#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ARID5B	84159	hgsc.bcm.edu;ucsc.edu	37	10	63661481	63661481	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr10:63661481T>G	ENST00000279873.7	+	1	423	c.13T>G	c.(13-15)Tca>Gca	p.S5A		NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	5					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					GGAGCCCAACTCACTCCAGGT	0.582																																																	0													134.0	113.0	120.0					10																	63661481		2203	4300	6503	SO:0001583	missense	84159			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.13T>G	10.37:g.63661481T>G	ENSP00000279873:p.Ser5Ala	Somatic		WXS	SOLID	Phase_I	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.148936	0.37923	.	.	ENSG00000150347	ENST00000279873	T	0.46451	0.87	5.55	5.55	0.83447	.	0.076399	0.53938	D	0.000043	T	0.45875	0.1364	N	0.12182	0.205	0.80722	D	1	D;B	0.61697	0.99;0.003	D;B	0.73380	0.98;0.003	T	0.48445	-0.9035	10	0.37606	T	0.19	-9.9479	14.9813	0.71313	0.0:0.0:0.0:1.0	.	5;5	Q14865-3;Q14865	.;ARI5B_HUMAN	A	5	ENSP00000279873:S5A	ENSP00000279873:S5A	S	+	1	0	ARID5B	63331487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.099000	0.64554	2.244000	0.73946	0.459000	0.35465	TCA		0.582	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1		XM_084482	
BCL6	604	hgsc.bcm.edu	37	3	187447718	187447718	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr3:187447718C>A	ENST00000406870.2	-	5	841	c.475G>T	c.(475-477)Ggt>Tgt	p.G159C	RP11-211G3.3_ENST00000449623.1_Intron|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.G159C|BCL6_ENST00000232014.4_Missense_Mutation_p.G159C	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	159					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G159S(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		ACCTCACGACCCCGATAGGCC	0.592			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	1	Substitution - Missense(1)	central_nervous_system(1)											69.0	69.0	69.0					3																	187447718		2203	4300	6503	SO:0001583	missense	604				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.475G>T	3.37:g.187447718C>A	ENSP00000384371:p.Gly159Cys	Somatic		WXS	SOLID	Phase_I	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929308	0.52759	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.08193	3.12;3.12;3.13	5.36	2.55	0.30701	.	0.244821	0.49305	D	0.000141	T	0.11580	0.0282	L	0.36672	1.1	0.34921	D	0.748431	D;D	0.57257	0.97;0.979	B;P	0.52710	0.436;0.707	T	0.17198	-1.0377	10	0.59425	D	0.04	.	9.3147	0.37926	0.0:0.6351:0.0:0.3649	.	159;159	B8PSA7;P41182	.;BCL6_HUMAN	C	159	ENSP00000384371:G159C;ENSP00000232014:G159C;ENSP00000413122:G159C	ENSP00000232014:G159C	G	-	1	0	BCL6	188930412	0.161000	0.22892	0.941000	0.38009	0.993000	0.82548	0.469000	0.22067	0.757000	0.33036	0.561000	0.74099	GGT		0.592	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1		NM_138931	
C12orf45	121053	hgsc.bcm.edu	37	12	105380152	105380152	+	Missense_Mutation	SNP	A	A	C	rs1129593|rs11554637	byFrequency	TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr12:105380152A>C	ENST00000552951.1	+	1	65	c.22A>C	c.(22-24)Aag>Cag	p.K8Q	C12orf45_ENST00000280749.5_Missense_Mutation_p.K8Q	NM_152318.2	NP_689531.2	Q8N5I9	CL045_HUMAN	chromosome 12 open reading frame 45	8			K -> Q (in dbSNP:rs1129593).							large_intestine(1)|lung(2)	3						TGGCAAGCCCAAGGCTAGCCC	0.662													C|||	2021	0.403554	0.6641	0.2767	5008	,	,		14115	0.502		0.2485	False		,,,				2504	0.1994																0								C	GLN/LYS	2236,1686		644,948,369	21.0	27.0	25.0		22	-0.5	0.0	12	dbSNP_86	25	1851,6455		204,1443,2506	yes	missense	C12orf45	NM_152318.2	53	848,2391,2875	CC,CA,AA		22.2851,42.9883,33.4233	benign	8/186	105380152	4087,8141	1961	4153	6114	SO:0001583	missense	121053			BC032326	CCDS41825.1	12q23.3	2012-05-30			ENSG00000151131	ENSG00000151131			28628	protein-coding gene	gene with protein product						12477932	Standard	NM_152318		Approved	MGC40397	uc001tlb.3	Q8N5I9	OTTHUMG00000169822	ENST00000552951.1:c.22A>C	12.37:g.105380152A>C	ENSP00000447057:p.Lys8Gln	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000552951.1	37	CCDS41825.1	917	0.4198717948717949	320	0.6504065040650406	107	0.2955801104972376	307	0.5367132867132867	183	0.24142480211081793	C	1.394	-0.580017	0.03854	0.570117	0.222851	ENSG00000151131	ENST00000552951;ENST00000280749	T;T	0.30182	1.54;1.57	3.7	-0.504	0.11997	.	2.072210	0.02429	N	0.083336	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40608	-0.9554	9	0.09084	T	0.74	-7.9944	4.5687	0.12200	0.136:0.2394:0.524:0.1006	rs1129593;rs17845994;rs17858978;rs59115175;rs1129593	8	Q8N5I9	CL045_HUMAN	Q	8	ENSP00000447057:K8Q;ENSP00000280749:K8Q	ENSP00000280749:K8Q	K	+	1	0	C12orf45	103904282	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.538000	0.06120	-0.363000	0.08101	-0.225000	0.12378	AAG		0.662	C12orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406076.1		NM_152318	
ERICH3	127254	hgsc.bcm.edu	37	1	75102070	75102070	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr1:75102070A>G	ENST00000326665.5	-	6	715	c.497T>C	c.(496-498)tTa>tCa	p.L166S	C1orf173_ENST00000420661.2_5'Flank	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		166										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AAGAGGCTGTAATCGAATTGG	0.418																																																	0													224.0	233.0	230.0					1																	75102070		2203	4300	6503	SO:0001583	missense	127254																														ENST00000326665.5:c.497T>C	1.37:g.75102070A>G	ENSP00000322609:p.Leu166Ser	Somatic		WXS	SOLID	Phase_I	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.001059	0.54254	.	.	ENSG00000178965	ENST00000326665	T	0.17691	2.26	5.65	5.65	0.86999	.	.	.	.	.	T	0.29093	0.0723	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01748	-1.1282	9	0.40728	T	0.16	-2.2757	14.8655	0.70412	1.0:0.0:0.0:0.0	.	166	Q5RHP9	CA173_HUMAN	S	166	ENSP00000322609:L166S	ENSP00000322609:L166S	L	-	2	0	C1orf173	74874658	1.000000	0.71417	0.991000	0.47740	0.309000	0.27889	6.287000	0.72671	2.150000	0.67090	0.455000	0.32223	TTA		0.418	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			
SHCBP1L	81626	hgsc.bcm.edu	37	1	182869245	182869245	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr1:182869245C>G	ENST00000367547.3	-	10	2071	c.1835G>C	c.(1834-1836)aGg>aCg	p.R612T	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_Missense_Mutation_p.R493T	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	684										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TGAAGAAGCCCTTTTGTTGAG	0.323																																																	0													67.0	66.0	66.0					1																	182869245		2203	4299	6502	SO:0001583	missense	0			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.1835G>C	1.37:g.182869245C>G	ENSP00000356518:p.Arg612Thr	Somatic		WXS	SOLID	Phase_I	Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	ENST00000367547.3	37	CCDS30955.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645450	0.29246	.	.	ENSG00000157060	ENST00000367547;ENST00000287709;ENST00000423786	T;T	0.41065	1.01;1.02	5.56	4.64	0.57946	Pectin lyase fold/virulence factor (1);	0.334072	0.26065	N	0.026545	T	0.19087	0.0458	N	0.08118	0	0.23802	N	0.996803	B;B;B	0.31383	0.321;0.039;0.175	B;B;B	0.30251	0.113;0.043;0.043	T	0.14117	-1.0484	10	0.15499	T	0.54	-13.3422	7.5892	0.28010	0.0:0.8341:0.0:0.1659	.	684;493;612	Q9BZQ2;Q9BZQ2-2;Q9BZQ2-3	SHP1L_HUMAN;.;.	T	612;681;493	ENSP00000356518:R612T;ENSP00000397308:R493T	ENSP00000287709:R681T	R	-	2	0	SHCBP1L	181135868	0.950000	0.32346	1.000000	0.80357	0.830000	0.47004	0.908000	0.28545	2.617000	0.88574	0.585000	0.79938	AGG		0.323	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1		NM_030933	
CARD10	29775	hgsc.bcm.edu	37	22	37891824	37891824	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr22:37891824C>A	ENST00000403299.1	-	15	2462	c.2246G>T	c.(2245-2247)cGg>cTg	p.R749L	CARD10_ENST00000406271.3_Missense_Mutation_p.R463L|CARD10_ENST00000251973.5_Missense_Mutation_p.R749L			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	749					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GGGGTCAACCCGGGTGCAGAA	0.637																																																	0													56.0	50.0	52.0					22																	37891824		2203	4300	6503	SO:0001583	missense	29775			AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2246G>T	22.37:g.37891824C>A	ENSP00000384570:p.Arg749Leu	Somatic		WXS	SOLID	Phase_I	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076594	0.76415	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973;ENST00000437756	T;T;T;T	0.51574	0.7;2.33;0.7;1.06	4.98	4.98	0.66077	.	0.258920	0.33572	N	0.004776	T	0.68686	0.3028	M	0.75615	2.305	0.39097	D	0.961218	D;P	0.89917	1.0;0.934	D;P	0.85130	0.997;0.718	T	0.72827	-0.4175	10	0.49607	T	0.09	-35.7438	16.4258	0.83814	0.0:1.0:0.0:0.0	.	749;463	Q9BWT7;Q8NC81	CAR10_HUMAN;.	L	749;463;749;390	ENSP00000384570:R749L;ENSP00000385799:R463L;ENSP00000251973:R749L;ENSP00000416239:R390L	ENSP00000251973:R749L	R	-	2	0	CARD10	36221770	0.998000	0.40836	0.422000	0.26621	0.972000	0.66771	5.380000	0.66202	2.289000	0.77006	0.561000	0.74099	CGG		0.637	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1		NM_014550	
