#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACOT8	10005	hgsc.bcm.edu	37	20	44483907	44483907	+	Silent	SNP	G	G	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr20:44483907G>T	ENST00000217455.4	-	2	243	c.153C>A	c.(151-153)gcC>gcA	p.A51A	ZSWIM3_ENST00000255152.2_5'Flank|ZSWIM3_ENST00000454862.2_5'Flank	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8	51					acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				ACAGCCTCTTGGCCGGTACCC	0.557																																																	0													101.0	99.0	99.0					20																	44483907		2203	4300	6503	SO:0001819	synonymous_variant	10005			AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.153C>A	20.37:g.44483907G>T		Somatic		WXS	SOLID	Phase_I	O15261|Q17RX4	Silent	SNP	ENST00000217455.4	37	CCDS13378.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.096|5.096	0.203415|0.203415	0.09704|0.09704	.|.	.|.	ENSG00000101473|ENSG00000101473	ENST00000487205|ENST00000457981	.|.	.|.	.|.	5.08|5.08	1.56|1.56	0.23342|0.23342	.|.	.|.	.|.	.|.	.|.	T|T	0.34366|0.34366	0.0895|0.0895	.|.	.|.	.|.	0.28417|0.28417	N|N	0.917902|0.917902	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.26849|0.26849	-1.0091|-1.0091	4|4	.|.	.|.	.|.	.|.	7.9898|7.9898	0.30233|0.30233	0.0:0.177:0.4298:0.3932|0.0:0.177:0.4298:0.3932	.|.	.|.	.|.	.|.	Q|K	6|12	.|.	.|.	P|Q	-|-	2|1	0|0	ACOT8|ACOT8	43917314|43917314	0.979000|0.979000	0.34478|0.34478	0.124000|0.124000	0.21820|0.21820	0.490000|0.490000	0.33462|0.33462	0.192000|0.192000	0.17096|0.17096	0.575000|0.575000	0.29434|0.29434	0.561000|0.561000	0.74099|0.74099	CCA|CAA		0.557	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080338.2		NM_183386	
ADAMTS16	170690	hgsc.bcm.edu;ucsc.edu	37	5	5187899	5187899	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr5:5187899T>A	ENST00000274181.7	+	6	1163	c.1025T>A	c.(1024-1026)cTg>cAg	p.L342Q	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.L342Q	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	342	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ATTGTAGGTCTGATTCTTCTA	0.313																																																	0													133.0	124.0	127.0					5																	5187899		1836	4088	5924	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1025T>A	5.37:g.5187899T>A	ENSP00000274181:p.Leu342Gln	Somatic		WXS	SOLID	Phase_I	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945309	0.73672	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	D;D	0.91351	-2.83;-2.83	5.13	5.13	0.70059	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.187760	0.34531	N	0.003895	D	0.96620	0.8897	H	0.95328	3.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.97685	1.0175	10	0.87932	D	0	.	13.9617	0.64185	0.0:0.0:0.0:1.0	.	342;342;342	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	Q	342	ENSP00000274181:L342Q;ENSP00000421631:L342Q	ENSP00000274181:L342Q	L	+	2	0	ADAMTS16	5240899	0.998000	0.40836	0.990000	0.47175	0.774000	0.43823	7.189000	0.77747	1.948000	0.56530	0.383000	0.25322	CTG		0.313	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1		NM_139056	
AHR	196	hgsc.bcm.edu;ucsc.edu	37	7	17382681	17382681	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr7:17382681T>A	ENST00000242057.4	+	11	3183	c.2540T>A	c.(2539-2541)tTc>tAc	p.F847Y		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	847				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TCCAGTGGATTCCTGTAATTC	0.383																																																	0													205.0	194.0	198.0					7																	17382681		2203	4300	6503	SO:0001583	missense	196			L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2540T>A	7.37:g.17382681T>A	ENSP00000242057:p.Phe847Tyr	Somatic		WXS	SOLID	Phase_I	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.968850	0.92855	.	.	ENSG00000106546	ENST00000242057	T	0.09073	3.02	5.37	5.37	0.77165	.	0.186934	0.48286	D	0.000193	T	0.20901	0.0503	M	0.61703	1.905	0.38662	D	0.952091	D	0.58970	0.984	P	0.54815	0.761	T	0.01256	-1.1404	10	0.66056	D	0.02	.	15.6747	0.77307	0.0:0.0:0.0:1.0	.	847	P35869	AHR_HUMAN	Y	847	ENSP00000242057:F847Y	ENSP00000242057:F847Y	F	+	2	0	AHR	17349206	1.000000	0.71417	0.971000	0.41717	0.955000	0.61496	5.505000	0.66981	2.148000	0.66965	0.482000	0.46254	TTC		0.383	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2		NM_001621	
AMPD3	272	hgsc.bcm.edu;ucsc.edu	37	11	10516458	10516458	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr11:10516458T>A	ENST00000396554.3	+	8	1515	c.1174T>A	c.(1174-1176)Ttc>Atc	p.F392I	AMPD3_ENST00000444303.2_Missense_Mutation_p.F224I	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	383	Substrate binding. {ECO:0000250}.				ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CCGGCAGACATTCCACCGCTT	0.542																																																	0													124.0	121.0	122.0					11																	10516458		2201	4294	6495	SO:0001583	missense	272			M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.1174T>A	11.37:g.10516458T>A	ENSP00000379802:p.Phe392Ile	Somatic		WXS	SOLID	Phase_I	A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	37	CCDS7802.1	.	.	.	.	.	.	.	.	.	.	T	33	5.219694	0.95139	.	.	ENSG00000133805	ENST00000444303;ENST00000396554;ENST00000396553;ENST00000528723;ENST00000529507	D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68	4.81	4.81	0.61882	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.91710	0.7379	M	0.87900	2.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.92936	0.6368	10	0.62326	D	0.03	-15.9671	14.3823	0.66919	0.0:0.0:0.0:1.0	.	390;383;392	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	I	224;392;383;390;383	ENSP00000396000:F224I;ENSP00000379802:F392I;ENSP00000379801:F383I;ENSP00000436987:F390I;ENSP00000431648:F383I	ENSP00000379801:F383I	F	+	1	0	AMPD3	10473034	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.040000	0.89188	1.803000	0.52742	0.402000	0.26972	TTC		0.542	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2		NM_000480	
AOX1	316	hgsc.bcm.edu;ucsc.edu	37	2	201488671	201488671	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr2:201488671T>A	ENST00000374700.2	+	19	2330	c.2089T>A	c.(2089-2091)Tat>Aat	p.Y697N	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	697					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GAAGATTGTCTATCAAGACTT	0.468																																																	0													197.0	169.0	179.0					2																	201488671		2203	4300	6503	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.2089T>A	2.37:g.201488671T>A	ENSP00000363832:p.Tyr697Asn	Somatic		WXS	SOLID	Phase_I	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045166	0.75846	.	.	ENSG00000138356	ENST00000374700	T	0.27557	1.66	5.21	5.21	0.72293	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead (3);	0.120124	0.64402	D	0.000017	T	0.71484	0.3345	H	0.98295	4.195	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.83676	0.0169	10	0.87932	D	0	-44.4277	15.5441	0.76081	0.0:0.0:0.0:1.0	.	697	Q06278	ADO_HUMAN	N	697	ENSP00000363832:Y697N	ENSP00000363832:Y697N	Y	+	1	0	AOX1	201196916	1.000000	0.71417	0.998000	0.56505	0.510000	0.34073	7.038000	0.76537	2.317000	0.78254	0.459000	0.35465	TAT		0.468	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1		NM_001159	
APC	324	hgsc.bcm.edu;ucsc.edu	37	5	112174812	112174812	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr5:112174812A>G	ENST00000457016.1	+	16	3901	c.3521A>G	c.(3520-3522)gAt>gGt	p.D1174G	APC_ENST00000508376.2_Missense_Mutation_p.D1174G|APC_ENST00000257430.4_Missense_Mutation_p.D1174G|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1174	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CGTCATGTGGATCAGCCTATT	0.333		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)											71.0	76.0	74.0					5																	112174812		2202	4300	6502	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3521A>G	5.37:g.112174812A>G	ENSP00000413133:p.Asp1174Gly	Somatic		WXS	SOLID	Phase_I	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.361651	0.41801	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36	5.76	5.76	0.90799	.	0.101162	0.64402	D	0.000002	D	0.88698	0.6507	N	0.19112	0.55	0.50813	D	0.999891	P;P	0.38745	0.645;0.645	B;B	0.40534	0.332;0.332	D	0.87557	0.2469	9	.	.	.	-15.6685	16.0796	0.80995	1.0:0.0:0.0:0.0	.	1176;1174	Q4LE70;P25054	.;APC_HUMAN	G	1174	ENSP00000413133:D1174G;ENSP00000257430:D1174G;ENSP00000427089:D1174G;ENSP00000423828:D1174G	.	D	+	2	0	APC	112202711	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.223000	0.89779	2.206000	0.71126	0.533000	0.62120	GAT		0.333	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2		NM_000038	
ARHGAP18	93663	hgsc.bcm.edu	37	6	129963095	129963095	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr6:129963095A>G	ENST00000368149.2	-	2	270	c.182T>C	c.(181-183)tTt>tCt	p.F61S		NM_033515.2	NP_277050.2			Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		TGATCGATCAAATGGAGGCTT	0.378																																																	0													138.0	136.0	136.0					6																	129963095		2203	4300	6503	SO:0001583	missense	93663			AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.182T>C	6.37:g.129963095A>G	ENSP00000357131:p.Phe61Ser	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000368149.2	37	CCDS34535.1	.	.	.	.	.	.	.	.	.	.	A	7.514	0.655235	0.14580	.	.	ENSG00000146376	ENST00000368149;ENST00000275189	.	.	.	5.89	3.42	0.39159	.	0.195325	0.44902	D	0.000401	T	0.31104	0.0786	M	0.80183	2.485	0.31529	N	0.661428	B;B	0.25441	0.068;0.126	B;B	0.25140	0.022;0.058	T	0.14392	-1.0474	8	.	.	.	.	5.8756	0.18826	0.5609:0.0:0.0684:0.3707	.	61;61	A9UK01;Q8N392	.;RHG18_HUMAN	S	16;61	.	.	F	-	2	0	ARHGAP18	130004788	0.843000	0.29541	0.240000	0.24138	0.027000	0.11550	2.200000	0.42724	0.434000	0.26340	-0.333000	0.08304	TTT		0.378	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2		NM_033515	
