											84.0	84.0	84.0					14																	75329252		2008	4184	6192	SO:0001583	missense	283571				CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.1286T>G	14.37:g.75329252A>C	ENSP00000405932:p.Leu429Arg	Somatic		WXS	Illumina HiSeq	Phase_I	C9J5W1|Q8N9Q3	Missense_Mutation	SNP	ENST00000445876.1	37	CCDS45136.2	.	.	.	.	.	.	.	.	.	.	A	13.97	2.396181	0.42512	.	.	ENSG00000119608	ENST00000556489;ENST00000389664;ENST00000445876	T;T	0.46063	0.88;0.9	5.35	0.33	0.15929	.	0.702859	0.12074	N	0.501935	T	0.36663	0.0975	L	0.54323	1.7	0.09310	N	1	D	0.55172	0.97	P	0.47376	0.545	T	0.20773	-1.0265	10	0.22706	T	0.39	-0.0047	4.2695	0.10780	0.5406:0.0:0.3127:0.1468	.	429	G3V3G0	.	R	429	ENSP00000451223:L429R;ENSP00000405932:L429R	ENSP00000374315:L429R	L	-	2	0	PROX2	74399005	0.000000	0.05858	0.001000	0.08648	0.248000	0.25809	0.037000	0.13840	0.028000	0.15324	0.459000	0.35465	CTG		0.507	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				
PRR22	163154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	5784427	5784427	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr19:5784427G>T	ENST00000419421.2	-	2	258	c.154C>A	c.(154-156)Cca>Aca	p.P52T	CTB-54O9.9_ENST00000586012.1_Missense_Mutation_p.P57H	NM_001134316.1	NP_001127788.1	Q8IZ63	PRR22_HUMAN	proline rich 22	52								p.P52T(1)		endometrium(2)|large_intestine(1)|prostate(1)|urinary_tract(1)	5						TCTGGGTCTGGGGGATGATAC	0.637																																																	1	Substitution - Missense(1)	kidney(1)											106.0	113.0	111.0					19																	5784427		692	1591	2283	SO:0001583	missense	163154			BC023278	CCDS45933.1	19p13.3	2012-12-20			ENSG00000212123	ENSG00000212123			28354	protein-coding gene	gene with protein product						12477932	Standard	NM_001134316		Approved	MGC24975	uc010xiv.1	Q8IZ63	OTTHUMG00000180553	ENST00000419421.2:c.154C>A	19.37:g.5784427G>T	ENSP00000407653:p.Pro52Thr	Somatic		WXS	Illumina HiSeq	Phase_I	E9PB31	Missense_Mutation	SNP	ENST00000419421.2	37	CCDS45933.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961367	0.53400	.	.	ENSG00000212123	ENST00000419421	T	0.18810	2.19	4.66	1.29	0.21616	.	.	.	.	.	T	0.18923	0.0454	N	0.19112	0.55	0.21220	N	0.999755	D	0.53462	0.96	P	0.52217	0.693	T	0.11842	-1.0571	9	0.59425	D	0.04	.	6.3927	0.21595	0.1742:0.1504:0.6754:0.0	.	52	E9PB31	.	T	52	ENSP00000407653:P52T	ENSP00000407653:P52T	P	-	1	0	PRR22	5735427	0.066000	0.20996	0.133000	0.22050	0.085000	0.17905	-0.012000	0.12699	0.193000	0.20303	-0.305000	0.09177	CCA		0.637	PRR22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368523.1		NM_153359	
PSD3	23362	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	18662289	18662289	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr8:18662289G>A	ENST00000327040.8	-	5	1856	c.1754C>T	c.(1753-1755)gCc>gTc	p.A585V	PSD3_ENST00000440756.2_Missense_Mutation_p.A585V|PSD3_ENST00000523619.1_Missense_Mutation_p.A520V|PSD3_ENST00000286485.8_Missense_Mutation_p.A51V	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	585	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.A585V(1)|p.A51V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CAACCTTTTGGCTGCTTCCAC	0.458																																																	2	Substitution - Missense(2)	kidney(2)											201.0	199.0	200.0					8																	18662289		2203	4300	6503	SO:0001583	missense	23362			AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.1754C>T	8.37:g.18662289G>A	ENSP00000324127:p.Ala585Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	G	35	5.580333	0.96565	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000286485;ENST00000523619;ENST00000519851	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.56906	0.2017	L	0.48986	1.54	0.80722	D	1	P;P	0.46277	0.87;0.875	P;P	0.57057	0.812;0.577	T	0.52697	-0.8541	10	0.59425	D	0.04	.	18.1531	0.89682	0.0:0.0:1.0:0.0	.	585;51	E9KL50;Q9NYI0-3	.;.	V	585;585;51;520;26	ENSP00000324127:A585V;ENSP00000401704:A585V;ENSP00000286485:A51V;ENSP00000430640:A520V;ENSP00000429069:A26V	ENSP00000286485:A51V	A	-	2	0	PSD3	18706569	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.800000	0.91900	2.885000	0.99019	0.655000	0.94253	GCC		0.458	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1		NM_015310	