CDH22	64405	hgsc.bcm.edu	37	20	44869833	44869833	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr20:44869833C>A	ENST00000372262.3	-	2	719	c.319G>T	c.(319-321)Ggg>Tgg	p.G107W	CDH22_ENST00000537909.1_Missense_Mutation_p.G107W	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	107	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				AAGATGGTCCCAGCACCCTCG	0.612																																																	0													78.0	66.0	70.0					20																	44869833		2203	4300	6503	SO:0001583	missense	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.319G>T	20.37:g.44869833C>A	ENSP00000361336:p.Gly107Trp	Somatic		WXS	SOLID	Phase_I	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955545	0.73902	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.55234	0.53;0.53	4.42	4.42	0.53409	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.82181	0.4981	H	0.97340	3.985	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.88930	0.3372	10	0.87932	D	0	.	16.5845	0.84724	0.0:1.0:0.0:0.0	.	107	Q9UJ99	CAD22_HUMAN	W	107	ENSP00000361336:G107W;ENSP00000437790:G107W	ENSP00000361336:G107W	G	-	1	0	CDH22	44303240	1.000000	0.71417	0.963000	0.40424	0.955000	0.61496	5.584000	0.67490	2.475000	0.83589	0.455000	0.32223	GGG		0.612	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1		NM_021248	
CENPE	1062	hgsc.bcm.edu	37	4	104115562	104115562	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr4:104115562C>T	ENST00000265148.3	-	7	685	c.596G>A	c.(595-597)aGa>aAa	p.R199K	CENPE_ENST00000380026.3_Missense_Mutation_p.R199K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	199	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ACGACTGCTTCTTTGATTCAT	0.313																																																	0													99.0	103.0	102.0					4																	104115562		2203	4300	6503	SO:0001583	missense	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.596G>A	4.37:g.104115562C>T	ENSP00000265148:p.Arg199Lys	Somatic		WXS	SOLID	Phase_I	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172204	0.78452	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705;ENST00000514974	T;T;T;T	0.74421	-0.84;-0.84;-0.84;2.27	5.24	5.24	0.73138	Kinesin, motor domain (5);	.	.	.	.	T	0.78104	0.4231	L	0.35644	1.08	0.50632	D	0.999884	P;D	0.89917	0.956;1.0	P;D	0.87578	0.776;0.998	T	0.77024	-0.2741	9	0.45353	T	0.12	.	9.579	0.39477	0.0:0.8383:0.0:0.1617	.	199;199	Q02224-3;Q02224	.;CENPE_HUMAN	K	199;199;199;199;159	ENSP00000265148:R199K;ENSP00000369365:R199K;ENSP00000423981:R199K;ENSP00000426023:R159K	ENSP00000265148:R199K	R	-	2	0	CENPE	104335011	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.620000	0.54203	2.605000	0.88082	0.591000	0.81541	AGA		0.313	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
CHD9	80205	hgsc.bcm.edu	37	16	53358033	53358033	+	Silent	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr16:53358033G>A	ENST00000398510.3	+	38	8007	c.7920G>A	c.(7918-7920)aaG>aaA	p.K2640K	CHD9_ENST00000566029.1_Silent_p.K2624K|CHD9_ENST00000564845.1_Silent_p.K2624K|CHD9_ENST00000447540.1_Silent_p.K2625K			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2640	Poly-Ala.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GAATTGCAAAGGCCACAGCAG	0.507																																																	0													100.0	101.0	101.0					16																	53358033		1927	4139	6066	SO:0001819	synonymous_variant	80205			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.7920G>A	16.37:g.53358033G>A		Somatic		WXS	SOLID	Phase_I	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	37																																																																																					0.507	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1		NM_025134	
CHRM5	1133	hgsc.bcm.edu;ucsc.edu	37	15	34356453	34356453	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr15:34356453G>A	ENST00000383263.5	+	3	2205	c.1535G>A	c.(1534-1536)tGc>tAc	p.C512Y	CHRM5_ENST00000557872.1_Missense_Mutation_p.C512Y	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	512					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CTGCTTCTCTGCCGATGGAAA	0.463																																																	0													77.0	82.0	80.0					15																	34356453		2201	4298	6499	SO:0001583	missense	1133				CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.1535G>A	15.37:g.34356453G>A	ENSP00000372750:p.Cys512Tyr	Somatic		WXS	SOLID	Phase_I	Q96RG7	Missense_Mutation	SNP	ENST00000383263.5	37	CCDS10031.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.790829	0.70452	.	.	ENSG00000184984	ENST00000383263	T	0.42513	0.97	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.70422	0.3222	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74377	-0.3685	10	0.87932	D	0	-19.4662	19.4929	0.95059	0.0:0.0:1.0:0.0	.	512	P08912	ACM5_HUMAN	Y	512	ENSP00000372750:C512Y	ENSP00000372750:C512Y	C	+	2	0	CHRM5	32143745	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.835000	0.97688	0.650000	0.86243	TGC		0.463	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251521.2			
CLSTN2	64084	hgsc.bcm.edu	37	3	140140114	140140114	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr3:140140114A>G	ENST00000458420.3	+	5	975	c.785A>G	c.(784-786)cAa>cGa	p.Q262R		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	262	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCTGGCTGGCAAGGTGGGCCT	0.502										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													134.0	129.0	131.0					3																	140140114		2203	4300	6503	SO:0001583	missense	64084			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.785A>G	3.37:g.140140114A>G	ENSP00000402460:p.Gln262Arg	Somatic		WXS	SOLID	Phase_I	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531671	0.64972	.	.	ENSG00000158258	ENST00000458420	T	0.60548	0.18	5.7	5.7	0.88788	Cadherin (1);	0.062950	0.64402	D	0.000003	T	0.57989	0.2091	M	0.65677	2.01	0.80722	D	1	P	0.40250	0.709	B	0.40410	0.328	T	0.58973	-0.7541	10	0.34782	T	0.22	-18.1048	13.9254	0.63959	1.0:0.0:0.0:0.0	.	262	Q9H4D0	CSTN2_HUMAN	R	262	ENSP00000402460:Q262R	ENSP00000402460:Q262R	Q	+	2	0	CLSTN2	141622804	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.586000	0.90806	2.164000	0.68074	0.533000	0.62120	CAA		0.502	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3		NM_022131	
COL9A2	1298	hgsc.bcm.edu;ucsc.edu	37	1	40776390	40776390	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr1:40776390G>A	ENST00000372748.3	-	13	776	c.680C>T	c.(679-681)cCa>cTa	p.P227L		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	227	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			CCTTACCGGTGGTCCAGGGAT	0.577																																																	0													55.0	52.0	53.0					1																	40776390		2199	4294	6493	SO:0001583	missense	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.680C>T	1.37:g.40776390G>A	ENSP00000361834:p.Pro227Leu	Somatic		WXS	SOLID	Phase_I	B2RMP9	Missense_Mutation	SNP	ENST00000372748.3	37	CCDS450.1	.	.	.	.	.	.	.	.	.	.	.	22.2	4.262038	0.80358	.	.	ENSG00000049089	ENST00000372748	D	0.92446	-3.04	5.63	5.63	0.86233	.	0.156761	0.64402	D	0.000019	D	0.92821	0.7717	L	0.49350	1.555	0.80722	D	1	D	0.56968	0.978	P	0.57620	0.824	D	0.90197	0.4254	10	0.19147	T	0.46	.	15.2358	0.73430	0.0:0.0:1.0:0.0	.	227	Q14055	CO9A2_HUMAN	L	227	ENSP00000361834:P227L	ENSP00000361834:P227L	P	-	2	0	COL9A2	40548977	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	3.688000	0.54699	2.660000	0.90430	0.558000	0.71614	CCA		0.577	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3		NM_001852	
CSF2RB	1439	hgsc.bcm.edu	37	22	37334375	37334375	+	Missense_Mutation	SNP	C	C	T	rs147019788	byFrequency	TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr22:37334375C>T	ENST00000403662.3	+	14	2747	c.2525C>T	c.(2524-2526)cCg>cTg	p.P842L	CSF2RB_ENST00000262825.5_Missense_Mutation_p.P848L|CSF2RB_ENST00000406230.1_Missense_Mutation_p.P848L|CSF2RB_ENST00000536485.1_Missense_Mutation_p.P789L			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	842					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCTTCTTCCCCGGGACCCGGT	0.627													C|||	7	0.00139776	0.0	0.0	5008	,	,		17121	0.0069		0.0	False		,,,				2504	0.0																0								C	LEU/PRO	0,4406		0,0,2203	101.0	122.0	115.0		2525	5.3	0.2	22	dbSNP_134	115	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CSF2RB	NM_000395.2	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	842/898	37334375	2,13004	2203	4300	6503	SO:0001583	missense	1439			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2525C>T	22.37:g.37334375C>T	ENSP00000384053:p.Pro842Leu	Somatic		WXS	SOLID	Phase_I	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	19.56	3.851095	0.71719	0.0	2.33E-4	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.97430	-3.83;-4.36;-4.36;-4.38	5.3	5.3	0.74995	.	0.168606	0.28488	N	0.015165	D	0.97711	0.9249	L	0.54323	1.7	0.45295	D	0.998291	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98220	1.0477	10	0.72032	D	0.01	-23.9168	14.4524	0.67394	0.0:1.0:0.0:0.0	.	848;842	P32927-2;P32927	.;IL3RB_HUMAN	L	842;842;848;848;789	ENSP00000384053:P842L;ENSP00000262825:P848L;ENSP00000385271:P848L;ENSP00000440003:P789L	ENSP00000262825:P848L	P	+	2	0	CSF2RB	35664321	0.159000	0.22864	0.238000	0.24106	0.017000	0.09413	3.724000	0.54962	2.476000	0.83614	0.650000	0.86243	CCG		0.627	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1		NM_000395	