ARID2	196528	hgsc.bcm.edu;ucsc.edu	37	12	46230714	46230714	+	Silent	SNP	T	T	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr12:46230714T>C	ENST00000334344.6	+	8	1135	c.963T>C	c.(961-963)caT>caC	p.H321H	ARID2_ENST00000422737.1_Silent_p.H172H|ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	321					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTTCTGCACATAGTCATTTTA	0.368			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													160.0	150.0	154.0					12																	46230714		2203	4300	6503	SO:0001819	synonymous_variant	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.963T>C	12.37:g.46230714T>C		Somatic		WXS	SOLID	Phase_I	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	37	CCDS31783.1																																																																																				0.368	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2		XM_350875	
BIRC2	329	hgsc.bcm.edu;ucsc.edu	37	11	102221130	102221130	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr11:102221130G>A	ENST00000227758.2	+	2	1944	c.545G>A	c.(544-546)aGt>aAt	p.S182N	BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000530675.1_Missense_Mutation_p.S133N|BIRC2_ENST00000532672.1_Missense_Mutation_p.S161N	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	182					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		TATGCAATGAGTACTGAAGAA	0.408																																																	0													121.0	118.0	119.0					11																	102221130		2203	4299	6502	SO:0001583	missense	329			L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.545G>A	11.37:g.102221130G>A	ENSP00000227758:p.Ser182Asn	Somatic		WXS	SOLID	Phase_I	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	37	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271417	0.40194	.	.	ENSG00000110330	ENST00000532832;ENST00000530675;ENST00000227758;ENST00000541741;ENST00000532672	T;T;T;T	0.03982	3.74;3.74;3.74;3.74	5.92	5.92	0.95590	Baculoviral inhibition of apoptosis protein repeat (2);	0.083411	0.85682	N	0.000000	T	0.05318	0.0141	L	0.28274	0.84	0.39307	D	0.965014	B	0.06786	0.001	B	0.08055	0.003	T	0.49273	-0.8957	10	0.22706	T	0.39	-8.0298	18.5012	0.90882	0.0:0.0:1.0:0.0	.	182	Q13490	BIRC2_HUMAN	N	24;133;182;182;161	ENSP00000432410:S24N;ENSP00000431723:S133N;ENSP00000227758:S182N;ENSP00000434979:S161N	ENSP00000227758:S182N	S	+	2	0	BIRC2	101726340	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.186000	0.50942	2.809000	0.96659	0.655000	0.94253	AGT		0.408	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1		NM_001166	
NOA1	84273	hgsc.bcm.edu;ucsc.edu	37	4	57834621	57834621	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr4:57834621G>A	ENST00000264230.4	-	4	2813	c.1576C>T	c.(1576-1578)Cca>Tca	p.P526S		NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	526					apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										AAAGTTCTTGGAACAATGGAC	0.328																																																	0													69.0	73.0	71.0					4																	57834621		2203	4300	6503	SO:0001583	missense	0			AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.1576C>T	4.37:g.57834621G>A	ENSP00000264230:p.Pro526Ser	Somatic		WXS	SOLID	Phase_I	Q8N7L6|Q9BSQ9	Missense_Mutation	SNP	ENST00000264230.4	37	CCDS3510.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428124	0.83667	.	.	ENSG00000084092	ENST00000264230	T	0.47869	0.83	5.79	4.93	0.64822	.	0.110406	0.64402	D	0.000008	T	0.73560	0.3602	M	0.90595	3.13	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	T	0.80516	-0.1348	10	0.72032	D	0.01	.	15.7323	0.77817	0.0:0.0:0.8622:0.1378	.	526	Q8NC60	CD014_HUMAN	S	526	ENSP00000264230:P526S	ENSP00000264230:P526S	P	-	1	0	C4orf14	57529378	1.000000	0.71417	0.990000	0.47175	0.990000	0.78478	8.875000	0.92372	1.391000	0.46566	0.563000	0.77884	CCA		0.328	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250694.2		NM_032313	
CFTR	1080	hgsc.bcm.edu	37	7	117170982	117170982	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr7:117170982A>T	ENST00000003084.6	+	4	435	c.303A>T	c.(301-303)ttA>ttT	p.L101F	CFTR_ENST00000454343.1_Missense_Mutation_p.L101F	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	101	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	AGCCTCTCTTACTGGGAAGAA	0.393									Cystic Fibrosis																																								0			GRCh37	CI920927	CFTR	I							86.0	79.0	81.0					7																	117170982		2203	4300	6503	SO:0001583	missense	1080	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.303A>T	7.37:g.117170982A>T	ENSP00000003084:p.Leu101Phe	Somatic		WXS	SOLID	Phase_I	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175231	0.78564	.	.	ENSG00000001626	ENST00000446805;ENST00000003084;ENST00000454343;ENST00000426809	D;D;D;D	0.99582	-6.22;-2.64;-2.64;-3.16	5.73	-1.36	0.09085	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98102	0.9374	L	0.28458	0.855	0.46981	D	0.999273	P	0.40834	0.73	P	0.53518	0.728	D	0.94032	0.7302	10	0.30854	T	0.27	-8.3613	0.4732	0.00535	0.3288:0.1161:0.216:0.3392	.	101	P13569	CFTR_HUMAN	F	20;101;101;101	ENSP00000417012:L20F;ENSP00000003084:L101F;ENSP00000403677:L101F;ENSP00000389119:L101F	ENSP00000003084:L101F	L	+	3	2	CFTR	116958218	0.999000	0.42202	0.997000	0.53966	0.988000	0.76386	0.748000	0.26305	-0.064000	0.13043	0.454000	0.30748	TTA		0.393	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3		NM_000492	
CGRRF1	10668	hgsc.bcm.edu;ucsc.edu	37	14	54996813	54996813	+	Silent	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr14:54996813A>G	ENST00000216420.7	+	3	423	c.291A>G	c.(289-291)acA>acG	p.T97T	CGRRF1_ENST00000557512.1_3'UTR	NM_006568.2	NP_006559.1	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	97					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|lung(5)|ovary(2)|stomach(1)	13						GCCTCCTTACATGCTACTGGG	0.383																																																	0													98.0	92.0	94.0					14																	54996813		2203	4300	6503	SO:0001819	synonymous_variant	10668			BC015063	CCDS9719.1	14q22.2	2013-09-20			ENSG00000100532	ENSG00000100532		"""RING-type (C3HC4) zinc fingers"""	15528	protein-coding gene	gene with protein product		606138				8968090	Standard	NM_006568		Approved	CGR19, RNF197	uc001xay.3	Q99675	OTTHUMG00000140308	ENST00000216420.7:c.291A>G	14.37:g.54996813A>G		Somatic		WXS	SOLID	Phase_I	Q96BX2	Silent	SNP	ENST00000216420.7	37	CCDS9719.1																																																																																				0.383	CGRRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276905.2		NM_006568	
CHIT1	1118	hgsc.bcm.edu;ucsc.edu	37	1	203188447	203188447	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr1:203188447C>T	ENST00000367229.1	-	9	960	c.926G>A	c.(925-927)tGg>tAg	p.W309*	CHIT1_ENST00000255427.3_Nonsense_Mutation_p.W290*|CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.W300*	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	309					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GGCCCCCTTCCAGGAGCAGAC	0.572																																																	0													87.0	80.0	82.0					1																	203188447		2203	4300	6503	SO:0001587	stop_gained	1118			U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.926G>A	1.37:g.203188447C>T	ENSP00000356198:p.Trp309*	Somatic		WXS	SOLID	Phase_I	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838397	0.91117	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	5.2	3.13	0.36017	.	0.139540	0.33772	N	0.004580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-0.1881	9.3596	0.38188	0.1538:0.7587:0.0:0.0875	.	.	.	.	X	309;290;300	.	ENSP00000255427:W290X	W	-	2	0	CHIT1	201455070	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	1.464000	0.35288	1.179000	0.42884	0.655000	0.94253	TGG		0.572	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2		NM_003465	
CLDN2	9075	hgsc.bcm.edu	37	X	106171625	106171625	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chrX:106171625C>A	ENST00000541806.1	+	2	686	c.167C>A	c.(166-168)aCa>aAa	p.T56K	CLDN2_ENST00000336803.1_Missense_Mutation_p.T56K|CLDN2_ENST00000540876.1_Missense_Mutation_p.T56K	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	56					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.T56K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						GAATGTGCCACACACAGCACA	0.567																																																	1	Substitution - Missense(1)	ovary(1)											115.0	94.0	101.0					X																	106171625		2203	4300	6503	SO:0001583	missense	9075			AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.167C>A	X.37:g.106171625C>A	ENSP00000441283:p.Thr56Lys	Somatic		WXS	SOLID	Phase_I	B2R6B9	Missense_Mutation	SNP	ENST00000541806.1	37	CCDS14524.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890862	0.52014	.	.	ENSG00000165376	ENST00000541806;ENST00000540876;ENST00000336803	D;D;D	0.89123	-2.47;-2.47;-2.47	5.6	5.6	0.85130	Claudin, conserved site (1);	0.108239	0.64402	D	0.000006	D	0.90448	0.7009	M	0.63428	1.95	0.40844	D	0.983695	P	0.50369	0.934	P	0.51101	0.659	D	0.89377	0.3679	10	0.29301	T	0.29	.	15.8564	0.78979	0.0:1.0:0.0:0.0	.	56	P57739	CLD2_HUMAN	K	56	ENSP00000441283:T56K;ENSP00000443230:T56K;ENSP00000336571:T56K	ENSP00000336571:T56K	T	+	2	0	CLDN2	106058281	0.691000	0.27709	1.000000	0.80357	0.995000	0.86356	1.612000	0.36889	2.343000	0.79666	0.594000	0.82650	ACA		0.567	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057815.1			
COL16A1	1307	hgsc.bcm.edu	37	1	32146505	32146505	+	Splice_Site	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr1:32146505C>T	ENST00000373672.3	-	39	3127		c.e39+1		COL16A1_ENST00000271069.6_Splice_Site|COL16A1_ENST00000373668.3_Splice_Site	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1						cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.?(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TTGGAACTCACCTTCTCTCCT	0.607																																					Colon(143;498 1786 21362 25193 36625)												1	Unknown(1)	ovary(1)											97.0	106.0	103.0					1																	32146505		1958	4147	6105	SO:0001630	splice_region_variant	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2610+1G>A	1.37:g.32146505C>T		Somatic		WXS	SOLID	Phase_I	Q16593|Q59F89|Q71RG9	Splice_Site	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.811068	0.32053	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000458715;ENST00000373668	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9126	0.79482	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL16A1	31919092	1.000000	0.71417	0.998000	0.56505	0.162000	0.22319	4.336000	0.59304	2.566000	0.86566	0.643000	0.83706	.		0.607	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2		NM_001856	Intron
