#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACBD5	91452	hgsc.bcm.edu	37	10	27497270	27497270	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr10:27497270T>A	ENST00000375888.1	-	10	1400	c.1336A>T	c.(1336-1338)Aat>Tat	p.N446Y	ACBD5_ENST00000396271.3_Missense_Mutation_p.N437Y|ACBD5_ENST00000375905.4_Missense_Mutation_p.N402Y|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375897.3_Missense_Mutation_p.N260Y|ACBD5_ENST00000375901.1_Missense_Mutation_p.N328Y			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	446					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						ATCTGCTCATTGAGGCTGCCT	0.577																																																	0													111.0	102.0	105.0					10																	27497270		2203	4300	6503	SO:0001583	missense	91452			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1336A>T	10.37:g.27497270T>A	ENSP00000365049:p.Asn446Tyr	Somatic		WXS	SOLID	Phase_I	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	ENST00000375888.1	37		.	.	.	.	.	.	.	.	.	.	T	26.7	4.765557	0.90020	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	T;T;T;T;T	0.35789	2.3;2.04;1.29;1.32;2.3	5.63	5.63	0.86233	.	0.040310	0.85682	D	0.000000	T	0.62612	0.2442	M	0.81942	2.565	0.52501	D	0.999959	D;D;D;D	0.76494	0.997;0.998;0.999;0.999	D;D;D;D	0.71870	0.957;0.975;0.94;0.94	T	0.67673	-0.5610	10	0.72032	D	0.01	-17.4258	16.1324	0.81449	0.0:0.0:0.0:1.0	.	437;260;435;446	Q5T8D3-3;B7Z2A7;B7Z2R7;Q5T8D3	.;.;.;ACBD5_HUMAN	Y	443;437;402;328;260;446	ENSP00000379568:N437Y;ENSP00000365070:N402Y;ENSP00000365066:N328Y;ENSP00000365062:N260Y;ENSP00000365049:N446Y	ENSP00000365049:N446Y	N	-	1	0	ACBD5	27537276	1.000000	0.71417	0.998000	0.56505	0.879000	0.50718	7.330000	0.79181	2.261000	0.74972	0.477000	0.44152	AAT		0.577	ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1		NM_145698	
ACP5	54	hgsc.bcm.edu	37	19	11685841	11685841	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:11685841C>T	ENST00000592828.1	-	7	1364	c.962G>A	c.(961-963)aGg>aAg	p.R321K	ACP5_ENST00000433365.2_Missense_Mutation_p.R321K|ZNF627_ENST00000588651.1_Intron|ACP5_ENST00000218758.5_Missense_Mutation_p.R321K|ACP5_ENST00000412435.2_Missense_Mutation_p.R321K|ACP5_ENST00000590420.1_3'UTR	NM_001111034.1	NP_001104504.1	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	321					bone morphogenesis (GO:0060349)|bone resorption (GO:0045453)|defense response to Gram-positive bacterium (GO:0050830)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of superoxide anion generation (GO:0032929)|negative regulation of tumor necrosis factor production (GO:0032720)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	acid phosphatase activity (GO:0003993)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	9						CCTGGCTCGCCTCGGCAGCCT	0.612																																																	0													45.0	46.0	46.0					19																	11685841		2203	4300	6503	SO:0001583	missense	54			X14618	CCDS12265.1	19p13.2	2012-10-02			ENSG00000102575	ENSG00000102575	3.1.3.2		124	protein-coding gene	gene with protein product	"""tartrate-resistant acid phosphatase"""	171640				8449511, 2338077	Standard	NM_001611		Approved	TRAP	uc002msj.4	P13686	OTTHUMG00000182036	ENST00000592828.1:c.962G>A	19.37:g.11685841C>T	ENSP00000468767:p.Arg321Lys	Somatic		WXS	SOLID	Phase_I	A8K3V2|Q2TAB1|Q6IAS6|Q9UCJ5|Q9UCJ6|Q9UCJ7	Missense_Mutation	SNP	ENST00000592828.1	37	CCDS12265.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.646044	0.29246	.	.	ENSG00000102575	ENST00000218758;ENST00000412435;ENST00000433365	T;T;T	0.65178	-0.14;-0.14;-0.14	5.08	4.04	0.47022	.	0.439517	0.26387	N	0.024679	T	0.40145	0.1105	N	0.20357	0.565	0.22500	N	0.999047	B	0.02656	0.0	B	0.01281	0.0	T	0.20974	-1.0259	10	0.02654	T	1	-2.3415	10.7795	0.46369	0.0:0.909:0.0:0.091	.	321	P13686	PPA5_HUMAN	K	321	ENSP00000218758:R321K;ENSP00000392374:R321K;ENSP00000413456:R321K	ENSP00000218758:R321K	R	-	2	0	ACP5	11546841	0.003000	0.15002	0.020000	0.16555	0.101000	0.19017	1.265000	0.33027	1.136000	0.42199	0.550000	0.68814	AGG		0.612	ACP5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458881.1			
ADI1	55256	hgsc.bcm.edu	37	2	3504658	3504658	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:3504658C>T	ENST00000327435.6	-	3	595	c.347G>A	c.(346-348)cGg>cAg	p.R116Q	ADI1_ENST00000382093.5_Missense_Mutation_p.R110Q	NM_018269.3	NP_060739.2			acireductone dioxygenase 1											breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CATGAAGATCCGGATCCACTG	0.567																																																	0													230.0	173.0	192.0					2																	3504658		2203	4300	6503	SO:0001583	missense	55256				CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.347G>A	2.37:g.3504658C>T	ENSP00000333666:p.Arg116Gln	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000327435.6	37	CCDS1653.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912582	0.72983	.	.	ENSG00000182551	ENST00000327435;ENST00000382093	.	.	.	4.73	4.73	0.59995	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	D	0.82430	0.5035	M	0.92880	3.355	0.80722	D	1	D	0.65815	0.995	P	0.55391	0.775	D	0.86224	0.1633	9	0.46703	T	0.11	-36.4799	16.6473	0.85179	0.0:1.0:0.0:0.0	.	116	Q9BV57	MTND_HUMAN	Q	116;110	.	ENSP00000333666:R116Q	R	-	2	0	ADI1	3483665	1.000000	0.71417	0.992000	0.48379	0.140000	0.21249	7.311000	0.78958	2.339000	0.79563	0.655000	0.94253	CGG		0.567	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6		NM_018269	