DNAH10	196385	hgsc.bcm.edu;ucsc.edu	37	12	124416606	124416606	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr12:124416606G>C	ENST00000409039.3	+	75	12918	c.12893G>C	c.(12892-12894)gGa>gCa	p.G4298A	CCDC92_ENST00000544798.1_Intron|DNAH10_ENST00000538983.1_3'UTR|DNAH10OS_ENST00000514254.2_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4298					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGTCCCTTGGAAACTGGATG	0.512																																																	0													90.0	94.0	93.0					12																	124416606		1967	4145	6112	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12893G>C	12.37:g.124416606G>C	ENSP00000386770:p.Gly4298Ala	Somatic		WXS	SOLID	Phase_I	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329434	0.60743	.	.	ENSG00000197653	ENST00000409039	T	0.08102	3.13	5.13	5.13	0.70059	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	L	0.33485	1.01	0.80722	D	1	P	0.44659	0.84	P	0.51415	0.669	T	0.08659	-1.0711	10	0.25106	T	0.35	.	18.5666	0.91119	0.0:0.0:1.0:0.0	.	4298	Q8IVF4	DYH10_HUMAN	A	4298	ENSP00000386770:G4298A	ENSP00000386770:G4298A	G	+	2	0	DNAH10	122982559	1.000000	0.71417	0.985000	0.45067	0.936000	0.57629	6.594000	0.74104	2.551000	0.86045	0.563000	0.77884	GGA		0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			
F7	2155	hgsc.bcm.edu	37	13	113769996	113769996	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr13:113769996T>A	ENST00000375581.3	+	6	488	c.453T>A	c.(451-453)tgT>tgA	p.C151*	F7_ENST00000346342.3_Nonsense_Mutation_p.C129*|F7_ENST00000541084.1_Nonsense_Mutation_p.C82*	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	151	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.		C -> S (in FA7D). {ECO:0000269|PubMed:11129332}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	AGCTGATCTGTGTGAACGAGA	0.657																																																	0													51.0	41.0	44.0					13																	113769996		2202	4300	6502	SO:0001587	stop_gained	2155				CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.453T>A	13.37:g.113769996T>A	ENSP00000364731:p.Cys151*	Somatic		WXS	SOLID	Phase_I	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Nonsense_Mutation	SNP	ENST00000375581.3	37	CCDS9528.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386290	0.25031	.	.	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	.	.	.	4.3	-5.6	0.02497	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2232	0.65841	0.0:0.7109:0.0:0.2891	.	.	.	.	X	129;82;151	.	ENSP00000329546:C129X	C	+	3	2	F7	112817997	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.752000	0.04797	-1.925000	0.01063	-0.964000	0.02622	TGT		0.657	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4		NM_000131	
FAM178A	55719	hgsc.bcm.edu	37	10	102676494	102676494	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr10:102676494G>C	ENST00000238961.4	+	3	894	c.352G>C	c.(352-354)Ggt>Cgt	p.G118R	FAM178A_ENST00000370271.3_Missense_Mutation_p.G118R|FAM178A_ENST00000370269.3_Missense_Mutation_p.G118R	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	118						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.G118C(1)									TTTCATGAAAGGTGTTAAAGA	0.413																																																	1	Substitution - Missense(1)	lung(1)											79.0	73.0	75.0					10																	102676494		2203	4300	6503	SO:0001583	missense	55719			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.352G>C	10.37:g.102676494G>C	ENSP00000238961:p.Gly118Arg	Somatic		WXS	SOLID	Phase_I	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	ENST00000238961.4	37	CCDS7500.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648598	0.67358	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.56275	0.47;1.11;1.1	5.84	3.95	0.45737	.	0.406531	0.21640	N	0.071344	T	0.39963	0.1098	L	0.27053	0.805	0.30609	N	0.759745	B;B;B	0.32203	0.023;0.023;0.36	B;B;B	0.28553	0.027;0.044;0.091	T	0.44907	-0.9297	10	0.72032	D	0.01	-1.5955	13.8236	0.63338	0.0:0.2926:0.7074:0.0	.	118;118;118	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	R	118	ENSP00000359294:G118R;ENSP00000238961:G118R;ENSP00000359292:G118R	ENSP00000238961:G118R	G	+	1	0	FAM178A	102666484	1.000000	0.71417	0.995000	0.50966	0.961000	0.63080	2.907000	0.48743	0.780000	0.33566	0.655000	0.94253	GGT		0.413	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3			
FAT1	2195	hgsc.bcm.edu	37	4	187630234	187630234	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr4:187630234C>T	ENST00000441802.2	-	2	957	c.748G>A	c.(748-750)Gcc>Acc	p.A250T		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	250	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CATTCATTGGCCTGTTCGATG	0.522										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													156.0	155.0	156.0					4																	187630234		2181	4282	6463	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.748G>A	4.37:g.187630234C>T	ENSP00000406229:p.Ala250Thr	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334042	0.24253	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	T;T	0.60672	0.17;0.17	5.04	5.04	0.67666	Cadherin (3);	0.000000	0.85682	D	0.000000	T	0.66346	0.2780	L	0.33093	0.98	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59974	-0.7353	10	0.20519	T	0.43	.	18.5673	0.91121	0.0:1.0:0.0:0.0	.	250	Q14517	FAT1_HUMAN	T	250	ENSP00000406229:A250T;ENSP00000423736:A250T	ENSP00000260147:A250T	A	-	1	0	FAT1	187867228	1.000000	0.71417	0.997000	0.53966	0.103000	0.19146	3.877000	0.56123	2.613000	0.88420	0.591000	0.81541	GCC		0.522	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3		NM_005245	
FMR1	2332	hgsc.bcm.edu;ucsc.edu	37	X	147030317	147030317	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chrX:147030317C>A	ENST00000370475.4	+	17	1980	c.1852C>A	c.(1852-1854)Cca>Aca	p.P618T	FMR1_ENST00000370471.3_Missense_Mutation_p.S527R|FMR1_ENST00000370470.1_Missense_Mutation_p.P576T|FMR1_ENST00000370477.1_Missense_Mutation_p.P568T|FMR1-IT1_ENST00000441414.1_RNA|FMR1_ENST00000218200.8_Missense_Mutation_p.P597T|FMR1_ENST00000440235.2_Missense_Mutation_p.P248T|FMR1_ENST00000439526.2_Missense_Mutation_p.P578T	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	618	Interaction with RANBP9.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					GAAAGAGAAGCCAGACAGCGT	0.428									Fragile X syndrome																																								0													143.0	122.0	129.0					X																	147030317		2203	4300	6503	SO:0001583	missense	2332	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.1852C>A	X.37:g.147030317C>A	ENSP00000359506:p.Pro618Thr	Somatic		WXS	SOLID	Phase_I	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	37	CCDS14682.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.04|11.04	1.522675|1.522675	0.27211|0.27211	.|.	.|.	ENSG00000102081|ENSG00000102081	ENST00000218200;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000370470;ENST00000440235|ENST00000370471	T;T;T;T;T;T|T	0.35605|0.58940	1.36;1.43;1.36;1.41;1.3;1.68|0.3	5.61|5.61	4.52|4.52	0.55395|0.55395	.|.	0.365238|.	0.32578|.	N|.	0.005903|.	T|T	0.36110|0.36110	0.0955|0.0955	N|N	0.08118|0.08118	0|0	0.34389|0.34389	D|D	0.69401|0.69401	B;B;B;B;B|.	0.21309|.	0.002;0.054;0.0;0.0;0.0|.	B;B;B;B;B|.	0.24006|.	0.004;0.05;0.001;0.001;0.0|.	T|T	0.50524|0.50524	-0.8818|-0.8818	10|7	0.36615|0.87932	T|D	0.2|0	-2.4197|-2.4197	1.5877|1.5877	0.02647|0.02647	0.3391:0.3676:0.1655:0.1278|0.3391:0.3676:0.1655:0.1278	.|.	248;618;513;572;578|.	F8W871;Q06787;Q59GC1;Q06787-8;G3V0J0|.	.;FMR1_HUMAN;.;.;.|.	T|R	597;568;618;578;576;248|527	ENSP00000218200:P597T;ENSP00000359508:P568T;ENSP00000359506:P618T;ENSP00000395923:P578T;ENSP00000359501:P576T;ENSP00000413764:P248T|ENSP00000359502:S527R	ENSP00000218200:P597T|ENSP00000359502:S527R	P|S	+|+	1|3	0|2	FMR1|FMR1	146838009|146838009	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.049000|1.049000	0.30392|0.30392	2.499000|2.499000	0.84300|0.84300	0.594000|0.594000	0.82650|0.82650	CCA|AGC		0.428	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1		NM_002024	