CSMD3	114788	hgsc.bcm.edu;ucsc.edu	37	8	113326746	113326746	+	Missense_Mutation	SNP	G	G	T	rs199566824		TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr8:113326746G>T	ENST00000297405.5	-	48	7705	c.7461C>A	c.(7459-7461)agC>agA	p.S2487R	CSMD3_ENST00000455883.2_Missense_Mutation_p.S2383R|CSMD3_ENST00000352409.3_Missense_Mutation_p.S2417R|CSMD3_ENST00000343508.3_Missense_Mutation_p.S2447R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2487	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCACTGAAATGCTCCATGCAC	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													124.0	118.0	120.0					8																	113326746		2203	4300	6503	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7461C>A	8.37:g.113326746G>T	ENSP00000297405:p.Ser2487Arg	Somatic		WXS	SOLID	Phase_I	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672085	0.67928	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	4.98	3.19	0.36642	CUB (5);	0.436137	0.22940	N	0.053797	T	0.27454	0.0674	N	0.24115	0.695	0.31284	N	0.690293	B;B;P	0.35174	0.409;0.154;0.488	B;B;P	0.46629	0.398;0.333;0.522	T	0.26503	-1.0101	10	0.17832	T	0.49	.	10.8286	0.46647	0.1523:0.0:0.8477:0.0	.	2383;2487;2447	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	2447;2487;1757;2383;2417	ENSP00000345799:S2447R;ENSP00000297405:S2487R;ENSP00000341558:S1757R;ENSP00000412263:S2383R;ENSP00000343124:S2417R	ENSP00000297405:S2487R	S	-	3	2	CSMD3	113395922	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.818000	0.27295	0.691000	0.31592	0.579000	0.79373	AGC		0.408	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1		NM_052900	
DACH1	1602	hgsc.bcm.edu;ucsc.edu	37	13	72049972	72049972	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr13:72049972T>C	ENST00000359684.2	-	10	2041	c.2042A>G	c.(2041-2043)cAa>cGa	p.Q681R	DACH1_ENST00000354591.4_Missense_Mutation_p.Q427R|DACH1_ENST00000313174.7_Missense_Mutation_p.Q481R|DACH1_ENST00000305425.4_Missense_Mutation_p.Q629R			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	681	DACHbox-C.|Interaction with SIN3A. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TAGCCTCTTTTGAACTATGGC	0.323																																																	0													160.0	139.0	146.0					13																	72049972		1831	4078	5909	SO:0001583	missense	1602			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2042A>G	13.37:g.72049972T>C	ENSP00000352712:p.Gln681Arg	Somatic		WXS	SOLID	Phase_I	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37		.	.	.	.	.	.	.	.	.	.	T	24.2	4.499929	0.85176	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.42131	1.05;1.08;1.08;0.98	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.67776	0.2929	M	0.82193	2.58	0.32958	D	0.520586	D;D;D	0.76494	0.981;0.975;0.999	D;D;D	0.87578	0.969;0.974;0.998	T	0.79529	-0.1766	10	0.87932	D	0	-9.2294	15.6179	0.76780	0.0:0.0:0.0:1.0	.	425;479;627	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	R	629;481;427;681;681	ENSP00000304994:Q629R;ENSP00000318506:Q481R;ENSP00000346604:Q427R;ENSP00000352712:Q681R	ENSP00000304994:Q629R	Q	-	2	0	DACH1	70947973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.852000	0.86927	2.150000	0.67090	0.533000	0.62120	CAA		0.323	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1		NM_004392	
DIDO1	11083	hgsc.bcm.edu	37	20	61526431	61526431	+	Silent	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr20:61526431A>G	ENST00000266070.4	-	9	2626	c.2301T>C	c.(2299-2301)ctT>ctC	p.L767L	DIDO1_ENST00000395340.1_Silent_p.L767L|DIDO1_ENST00000395343.1_Silent_p.L767L|DIDO1_ENST00000395335.2_Silent_p.L767L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	767	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TCCACGTGGAAAGCTCTTTAG	0.473																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													162.0	177.0	171.0					20																	61526431		2203	4300	6503	SO:0001819	synonymous_variant	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2301T>C	20.37:g.61526431A>G		Somatic		WXS	SOLID	Phase_I	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1																																																																																				0.473	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2		NM_080796	
DUSP4	1846	hgsc.bcm.edu	37	8	29197736	29197736	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr8:29197736T>C	ENST00000240100.2	-	2	847	c.458A>G	c.(457-459)gAg>gGg	p.E153G	DUSP4_ENST00000240101.2_Missense_Mutation_p.E62G	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	153	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		TTCTGGGTACTCGGAGGAAAA	0.557											OREG0018686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	29.0	27.0					8																	29197736		2203	4300	6503	SO:0001583	missense	1846			U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.458A>G	8.37:g.29197736T>C	ENSP00000240100:p.Glu153Gly	Somatic	807	WXS	SOLID	Phase_I	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	ENST00000240100.2	37	CCDS6072.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.942711	0.73672	.	.	ENSG00000120875	ENST00000240100;ENST00000240101	T;T	0.47869	0.83;3.85	5.01	5.01	0.66863	Rhodanese-like (4);	0.045571	0.85682	D	0.000000	T	0.46756	0.1409	M	0.62723	1.935	0.58432	D	0.999997	B;B	0.17038	0.02;0.005	B;B	0.19666	0.026;0.012	T	0.44559	-0.9320	10	0.46703	T	0.11	.	13.3328	0.60497	0.0:0.0:0.0:1.0	.	153;62	Q13115;G5E930	DUS4_HUMAN;.	G	153;62	ENSP00000240100:E153G;ENSP00000240101:E62G	ENSP00000240100:E153G	E	-	2	0	DUSP4	29253655	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.862000	0.62976	2.197000	0.70478	0.528000	0.53228	GAG		0.557	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257249.1		NM_001394	
ELF1	1997	hgsc.bcm.edu	37	13	41517220	41517220	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr13:41517220G>T	ENST00000239882.3	-	7	988	c.674C>A	c.(673-675)cCt>cAt	p.P225H	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.P201H	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	225					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		GATGTATTTAGGACAAGTAGC	0.393																																																	0													88.0	83.0	84.0					13																	41517220		2203	4300	6503	SO:0001583	missense	1997			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.674C>A	13.37:g.41517220G>T	ENSP00000239882:p.Pro225His	Somatic		WXS	SOLID	Phase_I	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342564	0.82022	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.55588	0.51;0.51	5.76	4.92	0.64577	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (3);	0.000000	0.85682	D	0.000000	T	0.72843	0.3511	M	0.76433	2.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77253	-0.2656	10	0.87932	D	0	.	16.2778	0.82654	0.0:0.0:0.8664:0.1336	.	201;225	E9PDQ9;P32519	.;ELF1_HUMAN	H	201;225	ENSP00000405580:P201H;ENSP00000239882:P225H	ENSP00000239882:P225H	P	-	2	0	ELF1	40415220	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	1.425000	0.47237	-0.169000	0.13324	CCT		0.393	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3		NM_172373	
FAAH	2166	hgsc.bcm.edu	37	1	46878796	46878796	+	Silent	SNP	G	G	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr1:46878796G>T	ENST00000243167.8	+	14	1599	c.1515G>T	c.(1513-1515)ggG>ggT	p.G505G		NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	505					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	TCCCTGCAGGGGTGGTGCCTG	0.567																																																	0													79.0	69.0	73.0					1																	46878796		2203	4300	6503	SO:0001819	synonymous_variant	2166			U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.1515G>T	1.37:g.46878796G>T		Somatic		WXS	SOLID	Phase_I	D3DQ19|Q52M86|Q5TDF8	Silent	SNP	ENST00000243167.8	37	CCDS535.1																																																																																				0.567	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021443.1		NM_001441	
GET4	51608	hgsc.bcm.edu	37	7	925701	925701	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr7:925701C>T	ENST00000265857.3	+	2	258	c.164C>T	c.(163-165)tCc>tTc	p.S55F	GET4_ENST00000407192.1_Missense_Mutation_p.S2F|RP11-449P15.2_ENST00000609998.1_RNA	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)	55					tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)				breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AGGTACATGTCCCAGAGCAAG	0.622																																																	0													80.0	71.0	74.0					7																	925701		2203	4299	6502	SO:0001583	missense	51608			AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.164C>T	7.37:g.925701C>T	ENSP00000265857:p.Ser55Phe	Somatic		WXS	SOLID	Phase_I	A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	Missense_Mutation	SNP	ENST00000265857.3	37	CCDS5317.1	.	.	.	.	.	.	.	.	.	.	c	20.9	4.066335	0.76187	.	.	ENSG00000239857	ENST00000265857;ENST00000412734;ENST00000407192;ENST00000441491	T	0.76968	-1.06	5.06	4.18	0.49190	.	0.059629	0.64402	D	0.000001	D	0.86356	0.5913	M	0.79258	2.445	0.80722	D	1	D	0.61080	0.989	D	0.65233	0.933	D	0.87459	0.2406	10	0.62326	D	0.03	-18.6866	13.3801	0.60762	0.0:0.9233:0.0:0.0767	.	55	Q7L5D6	GET4_HUMAN	F	55;9;2;67	ENSP00000265857:S55F	ENSP00000265857:S55F	S	+	2	0	GET4	892227	1.000000	0.71417	0.978000	0.43139	0.633000	0.38033	7.505000	0.81655	1.134000	0.42165	0.558000	0.71614	TCC		0.622	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000231930.1		NM_015949	