PUS7	54517	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	105111238	105111238	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr7:105111238G>A	ENST00000356362.2	-	11	1509	c.1295C>T	c.(1294-1296)aCt>aTt	p.T432I	PUS7_ENST00000469408.1_Missense_Mutation_p.T432I	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	432	TRUD. {ECO:0000255|PROSITE- ProRule:PRU00342}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.T432I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						GAGGGCAGCAGTTGGGTCTTT	0.453																																					Colon(138;2387 3051 17860)												1	Substitution - Missense(1)	kidney(1)											148.0	137.0	141.0					7																	105111238		2203	4300	6503	SO:0001583	missense	54517			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1295C>T	7.37:g.105111238G>A	ENSP00000348722:p.Thr432Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.088810	0.36855	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.41065	1.01;1.01	5.8	4.84	0.62591	Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase, TruD, insertion domain (1);	0.202809	0.50627	D	0.000105	T	0.25865	0.0630	N	0.08118	0	0.20638	N	0.999875	B;B	0.23540	0.074;0.087	B;B	0.23852	0.049;0.049	T	0.21177	-1.0253	10	0.45353	T	0.12	-18.5228	14.9844	0.71336	0.0:0.0:0.7771:0.2229	.	432;432	B3KY42;Q96PZ0	.;PUS7_HUMAN	I	432	ENSP00000348722:T432I;ENSP00000417402:T432I	ENSP00000348722:T432I	T	-	2	0	PUS7	104898474	1.000000	0.71417	0.991000	0.47740	0.904000	0.53231	3.590000	0.53979	2.739000	0.93911	0.561000	0.74099	ACT		0.453	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1		NM_019042	
RTTN	25914	hgsc.bcm.edu;ucsc.edu	37	18	67871409	67871411	+	In_Frame_Del	DEL	CAG	CAG	-	rs554154376		TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr18:67871409_67871411delCAG	ENST00000255674.6	-	3	594_596	c.308_310delCTG	c.(307-312)gctgaa>gaa	p.A103del	RTTN_ENST00000437017.1_In_Frame_Del_p.A103del|RTTN_ENST00000454359.1_In_Frame_Del_p.A103del	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	103					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CCATCAATTTCAGCCTGCAGATT	0.429																																																	0																																										SO:0001651	inframe_deletion	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.308_310delCTG	18.37:g.67871409_67871411delCAG	ENSP00000255674:p.Ala103del	Somatic		WXS	Illumina HiSeq	Phase_I	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	In_Frame_Del	DEL	ENST00000255674.6	37	CCDS42443.1																																																																																				0.429	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1		NM_173630	
RTTN	25914	hgsc.bcm.edu	37	18	67871413	67871413	+	Silent	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr18:67871413C>T	ENST00000255674.6	-	3	592	c.306G>A	c.(304-306)caG>caA	p.Q102Q	RTTN_ENST00000437017.1_Silent_p.Q102Q|RTTN_ENST00000454359.1_Silent_p.Q102Q	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	102					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CAATTTCAGCCTGCAGATTTG	0.428																																																	0													110.0	108.0	109.0					18																	67871413		1897	4127	6024	SO:0001819	synonymous_variant	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.306G>A	18.37:g.67871413C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	37	CCDS42443.1																																																																																				0.428	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1		NM_173630	
SCN7A	6332	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	167328884	167328884	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr2:167328884G>A	ENST00000409855.1	-	5	641	c.515C>T	c.(514-516)tCa>tTa	p.S172L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	172					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S172L(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GAAGGAAAATGATCCTGCCCA	0.343																																																	2	Substitution - Missense(2)	kidney(2)											50.0	51.0	50.0					2																	167328884		1881	4147	6028	SO:0001583	missense	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.515C>T	2.37:g.167328884G>A	ENSP00000386796:p.Ser172Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860219	0.32884	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98567	-5.0;-5.0;-5.0	5.37	4.43	0.53597	Ion transport (1);	0.872025	0.09761	N	0.759317	D	0.96043	0.8711	L	0.38175	1.15	0.09310	N	1	P	0.35226	0.491	B	0.33846	0.171	D	0.92304	0.5852	10	0.72032	D	0.01	.	13.0407	0.58897	0.0:0.0:0.7734:0.2266	.	172	Q01118	SCN7A_HUMAN	L	172	ENSP00000386796:S172L;ENSP00000413699:S172L;ENSP00000403846:S172L	ENSP00000259060:S172L	S	-	2	0	SCN7A	167037130	0.000000	0.05858	0.184000	0.23157	0.935000	0.57460	-0.170000	0.09897	2.675000	0.91044	0.655000	0.94253	TCA		0.343	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			