GLT8D2	83468	hgsc.bcm.edu	37	12	104387250	104387250	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr12:104387250C>T	ENST00000360814.4	-	10	1205	c.800G>A	c.(799-801)gGg>gAg	p.G267E	GLT8D2_ENST00000548660.1_Missense_Mutation_p.G267E|GLT8D2_ENST00000546436.1_Missense_Mutation_p.G267E	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	267						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						GGTGGCCACCCCTCCTCCCAG	0.458																																																	0													51.0	52.0	52.0					12																	104387250		2203	4300	6503	SO:0001583	missense	83468			BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.800G>A	12.37:g.104387250C>T	ENSP00000354053:p.Gly267Glu	Somatic		WXS	SOLID	Phase_I	Q96KA2	Missense_Mutation	SNP	ENST00000360814.4	37	CCDS9096.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.615628	0.66672	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.40476	1.03;1.03;1.03	5.58	4.7	0.59300	.	0.094242	0.64402	N	0.000001	T	0.44180	0.1281	M	0.76170	2.325	0.80722	D	1	B	0.19331	0.035	B	0.22601	0.04	T	0.34825	-0.9813	10	0.30854	T	0.27	.	12.7766	0.57453	0.0:0.924:0.0:0.076	.	267	Q9H1C3	GL8D2_HUMAN	E	267	ENSP00000354053:G267E;ENSP00000449750:G267E;ENSP00000447450:G267E	ENSP00000354053:G267E	G	-	2	0	GLT8D2	102911380	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.087000	0.71362	1.359000	0.45940	0.655000	0.94253	GGG		0.458	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1		NM_031302	
KLHDC8B	200942	hgsc.bcm.edu	37	3	49210262	49210262	+	Silent	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr3:49210262C>T	ENST00000332780.2	+	2	269	c.60C>T	c.(58-60)tgC>tgT	p.C20C	KLHDC8B_ENST00000476495.2_3'UTR	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	20						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGCCCACTTGCCGGGTCTATG	0.632																																																	0													58.0	54.0	55.0					3																	49210262		2203	4300	6503	SO:0001819	synonymous_variant	200942				CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.60C>T	3.37:g.49210262C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000332780.2	37	CCDS2791.1																																																																																				0.632	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345974.1		NM_173546	
KSR1	8844	hgsc.bcm.edu;ucsc.edu	37	17	25919598	25919598	+	Silent	SNP	G	G	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr17:25919598G>T	ENST00000319524.6	+	9	1245	c.1245G>T	c.(1243-1245)gtG>gtT	p.V415V	KSR1_ENST00000268763.6_Silent_p.V278V|KSR1_ENST00000509603.2_Silent_p.V415V|KSR1_ENST00000581975.1_3'UTR|KSR1_ENST00000398988.3_Silent_p.V278V			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	415					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		ACAACCCGGTGGACAGAGCAG	0.547																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													80.0	78.0	78.0					17																	25919598		1903	4118	6021	SO:0001819	synonymous_variant	8844			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1245G>T	17.37:g.25919598G>T		Somatic		WXS	SOLID	Phase_I	F8WEA9|H7BYU0|Q13476	Silent	SNP	ENST00000319524.6	37		.	.	.	.	.	.	.	.	.	.	G	10.66	1.411660	0.25465	.	.	ENSG00000141068	ENST00000398988	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.1304	0.25497	0.1937:0.0:0.8063:0.0	.	.	.	.	X	151	.	.	G	+	1	0	KSR1	22943725	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.080000	0.50112	2.258000	0.74832	0.591000	0.81541	GGA		0.547	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_014238	
LALBA	3906	hgsc.bcm.edu;ucsc.edu	37	12	48961740	48961740	+	Nonstop_Mutation	SNP	T	T	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr12:48961740T>C	ENST00000301046.2	-	4	454	c.429A>G	c.(427-429)tgA>tgG	p.*143W	LALBA_ENST00000549817.1_3'UTR	NM_002289.2	NP_002280.1	P00709	LALBA_HUMAN	lactalbumin, alpha-	0					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|lactose biosynthetic process (GO:0005989)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|lactose synthase activity (GO:0004461)			large_intestine(1)|stomach(2)	3						CAGCAGACACTCACAACTTCT	0.512																																																	0													140.0	101.0	114.0					12																	48961740		2203	4300	6503	SO:0001578	stop_lost	3906				CCDS8765.1	12q13	2012-10-02				ENSG00000167531			6480	protein-coding gene	gene with protein product		149750					Standard	XM_006719395		Approved	LYZL7	uc001rrt.3	P00709	OTTHUMG00000170391	ENST00000301046.2:c.429A>G	12.37:g.48961740T>C	ENSP00000301046:p.*143Cysext*42	Somatic		WXS	SOLID	Phase_I	Q6FGX0|Q9UDK4	Missense_Mutation	SNP	ENST00000301046.2	37	CCDS8765.1	.	.	.	.	.	.	.	.	.	.	t	9.170	1.020904	0.19433	.	.	ENSG00000167531	ENST00000301046	.	.	.	4.88	3.74	0.42951	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.046	0.25046	0.0:0.1013:0.0:0.8987	.	.	.	.	W	143	.	.	X	-	3	0	LALBA	47248007	0.358000	0.24947	0.008000	0.14137	0.142000	0.21351	2.839000	0.48207	0.899000	0.36444	0.378000	0.23410	TGA		0.512	LALBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408836.1		NM_002289	
CERS3	204219	hgsc.bcm.edu;ucsc.edu	37	15	101031104	101031104	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr15:101031104C>G	ENST00000394113.1	-	6	896	c.206G>C	c.(205-207)gGc>gCc	p.G69A	CERS3_ENST00000538112.2_Missense_Mutation_p.G69A|CERS3_ENST00000284382.4_Missense_Mutation_p.G69A|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	69					ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CTCTTTAATGCCAAATGATTT	0.313																																																	0													98.0	97.0	97.0					15																	101031104		2203	4300	6503	SO:0001583	missense	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.206G>C	15.37:g.101031104C>G	ENSP00000377672:p.Gly69Ala	Somatic		WXS	SOLID	Phase_I	Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129149	0.56721	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	T;T	0.72051	-0.62;-0.62	5.53	5.53	0.82687	Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.86310	0.5902	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88332	0.2969	10	0.87932	D	0	-14.2907	15.3311	0.74212	0.0:1.0:0.0:0.0	.	69	Q8IU89	CERS3_HUMAN	A	69;80;69	ENSP00000284382:G69A;ENSP00000437640:G69A	ENSP00000284382:G69A	G	-	2	0	CERS3	98848627	1.000000	0.71417	0.997000	0.53966	0.245000	0.25701	3.112000	0.50368	2.763000	0.94921	0.563000	0.77884	GGC		0.313	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4		NM_178842	
LUM	4060	hgsc.bcm.edu	37	12	91502421	91502421	+	Silent	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr12:91502421G>A	ENST00000266718.4	-	2	790	c.336C>T	c.(334-336)ttC>ttT	p.F112F	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	112					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.F112L(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						TCAATTTAGAGAAAACTCTCC	0.418																																																	1	Substitution - Missense(1)	central_nervous_system(1)											78.0	81.0	80.0					12																	91502421		2203	4300	6503	SO:0001819	synonymous_variant	4060			BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.336C>T	12.37:g.91502421G>A		Somatic		WXS	SOLID	Phase_I	B2R6R5|Q96QM7	Silent	SNP	ENST00000266718.4	37	CCDS9038.1																																																																																				0.418	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2		NM_002345	
MAPK4	5596	hgsc.bcm.edu	37	18	48190484	48190484	+	Silent	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr18:48190484C>T	ENST00000400384.2	+	2	1192	c.156C>T	c.(154-156)gcC>gcT	p.A52A	MAPK4_ENST00000588540.1_Silent_p.A52A|MAPK4_ENST00000540640.1_Intron|MAPK4_ENST00000592595.1_Silent_p.A52A	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	52	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.A52A(1)		lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		AGAAGATTGCCCTGAGCGATG	0.597																																																	1	Substitution - coding silent(1)	endometrium(1)											74.0	81.0	78.0					18																	48190484		2157	4258	6415	SO:0001819	synonymous_variant	5596			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.156C>T	18.37:g.48190484C>T		Somatic		WXS	SOLID	Phase_I	A1A4C4|Q0VG04	Silent	SNP	ENST00000400384.2	37	CCDS42437.1																																																																																				0.597	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448631.2		NM_002747	
MALT1	10892	hgsc.bcm.edu;ucsc.edu	37	18	56414818	56414818	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr18:56414818C>T	ENST00000348428.3	+	17	2477	c.2219C>T	c.(2218-2220)tCt>tTt	p.S740F	MALT1_ENST00000345724.3_Missense_Mutation_p.S729F|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	740					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TACCAGAGTTCTGCAGCCACC	0.443			T	BIRC3	MALT																																			Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	0													162.0	154.0	157.0					18																	56414818		2203	4300	6503	SO:0001583	missense	10892				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.2219C>T	18.37:g.56414818C>T	ENSP00000319279:p.Ser740Phe	Somatic		WXS	SOLID	Phase_I	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	37	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256053	0.39896	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.11930	2.73;2.73	5.46	4.59	0.56863	.	0.630566	0.17973	N	0.155790	T	0.12050	0.0293	L	0.36672	1.1	0.09310	N	1	P;P	0.39094	0.659;0.528	B;B	0.39379	0.298;0.101	T	0.14008	-1.0488	10	0.56958	D	0.05	.	8.2724	0.31853	0.1978:0.7211:0.0:0.0811	.	729;740	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	F	740;729	ENSP00000319279:S740F;ENSP00000304161:S729F	ENSP00000304161:S729F	S	+	2	0	MALT1	54565798	0.062000	0.20869	0.015000	0.15790	0.137000	0.21094	1.226000	0.32563	2.579000	0.87056	0.650000	0.86243	TCT		0.443	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2			