AMY1B	277	hgsc.bcm.edu	37	1	104233933	104233933	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:104233933A>G	ENST00000330330.5	-	8	1378	c.1084T>C	c.(1084-1086)Tat>Cat	p.Y362H	AMY1B_ENST00000464691.1_5'Flank|AMY1B_ENST00000370080.3_Missense_Mutation_p.Y362H	NM_001008218.1	NP_001008219.1	P04745	AMY1_HUMAN	amylase, alpha 1B (salivary)	362					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		TTTTCAAAATATCTTGGCCAA	0.328																																																	0													3.0	4.0	4.0					1																	104233933		195	814	1009	SO:0001583	missense	277				CCDS30783.1	1p21	2012-10-02	2007-05-03		ENSG00000174876	ENSG00000174876	3.2.1.1		475	protein-coding gene	gene with protein product		104701	"""amylase, alpha 1B; salivary"""	AMY1			Standard	XM_005270758		Approved			P04745	OTTHUMG00000011021	ENST00000330330.5:c.1084T>C	1.37:g.104233933A>G	ENSP00000330484:p.Tyr362His	Somatic		WXS	SOLID	Phase_I	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	ENST00000330330.5	37	CCDS30783.1	.	.	.	.	.	.	.	.	.	.	-	0.001	-4.283957	0.00001	.	.	ENSG00000174876	ENST00000416771;ENST00000370080;ENST00000330330	.	.	.	2.08	-4.16	0.03869	.	0.580895	0.19056	N	0.123899	T	0.03220	0.0094	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.23655	-1.0182	6	0.09084	T	0.74	.	5.8178	0.18506	0.4117:0.0:0.3565:0.2317	.	.	.	.	H	362	.	ENSP00000330484:Y362H	Y	-	1	0	AMY1B	104035456	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-2.777000	0.00775	-4.695000	0.00036	-3.130000	0.00060	TAT		0.328	AMY1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030309.1		NM_001008218	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156907115	156907115	+	Missense_Mutation	SNP	T	T	C	rs868188	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:156907115T>C	ENST00000361409.2	-	38	4988	c.4246A>G	c.(4246-4248)Agc>Ggc	p.S1416G	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.S1456G|MIR765_ENST00000390226.1_RNA|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.S832G	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1416			S -> G (in dbSNP:rs868188).		actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGGGCCAGGCTTGGAGGAGAG	0.627													T|||	2036	0.40655	0.2284	0.5014	5008	,	,		18795	0.5169		0.3569	False		,,,				2504	0.5174																0			GRCh37	CM061640	ARHGEF11	M	rs868188	T	GLY/SER,GLY/SER	987,3419	366.4+/-317.8	106,775,1322	64.0	62.0	63.0		4246,4366	0.5	0.1	1	dbSNP_86	63	3067,5533	465.4+/-366.5	557,1953,1790	yes	missense,missense	ARHGEF11	NM_014784.2,NM_198236.1	56,56	663,2728,3112	CC,CT,TT		35.6628,22.4013,31.1702	probably-damaging,probably-damaging	1416/1523,1456/1563	156907115	4054,8952	2203	4300	6503	SO:0001583	missense	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4246A>G	1.37:g.156907115T>C	ENSP00000354644:p.Ser1416Gly	Somatic		WXS	SOLID	Phase_I	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	CCDS1162.1	805	0.3685897435897436	109	0.22154471544715448	149	0.4116022099447514	272	0.4755244755244755	275	0.3627968337730871	T	6.223	0.409363	0.11812	0.224013	0.356628	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.68624	-0.34;-0.33;-0.23	4.15	0.503	0.16940	.	0.558310	0.17430	N	0.174513	T	0.31136	0.0787	L	0.29908	0.895	0.37737	P	0.07450400000000001	B;B;B	0.10296	0.003;0.0;0.003	B;B;B	0.13407	0.009;0.001;0.008	T	0.05007	-1.0912	9	0.59425	D	0.04	-4.126	7.6539	0.28365	0.0:0.2703:0.0:0.7297	rs868188	832;1416;1456	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	G	1456;1416;832	ENSP00000357177:S1456G;ENSP00000354644:S1416G;ENSP00000313470:S832G	ENSP00000313470:S832G	S	-	1	0	ARHGEF11	155173739	0.657000	0.27393	0.107000	0.21349	0.140000	0.21249	1.112000	0.31172	-0.078000	0.12730	-0.379000	0.06801	AGC		0.627	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1		NM_198236	
ASCL3	56676	hgsc.bcm.edu	37	11	8959460	8959460	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:8959460G>T	ENST00000531618.1	-	1	298	c.249C>A	c.(247-249)taC>taA	p.Y83*	ASCL3_ENST00000325884.1_Nonsense_Mutation_p.Y83*			Q9NQ33	ASCL3_HUMAN	achaete-scute family bHLH transcription factor 3	82					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(1)|large_intestine(2)|lung(5)|stomach(1)	9				Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)		CGCACCCTCTGTAATTTGGAT	0.557																																																	0													61.0	63.0	63.0					11																	8959460		2201	4295	6496	SO:0001587	stop_gained	56676			AJ400877	CCDS7795.1	11p15.3	2013-10-17	2013-10-17			ENSG00000176009		"""Basic helix-loop-helix proteins"""	740	protein-coding gene	gene with protein product		609154	"""achaete-scute complex (Drosophila) homolog-like 3"", ""achaete-scute complex homolog 3 (Drosophila)"""			11528127	Standard	NM_020646		Approved	bHLHa42, HASH3, Sgn1	uc001mhd.1	Q9NQ33	OTTHUMG00000165679	ENST00000531618.1:c.249C>A	11.37:g.8959460G>T	ENSP00000435770:p.Tyr83*	Somatic		WXS	SOLID	Phase_I	Q8WYQ6	Nonsense_Mutation	SNP	ENST00000531618.1	37	CCDS7795.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474329	0.43942	.	.	ENSG00000176009	ENST00000325884;ENST00000531618	.	.	.	5.72	4.8	0.61643	.	0.207594	0.34435	N	0.003970	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.8037	10.6853	0.45839	0.1442:0.0:0.8558:0.0	.	.	.	.	X	83	.	ENSP00000318846:Y83X	Y	-	3	2	ASCL3	8916036	0.993000	0.37304	1.000000	0.80357	0.134000	0.20937	1.269000	0.33074	2.717000	0.92951	0.650000	0.86243	TAC		0.557	ASCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385773.1			