GINS3	64785	hgsc.bcm.edu	37	16	58437163	58437163	+	Silent	SNP	C	C	T	rs186469314		TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr16:58437163C>T	ENST00000318129.5	+	2	556	c.348C>T	c.(346-348)ttC>ttT	p.F116F	GINS3_ENST00000426538.2_Silent_p.F155F|GINS3_ENST00000328514.7_Intron	NM_022770.3	NP_073607.2	Q9BRX5	PSF3_HUMAN	GINS complex subunit 3 (Psf3 homolog)	116					DNA replication (GO:0006260)	nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	7						GGCCCCATTTCTACGGGTTTG	0.522																																																	0													76.0	67.0	70.0					16																	58437163		2198	4300	6498	SO:0001819	synonymous_variant	64785			BC005879	CCDS10796.1, CCDS45498.1, CCDS45499.1	16q21	2008-02-05			ENSG00000181938	ENSG00000181938			25851	protein-coding gene	gene with protein product		610610				12477932	Standard	NM_022770		Approved	FLJ13912, PSF3	uc010cdj.3	Q9BRX5	OTTHUMG00000133486	ENST00000318129.5:c.348C>T	16.37:g.58437163C>T		Somatic		WXS	SOLID	Phase_I	B2RDP3|E9PB21|Q9H870	Silent	SNP	ENST00000318129.5	37	CCDS10796.1																																																																																				0.522	GINS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257384.2		NM_022770	
SLC52A1	55065	hgsc.bcm.edu	37	17	4937083	4937083	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr17:4937083T>G	ENST00000424747.1	-	3	1413	c.701A>C	c.(700-702)cAa>cCa	p.Q234P	SLC52A1_ENST00000512825.2_Missense_Mutation_p.Q234P|SLC52A1_ENST00000254853.5_Missense_Mutation_p.Q234P	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	234					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)										GGATCCCAGTTGAAGTTCAGG	0.607																																																	0													54.0	54.0	54.0					17																	4937083		2203	4300	6503	SO:0001583	missense	0			AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.701A>C	17.37:g.4937083T>G	ENSP00000399979:p.Gln234Pro	Somatic		WXS	SOLID	Phase_I	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Missense_Mutation	SNP	ENST00000424747.1	37	CCDS11066.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.864712	0.00547	.	.	ENSG00000132517	ENST00000254853;ENST00000512825;ENST00000424747	T;T;T	0.75154	-0.91;-0.75;-0.91	1.11	-2.21	0.06973	.	1.322620	0.04667	N	0.410017	T	0.56352	0.1979	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.19910	-1.0291	10	0.29301	T	0.29	.	4.0816	0.09929	0.0:0.1699:0.3488:0.4813	.	234;234	F5H5Y1;Q9NWF4	.;RFT_HUMAN	P	234	ENSP00000254853:Q234P;ENSP00000443026:Q234P;ENSP00000399979:Q234P	ENSP00000254853:Q234P	Q	-	2	0	GPR172B	4877807	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.473000	0.06615	-2.971000	0.00286	-2.964000	0.00082	CAA		0.607	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1		NM_017986	
HERPUD2	64224	hgsc.bcm.edu	37	7	35712843	35712843	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr7:35712843C>T	ENST00000396081.1	-	2	997	c.193G>A	c.(193-195)Gat>Aat	p.D65N	HERPUD2_ENST00000311350.3_Missense_Mutation_p.D65N	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	65	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						TGCAGATGATCGGGAAGCAGT	0.373																																																	0													121.0	116.0	118.0					7																	35712843		2203	4300	6503	SO:0001583	missense	64224			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.193G>A	7.37:g.35712843C>T	ENSP00000379390:p.Asp65Asn	Somatic		WXS	SOLID	Phase_I	A4D1Y8|Q9H6F9	Missense_Mutation	SNP	ENST00000396081.1	37	CCDS5446.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055086	0.93793	.	.	ENSG00000122557	ENST00000396081;ENST00000311350	D;D	0.82167	-1.58;-1.58	4.86	4.86	0.63082	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.90140	0.6919	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89882	0.4031	10	0.46703	T	0.11	-9.3864	18.1837	0.89786	0.0:1.0:0.0:0.0	.	65	Q9BSE4	HERP2_HUMAN	N	65	ENSP00000379390:D65N;ENSP00000310729:D65N	ENSP00000310729:D65N	D	-	1	0	HERPUD2	35679368	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	6.368000	0.73104	2.525000	0.85131	0.585000	0.79938	GAT		0.373	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1		NM_022373	
HTATSF1	27336	hgsc.bcm.edu;ucsc.edu	37	X	135581831	135581831	+	Silent	SNP	A	A	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chrX:135581831A>C	ENST00000218364.4	+	2	435	c.261A>C	c.(259-261)gcA>gcC	p.A87A	HTATSF1_ENST00000535601.1_Silent_p.A87A	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	87					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GTTCTACCGCAAATGTTGAAG	0.458																																																	0													125.0	123.0	123.0					X																	135581831		2203	4300	6503	SO:0001819	synonymous_variant	27336			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.261A>C	X.37:g.135581831A>C		Somatic		WXS	SOLID	Phase_I	D3DWG9|Q59G06|Q99730	Silent	SNP	ENST00000218364.4	37	CCDS14657.1																																																																																				0.458	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1		NM_014500	
KIAA0319	9856	hgsc.bcm.edu;ucsc.edu	37	6	24547461	24547461	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr6:24547461G>A	ENST00000378214.3	-	21	3675	c.3151C>T	c.(3151-3153)Cca>Tca	p.P1051S	KIAA0319_ENST00000543707.1_Missense_Mutation_p.P1051S|KIAA0319_ENST00000537886.1_Missense_Mutation_p.P990S|KIAA0319_ENST00000535378.1_Missense_Mutation_p.P1042S|KIAA0319_ENST00000430948.2_Missense_Mutation_p.P1006S	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	1051					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						GAAACCTTTGGATTCCCTCTC	0.478																																																	0													211.0	196.0	201.0					6																	24547461		2203	4300	6503	SO:0001583	missense	9856			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.3151C>T	6.37:g.24547461G>A	ENSP00000367459:p.Pro1051Ser	Somatic		WXS	SOLID	Phase_I	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	ENST00000378214.3	37	CCDS34348.1	.	.	.	.	.	.	.	.	.	.	G	1.108	-0.658918	0.03454	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.05855	3.41;3.38;3.38;3.38;3.38	4.76	-0.811	0.10857	.	0.687582	0.13146	N	0.410235	T	0.00666	0.0022	N	0.08118	0	0.09310	N	1	B;B;B	0.16603	0.018;0.018;0.01	B;B;B	0.14578	0.009;0.011;0.005	T	0.46261	-0.9204	10	0.13853	T	0.58	-0.0025	2.5836	0.04825	0.3186:0.1238:0.4327:0.1249	.	990;1042;1051	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	S	990;1042;1006;1051;1051	ENSP00000439700:P990S;ENSP00000442403:P1042S;ENSP00000401086:P1006S;ENSP00000367459:P1051S;ENSP00000437656:P1051S	ENSP00000367459:P1051S	P	-	1	0	KIAA0319	24655440	0.605000	0.26941	0.000000	0.03702	0.866000	0.49608	0.233000	0.17911	-0.054000	0.13266	0.655000	0.94253	CCA		0.478	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1		NM_014809	
KIF18B	146909	hgsc.bcm.edu	37	17	43011388	43011388	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr17:43011388G>A	ENST00000593135.1	-	7	1062	c.965C>T	c.(964-966)aCa>aTa	p.T322I	KIF18B_ENST00000590129.1_Missense_Mutation_p.T331I|KIF18B_ENST00000339151.4_Missense_Mutation_p.T322I|KIF18B_ENST00000587309.1_Missense_Mutation_p.T322I|KIF18B_ENST00000438933.2_Missense_Mutation_p.T322I	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	331	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				GATCATCACTGTGCGGCAGTT	0.627																																																	0													46.0	48.0	47.0					17																	43011388		2141	4276	6417	SO:0001583	missense	146909				CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.965C>T	17.37:g.43011388G>A	ENSP00000465992:p.Thr322Ile	Somatic		WXS	SOLID	Phase_I	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Missense_Mutation	SNP	ENST00000593135.1	37	CCDS45709.2	.	.	.	.	.	.	.	.	.	.	G	33	5.234971	0.95207	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	T;T	0.76578	-1.03;-1.03	5.5	5.5	0.81552	Kinesin, motor domain (4);	0.000000	0.36591	N	0.002503	D	0.92886	0.7737	H	0.97440	4.005	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95070	0.8203	10	0.87932	D	0	.	19.4119	0.94677	0.0:0.0:1.0:0.0	.	331;331;331	Q86Y91;Q86Y91-3;Q86Y91-2	KI18B_HUMAN;.;.	I	322	ENSP00000412798:T322I;ENSP00000341466:T322I	ENSP00000341466:T322I	T	-	2	0	KIF18B	40366914	1.000000	0.71417	0.983000	0.44433	0.983000	0.72400	5.725000	0.68507	2.596000	0.87737	0.650000	0.86243	ACA		0.627	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1		NM_001080443	
KIF20B	9585	hgsc.bcm.edu	37	10	91532538	91532538	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr10:91532538A>G	ENST00000371728.3	+	32	5400	c.5335A>G	c.(5335-5337)Aaa>Gaa	p.K1779E	KIF20B_ENST00000416354.1_Missense_Mutation_p.K1809E|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.K1739E	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1779	Interaction with PIN1.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AGCCAAACGGAAATTATACAC	0.333																																																	0													129.0	127.0	128.0					10																	91532538		2203	4300	6503	SO:0001583	missense	9585			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.5335A>G	10.37:g.91532538A>G	ENSP00000360793:p.Lys1779Glu	Somatic		WXS	SOLID	Phase_I	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	26.2	4.718275	0.89205	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000371728	T;T;T	0.57907	0.37;0.37;0.37	5.91	5.91	0.95273	.	0.134947	0.33553	N	0.004795	T	0.68751	0.3035	M	0.66939	2.045	0.80722	D	1	D;D	0.61697	0.982;0.99	P;P	0.61940	0.664;0.896	T	0.71902	-0.4452	10	0.72032	D	0.01	-24.2707	15.3204	0.74117	1.0:0.0:0.0:0.0	.	1779;1739	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	E	1739;1809;1779	ENSP00000260753:K1739E;ENSP00000411545:K1809E;ENSP00000360793:K1779E	ENSP00000260753:K1739E	K	+	1	0	KIF20B	91522518	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.921000	0.75805	2.255000	0.74692	0.533000	0.62120	AAA		0.333	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1		NM_016195	