MUC6	4588	hgsc.bcm.edu	37	11	1017069	1017069	+	Missense_Mutation	SNP	G	G	A	rs80333708	byFrequency	TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr11:1017069G>A	ENST00000421673.2	-	31	5782	c.5732C>T	c.(5731-5733)aCg>aTg	p.T1911M		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1911	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.T1911M(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTTTTGGCCGTGCTAAATGA	0.557																																																	1	Substitution - Missense(1)	ovary(1)											696.0	710.0	706.0					11																	1017069		2198	4283	6481	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5732C>T	11.37:g.1017069G>A	ENSP00000406861:p.Thr1911Met	Somatic		WXS	SOLID	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.686928	0.48097	.	.	ENSG00000184956	ENST00000421673	T	0.38240	1.15	3.01	3.01	0.34805	.	.	.	.	.	T	0.54983	0.1892	M	0.68317	2.08	0.20074	N	0.999931	D	0.89917	1.0	D	0.79784	0.993	T	0.35773	-0.9775	9	0.59425	D	0.04	.	10.1345	0.42697	0.0:0.0:1.0:0.0	.	1911	Q6W4X9	MUC6_HUMAN	M	1911	ENSP00000406861:T1911M	ENSP00000406861:T1911M	T	-	2	0	MUC6	1007069	0.029000	0.19370	0.095000	0.20976	0.045000	0.14185	0.596000	0.24044	1.642000	0.50584	0.313000	0.20887	ACG		0.557	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2		XM_290540	
MICAL2	9645	hgsc.bcm.edu;ucsc.edu	37	11	12225972	12225972	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr11:12225972G>T	ENST00000256194.4	+	4	728	c.440G>T	c.(439-441)gGg>gTg	p.G147V	MICAL2_ENST00000527546.1_Missense_Mutation_p.G147V|MICAL2_ENST00000527195.1_3'UTR|MICAL2_ENST00000342902.5_Missense_Mutation_p.G147V|MICAL2_ENST00000379612.3_Missense_Mutation_p.G147V|MICAL2_ENST00000537344.1_Missense_Mutation_p.G147V	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	147	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		AAGTTCTATGGGAAGTTCTGT	0.547																																																	0													107.0	95.0	99.0					11																	12225972		2201	4294	6495	SO:0001583	missense	9645			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.440G>T	11.37:g.12225972G>T	ENSP00000256194:p.Gly147Val	Somatic		WXS	SOLID	Phase_I	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	G	31	5.071223	0.93950	.	.	ENSG00000133816	ENST00000537344;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	M	0.91196	3.185	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.994;0.999;1.0;1.0;0.999	T	0.45760	-0.9239	9	.	.	.	.	19.4289	0.94756	0.0:0.0:1.0:0.0	.	147;147;147;147;147;147	G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851;B4DGZ0	.;.;.;.;MICA2_HUMAN;.	V	147	ENSP00000441689:G147V;ENSP00000256194:G147V;ENSP00000433965:G147V;ENSP00000344894:G147V;ENSP00000368932:G147V	.	G	+	2	0	MICAL2	12182548	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.835000	0.99442	2.700000	0.92200	0.563000	0.77884	GGG		0.547	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1		NM_014632	
MEN1	4221	hgsc.bcm.edu;ucsc.edu	37	11	64577153	64577153	+	Silent	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr11:64577153G>A	ENST00000337652.1	-	2	932	c.429C>T	c.(427-429)ctC>ctT	p.L143L	MEN1_ENST00000443283.1_Silent_p.L143L|MEN1_ENST00000377321.1_Silent_p.L143L|MEN1_ENST00000312049.6_Silent_p.L143L|MEN1_ENST00000394376.1_Silent_p.L143L|MEN1_ENST00000377326.3_Silent_p.L143L|MEN1_ENST00000315422.4_Silent_p.L143L|MEN1_ENST00000394374.2_Silent_p.L143L|MEN1_ENST00000377316.2_Silent_p.L143L|MEN1_ENST00000377313.1_Silent_p.L143L	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	143					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.Y133_L143del(2)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						TGAAGCTGAAGAGGGACTGGA	0.522			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)		yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	2	Deletion - In frame(2)	parathyroid(2)											142.0	146.0	145.0					11																	64577153		2201	4297	6498	SO:0001819	synonymous_variant	4221	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.429C>T	11.37:g.64577153G>A		Somatic		WXS	SOLID	Phase_I	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000337652.1	37	CCDS8083.1																																																																																				0.522	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1			
MYT1L	23040	hgsc.bcm.edu;ucsc.edu	37	2	1921063	1921063	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr2:1921063C>A	ENST00000399161.2	-	11	2279	c.1532G>T	c.(1531-1533)tGt>tTt	p.C511F	MYT1L_ENST00000428368.2_Missense_Mutation_p.C509F	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	511					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGTTCCATCACACCCGGGGGT	0.507																																																	0													194.0	201.0	199.0					2																	1921063		1949	4164	6113	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1532G>T	2.37:g.1921063C>A	ENSP00000382114:p.Cys511Phe	Somatic		WXS	SOLID	Phase_I	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	C	28.2	4.895698	0.91962	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.70516	-0.49;-0.05	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.87939	0.6304	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89582	0.3821	10	0.87932	D	0	-21.0443	19.8984	0.96975	0.0:1.0:0.0:0.0	.	511;509	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	F	511;457;509	ENSP00000382114:C511F;ENSP00000396103:C509F	ENSP00000295067:C457F	C	-	2	0	MYT1L	1900070	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.755000	0.85180	2.713000	0.92767	0.655000	0.94253	TGT		0.507	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1		NM_015025	
NDUFV2	4729	hgsc.bcm.edu	37	18	9117867	9117867	+	Missense_Mutation	SNP	T	T	C	rs906807	byFrequency	TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr18:9117867T>C	ENST00000318388.6	+	2	200	c.86T>C	c.(85-87)gTt>gCt	p.V29A	RP11-21J18.1_ENST00000579126.1_RNA|RP11-143J12.3_ENST00000579467.1_RNA|NDUFV2_ENST00000400033.1_Missense_Mutation_p.V32A	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	29			V -> A (in dbSNP:rs906807). {ECO:0000269|PubMed:2500970}.		cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|lung(4)|ovary(1)|stomach(1)	7						CATAAGACAGTTATGCAAAAT	0.279													C|||	3901	0.778954	0.7368	0.8026	5008	,	,		17344	0.7063		0.831	False		,,,				2504	0.8405																0			GRCh37	CM983407	NDUFV2	M	rs906807	C	ALA/VAL	3352,1054	378.0+/-322.7	1265,822,116	59.0	65.0	63.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	86	4.7	1.0	18	dbSNP_86	63	7042,1552	285.9+/-297.4	2877,1288,132	yes	missense	NDUFV2	NM_021074.4	64	4142,2110,248	CC,CT,TT		18.0591,23.9219,20.0462	benign	29/250	9117867	10394,2606	2203	4297	6500	SO:0001583	missense	4729			X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.86T>C	18.37:g.9117867T>C	ENSP00000327268:p.Val29Ala	Somatic		WXS	SOLID	Phase_I	Q9BV41	Missense_Mutation	SNP	ENST00000318388.6	37	CCDS11842.1	1659	0.7596153846153846	365	0.741869918699187	285	0.787292817679558	386	0.6748251748251748	623	0.8218997361477572	C	1.661	-0.511449	0.04231	0.760781	0.819409	ENSG00000178127	ENST00000318388;ENST00000400033	T;T	0.42900	1.02;0.96	5.55	4.67	0.58626	.	0.361399	0.35615	N	0.003096	T	0.00012	0.0000	N	0.00465	-1.465	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.38436	-0.9661	9	0.02654	T	1	-5.223	11.8551	0.52433	0.0:0.8565:0.0:0.1435	rs906807;rs52810649;rs906807	29	P19404	NDUV2_HUMAN	A	29;32	ENSP00000327268:V29A;ENSP00000382908:V32A	ENSP00000327268:V29A	V	+	2	0	NDUFV2	9107867	1.000000	0.71417	0.974000	0.42286	0.190000	0.23558	1.537000	0.36083	1.497000	0.48584	-0.197000	0.12766	GTT		0.279	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254475.2		NM_021074	