ATP8A2	51761	hgsc.bcm.edu;ucsc.edu	37	13	26594067	26594067	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr13:26594067C>G	ENST00000381655.2	+	37	3653	c.3511C>G	c.(3511-3513)Cag>Gag	p.Q1171E	ATP8A2_ENST00000255283.8_Missense_Mutation_p.Q1106E	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1131					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AGCTGTTAGTCAGGAAGAAGT	0.423																																																	0													122.0	113.0	116.0					13																	26594067		1895	4118	6013	SO:0001583	missense	51761			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3511C>G	13.37:g.26594067C>G	ENSP00000371070:p.Gln1171Glu	Somatic		WXS	SOLID	Phase_I	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851541	0.51270	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.66460	0.3;-0.21	4.97	4.97	0.65823	.	0.129442	0.52532	D	0.000064	D	0.84552	0.5497	M	0.87900	2.915	0.38944	D	0.958212	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.88168	0.2862	10	0.87932	D	0	.	18.4138	0.90561	0.0:1.0:0.0:0.0	.	1106;1131	B7Z880;Q9NTI2	.;AT8A2_HUMAN	E	1171;1106;951	ENSP00000371070:Q1171E;ENSP00000255283:Q1106E	ENSP00000255283:Q1106E	Q	+	1	0	ATP8A2	25492067	1.000000	0.71417	0.956000	0.39512	0.213000	0.24496	5.481000	0.66826	2.589000	0.87451	0.555000	0.69702	CAG		0.423	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2		NM_016529	
ATR	545	hgsc.bcm.edu	37	3	142254950	142254950	+	Splice_Site	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr3:142254950C>A	ENST00000350721.4	-	20	3940	c.3819G>T	c.(3817-3819)aaG>aaT	p.K1273N	ATR_ENST00000383101.3_Splice_Site_p.K1209N	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1273					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AATTAAATACCTTTCTGTATT	0.308								Other conserved DNA damage response genes																																									0													42.0	49.0	47.0					3																	142254950		2143	4263	6406	SO:0001630	splice_region_variant	545			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.3819+1G>T	3.37:g.142254950C>A		Somatic		WXS	SOLID	Phase_I	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041057	0.55003	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.68765	-0.35;-0.35	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73946	0.3652	L	0.45581	1.43	0.80722	D	1	D	0.76494	0.999	D	0.65684	0.937	T	0.71994	-0.4424	9	.	.	.	-15.7472	12.9064	0.58154	0.0:0.9257:0.0:0.0743	.	1273	Q13535	ATR_HUMAN	N	1273;1209	ENSP00000343741:K1273N;ENSP00000372581:K1209N	.	K	-	3	2	ATR	143737640	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.017000	0.57167	2.636000	0.89361	0.585000	0.79938	AAG		0.308	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2		NM_001184	Missense_Mutation
AUTS2	26053	hgsc.bcm.edu;ucsc.edu	37	7	69364395	69364395	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr7:69364395C>G	ENST00000342771.4	+	2	754	c.433C>G	c.(433-435)Cca>Gca	p.P145A	AUTS2_ENST00000403018.2_Missense_Mutation_p.P145A|AUTS2_ENST00000406775.2_Missense_Mutation_p.P145A	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	145										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACTCAGCCACCCACACCACTA	0.512																																																	0													129.0	122.0	124.0					7																	69364395		2203	4300	6503	SO:0001583	missense	26053			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.433C>G	7.37:g.69364395C>G	ENSP00000344087:p.Pro145Ala	Somatic		WXS	SOLID	Phase_I	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291233	0.40494	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	T;T	0.32515	1.46;1.45	5.65	2.89	0.33648	.	0.578426	0.15814	N	0.243333	T	0.20941	0.0504	L	0.34521	1.04	0.20074	N	0.999935	B;B;B	0.29988	0.004;0.004;0.264	B;B;B	0.31101	0.013;0.013;0.124	T	0.18272	-1.0342	9	.	.	.	-0.0606	6.9887	0.24743	0.0:0.7229:0.0:0.2771	.	145;145;145	Q8WXX7-2;Q8WXX7;Q6PJU5	.;AUTS2_HUMAN;.	A	145	ENSP00000385263:P145A;ENSP00000344087:P145A	.	P	+	1	0	AUTS2	69002331	0.820000	0.29190	0.934000	0.37439	0.998000	0.95712	0.698000	0.25571	0.478000	0.27488	0.655000	0.94253	CCA		0.512	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			