SDHA	6389	hgsc.bcm.edu;ucsc.edu	37	5	236649	236649	+	Missense_Mutation	SNP	C	C	T	rs76896145	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:236649C>T	ENST00000264932.6	+	10	1482	c.1367C>T	c.(1366-1368)tCg>tTg	p.S456L	SDHA_ENST00000504309.1_Missense_Mutation_p.S456L|SDHA_ENST00000510361.1_Missense_Mutation_p.S408L	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	456					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GGGGCAAACTCGCTCTTGGAC	0.587									Familial Paragangliomas																																								0													91.0	82.0	85.0					5																	236649		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1367C>T	5.37:g.236649C>T	ENSP00000264932:p.Ser456Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	216|216	0.0989010989010989|0.0989010989010989	47|47	0.09552845528455285|0.09552845528455285	40|40	0.11049723756906077|0.11049723756906077	72|72	0.1258741258741259|0.1258741258741259	57|57	0.07519788918205805|0.07519788918205805	c|c	21.1|21.1	4.103578|4.103578	0.76983|0.76983	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000515815|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	.|T;T;T	.|0.74002	.|-0.8;-0.8;-0.8	5.01|5.01	5.01|5.01	0.66863|0.66863	.|Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	.|0.146175	.|0.47455	.|U	.|0.000231	T|T	0.15869|0.15869	0.0382|0.0382	H|H	0.99815|0.99815	4.805|4.805	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.964;1.0;1.0;1.0;1.0	.|P;D;D;D;D	.|0.85130	.|0.788;0.997;0.969;0.994;0.995	T|T	0.72484|0.72484	-0.4279|-0.4279	5|10	.|0.87932	.|D	.|0	.|.	16.16|16.16	0.81698|0.81698	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|408;456;50;456;456	.|E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040	.|.;.;.;.;DHSA_HUMAN	C|L	8|456;311;456;408	.|ENSP00000264932:S456L;ENSP00000426514:S456L;ENSP00000427703:S408L	.|ENSP00000264932:S456L	R|S	+|+	1|2	0|0	SDHA|SDHA	289649|289649	1.000000|1.000000	0.71417|0.71417	0.942000|0.942000	0.38095|0.38095	0.059000|0.059000	0.15707|0.15707	7.499000|7.499000	0.81566|0.81566	2.483000|2.483000	0.83821|0.83821	0.650000|0.650000	0.86243|0.86243	CGC|TCG		0.587	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1		NM_004168	
SLC12A7	10723	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	1065466	1065466	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr5:1065466G>A	ENST00000264930.5	-	18	2412	c.2369C>T	c.(2368-2370)aCg>aTg	p.T790M	MIR4635_ENST00000583759.1_RNA	NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	790					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.T790M(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CATGAGCACCGTGTTGTGCTT	0.647																																																	1	Substitution - Missense(1)	kidney(1)											66.0	66.0	66.0					5																	1065466		2203	4300	6503	SO:0001583	missense	10723			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2369C>T	5.37:g.1065466G>A	ENSP00000264930:p.Thr790Met	Somatic		WXS	Illumina HiSeq	Phase_I	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	g	23.3	4.405502	0.83230	.	.	ENSG00000113504	ENST00000264930	D	0.93763	-3.28	4.49	4.49	0.54785	.	0.055962	0.64402	D	0.000001	D	0.97049	0.9036	M	0.90483	3.12	0.58432	D	0.999995	D	0.89917	1.0	D	0.70716	0.97	D	0.98065	1.0395	10	0.87932	D	0	.	15.7172	0.77677	0.0:0.0:1.0:0.0	.	790	Q9Y666	S12A7_HUMAN	M	790	ENSP00000264930:T790M	ENSP00000264930:T790M	T	-	2	0	SLC12A7	1118466	1.000000	0.71417	0.960000	0.40013	0.820000	0.46376	8.621000	0.90949	2.055000	0.61198	0.467000	0.42956	ACG		0.647	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2		NM_006598	
SLC38A10	124565	hgsc.bcm.edu	37	17	79219501	79219503	+	In_Frame_Del	DEL	ATG	ATG	-	rs10569617|rs3833102|rs201518560	byFrequency	TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	ATG	ATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr17:79219501_79219503delATG	ENST00000374759.3	-	16	3596_3598	c.3213_3215delCAT	c.(3211-3216)atcatt>att	p.1071_1072II>I		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	1071				Missing (in Ref. 5; AAG17235). {ECO:0000305}.	amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GTTAAGGCCAATGATGACCCCAT	0.685														2114	0.422125	0.025	0.4712	5008	,	,		16375	0.6776		0.4364	False		,,,				2504	0.6462																0										353,3595		37,279,1658						-2.8	0.0		dbSNP_119	35	3598,4380		853,1892,1244	no	coding	SLC38A10	NM_001037984.1		890,2171,2902	A1A1,A1R,RR		45.099,8.9412,33.1293				3951,7975				SO:0001651	inframe_deletion	124565			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.3213_3215delCAT	17.37:g.79219504_79219506delATG	ENSP00000363891:p.Ile1072del	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZRC5|Q8NA99|Q96C66	In_Frame_Del	DEL	ENST00000374759.3	37	CCDS42397.1																																																																																				0.685	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1		NM_138570	