NETO2	81831	hgsc.bcm.edu;ucsc.edu	37	16	47165915	47165915	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr16:47165915A>G	ENST00000562435.1	-	2	440	c.56T>C	c.(55-57)gTa>gCa	p.V19A	NETO2_ENST00000303155.5_Missense_Mutation_p.V19A	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	19					regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)				breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				CCCTTCCACTACCAGTACTGT	0.338										HNSCC(25;0.065)																																							0													221.0	208.0	212.0					16																	47165915		2202	4300	6502	SO:0001583	missense	81831			AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.56T>C	16.37:g.47165915A>G	ENSP00000455169:p.Val19Ala	Somatic		WXS	SOLID	Phase_I	J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	ENST00000562435.1	37	CCDS10727.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.493645	0.64186	.	.	ENSG00000171208	ENST00000303155	T	0.24538	1.85	4.94	4.94	0.65067	.	0.193063	0.44902	D	0.000408	T	0.19167	0.0460	N	0.24115	0.695	0.42323	D	0.992268	B;B	0.29037	0.092;0.231	B;B	0.24701	0.055;0.055	T	0.05338	-1.0891	10	0.62326	D	0.03	.	14.6074	0.68489	1.0:0.0:0.0:0.0	.	19;19	Q32NC3;Q8NC67	.;NETO2_HUMAN	A	19	ENSP00000306726:V19A	ENSP00000306726:V19A	V	-	2	0	NETO2	45723416	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	6.970000	0.76099	1.839000	0.53478	0.455000	0.32223	GTA		0.338	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256766.2		NM_018092	
NEURL4	84461	hgsc.bcm.edu;ucsc.edu	37	17	7224890	7224890	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr17:7224890C>G	ENST00000399464.2	-	18	3103	c.3088G>C	c.(3088-3090)Gag>Cag	p.E1030Q	RP11-542C16.2_ENST00000575474.1_5'Flank|NEURL4_ENST00000574120.1_5'Flank|NEURL4_ENST00000570460.1_Missense_Mutation_p.E1006Q|NEURL4_ENST00000315614.7_Missense_Mutation_p.E1028Q	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1030	NHR 5. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCCAGCCTCTCTAGGTTCCGG	0.612																																																	0													65.0	73.0	71.0					17																	7224890		2083	4214	6297	SO:0001583	missense	84461				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.3088G>C	17.37:g.7224890C>G	ENSP00000382390:p.Glu1030Gln	Somatic		WXS	SOLID	Phase_I	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581601	0.86748	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.35421	1.31;1.31	4.86	4.86	0.63082	NEUZ (2);	0.112080	0.64402	D	0.000014	T	0.50531	0.1621	M	0.66939	2.045	0.51233	D	0.999918	P;P	0.48162	0.906;0.849	P;B	0.51701	0.677;0.378	T	0.51826	-0.8656	10	0.52906	T	0.07	-26.7763	17.2714	0.87103	0.0:1.0:0.0:0.0	.	1028;1030	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	Q	1028;1030	ENSP00000319826:E1028Q;ENSP00000382390:E1030Q	ENSP00000319826:E1028Q	E	-	1	0	NEURL4	7165614	1.000000	0.71417	0.972000	0.41901	0.998000	0.95712	6.176000	0.71955	2.684000	0.91462	0.557000	0.71058	GAG		0.612	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2		NM_032442	
OBSCN	84033	hgsc.bcm.edu;ucsc.edu	37	1	228511298	228511298	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr1:228511298C>T	ENST00000422127.1	+	56	15687	c.15643C>T	c.(15643-15645)Cgt>Tgt	p.R5215C	OBSCN_ENST00000284548.11_Missense_Mutation_p.R5215C|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6172C|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2334C|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2849C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5215	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCTGAGCTCCGTGTGGACTG	0.587																																																	0													61.0	64.0	63.0					1																	228511298		2166	4266	6432	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15643C>T	1.37:g.228511298C>T	ENSP00000409493:p.Arg5215Cys	Somatic		WXS	SOLID	Phase_I	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805823	0.90623	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.41	5.41	0.78517	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.069529	0.56097	D	0.000040	T	0.81422	0.4819	M	0.77616	2.38	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.82676	-0.0339	10	0.66056	D	0.02	.	14.2492	0.66009	0.1488:0.8512:0.0:0.0	.	5215;5215	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	C	5215;5215;2849;2334	ENSP00000284548:R5215C;ENSP00000409493:R5215C;ENSP00000355668:R2849C;ENSP00000355670:R2334C	ENSP00000284548:R5215C	R	+	1	0	OBSCN	226577921	0.987000	0.35691	0.999000	0.59377	0.934000	0.57294	2.702000	0.47102	2.808000	0.96608	0.655000	0.94253	CGT		0.587	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_052843	
OR10G3	26533	hgsc.bcm.edu	37	14	22038054	22038054	+	Silent	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr14:22038054G>A	ENST00000303532.1	-	1	821	c.822C>T	c.(820-822)gcC>gcT	p.A274A		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		TGGGGACTAGGGCAGCTGCCC	0.567																																																	0													75.0	78.0	77.0					14																	22038054		2203	4300	6503	SO:0001819	synonymous_variant	26533				CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.822C>T	14.37:g.22038054G>A		Somatic		WXS	SOLID	Phase_I	Q6IET7|Q96R77	Silent	SNP	ENST00000303532.1	37	CCDS32046.1																																																																																				0.567	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1			
PER2	8864	hgsc.bcm.edu;ucsc.edu	37	2	239185783	239185783	+	Silent	SNP	T	T	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr2:239185783T>C	ENST00000254657.3	-	3	561	c.282A>G	c.(280-282)acA>acG	p.T94T	PER2_ENST00000440245.1_Silent_p.T94T|PER2_ENST00000254658.3_Silent_p.T94T|PER2_ENST00000355768.2_Silent_p.T94T	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	94					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGCAGCCACTTGTAGATGGGT	0.378																																																	0													248.0	263.0	258.0					2																	239185783		2203	4300	6503	SO:0001819	synonymous_variant	8864			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.282A>G	2.37:g.239185783T>C		Somatic		WXS	SOLID	Phase_I	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	37	CCDS2528.1																																																																																				0.378	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1		NM_022817	
PLEKHA6	22874	hgsc.bcm.edu;ucsc.edu	37	1	204228767	204228767	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr1:204228767C>T	ENST00000272203.3	-	8	942	c.626G>A	c.(625-627)gGg>gAg	p.G209E	PLEKHA6_ENST00000485632.1_5'Flank|PLEKHA6_ENST00000414478.1_Missense_Mutation_p.G229E	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	209	Pro-rich.									breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			ATCACCCTCCCCTCGAGTCTT	0.612																																																	0													64.0	61.0	62.0					1																	204228767		2203	4300	6503	SO:0001583	missense	22874			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.626G>A	1.37:g.204228767C>T	ENSP00000272203:p.Gly209Glu	Somatic		WXS	SOLID	Phase_I	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844167	0.71488	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.10382	2.88;3.34	5.55	4.63	0.57726	.	0.395725	0.27782	N	0.017874	T	0.29423	0.0733	M	0.62723	1.935	0.51233	D	0.999913	D	0.89917	1.0	D	0.85130	0.997	T	0.01169	-1.1430	10	0.42905	T	0.14	-39.493	13.912	0.63873	0.0:0.9257:0.0:0.0743	.	209	Q9Y2H5	PKHA6_HUMAN	E	209;229	ENSP00000272203:G209E;ENSP00000402046:G229E	ENSP00000272203:G209E	G	-	2	0	PLEKHA6	202495390	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.073000	0.57570	1.325000	0.45301	0.561000	0.74099	GGG		0.612	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3		NM_014935	
PRKCD	5580	hgsc.bcm.edu	37	3	53223226	53223226	+	Silent	SNP	C	C	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr3:53223226C>A	ENST00000394729.2	+	16	2035	c.1707C>A	c.(1705-1707)cgC>cgA	p.R569R	PRKCD_ENST00000330452.3_Silent_p.R569R	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	569	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	ATTATCCCCGCTGGATCACCA	0.607																																																	0													65.0	58.0	60.0					3																	53223226		2203	4300	6503	SO:0001819	synonymous_variant	5580				CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.1707C>A	3.37:g.53223226C>A		Somatic		WXS	SOLID	Phase_I	B0KZ81|B2R834|Q15144|Q86XJ6	Silent	SNP	ENST00000394729.2	37	CCDS2870.1																																																																																				0.607	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257818.1			
SCAPER	49855	hgsc.bcm.edu;ucsc.edu	37	15	77096926	77096926	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr15:77096926T>C	ENST00000563290.1	-	6	537	c.442A>G	c.(442-444)Att>Gtt	p.I148V	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000324767.7_Missense_Mutation_p.I148V			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	148						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						ATCCAGTCAATCAATGCTTTG	0.363																																																	0													123.0	111.0	115.0					15																	77096926		1848	4081	5929	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.442A>G	15.37:g.77096926T>C	ENSP00000454973:p.Ile148Val	Somatic		WXS	SOLID	Phase_I	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.476765	0.84640	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.28255	1.62	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	L	0.55213	1.73	0.54753	D	0.999981	D;P	0.63880	0.993;0.864	D;P	0.74674	0.984;0.784	T	0.49303	-0.8954	10	0.51188	T	0.08	.	15.3287	0.74190	0.0:0.0:0.0:1.0	.	148;163	Q6NSF1;Q9BY12-2	.;.	V	148;164	ENSP00000326924:I148V	ENSP00000303560:I164V	I	-	1	0	SCAPER	74883981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.624000	0.83124	2.011000	0.59026	0.528000	0.53228	ATT		0.363	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1		NM_020843	