KIRREL	55243	hgsc.bcm.edu;ucsc.edu	37	1	158054231	158054231	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr1:158054231G>C	ENST00000359209.6	+	4	439	c.372G>C	c.(370-372)agG>agC	p.R124S	KIRREL_ENST00000368173.3_Missense_Mutation_p.R124S|KIRREL_ENST00000360089.4_Intron|KIRREL_ENST00000368172.1_5'Flank|KIRREL_ENST00000416935.2_Missense_Mutation_p.R24S|KIRREL_ENST00000392272.2_Intron			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	124	Ig-like C2-type 2.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					AGGACACCAGGATTGACGGAG	0.582																																																	0													59.0	66.0	64.0					1																	158054231		692	1591	2283	SO:0001583	missense	55243			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.372G>C	1.37:g.158054231G>C	ENSP00000352138:p.Arg124Ser	Somatic		WXS	SOLID	Phase_I	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879455	0.33162	.	.	ENSG00000183853	ENST00000368173;ENST00000359209;ENST00000416935	D;D;D	0.85702	-2.02;-2.02;-2.02	5.34	4.23	0.50019	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.468641	0.18031	N	0.153909	T	0.62233	0.2411	N	0.11560	0.145	0.35864	D	0.827726	B;B	0.19817	0.039;0.017	B;B	0.27380	0.079;0.042	T	0.61505	-0.7049	10	0.44086	T	0.13	-13.4071	12.1787	0.54199	0.0983:0.0:0.9017:0.0	.	24;124	B4DN67;Q96J84	.;KIRR1_HUMAN	S	124;124;24	ENSP00000357155:R124S;ENSP00000352138:R124S;ENSP00000389674:R24S	ENSP00000352138:R124S	R	+	3	2	KIRREL	156320855	0.976000	0.34144	1.000000	0.80357	0.979000	0.70002	1.660000	0.37397	2.515000	0.84797	0.650000	0.86243	AGG		0.582	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3		NM_018240	
MAPK15	225689	hgsc.bcm.edu	37	8	144801567	144801567	+	Silent	SNP	G	G	C	rs140965473	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr8:144801567G>C	ENST00000338033.4	+	7	755	c.636G>C	c.(634-636)ctG>ctC	p.L212L	MAPK15_ENST00000395107.4_Silent_p.L229L|RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Silent_p.L212L	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	212	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGGAGATGCTGCGGGGGAGAC	0.647													G|||	49	0.00978435	0.0348	0.0043	5008	,	,		14712	0.0		0.0	False		,,,				2504	0.0																0								G		82,4324	69.2+/-107.0	0,82,2121	48.0	48.0	48.0		636	-0.5	0.6	8	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous	MAPK15	NM_139021.2		0,82,6421	CC,CG,GG		0.0,1.8611,0.6305		212/545	144801567	82,12924	2203	4300	6503	SO:0001819	synonymous_variant	225689			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.636G>C	8.37:g.144801567G>C		Somatic		WXS	SOLID	Phase_I	Q2TCF9|Q8N362	Silent	SNP	ENST00000338033.4	37	CCDS6409.2																																																																																				0.647	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1		NM_139021	
MPO	4353	hgsc.bcm.edu;ucsc.edu	37	17	56350802	56350802	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr17:56350802A>C	ENST00000225275.3	-	9	1770	c.1594T>G	c.(1594-1596)Ttt>Gtt	p.F532V	MPO_ENST00000578493.1_5'Flank|MPO_ENST00000340482.3_Missense_Mutation_p.F564V	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	532					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	CAGGAGGCAAAAAAGACCCTG	0.612																																																	0													107.0	111.0	110.0					17																	56350802		2203	4300	6503	SO:0001583	missense	4353				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1594T>G	17.37:g.56350802A>C	ENSP00000225275:p.Phe532Val	Somatic		WXS	SOLID	Phase_I	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.926206	0.73327	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.72394	-0.65;-0.65	4.27	4.27	0.50696	.	0.107034	0.64402	D	0.000004	D	0.88833	0.6544	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.92132	0.5713	10	0.87932	D	0	-8.0532	12.7517	0.57312	1.0:0.0:0.0:0.0	.	532	P05164	PERM_HUMAN	V	564;532	ENSP00000344419:F564V;ENSP00000225275:F532V	ENSP00000225275:F532V	F	-	1	0	MPO	53705801	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	9.109000	0.94291	1.792000	0.52537	0.459000	0.35465	TTT		0.612	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1			
FAN1	22909	hgsc.bcm.edu	37	15	31221493	31221493	+	Missense_Mutation	SNP	C	C	T	rs80120912	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr15:31221493C>T	ENST00000362065.4	+	12	2971	c.2680C>T	c.(2680-2682)Ccc>Tcc	p.P894S	FAN1_ENST00000568145.1_3'UTR|RP11-540B6.6_ENST00000602886.1_RNA	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	894					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						TCATGATGCCCCCGAGGAGAG	0.617								Direct reversal of damage					C|||	40	0.00798722	0.0008	0.013	5008	,	,		13082	0.0		0.0239	False		,,,				2504	0.0061																0								C	SER/PRO	18,4386	25.3+/-52.1	0,18,2184	112.0	111.0	112.0		2680	-4.9	0.0	15	dbSNP_132	112	146,8454	70.3+/-132.9	1,144,4155	yes	missense	FAN1	NM_014967.4	74	1,162,6339	TT,TC,CC		1.6977,0.4087,1.2612	benign	894/1018	31221493	164,12840	2202	4300	6502	SO:0001583	missense	0				CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.2680C>T	15.37:g.31221493C>T	ENSP00000354497:p.Pro894Ser	Somatic		WXS	SOLID	Phase_I	A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	37	CCDS32186.1	27	0.012362637362637362	0	0.0	5	0.013812154696132596	0	0.0	22	0.029023746701846966	C	0.006	-2.038431	0.00402	0.004087	0.016977	ENSG00000198690	ENST00000362065	T	0.79454	-1.27	5.39	-4.95	0.03048	.	0.528821	0.20907	N	0.083522	T	0.22859	0.0552	N	0.04508	-0.205	0.42132	D	0.991471	B;B	0.14438	0.01;0.005	B;B	0.17722	0.019;0.012	T	0.22906	-1.0203	10	0.07644	T	0.81	-0.2117	10.6301	0.45532	0.0:0.223:0.102:0.675	.	894;894	Q9Y2M0;D9MXF4	FAN1_HUMAN;.	S	894	ENSP00000354497:P894S	ENSP00000354497:P894S	P	+	1	0	FAN1	29008785	0.003000	0.15002	0.001000	0.08648	0.010000	0.07245	0.139000	0.16036	-0.893000	0.03930	-0.355000	0.07637	CCC		0.617	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1		NM_014967	
MYO1G	64005	hgsc.bcm.edu;ucsc.edu	37	7	45011770	45011770	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr7:45011770G>A	ENST00000258787.7	-	6	809	c.673C>T	c.(673-675)Cct>Tct	p.P225S		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	225	Myosin motor.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						TATACAGCAGGGTTTCTCTCC	0.517																																																	0													288.0	241.0	257.0					7																	45011770		2203	4300	6503	SO:0001583	missense	64005			AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.673C>T	7.37:g.45011770G>A	ENSP00000258787:p.Pro225Ser	Somatic		WXS	SOLID	Phase_I	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	ENST00000258787.7	37	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997224	0.74818	.	.	ENSG00000136286	ENST00000258787	T	0.72505	-0.66	4.46	4.46	0.54185	Myosin head, motor domain (2);	0.000000	0.40469	N	0.001100	T	0.74764	0.3759	M	0.69358	2.11	0.58432	D	0.999999	B;P	0.47106	0.415;0.89	B;P	0.48952	0.274;0.596	T	0.75955	-0.3135	10	0.41790	T	0.15	.	15.0103	0.71545	0.0:0.0:1.0:0.0	.	225;225	B0I1T2-4;B0I1T2	.;MYO1G_HUMAN	S	225	ENSP00000258787:P225S	ENSP00000258787:P225S	P	-	1	0	MYO1G	44978295	1.000000	0.71417	0.994000	0.49952	0.841000	0.47740	4.931000	0.63469	2.458000	0.83093	0.655000	0.94253	CCT		0.517	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2			
NBPF3	84224	hgsc.bcm.edu	37	1	21808126	21808126	+	Silent	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr1:21808126G>A	ENST00000318249.5	+	13	1820	c.1470G>A	c.(1468-1470)gaG>gaA	p.E490E	NBPF3_ENST00000342104.5_Silent_p.E478E|NBPF3_ENST00000454000.2_Silent_p.E420E|NBPF3_ENST00000318220.6_Silent_p.E434E	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	490	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TAGAGCCTGAGGACTTGCAGG	0.488																																																	0													63.0	75.0	71.0					1																	21808126		2202	4298	6500	SO:0001819	synonymous_variant	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1470G>A	1.37:g.21808126G>A		Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	37	CCDS216.1																																																																																				0.488	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NOTCH4	4855	hgsc.bcm.edu	37	6	32188642	32188642	+	Silent	SNP	T	T	C	rs520688|rs71556915	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr6:32188642T>C	ENST00000375023.3	-	5	951	c.813A>G	c.(811-813)ccA>ccG	p.P271P		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	271	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CCTCACAGTCTGGGCCTATGA	0.607													C|||	1403	0.280152	0.2095	0.2594	5008	,	,		18868	0.2421		0.3519	False		,,,				2504	0.3558																0								C		939,3467	734.4+/-410.6	91,757,1355	94.0	85.0	88.0		813	-2.0	0.0	6	dbSNP_83	88	2747,5853	677.2+/-403.4	449,1849,2002	no	coding-synonymous	NOTCH4	NM_004557.3		540,2606,3357	CC,CT,TT		31.9419,21.3118,28.3408		271/2004	32188642	3686,9320	2203	4300	6503	SO:0001819	synonymous_variant	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.813A>G	6.37:g.32188642T>C		Somatic		WXS	SOLID	Phase_I	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	CCDS34420.1																																																																																				0.607	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			
ODF1	4956	hgsc.bcm.edu	37	8	103573037	103573037	+	Silent	SNP	G	G	C	rs143802899|rs568456031|rs377699584|rs62523273|rs386728348|rs58232162	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr8:103573037G>C	ENST00000285402.3	+	2	834	c.678G>C	c.(676-678)ccG>ccC	p.P226P	ODF1_ENST00000518835.1_Silent_p.P19P	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	226	C-X-P repeat region.		Missing. {ECO:0000269|PubMed:8111388}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.C218_P226delCNPCSPCNP(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			cctgcaacccgtgcagcccAT	0.547																																																	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)						C		691,3579		206,279,1650	52.0	62.0	58.0		678	-2.8	0.9	8	dbSNP_129	58	540,7902		123,294,3804	no	coding-synonymous	ODF1	NM_024410.3		329,573,5454	CC,CG,GG		6.3966,16.1827,9.6838		226/251	103573037	1231,11481	2135	4221	6356	SO:0001819	synonymous_variant	4956			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.678G>C	8.37:g.103573037G>C		Somatic		WXS	SOLID	Phase_I	Q3SX72	Silent	SNP	ENST00000285402.3	37	CCDS6293.1																																																																																				0.547	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			