BAK1	578	hgsc.bcm.edu	37	6	33545340	33545340	+	Silent	SNP	G	G	A	rs2227925	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:33545340G>A	ENST00000374467.3	-	2	290	c.42C>T	c.(40-42)tgC>tgT	p.C14C	BAK1_ENST00000360661.5_Silent_p.C14C|BAK1_ENST00000442998.2_Silent_p.C14C	NM_001188.3	NP_001179.1	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1	14					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell negative selection (GO:0002352)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast apoptotic process (GO:0044346)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|limb morphogenesis (GO:0035108)|mitochondrial fusion (GO:0008053)|myeloid cell homeostasis (GO:0002262)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of gene expression (GO:0010629)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic camera-type eye morphogenesis (GO:0048597)|regulation of cell cycle (GO:0051726)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fungus (GO:0009620)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to mycotoxin (GO:0010046)|response to organic cyclic compound (GO:0014070)|response to UV-C (GO:0010225)|thymocyte apoptotic process (GO:0070242)|vagina development (GO:0060068)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|pore complex (GO:0046930)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4						CAGGCTCTCCGCACTCCTGCC	0.612													g|||	381	0.0760783	0.0091	0.1297	5008	,	,		18711	0.0099		0.2207	False		,,,				2504	0.0481																0								G		142,3722		6,130,1796	42.0	29.0	33.0		42	-8.0	0.0	6	dbSNP_98	33	1373,5983		128,1117,2433	no	coding-synonymous	BAK1	NM_001188.3		134,1247,4229	AA,AG,GG		18.665,3.6749,13.5027		14/212	33545340	1515,9705	1932	3678	5610	SO:0001819	synonymous_variant	578			U23765	CCDS4781.1	6p21.31	2014-03-07			ENSG00000030110	ENSG00000030110			949	protein-coding gene	gene with protein product		600516		CDN1		7715730, 7715731	Standard	NM_001188		Approved	BCL2L7, BAK	uc003oes.3	Q16611	OTTHUMG00000014530	ENST00000374467.3:c.42C>T	6.37:g.33545340G>A		Somatic		WXS	SOLID	Phase_I	C0H5Y7|Q6I9T6|Q92533	Silent	SNP	ENST00000374467.3	37	CCDS4781.1																																																																																				0.612	BAK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040202.1		NM_001188	
PRRC2C	23215	hgsc.bcm.edu	37	1	171509616	171509616	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:171509616G>T	ENST00000338920.4	+	16	3242	c.3005G>T	c.(3004-3006)aGg>aTg	p.R1002M	PRRC2C_ENST00000367742.3_Missense_Mutation_p.R1004M|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R1002M|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R1004M	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1002					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCTAACAGAAGGGAAGAAGTT	0.403																																																	0													26.0	26.0	26.0					1																	171509616		2202	4300	6502	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.3005G>T	1.37:g.171509616G>T	ENSP00000343629:p.Arg1002Met	Somatic		WXS	SOLID	Phase_I	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021386	0.35701	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.08546	3.08;3.08;3.08;3.08	5.98	5.98	0.97165	.	0.000000	0.50627	D	0.000108	T	0.16557	0.0398	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01352	-1.1377	10	0.87932	D	0	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	1002	Q9Y520-4	.	M	1004;1003;1002;1004;1002;759;761	ENSP00000375928:R1004M;ENSP00000410219:R1002M;ENSP00000356716:R1004M;ENSP00000343629:R1002M	ENSP00000343629:R1002M	R	+	2	0	PRRC2C	169776240	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.588000	0.82629	2.835000	0.97688	0.650000	0.86243	AGG		0.403	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4		NM_015172	
PRRC2C	23215	hgsc.bcm.edu	37	1	171526904	171526904	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:171526904C>A	ENST00000338920.4	+	19	5884	c.5647C>A	c.(5647-5649)Cca>Aca	p.P1883T	PRRC2C_ENST00000367742.3_Missense_Mutation_p.P1885T|PRRC2C_ENST00000426496.2_Missense_Mutation_p.P1883T|PRRC2C_ENST00000392078.3_Missense_Mutation_p.P1885T	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1883	Ala-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										agcctcttccccagctgcccc	0.612																																																	0													49.0	39.0	43.0					1																	171526904		1763	3310	5073	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5647C>A	1.37:g.171526904C>A	ENSP00000343629:p.Pro1883Thr	Somatic		WXS	SOLID	Phase_I	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	6.730	0.503457	0.12822	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.01787	4.65;4.64;4.65;4.65	4.22	1.2	0.21068	.	.	.	.	.	T	0.00271	0.0008	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.38972	-0.9636	9	0.22109	T	0.4	.	2.553	0.04753	0.2018:0.5136:0.1801:0.1045	.	1883	Q9Y520-4	.	T	1885;1837;1883;1885;1883;1640	ENSP00000375928:P1885T;ENSP00000410219:P1883T;ENSP00000356716:P1885T;ENSP00000343629:P1883T	ENSP00000343629:P1883T	P	+	1	0	PRRC2C	169793528	0.002000	0.14202	0.013000	0.15412	0.124000	0.20399	-0.227000	0.09126	0.286000	0.22352	0.549000	0.68633	CCA		0.612	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4		NM_015172	