SLC44A3	126969	broad.mit.edu;ucsc.edu	37	1	95286513	95286513	+	Silent	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr1:95286513A>G	ENST00000271227.6	+	2	138	c.36A>G	c.(34-36)gcA>gcG	p.A12A	SLC44A3_ENST00000532427.1_Intron|SLC44A3_ENST00000527077.1_Intron|SLC44A3_ENST00000529450.1_Silent_p.A12A|SLC44A3_ENST00000446120.2_Intron|SLC44A3_ENST00000467909.1_Intron|LINC01057_ENST00000452922.1_lincRNA	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	12					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A12A(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	AGGTTTCTGCAGAAGGAGCCC	0.473																																																	1	Substitution - coding silent(1)	kidney(1)											143.0	120.0	127.0					1																	95286513		692	1591	2283	SO:0001819	synonymous_variant	126969			BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.36A>G	1.37:g.95286513A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Silent	SNP	ENST00000271227.6	37	CCDS44176.1																																																																																				0.473	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3		NM_152369	
SLK	9748	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	105750469	105750469	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr10:105750469A>G	ENST00000369755.3	+	2	732	c.187A>G	c.(187-189)Aaa>Gaa	p.K63E	SLK_ENST00000335753.4_Missense_Mutation_p.K63E	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	63	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.K63E(1)		kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AGCTGCTGCAAAAGTGATTGA	0.328																																					NSCLC(111;540 1651 1927 4474 17706)												1	Substitution - Missense(1)	kidney(1)											111.0	105.0	107.0					10																	105750469		2203	4300	6503	SO:0001583	missense	9748				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.187A>G	10.37:g.105750469A>G	ENSP00000358770:p.Lys63Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	A	33	5.239971	0.95240	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	D;D	0.85258	-1.96;-1.96	5.97	5.97	0.96955	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95557	0.8556	H	0.97874	4.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97220	0.9877	10	0.87932	D	0	.	16.4608	0.84044	1.0:0.0:0.0:0.0	.	63;63	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	E	63	ENSP00000336824:K63E;ENSP00000358770:K63E	ENSP00000336824:K63E	K	+	1	0	SLK	105740459	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.213000	0.95133	2.288000	0.76882	0.533000	0.62120	AAA		0.328	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1		NM_014720	
SNX25	83891	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	186244946	186244946	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr4:186244946G>A	ENST00000504273.1	+	9	1543	c.1249G>A	c.(1249-1251)Gat>Aat	p.D417N	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Missense_Mutation_p.D417N			Q9H3E2	SNX25_HUMAN	sorting nexin 25	417					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.D417N(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TTCCAACAAGGATGAGATGGT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											50.0	46.0	47.0					4																	186244946		2203	4298	6501	SO:0001583	missense	83891			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1249G>A	4.37:g.186244946G>A	ENSP00000426255:p.Asp417Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	.	17.93	3.508396	0.64410	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.10099	2.91;2.91	5.82	4.98	0.66077	.	0.571224	0.20053	N	0.100247	T	0.12390	0.0301	L	0.47716	1.5	0.45837	D	0.998706	P;P	0.43094	0.799;0.651	B;B	0.40901	0.343;0.154	T	0.11817	-1.0572	10	0.21540	T	0.41	-9.1468	14.9378	0.70970	0.0684:0.0:0.9316:0.0	.	188;417	Q8N6K3;Q9H3E2	.;SNX25_HUMAN	N	417	ENSP00000426255:D417N;ENSP00000264694:D417N	ENSP00000264694:D417N	D	+	1	0	SNX25	186481940	1.000000	0.71417	0.896000	0.35187	0.469000	0.32828	4.800000	0.62524	1.473000	0.48159	-0.258000	0.10820	GAT		0.348	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1		NM_031953	
SPNS3	201305	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	4389784	4389784	+	Silent	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr17:4389784C>T	ENST00000355530.2	+	11	1636	c.1356C>T	c.(1354-1356)tgC>tgT	p.C452C	RP13-580F15.2_ENST00000577064.1_RNA|SPNS3_ENST00000333476.2_Silent_p.C325C|RP13-580F15.2_ENST00000577176.1_RNA|RP13-580F15.2_ENST00000576086.1_RNA	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	452					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.C452C(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						GCTTCCTGTGCTGCGCCTTTG	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											34.0	37.0	36.0					17																	4389784		2203	4300	6503	SO:0001819	synonymous_variant	201305				CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1356C>T	17.37:g.4389784C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IZ31	Silent	SNP	ENST00000355530.2	37	CCDS11045.1																																																																																				0.652	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1		NM_182538	