PIGL	9487	hgsc.bcm.edu;ucsc.edu	37	17	16221127	16221127	+	Missense_Mutation	SNP	C	C	G	rs534716676		TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr17:16221127C>G	ENST00000225609.5	+	6	582	c.565C>G	c.(565-567)Cgc>Ggc	p.R189G	PIGL_ENST00000581006.1_Intron|PIGL_ENST00000395844.4_Missense_Mutation_p.A178G	NM_004278.3	NP_004269.1	Q9Y2B2	PIGL_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class L	189					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	N-acetylglucosaminylphosphatidylinositol deacetylase activity (GO:0000225)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)		GAATGTGCTGCGCAAGTACAT	0.542																																																	0													221.0	159.0	180.0					17																	16221127		2203	4300	6503	SO:0001583	missense	9487			AB017165	CCDS11176.1	17p12-p11.2	2013-02-26	2006-06-28		ENSG00000108474	ENSG00000108474	3.5.1.89	"""Phosphatidylinositol glycan anchor biosynthesis"""	8966	protein-coding gene	gene with protein product	"""N-acetylglucosaminylphosphatidylinositol deacetylase"""	605947	"""phosphatidylinositol glycan, class L"""			10085243	Standard	NM_004278		Approved		uc002gpv.3	Q9Y2B2	OTTHUMG00000059346	ENST00000225609.5:c.565C>G	17.37:g.16221127C>G	ENSP00000225609:p.Arg189Gly	Somatic		WXS	SOLID	Phase_I	A8KA67|B4DYN4	Missense_Mutation	SNP	ENST00000225609.5	37	CCDS11176.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.16|16.16	3.044281|3.044281	0.55110|0.55110	.|.	.|.	ENSG00000108474|ENSG00000108474	ENST00000395844|ENST00000225609	T|T	0.76709|0.01145	-1.04|5.27	6.02|6.02	5.04|5.04	0.67666|0.67666	.|Putative deacetylase LmbE-like domain (2);	.|0.047666	.|0.85682	.|D	.|0.000000	T|T	0.07369|0.07369	0.0186|0.0186	M|M	0.86343|0.86343	2.81|2.81	0.53688|0.53688	D|D	0.999972|0.999972	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.00920|0.00920	-1.1514|-1.1514	6|10	.|0.56958	.|D	.|0.05	-17.7413|-17.7413	9.9855|9.9855	0.41839|0.41839	0.1562:0.6932:0.1506:0.0|0.1562:0.6932:0.1506:0.0	.|.	.|189	.|Q9Y2B2	.|PIGL_HUMAN	G|G	178|189	ENSP00000379185:A178G|ENSP00000225609:R189G	.|ENSP00000225609:R189G	A|R	+|+	2|1	0|0	PIGL|PIGL	16161852|16161852	0.984000|0.984000	0.35163|0.35163	0.951000|0.951000	0.38953|0.38953	0.977000|0.977000	0.68977|0.68977	2.535000|2.535000	0.45685|0.45685	1.521000|1.521000	0.48983|0.48983	0.655000|0.655000	0.94253|0.94253	GCG|CGC		0.542	PIGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131881.1			
PLA2G4E	123745	hgsc.bcm.edu	37	15	42292364	42292364	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr15:42292364A>G	ENST00000399518.3	-	8	1276	c.790T>C	c.(790-792)Tac>Cac	p.Y264H	CTD-2382E5.1_ENST00000499478.2_RNA|PLA2G4E_ENST00000413860.2_Missense_Mutation_p.Y235H	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	257					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		TACTTGGGGTAGTGGAAGCAG	0.607																																																	0													41.0	47.0	45.0					15																	42292364		2031	4190	6221	SO:0001583	missense	123745				CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.790T>C	15.37:g.42292364A>G	ENSP00000382434:p.Tyr264His	Somatic		WXS	SOLID	Phase_I	Q6ZSC0	Missense_Mutation	SNP	ENST00000399518.3	37	CCDS55962.1	.	.	.	.	.	.	.	.	.	.	A	19.13	3.768180	0.69878	.	.	ENSG00000188089	ENST00000399518;ENST00000413860	T;T	0.01560	4.86;4.77	5.04	5.04	0.67666	.	0.445006	0.16898	U	0.195026	T	0.09949	0.0244	M	0.81341	2.54	0.32760	N	0.5052	D	0.89917	1.0	D	0.74674	0.984	T	0.02751	-1.1115	10	0.51188	T	0.08	-27.7269	11.446	0.50123	1.0:0.0:0.0:0.0	.	235	C9JK77	.	H	264;235	ENSP00000382434:Y264H;ENSP00000413897:Y235H	ENSP00000382434:Y264H	Y	-	1	0	PLA2G4E	40079656	1.000000	0.71417	0.999000	0.59377	0.845000	0.48019	3.243000	0.51392	2.028000	0.59812	0.460000	0.39030	TAC		0.607	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2		NM_198442	
PLEC	5339	hgsc.bcm.edu	37	8	145001221	145001221	+	Missense_Mutation	SNP	T	T	C	rs200895043	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr8:145001221T>C	ENST00000322810.4	-	29	4449	c.4280A>G	c.(4279-4281)aAg>aGg	p.K1427R	PLEC_ENST00000527096.1_Missense_Mutation_p.K1313R|PLEC_ENST00000356346.3_Missense_Mutation_p.K1276R|PLEC_ENST00000398774.2_Missense_Mutation_p.K1258R|PLEC_ENST00000357649.2_Missense_Mutation_p.K1294R|PLEC_ENST00000354589.3_Missense_Mutation_p.K1290R|PLEC_ENST00000345136.3_Missense_Mutation_p.K1290R|PLEC_ENST00000436759.2_Missense_Mutation_p.K1317R|PLEC_ENST00000354958.2_Missense_Mutation_p.K1268R	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1427	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AAGCTGCGCCTTGTACGTCAC	0.632													T|||	12	0.00239617	0.0091	0.0	5008	,	,		18266	0.0		0.0	False		,,,				2504	0.0																0								T	ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS	44,4134		1,42,2046	58.0	62.0	61.0		3869,3881,3869,3773,4280,3803,3827,3950	3.8	1.0	8		61	14,8422		0,14,4204	yes	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	26,26,26,26,26,26,26,26	1,56,6250	CC,CT,TT		0.166,1.0531,0.4598	benign,benign,benign,benign,benign,benign,benign,benign	1290/4548,1294/4552,1290/4548,1258/4516,1427/4685,1268/4526,1276/4534,1317/4575	145001221	58,12556	2089	4218	6307	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4280A>G	8.37:g.145001221T>C	ENSP00000323856:p.Lys1427Arg	Somatic		WXS	SOLID	Phase_I	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	13.97	2.397079	0.42512	0.010531	0.00166	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93	4.97	3.78	0.43462	.	0.160905	0.37136	U	0.002232	T	0.12646	0.0307	N	0.25789	0.76	0.36035	D	0.83969	B;B;B;B;B;B;B;B	0.24186	0.099;0.099;0.099;0.06;0.099;0.099;0.099;0.099	B;B;B;B;B;B;B;B	0.26202	0.067;0.067;0.067;0.03;0.067;0.067;0.067;0.067	T	0.14090	-1.0485	10	0.33940	T	0.23	.	10.5866	0.45286	0.0:0.08:0.0:0.92	.	1317;1276;1268;1427;1258;1290;1294;1290	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	R	1290;1294;1290;1258;1427;1268;1276;1317;1313	ENSP00000344848:K1290R;ENSP00000350277:K1294R;ENSP00000346602:K1290R;ENSP00000381756:K1258R;ENSP00000323856:K1427R;ENSP00000347044:K1268R;ENSP00000348702:K1276R;ENSP00000388180:K1317R;ENSP00000434583:K1313R	ENSP00000323856:K1427R	K	-	2	0	PLEC	145073209	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	2.534000	0.45676	1.863000	0.54032	0.368000	0.22195	AAG		0.632	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1		NM_000445	
POMT1	10585	hgsc.bcm.edu	37	9	134385419	134385419	+	Silent	SNP	C	C	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr9:134385419C>G	ENST00000372228.3	+	8	914	c.735C>G	c.(733-735)gcC>gcG	p.A245A	POMT1_ENST00000419118.2_Intron|POMT1_ENST00000423007.1_Intron|POMT1_ENST00000541219.1_Intron|POMT1_ENST00000341012.7_Intron|POMT1_ENST00000404875.2_Intron|POMT1_ENST00000354713.4_Intron|POMT1_ENST00000402686.3_Intron	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	245					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)	p.A245A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		TGAGGCCGGCCTGTATGGGGC	0.567																																																	1	Substitution - coding silent(1)	large_intestine(1)											84.0	71.0	75.0					9																	134385419		2203	4300	6503	SO:0001819	synonymous_variant	10585			AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.735C>G	9.37:g.134385419C>G		Somatic		WXS	SOLID	Phase_I	B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Silent	SNP	ENST00000372228.3	37	CCDS6943.1																																																																																				0.567	POMT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054737.1		NM_007171	
PXDN	7837	hgsc.bcm.edu;ucsc.edu	37	2	1667443	1667443	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr2:1667443C>A	ENST00000252804.4	-	12	1551	c.1501G>T	c.(1501-1503)Gaa>Taa	p.E501*	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	501	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GCCTGGCATTCGTACTGGCCC	0.597																																																	0													88.0	97.0	94.0					2																	1667443		2059	4181	6240	SO:0001587	stop_gained	7837			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1501G>T	2.37:g.1667443C>A	ENSP00000252804:p.Glu501*	Somatic		WXS	SOLID	Phase_I	A8QM65|D6W4Y0|Q4KMG2	Nonsense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	C	39	7.574065	0.98368	.	.	ENSG00000130508	ENST00000252804	.	.	.	5.79	5.79	0.91817	.	0.109447	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-54.0171	20.0263	0.97523	0.0:1.0:0.0:0.0	.	.	.	.	X	501	.	ENSP00000252804:E501X	E	-	1	0	PXDN	1646450	1.000000	0.71417	0.990000	0.47175	0.648000	0.38561	7.494000	0.81503	2.735000	0.93741	0.655000	0.94253	GAA		0.597	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1		XM_056455	
REV3L	5980	hgsc.bcm.edu;ucsc.edu	37	6	111711296	111711296	+	Silent	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr6:111711296G>A	ENST00000358835.3	-	7	1204	c.750C>T	c.(748-750)gaC>gaT	p.D250D	REV3L_ENST00000368802.3_Silent_p.D250D|REV3L_ENST00000435970.1_Silent_p.D172D|REV3L_ENST00000368805.1_Silent_p.D250D			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	250					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AACCTTCAATGTCCAGACGAT	0.378								DNA polymerases (catalytic subunits)																																									0													100.0	97.0	98.0					6																	111711296		2203	4300	6503	SO:0001819	synonymous_variant	5980			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.750C>T	6.37:g.111711296G>A		Somatic		WXS	SOLID	Phase_I	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																				0.378	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1		NM_002912	