BCL7A	605	hgsc.bcm.edu;ucsc.edu	37	12	122473306	122473306	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr12:122473306T>G	ENST00000261822.4	+	3	450	c.244T>G	c.(244-246)Tcc>Gcc	p.S82A	BCL7A_ENST00000538010.1_Missense_Mutation_p.S82A	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	82					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		GGAGAACAGTTCCTCCCCAGG	0.547			T	MYC	BNHL																																GBM(17;197 467 16477 23242 44349)			Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	0													90.0	76.0	81.0					12																	122473306		2203	4300	6503	SO:0001583	missense	605			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.244T>G	12.37:g.122473306T>G	ENSP00000261822:p.Ser82Ala	Somatic		WXS	SOLID	Phase_I	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	37	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.332448	0.81801	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.48522	0.81;0.82	6.17	5.01	0.66863	.	0.054127	0.85682	N	0.000000	T	0.37865	0.1019	L	0.32530	0.975	0.58432	D	0.999999	B;B	0.19583	0.022;0.037	B;B	0.19148	0.011;0.024	T	0.11470	-1.0586	10	0.41790	T	0.15	.	12.7371	0.57232	0.0:0.0:0.1374:0.8626	.	82;82	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	A	82	ENSP00000445868:S82A;ENSP00000261822:S82A	ENSP00000261822:S82A	S	+	1	0	BCL7A	120957689	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.525000	0.67110	1.116000	0.41820	0.533000	0.62120	TCC		0.547	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1			
BRWD1	54014	hgsc.bcm.edu;ucsc.edu	37	21	40571019	40571019	+	Missense_Mutation	SNP	G	G	T	rs202178838		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr21:40571019G>T	ENST00000333229.2	-	40	5650	c.5323C>A	c.(5323-5325)Cca>Aca	p.P1775T	BRWD1_ENST00000342449.3_Missense_Mutation_p.P1775T|BRWD1_ENST00000380800.3_Missense_Mutation_p.P1775T	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1775					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GACGTTGATGGGCCAGCAGTT	0.408																																					Melanoma(170;988 1986 4794 16843 39731)												0													99.0	99.0	99.0					21																	40571019		2203	4300	6503	SO:0001583	missense	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5323C>A	21.37:g.40571019G>T	ENSP00000330753:p.Pro1775Thr	Somatic		WXS	SOLID	Phase_I	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341331	0.60963	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.54479	0.57;0.59;0.66	5.48	5.48	0.80851	.	0.190219	0.37906	N	0.001890	T	0.52773	0.1755	M	0.66939	2.045	0.58432	D	0.999999	P;P	0.47106	0.867;0.89	B;B	0.42282	0.382;0.343	T	0.56505	-0.7968	10	0.44086	T	0.13	-10.9917	13.3977	0.60863	0.0:0.0:0.8434:0.1566	.	1775;1775	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	T	1775	ENSP00000330753:P1775T;ENSP00000344333:P1775T;ENSP00000370178:P1775T	ENSP00000330753:P1775T	P	-	1	0	BRWD1	39492889	0.977000	0.34250	0.978000	0.43139	0.868000	0.49771	3.511000	0.53400	2.576000	0.86940	0.655000	0.94253	CCA		0.408	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3		NM_033656	
C2CD3	26005	hgsc.bcm.edu;ucsc.edu	37	11	73814557	73814557	+	Silent	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:73814557T>A	ENST00000334126.7	-	14	2425	c.2199A>T	c.(2197-2199)ctA>ctT	p.L733L	C2CD3_ENST00000313663.7_Silent_p.L733L			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	733					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TAAGTTCTGGTAGTGCCTTAT	0.383																																																	0													193.0	196.0	195.0					11																	73814557		2200	4293	6493	SO:0001819	synonymous_variant	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.2199A>T	11.37:g.73814557T>A		Somatic		WXS	SOLID	Phase_I	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	ENST00000334126.7	37																																																																																					0.383	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015531	
MTURN	222166	hgsc.bcm.edu	37	7	30174891	30174891	+	Missense_Mutation	SNP	G	G	T	rs374284471		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr7:30174891G>T	ENST00000324453.8	+	1	466	c.139G>T	c.(139-141)Gac>Tac	p.D47Y	C7orf41_ENST00000415604.1_Missense_Mutation_p.D47Y|C7orf41_ENST00000409688.1_Missense_Mutation_p.D47Y	NM_152793.2	NP_690006.2	Q8N3F0	MTURN_HUMAN		47					multicellular organismal development (GO:0007275)					NS(1)|large_intestine(2)	3						GCTGTGTCCGGACAACGGCTG	0.672																																																	0								G	TYR/ASP	0,4290		0,0,2145	22.0	28.0	26.0		139	3.7	1.0	7		26	1,8515		0,1,4257	no	missense	C7orf41	NM_152793.2	160	0,1,6402	TT,TG,GG		0.0117,0.0,0.0078	possibly-damaging	47/132	30174891	1,12805	2145	4258	6403	SO:0001583	missense	222166																														ENST00000324453.8:c.139G>T	7.37:g.30174891G>T	ENSP00000324204:p.Asp47Tyr	Somatic		WXS	SOLID	Phase_I	B8ZZW9|Q8N791|Q8N8M4|Q8NEX2	Missense_Mutation	SNP	ENST00000324453.8	37	CCDS5425.2	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243577	0.58995	0.0	1.17E-4	ENSG00000180354	ENST00000324453;ENST00000409688;ENST00000415604	.	.	.	3.65	3.65	0.41850	.	0.210409	0.31542	U	0.007472	T	0.36110	0.0955	N	0.19112	0.55	0.80722	D	1	P	0.43412	0.806	B	0.37387	0.248	T	0.43065	-0.9414	9	0.87932	D	0	-15.0715	12.7909	0.57533	0.0:0.0:1.0:0.0	.	47	Q8N3F0	CG041_HUMAN	Y	47	.	ENSP00000324204:D47Y	D	+	1	0	C7orf41	30141416	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	5.487000	0.66863	1.562000	0.49601	0.289000	0.19496	GAC		0.672	C7orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250409.1			