SPRED2	200734	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	65541212	65541212	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr2:65541212C>T	ENST00000356388.4	-	6	869	c.680G>A	c.(679-681)gGg>gAg	p.G227E	SPRED2_ENST00000474228.1_5'Flank|SPRED2_ENST00000443619.2_Missense_Mutation_p.G224E	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	227	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.G227E(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						ATCCTCGTACCCCGTCATCCA	0.672																																																	1	Substitution - Missense(1)	kidney(1)											52.0	49.0	50.0					2																	65541212		2203	4300	6503	SO:0001583	missense	200734			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.680G>A	2.37:g.65541212C>T	ENSP00000348753:p.Gly227Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Missense_Mutation	SNP	ENST00000356388.4	37	CCDS33211.1	.	.	.	.	.	.	.	.	.	.	c	28.0	4.882407	0.91740	.	.	ENSG00000198369	ENST00000356388;ENST00000443619;ENST00000452315;ENST00000421087	T;T;T;T	0.80214	-1.31;-1.34;-1.35;-0.24	5.55	5.55	0.83447	c-Kit-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.89427	0.6712	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.88424	0.3030	10	0.44086	T	0.13	-26.2523	19.5022	0.95100	0.0:1.0:0.0:0.0	.	224;227	E9PEP0;Q7Z698	.;SPRE2_HUMAN	E	227;224;242;109	ENSP00000348753:G227E;ENSP00000393697:G224E;ENSP00000390595:G242E;ENSP00000407627:G109E	ENSP00000348753:G227E	G	-	2	0	SPRED2	65394716	1.000000	0.71417	0.428000	0.26697	0.955000	0.61496	7.747000	0.85070	2.608000	0.88229	0.586000	0.80456	GGG		0.672	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1			
SYDE1	85360	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	15223181	15223181	+	Missense_Mutation	SNP	C	C	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr19:15223181C>A	ENST00000342784.2	+	7	1634	c.1603C>A	c.(1603-1605)Cac>Aac	p.H535N	SYDE1_ENST00000600440.1_Missense_Mutation_p.H468N|SYDE1_ENST00000600252.1_Missense_Mutation_p.H192N	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	535	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)	p.H535N(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						TCTCCTGGACCACCTGCGCCT	0.627																																																	1	Substitution - Missense(1)	kidney(1)											67.0	49.0	55.0					19																	15223181		2203	4297	6500	SO:0001583	missense	85360			BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1603C>A	19.37:g.15223181C>A	ENSP00000341489:p.His535Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	ENST00000342784.2	37	CCDS12324.1	.	.	.	.	.	.	.	.	.	.	C	31	5.071350	0.93950	.	.	ENSG00000105137	ENST00000342784	T	0.25912	1.77	5.82	5.82	0.92795	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.68586	0.3017	H	0.98133	4.155	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.997;1.0	T	0.80603	-0.1309	10	0.87932	D	0	.	17.5829	0.87973	0.0:1.0:0.0:0.0	.	468;468;535	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	N	535	ENSP00000341489:H535N	ENSP00000341489:H535N	H	+	1	0	SYDE1	15084181	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.249000	0.78278	2.765000	0.95021	0.591000	0.81541	CAC		0.627	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1		NM_033025	
TEK	7010	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	27202840	27202840	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr9:27202840C>G	ENST00000380036.4	+	13	2374	c.1932C>G	c.(1930-1932)aaC>aaG	p.N644K	TEK_ENST00000406359.4_Missense_Mutation_p.N601K|TEK_ENST00000519097.1_Missense_Mutation_p.N497K	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	644	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N644K(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	AACCAGAAAACATCAAGATTT	0.343																																																	1	Substitution - Missense(1)	kidney(1)											129.0	130.0	130.0					9																	27202840		2203	4300	6503	SO:0001583	missense	7010			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1932C>G	9.37:g.27202840C>G	ENSP00000369375:p.Asn644Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854143	0.32791	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359;ENST00000519080	T;T;T;T	0.61274	0.12;0.12;0.12;2.8	5.79	0.161	0.14977	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.241077	0.28971	N	0.013543	T	0.46870	0.1415	L	0.27053	0.805	0.43065	D	0.994693	P;B;B;B	0.38711	0.643;0.011;0.0;0.008	P;B;B;B	0.46479	0.518;0.033;0.008;0.015	T	0.38714	-0.9648	10	0.56958	D	0.05	.	6.8933	0.24243	0.1164:0.5721:0.0:0.3115	.	497;677;601;644	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	K	497;644;601;454	ENSP00000430686:N497K;ENSP00000369375:N644K;ENSP00000383977:N601K;ENSP00000428337:N454K	ENSP00000369375:N644K	N	+	3	2	TEK	27192840	0.998000	0.40836	0.999000	0.59377	0.979000	0.70002	0.494000	0.22467	0.101000	0.17610	-0.857000	0.03018	AAC		0.343	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3			