SCN2A	6326	hgsc.bcm.edu;ucsc.edu	37	2	166152464	166152464	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr2:166152464A>G	ENST00000375437.2	+	2	421	c.131A>G	c.(130-132)gAg>gGg	p.E44G	SCN2A_ENST00000357398.3_Missense_Mutation_p.E44G|SCN2A_ENST00000375427.2_Missense_Mutation_p.E44G|SCN2A_ENST00000283256.6_Missense_Mutation_p.E44G	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	44					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CGCAAGGATGAGGATGATGAA	0.468																																																	0													102.0	92.0	95.0					2																	166152464		2203	4300	6503	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.131A>G	2.37:g.166152464A>G	ENSP00000364586:p.Glu44Gly	Somatic		WXS	SOLID	Phase_I	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.748462	0.30955	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.96830	-4.14;-4.13;-4.13;-4.13;-4.13	5.55	5.55	0.83447	.	0.627479	0.15917	N	0.238328	D	0.93572	0.7948	L	0.42245	1.32	0.35917	D	0.831533	B;B	0.15719	0.014;0.014	B;B	0.18871	0.023;0.01	D	0.92685	0.6161	10	0.62326	D	0.03	.	10.103	0.42517	0.9256:0.0:0.0744:0.0	.	44;44	Q99250-2;Q99250	.;SCN2A_HUMAN	G	44	ENSP00000406454:E44G;ENSP00000364586:E44G;ENSP00000349973:E44G;ENSP00000283256:E44G;ENSP00000364576:E44G	ENSP00000283256:E44G	E	+	2	0	SCN2A	165860710	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.544000	0.67231	2.117000	0.64856	0.533000	0.62120	GAG		0.468	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2		NM_021007	
SETX	23064	hgsc.bcm.edu;ucsc.edu	37	9	135202859	135202859	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr9:135202859C>T	ENST00000224140.5	-	10	4308	c.4126G>A	c.(4126-4128)Gca>Aca	p.A1376T	SETX_ENST00000372169.2_Missense_Mutation_p.A1376T|SETX_ENST00000393220.1_Missense_Mutation_p.A1376T	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1376					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TGTGACCCTGCTCTTTTAACA	0.383																																																	0													115.0	112.0	113.0					9																	135202859		2203	4300	6503	SO:0001583	missense	23064			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4126G>A	9.37:g.135202859C>T	ENSP00000224140:p.Ala1376Thr	Somatic		WXS	SOLID	Phase_I	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	1.092	-0.663698	0.03428	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.86497	-2.04;-2.13;-1.74	5.75	-1.99	0.07457	.	2.300740	0.01942	N	0.041980	T	0.70815	0.3267	N	0.11560	0.145	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.001;0.003	T	0.57636	-0.7777	10	0.19590	T	0.45	.	0.9338	0.01340	0.3034:0.2965:0.0943:0.3058	.	1376;1376;1376	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	T	1376	ENSP00000224140:A1376T;ENSP00000361242:A1376T;ENSP00000376913:A1376T	ENSP00000224140:A1376T	A	-	1	0	SETX	134192680	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.729000	0.04920	-0.399000	0.07668	-0.808000	0.03180	GCA		0.383	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3		NM_015046	
SFPQ	6421	hgsc.bcm.edu;ucsc.edu	37	1	35657116	35657116	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr1:35657116A>T	ENST00000357214.5	-	2	941	c.843T>A	c.(841-843)aaT>aaA	p.N281K		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	281					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				AGAGAGACAAATTGGCTTTAA	0.408			T	TFE3	papillary renal cell																																			Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	0													64.0	64.0	64.0					1																	35657116		2203	4300	6503	SO:0001583	missense	6421			X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.843T>A	1.37:g.35657116A>T	ENSP00000349748:p.Asn281Lys	Somatic		WXS	SOLID	Phase_I	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	37	CCDS388.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863647	0.51482	.	.	ENSG00000116560	ENST00000357214	T	0.22134	1.97	5.31	1.94	0.25998	.	0.048478	0.85682	D	0.000000	T	0.18215	0.0437	L	0.36672	1.1	0.34750	D	0.731643	D	0.57257	0.979	P	0.47528	0.549	T	0.23583	-1.0184	10	0.66056	D	0.02	-8.159	6.1924	0.20532	0.2932:0.0:0.5782:0.1286	.	281	P23246	SFPQ_HUMAN	K	281	ENSP00000349748:N281K	ENSP00000349748:N281K	N	-	3	2	SFPQ	35429703	0.973000	0.33851	1.000000	0.80357	0.977000	0.68977	0.032000	0.13732	0.630000	0.30394	-0.230000	0.12252	AAT		0.408	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4		NM_005066	
SLC17A1	6568	hgsc.bcm.edu	37	6	25813151	25813151	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr6:25813151T>C	ENST00000244527.4	-	8	920	c.805A>G	c.(805-807)Act>Gct	p.T269A	SLC17A1_ENST00000476801.1_Missense_Mutation_p.T269A|SLC17A1_ENST00000427328.1_Intron|SLC17A1_ENST00000468082.1_Intron	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	269			T -> I (in dbSNP:rs1165196). {ECO:0000269|PubMed:7826357, ECO:0000269|PubMed:8288239}.		ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AAACTACCAGTGGAAATAGCC	0.368																																																	0													77.0	77.0	77.0					6																	25813151		2203	4300	6503	SO:0001583	missense	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.805A>G	6.37:g.25813151T>C	ENSP00000244527:p.Thr269Ala	Somatic		WXS	SOLID	Phase_I	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	T	8.624	0.892172	0.17613	.	.	ENSG00000124568	ENST00000244527;ENST00000476801	T;T	0.56776	0.44;0.44	3.67	-7.34	0.01427	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.163280	0.02119	N	0.055446	T	0.06917	0.0176	N	0.03608	-0.345	0.09310	N	1	B	0.23377	0.084	B	0.23275	0.045	T	0.04565	-1.0942	10	0.33141	T	0.24	.	0.8209	0.01111	0.35:0.0998:0.2024:0.3478	.	269	Q14916	NPT1_HUMAN	A	269	ENSP00000244527:T269A;ENSP00000420614:T269A	ENSP00000244527:T269A	T	-	1	0	SLC17A1	25921130	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.231000	0.00548	-2.347000	0.00620	-1.137000	0.01932	ACT		0.368	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			
SLC6A20	54716	hgsc.bcm.edu;ucsc.edu	37	3	45817396	45817396	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr3:45817396A>G	ENST00000358525.4	-	4	554	c.439T>C	c.(439-441)Tac>Cac	p.Y147H	SLC6A20_ENST00000353278.4_Missense_Mutation_p.Y147H|SLC6A20_ENST00000456124.2_Missense_Mutation_p.Y147H	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	147					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		TACCAGAAGTACTGTGTGGAG	0.607																																																	0													196.0	179.0	185.0					3																	45817396		2203	4300	6503	SO:0001583	missense	54716			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.439T>C	3.37:g.45817396A>G	ENSP00000346298:p.Tyr147His	Somatic		WXS	SOLID	Phase_I	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Missense_Mutation	SNP	ENST00000358525.4	37	CCDS43077.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.854980	0.91355	.	.	ENSG00000163817	ENST00000353278;ENST00000358525;ENST00000456124;ENST00000413781	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.86606	0.5973	M	0.80982	2.52	0.51233	D	0.999916	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88332	0.2969	10	0.66056	D	0.02	.	15.5464	0.76104	1.0:0.0:0.0:0.0	.	147;147	Q9NP91-2;Q9NP91	.;S6A20_HUMAN	H	147;147;147;100	ENSP00000296133:Y147H;ENSP00000346298:Y147H;ENSP00000404310:Y147H;ENSP00000395506:Y100H	ENSP00000296133:Y147H	Y	-	1	0	SLC6A20	45792400	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.576000	0.82467	2.059000	0.61396	0.460000	0.39030	TAC		0.607	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3		NM_020208	
SREK1IP1	285672	hgsc.bcm.edu	37	5	64020316	64020316	+	Missense_Mutation	SNP	T	T	G	rs80170948	byFrequency	TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr5:64020316T>G	ENST00000513458.4	-	5	530	c.363A>C	c.(361-363)aaA>aaC	p.K121N		NM_173829.3	NP_776190.1	Q8N9Q2	SR1IP_HUMAN	SREK1-interacting protein 1	121	Lys-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)		nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6						atttactctttttttcttttt	0.299													T|||	72	0.014377	0.0015	0.0202	5008	,	,		17285	0.0		0.0487	False		,,,				2504	0.0072																0								T	ASN/LYS	33,4327		0,33,2147	41.0	35.0	37.0		363	3.0	1.0	5	dbSNP_132	37	329,8225		7,315,3955	yes	missense	SREK1IP1	NM_173829.3	94	7,348,6102	GG,GT,TT		3.8462,0.7569,2.8032	benign	121/156	64020316	362,12552	2180	4277	6457	SO:0001583	missense	285672			AK094073	CCDS34171.1	5q12.3	2010-09-20	2010-09-20	2010-09-20	ENSG00000153006	ENSG00000153006			26716	protein-coding gene	gene with protein product	"""p18 splicing regulatory protein"""		"""SFRS12-interacting protein 1"""	SFRS12IP1		15456940	Standard	NM_173829		Approved	FLJ36754, P18SRP	uc003jtk.3	Q8N9Q2	OTTHUMG00000162291	ENST00000513458.4:c.363A>C	5.37:g.64020316T>G	ENSP00000427401:p.Lys121Asn	Somatic		WXS	SOLID	Phase_I	Q32NC8	Missense_Mutation	SNP	ENST00000513458.4	37	CCDS34171.1	46	0.021062271062271064	0	0.0	9	0.024861878453038673	0	0.0	37	0.048812664907651716	T	13.49	2.254241	0.39896	0.007569	0.038462	ENSG00000153006	ENST00000513458	.	.	.	5.42	3.05	0.35203	.	0.092655	0.64402	D	0.000001	T	0.11239	0.0274	L	0.47716	1.5	0.39389	D	0.966385	B	0.26635	0.155	B	0.23716	0.048	T	0.07731	-1.0757	9	0.40728	T	0.16	0.212	6.9507	0.24544	0.0:0.1814:0.0:0.8186	.	121	Q8N9Q2	SR1IP_HUMAN	N	121	.	ENSP00000427401:K121N	K	-	3	2	SREK1IP1	64056072	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.793000	0.26944	0.386000	0.24997	0.533000	0.62120	AAA		0.299	SREK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368457.4		NM_173829	