CASR	846	hgsc.bcm.edu;ucsc.edu	37	3	121980855	121980855	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr3:121980855G>A	ENST00000490131.1	+	4	1345	c.973G>A	c.(973-975)Ggg>Agg	p.G325R	CASR_ENST00000498619.1_Missense_Mutation_p.G325R|CASR_ENST00000296154.5_Missense_Mutation_p.G325R	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	325					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TCTGAAGGCTGGGCAGATCCC	0.562																																																	0													53.0	49.0	50.0					3																	121980855		2203	4300	6503	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.973G>A	3.37:g.121980855G>A	ENSP00000418685:p.Gly325Arg	Somatic		WXS	SOLID	Phase_I	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918028	0.92249	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.83163	-1.69;-1.69;-1.69	6.17	6.17	0.99709	Extracellular ligand-binding receptor (1);	0.085942	0.85682	D	0.000000	D	0.90007	0.6880	L	0.56280	1.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.982	D	0.89649	0.3868	10	0.87932	D	0	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	325;325	E7ENE0;P41180	.;CASR_HUMAN	R	325	ENSP00000418685:G325R;ENSP00000420194:G325R;ENSP00000296154:G325R	ENSP00000296154:G325R	G	+	1	0	CASR	123463545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GGG		0.562	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1		NM_000388	
CEP89	84902	hgsc.bcm.edu	37	19	33444588	33444588	+	Missense_Mutation	SNP	T	T	G	rs73035551		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:33444588T>G	ENST00000305768.5	-	4	513	c.425A>C	c.(424-426)gAt>gCt	p.D142A	CEP89_ENST00000590597.2_Missense_Mutation_p.D142A	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	142					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GGCACTGACATCCCCCAATTC	0.498																																																	0													316.0	324.0	321.0					19																	33444588		2203	4300	6503	SO:0001583	missense	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.425A>C	19.37:g.33444588T>G	ENSP00000306105:p.Asp142Ala	Somatic		WXS	SOLID	Phase_I	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	T	9.846	1.192254	0.21954	.	.	ENSG00000121289	ENST00000305768	T	0.30714	1.52	4.63	2.25	0.28309	.	0.534254	0.18575	N	0.137213	T	0.27134	0.0665	L	0.60455	1.87	0.09310	N	1	P;B;B	0.51933	0.949;0.039;0.034	B;B;B	0.43301	0.415;0.022;0.036	T	0.11966	-1.0566	10	0.20519	T	0.43	-3.9698	8.2406	0.31658	0.0:0.0:0.4001:0.5999	.	113;142;142	Q8WUL5;Q96ST8-3;Q96ST8	.;.;CEP89_HUMAN	A	142	ENSP00000306105:D142A	ENSP00000306105:D142A	D	-	2	0	CEP89	38136428	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.179000	0.09768	0.681000	0.31386	0.477000	0.44152	GAT		0.498	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2		NM_032816	
CCS	9973	hgsc.bcm.edu	37	11	66373234	66373234	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:66373234T>G	ENST00000533244.1	+	8	1174	c.733T>G	c.(733-735)Tct>Gct	p.S245A	CCS_ENST00000310190.4_Missense_Mutation_p.S226A	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	245					copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						GCAGATCTGCTCTTGCGATGG	0.622																																																	0													81.0	76.0	77.0					11																	66373234		2200	4295	6495	SO:0001583	missense	9973			AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.733T>G	11.37:g.66373234T>G	ENSP00000436318:p.Ser245Ala	Somatic		WXS	SOLID	Phase_I	Q2M366|Q8NEV0	Missense_Mutation	SNP	ENST00000533244.1	37	CCDS8146.1	.	.	.	.	.	.	.	.	.	.	t	7.319	0.616494	0.14129	.	.	ENSG00000173992	ENST00000533244;ENST00000310190;ENST00000534763	T;T;T	0.40476	1.03;1.03;1.03	5.73	-4.29	0.03721	Superoxide dismutase, copper/zinc binding domain (1);	0.378363	0.29838	N	0.011061	T	0.11836	0.0288	N	0.02266	-0.62	0.31492	N	0.66589	B	0.02656	0.0	B	0.09377	0.004	T	0.40701	-0.9549	10	0.05959	T	0.93	.	9.5474	0.39288	0.6756:0.0:0.1073:0.2171	.	245	O14618	CCS_HUMAN	A	245;226;63	ENSP00000436318:S245A;ENSP00000307870:S226A;ENSP00000436379:S63A	ENSP00000307870:S226A	S	+	1	0	CCS	66129810	0.981000	0.34729	0.986000	0.45419	0.976000	0.68499	0.159000	0.16442	-0.592000	0.05851	-0.507000	0.04495	TCT		0.622	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393826.1		NM_005125	
CDH2	1000	hgsc.bcm.edu	37	18	25593663	25593663	+	Missense_Mutation	SNP	G	G	C	rs199902980		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr18:25593663G>C	ENST00000269141.3	-	3	806	c.383C>G	c.(382-384)aCt>aGt	p.T128S	CDH2_ENST00000399380.3_Missense_Mutation_p.T97S	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	128					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TGACTCCTCAGTTAAGGTTGG	0.418																																																	0								G	SER/THR	0,4406		0,0,2203	151.0	156.0	154.0		383	3.7	0.0	18		154	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDH2	NM_001792.3	58	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign	128/907	25593663	1,13005	2203	4300	6503	SO:0001583	missense	1000			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.383C>G	18.37:g.25593663G>C	ENSP00000269141:p.Thr128Ser	Somatic		WXS	SOLID	Phase_I	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	G	3.082	-0.188750	0.06299	0.0	1.16E-4	ENSG00000170558	ENST00000269141;ENST00000399380;ENST00000418492;ENST00000430882;ENST00000413878	T;T;T;T;T	0.67345	0.48;0.44;-0.26;0.34;0.88	5.55	3.73	0.42828	Cadherin-like (1);	0.568231	0.18218	N	0.147990	T	0.38374	0.1038	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.24548	-1.0157	10	0.06757	T	0.87	.	7.0662	0.25154	0.1501:0.1417:0.7082:0.0	.	97;128	A8MWK3;P19022	.;CADH2_HUMAN	S	128;97;77;43;43	ENSP00000269141:T128S;ENSP00000382312:T97S;ENSP00000411360:T77S;ENSP00000412120:T43S;ENSP00000414269:T43S	ENSP00000269141:T128S	T	-	2	0	CDH2	23847661	0.010000	0.17322	0.005000	0.12908	0.693000	0.40251	1.713000	0.37951	0.686000	0.31488	0.585000	0.79938	ACT		0.418	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3		NM_001792	