TOM1L2	146691	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	17810845	17810845	+	Splice_Site	SNP	T	T	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr17:17810845T>A	ENST00000379504.3	-	2	136	c.53A>T	c.(52-54)gAa>gTa	p.E18V	TOM1L2_ENST00000540946.1_Splice_Site_p.E18V|TOM1L2_ENST00000535933.1_Splice_Site_p.E18V|TOM1L2_ENST00000581396.1_Splice_Site_p.E18V|TOM1L2_ENST00000542206.1_Splice_Site_p.E18V|TOM1L2_ENST00000318094.10_Splice_Site_p.E18V|TOM1L2_ENST00000395739.4_Splice_Site_p.E18V	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	18					intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)	p.E18V(2)		endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					TGTTGCCTTTTCTGTGAAATC	0.483																																					Melanoma(192;2505 2909 14455 25269)												2	Substitution - Missense(2)	kidney(2)											98.0	81.0	86.0					17																	17810845		2203	4300	6503	SO:0001630	splice_region_variant	146691			AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.53-1A>T	17.37:g.17810845T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Missense_Mutation	SNP	ENST00000379504.3	37	CCDS42270.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534684	0.85812	.	.	ENSG00000175662	ENST00000379504;ENST00000318094;ENST00000395739;ENST00000535933;ENST00000540946;ENST00000542206;ENST00000537091	T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7	4.77	4.77	0.60923	VHS subgroup (1);ENTH/VHS (2);VHS (1);	0.095856	0.64402	D	0.000001	T	0.59500	0.2198	M	0.92122	3.275	0.34608	D	0.717288	D;D;D;P;D;D;D	0.89917	0.999;1.0;0.968;0.604;1.0;1.0;1.0	D;D;D;P;D;D;D	0.91635	0.996;0.997;0.978;0.676;0.998;0.999;0.999	T	0.77938	-0.2400	10	0.87932	D	0	.	13.4003	0.60879	0.0:0.0:0.0:1.0	.	18;18;18;18;18;18;18	B7Z8F0;B7Z2U2;F5H3S6;B7Z2L7;Q6ZVM7-3;Q6ZVM7;Q6ZVM7-2	.;.;.;.;.;TM1L2_HUMAN;.	V	18	ENSP00000368818:E18V;ENSP00000312860:E18V;ENSP00000379088:E18V;ENSP00000438621:E18V;ENSP00000437655:E18V;ENSP00000445188:E18V	ENSP00000312860:E18V	E	-	2	0	TOM1L2	17751570	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.116000	0.77119	2.011000	0.59026	0.482000	0.46254	GAA		0.483	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131928.1			Missense_Mutation
TTI1	9675	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	36641291	36641291	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr20:36641291G>T	ENST00000373448.2	-	3	1166	c.928C>A	c.(928-930)Ctg>Atg	p.L310M	TTI1_ENST00000449821.1_Missense_Mutation_p.L310M|TTI1_ENST00000373447.3_Missense_Mutation_p.L310M|TTI1_ENST00000487362.1_Intron	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	310					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.L310M(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AGTTCTACCAGTTCCAGTCTC	0.433																																																	1	Substitution - Missense(1)	kidney(1)											125.0	125.0	125.0					20																	36641291		2203	4300	6503	SO:0001583	missense	9675			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.928C>A	20.37:g.36641291G>T	ENSP00000362547:p.Leu310Met	Somatic		WXS	Illumina HiSeq	Phase_I	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288250	0.40494	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.67698	-0.28;-0.28;-0.28	5.64	3.62	0.41486	Armadillo-like helical (1);Armadillo-type fold (1);	0.125725	0.56097	D	0.000029	T	0.66896	0.2836	M	0.62723	1.935	0.48452	D	0.999653	P	0.46784	0.884	P	0.47162	0.54	T	0.66578	-0.5888	10	0.49607	T	0.09	-6.3216	10.0005	0.41927	0.0781:0.1356:0.7863:0.0	.	310	O43156	TTI1_HUMAN	M	310	ENSP00000362547:L310M;ENSP00000362546:L310M;ENSP00000407270:L310M	ENSP00000362546:L310M	L	-	1	2	TTI1	36074705	0.983000	0.35010	0.873000	0.34254	0.936000	0.57629	1.515000	0.35845	0.861000	0.35504	-0.355000	0.07637	CTG		0.433	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2		NM_014657	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179439168	179439168	+	Nonsense_Mutation	SNP	A	A	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr2:179439168A>C	ENST00000591111.1	-	276	66992	c.66768T>G	c.(66766-66768)taT>taG	p.Y22256*	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y14957*|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y14832*|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y15024*|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y21329*|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y23897*|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22256	Fibronectin type-III 61. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Y15024*(1)|p.Y21327*(1)|p.Y21329*(1)|p.Y14832*(1)|p.Y14957*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCGGAACTCATAAGCAATAC	0.438																																																	5	Substitution - Nonsense(5)	kidney(5)											229.0	228.0	228.0					2																	179439168		1929	4128	6057	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66768T>G	2.37:g.179439168A>C	ENSP00000465570:p.Tyr22256*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	62	68.887003	0.99991	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.9003	0.79369	1.0:0.0:0.0:0.0	.	.	.	.	X	21329;14832;15024;14957;14830	.	ENSP00000340554:Y15024X	Y	-	3	2	TTN	179147414	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.476000	0.81055	2.166000	0.68216	0.455000	0.32223	TAT		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