RUNX1T1	862	hgsc.bcm.edu;ucsc.edu	37	8	93027007	93027007	+	Missense_Mutation	SNP	C	C	T	rs150073605	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr8:93027007C>T	ENST00000523629.1	-	4	722	c.268G>A	c.(268-270)Gcc>Acc	p.A90T	RUNX1T1_ENST00000520724.1_Missense_Mutation_p.A53T|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.A53T|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.A63T|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.A101T|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.A90T|RUNX1T1_ENST00000521553.1_Missense_Mutation_p.A53T|RUNX1T1_ENST00000522163.1_5'Flank|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.A53T|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.A63T	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	90					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GGTGAGGGGGCGCCATTCAAG	0.517													C|||	4	0.000798722	0.003	0.0	5008	,	,		16997	0.0		0.0	False		,,,				2504	0.0																0								C	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	4,4402	8.1+/-20.4	0,4,2199	51.0	55.0	53.0		187,268,268,268,268,268,268,187,208,301,445,187,268,157,157	6.1	1.0	8	dbSNP_134	53	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	RUNX1T1	NM_001198625.1,NM_001198626.1,NM_001198627.1,NM_001198628.1,NM_001198629.1,NM_001198630.1,NM_001198631.1,NM_001198632.1,NM_001198633.1,NM_001198634.1,NM_001198679.1,NM_004349.3,NM_175634.2,NM_175635.2,NM_175636.2	58,58,58,58,58,58,58,58,58,58,58,58,58,58,58	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	63/578,90/605,90/605,90/605,90/605,90/605,90/605,63/578,70/585,101/616,149/664,63/578,90/605,53/568,53/568	93027007	4,13002	2203	4300	6503	SO:0001583	missense	862			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.268G>A	8.37:g.93027007C>T	ENSP00000428543:p.Ala90Thr	Somatic		WXS	SOLID	Phase_I	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	25.7	4.668744	0.88348	9.08E-4	0.0	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054;ENST00000519847;ENST00000517792;ENST00000522467;ENST00000517919;ENST00000521733;ENST00000520556;ENST00000521319;ENST00000520583;ENST00000523168;ENST00000518823;ENST00000518317;ENST00000521375	T;T;T;T;T;T;T;T;T;T;T	0.53423	1.25;1.21;1.25;1.21;1.21;1.21;1.19;1.21;0.71;0.62;1.32	6.05	6.05	0.98169	.	0.092272	0.85682	D	0.000000	T	0.61375	0.2342	L	0.49126	1.545	0.80722	D	1	P;D;P;D;P	0.65815	0.527;0.995;0.746;0.995;0.646	B;P;B;P;B	0.58391	0.086;0.838;0.132;0.838;0.178	T	0.52668	-0.8545	10	0.34782	T	0.22	-19.5656	20.6013	0.99457	0.0:1.0:0.0:0.0	.	101;101;63;90;63	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	T	90;63;90;53;53;53;101;63;53;90;53;90;53;90;90;63;53;53;90;90;63;63;90	ENSP00000428543:A90T;ENSP00000379520:A63T;ENSP00000265814:A90T;ENSP00000353504:A53T;ENSP00000390137:A53T;ENSP00000428742:A53T;ENSP00000402257:A101T;ENSP00000430728:A63T;ENSP00000429728:A53T;ENSP00000431094:A90T;ENSP00000427763:A53T	ENSP00000265814:A90T	A	-	1	0	RUNX1T1	93096183	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.783000	0.85696	2.878000	0.98634	0.650000	0.86243	GCC		0.517	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3		NM_004349, NM_175635	
SF3B1	23451	hgsc.bcm.edu	37	2	198266833	198266833	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr2:198266833T>C	ENST00000335508.6	-	15	2190	c.2099A>G	c.(2098-2100)aAa>aGa	p.K700R	SF3B1_ENST00000462613.1_5'UTR|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGTCCGAACTTTCTGCTGCTC	0.413			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	2	Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(2)											78.0	76.0	76.0					2																	198266833		2203	4300	6503	SO:0001583	missense	23451			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2099A>G	2.37:g.198266833T>C	ENSP00000335321:p.Lys700Arg	Somatic		WXS	SOLID	Phase_I	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	34	5.318999	0.95682	.	.	ENSG00000115524	ENST00000335508	T	0.65916	-0.18	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81678	0.4873	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83979	0.0331	10	0.59425	D	0.04	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	R	700	ENSP00000335321:K700R	ENSP00000335321:K700R	K	-	2	0	SF3B1	197975078	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA		0.413	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			
SIGLEC12	89858	hgsc.bcm.edu;ucsc.edu	37	19	52000158	52000158	+	Silent	SNP	G	G	A	rs372251299	byFrequency	TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr19:52000158G>A	ENST00000291707.3	-	7	1630	c.1575C>T	c.(1573-1575)aaC>aaT	p.N525N	SIGLEC12_ENST00000598614.1_Silent_p.N407N	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	525					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCCTGACAGCGTTTGCGTCCT	0.577													N|||	3	0.000599042	0.0	0.0	5008	,	,		18943	0.0		0.0	False		,,,				2504	0.0031																0								G	,	0,4406		0,0,2203	188.0	137.0	154.0		1221,1575	-3.4	0.0	19		154	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	SIGLEC12	NM_033329.1,NM_053003.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	407/478,525/596	52000158	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1575C>T	19.37:g.52000158G>A		Somatic		WXS	SOLID	Phase_I	Q8IYH7	Silent	SNP	ENST00000291707.3	37	CCDS12833.1																																																																																				0.577	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2		NM_053003	
SULT1B1	27284	hgsc.bcm.edu	37	4	70599939	70599939	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr4:70599939T>A	ENST00000310613.3	-	5	716	c.419A>T	c.(418-420)tAt>tTt	p.Y140F		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	140					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						AAAATGGTAATATGAGACTGA	0.373																																																	0													31.0	32.0	31.0					4																	70599939		2203	4299	6502	SO:0001583	missense	27284			D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.419A>T	4.37:g.70599939T>A	ENSP00000308770:p.Tyr140Phe	Somatic		WXS	SOLID	Phase_I	O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	ENST00000310613.3	37	CCDS3530.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.796235	0.31777	.	.	ENSG00000173597	ENST00000310613;ENST00000510821	T;T	0.01767	4.65;4.65	4.52	-9.03	0.00737	Sulfotransferase domain (1);	0.752808	0.11741	N	0.534008	T	0.01421	0.0046	N	0.25060	0.705	0.33795	D	0.626001	B	0.14805	0.011	B	0.25405	0.06	T	0.38908	-0.9639	10	0.38643	T	0.18	.	13.2991	0.60315	0.73:0.0:0.0:0.27	.	140	O43704	ST1B1_HUMAN	F	140	ENSP00000308770:Y140F;ENSP00000425464:Y140F	ENSP00000308770:Y140F	Y	-	2	0	SULT1B1	70634528	0.031000	0.19500	0.939000	0.37840	0.254000	0.26022	-1.111000	0.03303	-1.205000	0.02645	0.377000	0.23210	TAT		0.373	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2		NM_014465	
TEP1	7011	hgsc.bcm.edu	37	14	20864842	20864842	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr14:20864842G>T	ENST00000262715.5	-	10	1637	c.1597C>A	c.(1597-1599)Ctg>Atg	p.L533M	TEP1_ENST00000556935.1_Missense_Mutation_p.L425M	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	533	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		ACCCGCAGCAGGTTGCACAGG	0.552																																																	0													106.0	91.0	96.0					14																	20864842		2203	4300	6503	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1597C>A	14.37:g.20864842G>T	ENSP00000262715:p.Leu533Met	Somatic		WXS	SOLID	Phase_I	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256983	0.39896	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.23754	1.89;1.89	5.59	3.66	0.41972	TROVE (2);	0.184358	0.43260	D	0.000584	T	0.26011	0.0634	L	0.37800	1.135	0.80722	D	1	D;D	0.55172	0.958;0.97	P;P	0.55785	0.763;0.784	T	0.07654	-1.0761	10	0.27785	T	0.31	-12.3879	3.6982	0.08372	0.0832:0.1375:0.5207:0.2586	.	425;533	G3V5X7;Q99973	.;TEP1_HUMAN	M	533;533;425	ENSP00000262715:L533M;ENSP00000452574:L425M	ENSP00000262715:L533M	L	-	1	2	TEP1	19934682	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.113000	0.41902	1.379000	0.46325	-0.140000	0.14226	CTG		0.552	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2		NM_007110	
TMEM229B	161145	hgsc.bcm.edu	37	14	67940219	67940219	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr14:67940219C>T	ENST00000557006.1	-	4	704	c.422G>A	c.(421-423)cGc>cAc	p.R141H	TMEM229B_ENST00000357461.2_Missense_Mutation_p.R141H			Q8NBD8	T229B_HUMAN	transmembrane protein 229B	141						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAAGCGGAGGCGGAGGGTGTT	0.647																																																	0													54.0	55.0	55.0					14																	67940219		2203	4300	6503	SO:0001583	missense	161145			AK090706	CCDS9783.1	14q23.3-q24.1	2009-09-22	2009-09-22	2009-09-22	ENSG00000198133	ENSG00000198133			20130	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 83"""	C14orf83			Standard	NM_182526		Approved	FLJ33387	uc001xjk.3	Q8NBD8		ENST00000557006.1:c.422G>A	14.37:g.67940219C>T	ENSP00000451774:p.Arg141His	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000557006.1	37	CCDS9783.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327010	0.81690	.	.	ENSG00000198133	ENST00000557006;ENST00000357461	.	.	.	4.4	4.4	0.53042	.	0.174028	0.52532	D	0.000069	T	0.53546	0.1803	L	0.39397	1.21	0.80722	D	1	P	0.46064	0.872	B	0.43225	0.412	T	0.61028	-0.7145	9	0.59425	D	0.04	-19.1378	16.9889	0.86348	0.0:1.0:0.0:0.0	.	141	Q8NBD8	T229B_HUMAN	H	141	.	ENSP00000350050:R141H	R	-	2	0	TMEM229B	67009972	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.001000	0.58596	0.555000	0.69702	CGC		0.647	TMEM229B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412718.2		NM_182526	
TRIM42	287015	hgsc.bcm.edu;ucsc.edu	37	3	140407023	140407023	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr3:140407023C>T	ENST00000286349.3	+	3	1690	c.1499C>T	c.(1498-1500)tCa>tTa	p.S500L		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	500						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GTACGCTCCTCAGGGGACTCC	0.567																																																	0													79.0	75.0	76.0					3																	140407023		2203	4300	6503	SO:0001583	missense	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1499C>T	3.37:g.140407023C>T	ENSP00000286349:p.Ser500Leu	Somatic		WXS	SOLID	Phase_I	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.497925	0.26861	.	.	ENSG00000155890	ENST00000286349	T	0.39056	1.1	5.21	4.32	0.51571	.	0.852017	0.10150	N	0.709743	T	0.21062	0.0507	N	0.08118	0	0.30810	N	0.738904	P	0.34977	0.478	B	0.27608	0.081	T	0.02691	-1.1123	10	0.39692	T	0.17	-27.9862	8.7533	0.34631	0.0:0.9017:0.0:0.0983	.	500	Q8IWZ5	TRI42_HUMAN	L	500	ENSP00000286349:S500L	ENSP00000286349:S500L	S	+	2	0	TRIM42	141889713	0.997000	0.39634	0.974000	0.42286	0.140000	0.21249	3.290000	0.51755	2.826000	0.97356	0.655000	0.94253	TCA		0.567	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2		NM_152616	