CLTCL1	8218	hgsc.bcm.edu	37	22	19220820	19220820	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr22:19220820C>T	ENST00000263200.10	-	9	1462	c.1390G>A	c.(1390-1392)Gga>Aga	p.G464R	CLTCL1_ENST00000353891.5_Missense_Mutation_p.G464R|CLTCL1_ENST00000427926.1_Missense_Mutation_p.G464R	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	464	Binding site for the uncoating ATPase, involved in lattice disassembly. {ECO:0000255}.|Globular terminal domain.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					ACCAAGTCTCCGAGCTCCTCT	0.552			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													85.0	83.0	84.0					22																	19220820		1996	4154	6150	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.1390G>A	22.37:g.19220820C>T	ENSP00000445677:p.Gly464Arg	Somatic		WXS	SOLID	Phase_I	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192524	0.78902	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.80994	-1.44;-1.44;-1.44	3.92	3.92	0.45320	Armadillo-type fold (2);	0.000000	0.64402	D	0.000001	D	0.92538	0.7630	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95016	0.8156	10	0.87932	D	0	-13.3067	16.4728	0.84119	0.0:1.0:0.0:0.0	.	464;464	P53675-2;P53675	.;CLH2_HUMAN	R	464	ENSP00000439662:G464R;ENSP00000445677:G464R;ENSP00000441158:G464R	ENSP00000445677:G464R	G	-	1	0	CLTCL1	17600820	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	4.121000	0.57904	2.177000	0.69029	0.591000	0.81541	GGA		0.552	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5		NM_007098	
CNTNAP4	85445	hgsc.bcm.edu	37	16	76509834	76509834	+	Splice_Site	SNP	A	A	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr16:76509834A>T	ENST00000476707.1	+	10	1803		c.e10-1		CNTNAP4_ENST00000377504.4_Splice_Site|CNTNAP4_ENST00000469589.1_Splice_Site|CNTNAP4_ENST00000307431.8_Splice_Site|CNTNAP4_ENST00000478060.1_Splice_Site			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4						cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						ACCTTCTTTTAGGTGTTTGCC	0.408																																																	0													163.0	142.0	149.0					16																	76509834		2198	4300	6498	SO:0001630	splice_region_variant	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1665-1A>T	16.37:g.76509834A>T		Somatic		WXS	SOLID	Phase_I	E9PFZ6|Q86YZ7	Splice_Site	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	A	12.59	1.984382	0.35036	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2033	0.73157	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP4	75067335	1.000000	0.71417	0.977000	0.42913	0.071000	0.16799	9.004000	0.93583	2.238000	0.73509	0.533000	0.62120	.		0.408	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1		NM_033401	Intron
COL2A1	1280	hgsc.bcm.edu;ucsc.edu	37	12	48379700	48379700	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr12:48379700G>A	ENST00000380518.3	-	24	1740	c.1576C>T	c.(1576-1578)Ccc>Tcc	p.P526S	COL2A1_ENST00000337299.6_Missense_Mutation_p.P457S|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	526	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CTCACCTTGGGACCTGCCAGA	0.627																																																	0													44.0	45.0	45.0					12																	48379700		2126	4180	6306	SO:0001583	missense	1280			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1576C>T	12.37:g.48379700G>A	ENSP00000369889:p.Pro526Ser	Somatic		WXS	SOLID	Phase_I	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389238	0.61956	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.96587	-3.2;-4.06	4.95	4.95	0.65309	.	0.213564	0.38837	N	0.001560	D	0.97056	0.9038	L	0.61218	1.895	0.47949	D	0.999554	B;B	0.29552	0.158;0.248	P;P	0.48114	0.567;0.458	D	0.96102	0.9070	10	0.41790	T	0.15	.	17.1221	0.86705	0.0:0.0:1.0:0.0	.	457;526	P02458-1;P02458	.;CO2A1_HUMAN	S	526;457;457	ENSP00000369889:P526S;ENSP00000338213:P457S	ENSP00000338213:P457S	P	-	1	0	COL2A1	46665967	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.831000	0.48144	2.572000	0.86782	0.609000	0.83330	CCC		0.627	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2		NM_001844	