HNRNPKP3	399881	broad.mit.edu	37	11	43283988	43283988	+	RNA	SNP	T	T	C			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr11:43283988T>C	ENST00000511537.1	-	0	947					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		CATGTATCTATTGCAGAGTCC	0.483																																																	0																																												0					11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283988T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000511537.1	37																																																																																					0.483	HNRNPKP3-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390385.1		NR_033868	
LOC100288069	100288069	broad.mit.edu	37	1	700532	700532	+	lincRNA	DEL	T	T	-			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr1:700532delT	ENST00000428504.1	-	0	1021				RP11-206L10.5_ENST00000417659.1_lincRNA	NR_033908.1																						aaaaaaaaaaTTCCTTTGGGA	0.453																																																	0																																												0																															1.37:g.700532delT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000428504.1	37																																																																																					0.453	RP11-206L10.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000006889.1			
BCRP7	100133163	broad.mit.edu	37	22	18844615	18844615	+	3'UTR	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr22:18844615A>G	ENST00000412938.1	+	0	2865																											CCTCCTTGAGAAATATGGATG	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*2862A>G	22.37:g.18844615A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000412938.1	37																																																																																					0.552	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000471615.1			
XKR4	114786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	56436104	56436104	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr8:56436104G>T	ENST00000327381.6	+	3	1371	c.1271G>T	c.(1270-1272)tGt>tTt	p.C424F	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	424						integral component of membrane (GO:0016021)		p.C424F(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			ACAGAATTCTGTATCACCAAA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											255.0	225.0	235.0					8																	56436104		2203	4300	6503	SO:0001583	missense	114786			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1271G>T	8.37:g.56436104G>T	ENSP00000328326:p.Cys424Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934421	0.73442	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.65178	-0.14	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.80793	0.4691	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80207	-0.1478	10	0.48119	T	0.1	-17.9226	19.819	0.96583	0.0:0.0:1.0:0.0	.	424	Q5GH76	XKR4_HUMAN	F	424	ENSP00000328326:C424F	ENSP00000328326:C424F	C	+	2	0	XKR4	56598658	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.869000	0.99810	2.691000	0.91804	0.655000	0.94253	TGT		0.483	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2		NM_052898	
YME1L1	10730	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	27420850	27420850	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr10:27420850C>G	ENST00000326799.3	-	9	1115	c.967G>C	c.(967-969)Ggg>Cgg	p.G323R	YME1L1_ENST00000463270.1_5'UTR|YME1L1_ENST00000375972.3_Missense_Mutation_p.G233R|YME1L1_ENST00000376016.3_Missense_Mutation_p.G266R	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	323					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.G323R(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						GAATCAAGCCCTGTTGTTGTC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											127.0	121.0	123.0					10																	27420850		2203	4300	6503	SO:0001583	missense	10730			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.967G>C	10.37:g.27420850C>G	ENSP00000318480:p.Gly323Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336107	0.81801	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122;ENST00000427324	D;D;D	0.93547	-3.21;-3.24;-3.16	5.49	5.49	0.81192	Peptidase M41, FtsH (2);	0.089887	0.85682	D	0.000000	D	0.95758	0.8620	M	0.74881	2.28	0.80722	D	1	D;B;D	0.63880	0.992;0.234;0.993	D;B;P	0.62955	0.909;0.135;0.883	D	0.95660	0.8714	10	0.72032	D	0.01	-14.1135	13.4861	0.61366	0.0:0.9189:0.0:0.0811	.	233;266;323	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	R	266;323;323;233;69;233	ENSP00000365184:G266R;ENSP00000318480:G323R;ENSP00000365139:G233R	ENSP00000318480:G323R	G	-	1	0	YME1L1	27460856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.723000	0.68492	2.744000	0.94065	0.650000	0.86243	GGG		0.373	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1		NM_139312	