TUBGCP2	10844	hgsc.bcm.edu;ucsc.edu	37	10	135102393	135102393	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr10:135102393C>T	ENST00000252936.3	-	9	1531	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	TUBGCP2_ENST00000417178.2_Missense_Mutation_p.V368M|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.V91M|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.V526M|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.V498M			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	498					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TCCAGCAGCACCTTGCTGGCG	0.577																																																	0													170.0	132.0	145.0					10																	135102393		2203	4300	6503	SO:0001583	missense	10844			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1492G>A	10.37:g.135102393C>T	ENSP00000252936:p.Val498Met	Somatic		WXS	SOLID	Phase_I	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870883	0.72065	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.08714	0.0216	N	0.20401	0.57	0.80722	D	1	B;B;B	0.25904	0.113;0.137;0.078	B;B;B	0.34346	0.113;0.18;0.18	T	0.40194	-0.9576	10	0.27785	T	0.31	-45.6486	17.6603	0.88191	0.0:1.0:0.0:0.0	.	526;526;498	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	M	498;368;498;91;526	ENSP00000252936:V498M;ENSP00000395666:V368M;ENSP00000357551:V498M;ENSP00000357550:V91M;ENSP00000446093:V526M	ENSP00000252936:V498M	V	-	1	0	TUBGCP2	134952383	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.475000	0.81041	2.595000	0.87683	0.561000	0.74099	GTG		0.577	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1			
UBASH3B	84959	hgsc.bcm.edu;ucsc.edu	37	11	122665475	122665475	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr11:122665475G>A	ENST00000284273.5	+	7	1421	c.1046G>A	c.(1045-1047)aGg>aAg	p.R349K		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	349					negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		GTATTGGAGAGGCGGCCTTAT	0.502																																																	0													142.0	146.0	144.0					11																	122665475		2202	4299	6501	SO:0001583	missense	84959			AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1046G>A	11.37:g.122665475G>A	ENSP00000284273:p.Arg349Lys	Somatic		WXS	SOLID	Phase_I	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	37	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976318	0.34848	.	.	ENSG00000154127	ENST00000284273	T	0.05513	3.43	5.38	4.47	0.54385	.	0.472749	0.25272	N	0.031878	T	0.02888	0.0086	N	0.08118	0	0.28406	N	0.918426	B	0.02656	0.0	B	0.01281	0.0	T	0.40289	-0.9571	10	0.02654	T	1	-11.5957	10.0755	0.42358	0.1526:0.0:0.8474:0.0	.	349	Q8TF42	UBS3B_HUMAN	K	349	ENSP00000284273:R349K	ENSP00000284273:R349K	R	+	2	0	UBASH3B	122170685	1.000000	0.71417	0.981000	0.43875	0.960000	0.62799	5.186000	0.65082	1.254000	0.44035	0.563000	0.77884	AGG		0.502	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1		NM_032873	
USP18	11274	hgsc.bcm.edu	37	22	18640565	18640565	+	Silent	SNP	C	C	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr22:18640565C>A	ENST00000215794.7	+	2	565	c.135C>A	c.(133-135)ccC>ccA	p.P45P		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	45					cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						GAGAGCGTCCCAGGGCCTGGG	0.562																																																	0													105.0	104.0	104.0					22																	18640565		2203	4300	6503	SO:0001819	synonymous_variant	11274			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.135C>A	22.37:g.18640565C>A		Somatic		WXS	SOLID	Phase_I	Q53Y90|Q6IAD9|Q9NY71	Silent	SNP	ENST00000215794.7	37	CCDS13752.1																																																																																				0.562	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316368.1			
DPH7	92715	hgsc.bcm.edu;ucsc.edu	37	9	140449899	140449899	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr9:140449899T>G	ENST00000277540.2	-	9	1308	c.1151A>C	c.(1150-1152)aAc>aCc	p.N384T	DPH7_ENST00000479650.1_5'UTR	NM_138778.2	NP_620133.1	Q9BTV6	DPH7_HUMAN	diphthamide biosynthesis 7	384					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)												CTCCCCATCGTTATCCTCTCT	0.582																																																	0													148.0	121.0	130.0					9																	140449899		2203	4300	6503	SO:0001583	missense	92715			AK075115	CCDS7047.1	9q34.3	2013-06-20	2013-06-20	2013-06-20	ENSG00000148399	ENSG00000148399		"""WD repeat domain containing"""	25199	protein-coding gene	gene with protein product		613210	"""chromosome 9 open reading frame 112"", ""WD repeat domain 85"""	C9orf112, WDR85		23486472	Standard	NM_138778		Approved	FLJ90634, RRT2	uc004cnk.1	Q9BTV6	OTTHUMG00000020991	ENST00000277540.2:c.1151A>C	9.37:g.140449899T>G	ENSP00000277540:p.Asn384Thr	Somatic		WXS	SOLID	Phase_I	Q96AB7	Missense_Mutation	SNP	ENST00000277540.2	37	CCDS7047.1	.	.	.	.	.	.	.	.	.	.	T	6.325	0.428081	0.11987	.	.	ENSG00000148399	ENST00000277540	T	0.65549	-0.16	5.23	-3.59	0.04583	.	0.914285	0.09404	N	0.806826	T	0.43634	0.1256	N	0.22421	0.69	0.09310	N	1	B	0.17038	0.02	B	0.16289	0.015	T	0.26608	-1.0098	10	0.17832	T	0.49	.	12.7874	0.57514	0.0:0.405:0.0:0.595	.	384	Q9BTV6	WDR85_HUMAN	T	384	ENSP00000277540:N384T	ENSP00000277540:N384T	N	-	2	0	WDR85	139569720	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.035000	0.13797	-1.322000	0.02278	-1.139000	0.01908	AAC		0.582	DPH7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055350.1		NM_138778	
ZBTB8B	728116	hgsc.bcm.edu;ucsc.edu	37	1	32936276	32936276	+	Silent	SNP	G	G	A			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr1:32936276G>A	ENST00000609129.1	+	2	129	c.51G>A	c.(49-51)caG>caA	p.Q17Q	RP1-27O5.3_ENST00000480336.1_Silent_p.Q17Q	NM_001145720.1	NP_001139192.1	Q8NAP8	ZBT8B_HUMAN	zinc finger and BTB domain containing 8B	17					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)	1						TGAATGAACAGAGAAAGAGGG	0.502																																																	0													75.0	71.0	72.0					1																	32936276		692	1591	2283	SO:0001819	synonymous_variant	728116			AL442095	CCDS44104.1	1p35.1	2013-01-08			ENSG00000215897	ENSG00000273274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	37057	protein-coding gene	gene with protein product							Standard	NM_001145720		Approved	RP1-27O5.1, DKFZp547H154, ZNF916B	uc001bvl.4	Q8NAP8	OTTHUMG00000167087	ENST00000609129.1:c.51G>A	1.37:g.32936276G>A		Somatic		WXS	SOLID	Phase_I	Q15DG5|Q5VXR5|Q69YT7	Silent	SNP	ENST00000609129.1	37	CCDS44104.1																																																																																				0.502	ZBTB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392986.2		NM_001145720	
ZNF300	91975	hgsc.bcm.edu	37	5	150276155	150276155	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr5:150276155A>G	ENST00000274599.5	-	6	1066	c.646T>C	c.(646-648)Ttt>Ctt	p.F216L	ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Missense_Mutation_p.F216L|ZNF300_ENST00000418587.2_Missense_Mutation_p.F180L|ZNF300_ENST00000446148.2_Missense_Mutation_p.F232L	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	216					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCACCTCCAAAACTCTGATCA	0.343																																																	0													73.0	78.0	76.0					5																	150276155		2203	4296	6499	SO:0001583	missense	91975			AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.646T>C	5.37:g.150276155A>G	ENSP00000274599:p.Phe216Leu	Somatic		WXS	SOLID	Phase_I	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	ENST00000274599.5	37	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	A	6.565	0.472621	0.12461	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.07114	3.29;3.3;3.22;3.3	3.04	1.84	0.25277	.	.	.	.	.	T	0.05318	0.0141	N	0.14661	0.345	0.22457	N	0.999085	P	0.42248	0.774	B	0.43331	0.416	T	0.34477	-0.9827	9	0.11182	T	0.66	.	7.8368	0.29374	0.7893:0.2107:0.0:0.0	.	216	Q96RE9	ZN300_HUMAN	L	232;216;180;216	ENSP00000397178:F232L;ENSP00000274599:F216L;ENSP00000392593:F180L;ENSP00000377773:F216L	ENSP00000274599:F216L	F	-	1	0	ZNF300	150256348	0.000000	0.05858	0.049000	0.19019	0.097000	0.18754	0.317000	0.19487	0.543000	0.28864	0.455000	0.32223	TTT		0.343	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			NM_052860	
ZPBP2	124626	hgsc.bcm.edu;ucsc.edu	37	17	38032946	38032946	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4170-01A-02D-1366-10	TCGA-BP-4170-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16fcd199-55bc-4415-95cf-2a3d0b2d4b1b	021c1ab3-d01f-45ce-9fe5-ed2731e73f12	g.chr17:38032946C>T	ENST00000348931.4	+	8	1092	c.901C>T	c.(901-903)Cct>Tct	p.P301S	ZPBP2_ENST00000377940.3_Missense_Mutation_p.P279S|ZPBP2_ENST00000584588.1_Missense_Mutation_p.P228S	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	301					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGTTTGTAGTCCTGCGACTTT	0.373																																																	0													182.0	174.0	177.0					17																	38032946		2203	4300	6503	SO:0001583	missense	124626			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.901C>T	17.37:g.38032946C>T	ENSP00000335384:p.Pro301Ser	Somatic		WXS	SOLID	Phase_I	A8K8L8|Q6X783|Q86XL5	Missense_Mutation	SNP	ENST00000348931.4	37	CCDS11352.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473679	0.43942	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	T;T	0.67865	-0.29;-0.29	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000006	D	0.82884	0.5134	M	0.77313	2.365	0.46874	D	0.999235	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83960	0.0321	10	0.87932	D	0	-15.2584	18.189	0.89800	0.0:1.0:0.0:0.0	.	279;301	Q6X784-2;Q6X784	.;ZPBP2_HUMAN	S	301;279	ENSP00000335384:P301S;ENSP00000367174:P279S	ENSP00000335384:P301S	P	+	1	0	ZPBP2	35286472	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.583000	0.60964	2.826000	0.97356	0.655000	0.94253	CCT		0.373	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256609.2		NM_198844	