STARD9	57519	hgsc.bcm.edu	37	15	42961446	42961446	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr15:42961446G>A	ENST00000290607.7	+	16	1465	c.1408G>A	c.(1408-1410)Gct>Act	p.A470T		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	470					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CAGGAGGAGGGCTGGGGTGGT	0.542																																																	0													96.0	94.0	94.0					15																	42961446		692	1590	2282	SO:0001583	missense	57519			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.1408G>A	15.37:g.42961446G>A	ENSP00000290607:p.Ala470Thr	Somatic		WXS	SOLID	Phase_I	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	ENST00000290607.7	37	CCDS53935.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959188	0.92726	.	.	ENSG00000159433	ENST00000290607	T	0.66460	-0.21	5.92	5.92	0.95590	.	.	.	.	.	T	0.78566	0.4303	L	0.58669	1.825	0.41474	D	0.988125	.	.	.	.	.	.	T	0.79014	-0.1976	7	0.87932	D	0	.	20.3325	0.98724	0.0:0.0:1.0:0.0	.	.	.	.	T	470	ENSP00000290607:A470T	ENSP00000290607:A470T	A	+	1	0	STARD9	40748738	1.000000	0.71417	0.990000	0.47175	0.989000	0.77384	7.827000	0.86722	2.805000	0.96524	0.655000	0.94253	GCT		0.542	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431094.1			
TBC1D2	55357	hgsc.bcm.edu;ucsc.edu	37	9	100991264	100991264	+	Silent	SNP	C	C	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr9:100991264C>T	ENST00000375064.1	-	5	986	c.948G>A	c.(946-948)ctG>ctA	p.L316L	TBC1D2_ENST00000493589.2_5'UTR|TBC1D2_ENST00000375066.5_Silent_p.L316L|TBC1D2_ENST00000342112.5_Silent_p.L98L	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	316	Interaction with RAC1.				positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TGGTGAGCATCAGAACCTGTT	0.547																																																	0													118.0	105.0	110.0					9																	100991264		2203	4300	6503	SO:0001819	synonymous_variant	55357			AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.948G>A	9.37:g.100991264C>T		Somatic		WXS	SOLID	Phase_I	B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Silent	SNP	ENST00000375064.1	37																																																																																					0.547	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1		NM_018421	
TBC1D13	54662	hgsc.bcm.edu	37	9	131570110	131570110	+	Silent	SNP	T	T	C			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr9:131570110T>C	ENST00000372648.5	+	12	1305	c.1155T>C	c.(1153-1155)gaT>gaC	p.D385D	TBC1D13_ENST00000539497.1_Silent_p.D204D|TBC1D13_ENST00000223865.8_Silent_p.D260D	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	385							Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						CCATCACAGATGTCTGCCAGA	0.612																																																	0													109.0	113.0	112.0					9																	131570110		2203	4300	6503	SO:0001819	synonymous_variant	54662			AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.1155T>C	9.37:g.131570110T>C		Somatic		WXS	SOLID	Phase_I	A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Silent	SNP	ENST00000372648.5	37	CCDS6911.1																																																																																				0.612	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054496.1		NM_018201	
TGFBR2	7048	hgsc.bcm.edu	37	3	30732950	30732950	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr3:30732950G>T	ENST00000295754.5	+	7	1945	c.1563G>T	c.(1561-1563)tgG>tgT	p.W521C	TGFBR2_ENST00000359013.4_Missense_Mutation_p.W546C	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	521	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		W -> R (in LDS2). {ECO:0000269|PubMed:20358619}.		activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.W521*(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CTGAGTGCTGGGACCACGACC	0.617																																																	2	Substitution - Nonsense(2)	large_intestine(1)|breast(1)											72.0	63.0	66.0					3																	30732950		2203	4300	6503	SO:0001583	missense	7048				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1563G>T	3.37:g.30732950G>T	ENSP00000295754:p.Trp521Cys	Somatic		WXS	SOLID	Phase_I	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150634	0.78001	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	T;T	0.65916	-0.18;-0.18	5.91	5.03	0.67393	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.054129	0.85682	N	0.000000	D	0.83468	0.5261	M	0.91140	3.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87793	0.2620	10	0.87932	D	0	.	16.3682	0.83343	0.0:0.0:0.8671:0.1329	.	521;546	P37173;D2JYI1	TGFR2_HUMAN;.	C	521;546;351	ENSP00000295754:W521C;ENSP00000351905:W546C	ENSP00000295754:W521C	W	+	3	0	TGFBR2	30707954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	1.469000	0.48083	0.655000	0.94253	TGG		0.617	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2			
VEZT	55591	hgsc.bcm.edu;ucsc.edu	37	12	95668544	95668544	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr12:95668544A>G	ENST00000436874.1	+	7	980	c.875A>G	c.(874-876)aAt>aGt	p.N292S	VEZT_ENST00000356859.4_3'UTR|VEZT_ENST00000261219.6_Missense_Mutation_p.N244S|Y_RNA_ENST00000365600.1_RNA	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	292					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						GAGAGTGACAATGTAACCAAC	0.403																																																	0													131.0	124.0	126.0					12																	95668544		1883	4105	5988	SO:0001583	missense	55591			AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.875A>G	12.37:g.95668544A>G	ENSP00000410083:p.Asn292Ser	Somatic		WXS	SOLID	Phase_I	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	ENST00000436874.1	37	CCDS44954.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.400496	0.83120	.	.	ENSG00000028203	ENST00000436874;ENST00000261219;ENST00000397792;ENST00000397796	T;T;T	0.52057	0.68;0.68;0.68	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.63593	0.2524	L	0.52364	1.645	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.63985	-0.6513	10	0.49607	T	0.09	-30.2112	15.6518	0.77104	1.0:0.0:0.0:0.0	.	292	Q9HBM0	VEZA_HUMAN	S	292;244;248;292	ENSP00000410083:N292S;ENSP00000261219:N244S;ENSP00000380894:N248S	ENSP00000261219:N244S	N	+	2	0	VEZT	94192675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.950000	0.93019	2.099000	0.63709	0.482000	0.46254	AAT		0.403	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407804.2		NM_017599	
VPS13A	23230	hgsc.bcm.edu	37	9	79933403	79933403	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4169-01A-02D-1366-10	TCGA-BP-4169-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c5132145-355e-49d3-b6cd-2a8ba2daaa39	658defa0-ce93-475f-978e-9494b4b619d7	g.chr9:79933403A>G	ENST00000360280.3	+	41	5469	c.5209A>G	c.(5209-5211)Att>Gtt	p.I1737V	VPS13A_ENST00000376634.4_Missense_Mutation_p.I1737V|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000357409.5_Missense_Mutation_p.I1737V|VPS13A_ENST00000376636.3_Missense_Mutation_p.I1698V	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1737					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGAGGCTGGAATTGGTCATAG	0.388																																																	0													77.0	80.0	79.0					9																	79933403		2203	4298	6501	SO:0001583	missense	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.5209A>G	9.37:g.79933403A>G	ENSP00000353422:p.Ile1737Val	Somatic		WXS	SOLID	Phase_I	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	A	3.775	-0.046884	0.07407	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.4	-7.9	0.01169	.	0.469424	0.22389	N	0.060709	T	0.05823	0.0152	N	0.11789	0.175	0.80722	D	1	B;B;B;B	0.06786	0.0;0.0;0.001;0.001	B;B;B;B	0.06405	0.002;0.001;0.002;0.001	T	0.44682	-0.9312	10	0.02654	T	1	.	20.7544	0.99720	0.2532:0.0:0.7468:0.0	.	1698;1737;1737;1737	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	V	1737;1698;1737;1737	ENSP00000365821:I1737V;ENSP00000365823:I1698V;ENSP00000353422:I1737V;ENSP00000349985:I1737V	ENSP00000349985:I1737V	I	+	1	0	VPS13A	79123223	0.973000	0.33851	0.611000	0.29010	0.934000	0.57294	0.554000	0.23407	-1.548000	0.01712	-0.637000	0.03976	ATT		0.388	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2		NM_015186	