ZNF714	148206	broad.mit.edu;hgsc.bcm.edu	37	19	21300510	21300510	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr19:21300510A>G	ENST00000596143.1	+	5	1365	c.1040A>G	c.(1039-1041)aAa>aGa	p.K347R	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K452R(1)|p.K347R(1)		endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						GAATGTGGCAAAGCCTTTAAT	0.388																																																	2	Substitution - Missense(2)	kidney(2)											41.0	44.0	43.0					19																	21300510		2177	4290	6467	SO:0001583	missense	148206			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.1040A>G	19.37:g.21300510A>G	ENSP00000472368:p.Lys347Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	37	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	11.22	1.573376	0.28092	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.955	0.955	0.19602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50905	0.1643	L	0.42581	1.335	0.26162	N	0.979991	D;P;D	0.63046	0.99;0.665;0.992	D;B;D	0.81914	0.951;0.264;0.995	T	0.34229	-0.9837	8	0.66056	D	0.02	.	6.9761	0.24677	1.0:0.0:0.0:0.0	.	348;347;348	Q96N38-2;A6NEM4;Q96N38	.;.;ZN714_HUMAN	R	347	.	ENSP00000291770:K347R	K	+	2	0	ZNF714	21092350	1.000000	0.71417	0.360000	0.25837	0.348000	0.29142	6.237000	0.72345	0.378000	0.24764	0.369000	0.22263	AAA		0.388	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1		NM_182515	
ZNF180	7733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	45004270	45004270	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chr19:45004270G>A	ENST00000221327.4	-	1	304	c.23C>T	c.(22-24)aCg>aTg	p.T8M	ZNF180_ENST00000391956.4_Missense_Mutation_p.T8M|CEACAM20_ENST00000454753.1_RNA|ZNF180_ENST00000592529.1_Intron|ZNF180_ENST00000586637.1_Intron|ZNF180_ENST00000587047.1_Missense_Mutation_p.T8M|ZNF180_ENST00000585514.1_5'UTR	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T8M(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				AGCTTCCCGCGTAGACCCTGC	0.672											OREG0025537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(180;1353 2003 32862 46574 49854)												1	Substitution - Missense(1)	kidney(1)											149.0	135.0	140.0					19																	45004270		2203	4300	6503	SO:0001583	missense	7733			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.23C>T	19.37:g.45004270G>A	ENSP00000221327:p.Thr8Met	Somatic	928	WXS	Illumina HiSeq	Phase_I	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769312	0.31320	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.07567	3.18;3.18	3.47	1.35	0.21983	.	.	.	.	.	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	B;B	0.22276	0.067;0.04	B;B	0.09377	0.004;0.002	T	0.40156	-0.9578	9	0.46703	T	0.11	.	4.8159	0.13367	0.0:0.6528:0.2251:0.1221	.	8;8	G5E9B8;Q9UJW8	.;ZN180_HUMAN	M	8	ENSP00000221327:T8M;ENSP00000375818:T8M	ENSP00000221327:T8M	T	-	2	0	ZNF180	49696110	0.000000	0.05858	0.002000	0.10522	0.039000	0.13416	0.072000	0.14617	0.476000	0.27440	-0.139000	0.14373	ACG		0.672	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1		NM_013256	
KDM5C	8242	ucsc.edu	37	X	53247143	53247143	+	Silent	SNP	C	C	G			TCGA-B2-5641-01A-01D-1534-10	TCGA-B2-5641-10A-01D-1535-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	b49d3bb5-74fe-4ff0-9b47-131bcb455855	d7319ab4-8498-4599-aad8-54ab2174c541	g.chrX:53247143C>G	ENST00000375401.3	-	4	889	c.357G>C	c.(355-357)gtG>gtC	p.V119V	KDM5C_ENST00000452825.3_Silent_p.V52V|KDM5C_ENST00000375379.3_Silent_p.V119V|KDM5C_ENST00000375383.3_Silent_p.V78V|KDM5C_ENST00000404049.3_Silent_p.V119V	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	119	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.?(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTTCCTCCACCACAATCTGAA	0.498			"""N, F, S"""		clear cell renal carcinoma																																	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Unknown(1)	kidney(1)											55.0	44.0	48.0					X																	53247143		2203	4300	6503	SO:0001819	synonymous_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.357G>C	X.37:g.53247143C>G		Somatic		WXS	Illumina HiSeq	.	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	ENST00000375401.3	37	CCDS14351.1																																																																																				0.498	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