COX6B1	1340	hgsc.bcm.edu;ucsc.edu	37	19	36142196	36142196	+	Silent	SNP	T	T	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:36142196T>C	ENST00000592141.1	+	2	316	c.51T>C	c.(49-51)ttT>ttC	p.F17F	COX6B1_ENST00000392201.1_Silent_p.F17F|COX6B1_ENST00000246554.3_Silent_p.F17F			P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)	17					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			lung(6)|prostate(1)|stomach(1)	8	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCGCCCCTTTTGACAGCCGCT	0.567																																																	0													96.0	81.0	86.0					19																	36142196		2203	4300	6503	SO:0001819	synonymous_variant	1340			BC001015	CCDS12469.1	19q13.1	2011-07-04	2010-01-07	2004-08-12	ENSG00000126267	ENSG00000126267	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2280	protein-coding gene	gene with protein product		124089	"""cytochrome c oxidase subunit Vib"", ""cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)"""	COX6B		1650756	Standard	NM_001863		Approved	COXG	uc002oav.3	P14854	OTTHUMG00000048112	ENST00000592141.1:c.51T>C	19.37:g.36142196T>C		Somatic		WXS	SOLID	Phase_I	B2R5C9|Q6IBL4	Silent	SNP	ENST00000592141.1	37	CCDS12469.1																																																																																				0.567	COX6B1-004	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459068.3		NM_001863	
CSE1L	1434	hgsc.bcm.edu;ucsc.edu	37	20	47707554	47707554	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr20:47707554T>A	ENST00000262982.2	+	21	2483	c.2360T>A	c.(2359-2361)aTc>aAc	p.I787N	CSE1L_ENST00000469700.1_3'UTR|CSE1L_ENST00000396192.3_Missense_Mutation_p.I731N|CSE1L_ENST00000542325.1_Missense_Mutation_p.I570N	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	787					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			ACCAAGTTTATCAAGAGTAAG	0.313																																																	0													43.0	46.0	45.0					20																	47707554		2202	4294	6496	SO:0001583	missense	1434			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2360T>A	20.37:g.47707554T>A	ENSP00000262982:p.Ile787Asn	Somatic		WXS	SOLID	Phase_I	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.756732	0.89843	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.68025	-0.3;-0.3;-0.3	5.47	5.47	0.80525	Armadillo-like helical (1);Armadillo-type fold (1);CAS/CSE, C-terminal (1);	0.148445	0.64402	D	0.000008	T	0.70718	0.3256	L	0.46157	1.445	0.80722	D	1	P;P;B;B;P	0.44195	0.828;0.808;0.079;0.071;0.537	B;P;B;B;B	0.51266	0.431;0.664;0.063;0.059;0.36	T	0.71613	-0.4540	10	0.48119	T	0.1	-8.0406	15.8584	0.79005	0.0:0.0:0.0:1.0	.	476;570;731;731;787	F5GX54;B4DUC5;A3RLL6;F8W904;P55060	.;.;.;.;XPO2_HUMAN	N	385;787;570;731	ENSP00000262982:I787N;ENSP00000446477:I570N;ENSP00000379495:I731N	ENSP00000262982:I787N	I	+	2	0	CSE1L	47140961	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.655000	0.83696	2.201000	0.70794	0.528000	0.53228	ATC		0.313	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2		NM_001316	
CSTF2	1478	hgsc.bcm.edu	37	X	100088269	100088269	+	Silent	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chrX:100088269G>A	ENST00000372972.2	+	11	1324	c.1308G>A	c.(1306-1308)gaG>gaA	p.E436E	CSTF2_ENST00000415585.2_Silent_p.E456E	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	436	12 X 5 AA tandem repeats of M-E-A-R-[AG].				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						GTGCAATGGAGGCCCGTGCGA	0.622																																																	0													52.0	42.0	45.0					X																	100088269		2203	4300	6503	SO:0001819	synonymous_variant	1478			BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.1308G>A	X.37:g.100088269G>A		Somatic		WXS	SOLID	Phase_I	Q5H951|Q6LA74|Q8N502	Silent	SNP	ENST00000372972.2	37	CCDS14473.1																																																																																				0.622	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058926.1		NM_001325	
DCTN2	10540	hgsc.bcm.edu;ucsc.edu	37	12	57926027	57926027	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr12:57926027T>G	ENST00000548249.1	-	12	1263	c.996A>C	c.(994-996)agA>agC	p.R332S	DCTN2_ENST00000551400.1_5'Flank|DCTN2_ENST00000434715.3_Missense_Mutation_p.R337S|DCTN2_ENST00000543672.1_Missense_Mutation_p.R337S|DCTN2_ENST00000537439.1_Missense_Mutation_p.R309S	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	332					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						TGGTGACAAGTCTCTGCACCA	0.562																																																	0													27.0	27.0	27.0					12																	57926027		1940	4119	6059	SO:0001583	missense	10540			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.996A>C	12.37:g.57926027T>G	ENSP00000447824:p.Arg332Ser	Somatic		WXS	SOLID	Phase_I	B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	ENST00000548249.1	37	CCDS58245.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987754	0.74589	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000543105;ENST00000546758	.	.	.	5.1	3.95	0.45737	.	0.000000	0.85682	D	0.000000	T	0.73171	0.3553	M	0.84948	2.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.997;0.998	T	0.73642	-0.3918	9	0.87932	D	0	-17.5931	4.365	0.11220	0.0:0.1725:0.171:0.6564	.	308;337;332	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	S	332;337;337;309;308;245;199	.	ENSP00000346785:R308S	R	-	3	2	DCTN2	56212294	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	0.377000	0.20552	1.075000	0.40932	0.533000	0.62120	AGA		0.562	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407393.2		NM_006400	
DEFB107A	245910	hgsc.bcm.edu	37	8	7673126	7673126	+	Missense_Mutation	SNP	C	C	A	rs200631345		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr8:7673126C>A	ENST00000335021.2	-	1	112	c.25G>T	c.(25-27)Gtc>Ttc	p.V9F		NM_001037668.1	NP_001032757.2	Q8IZN7	D107A_HUMAN	defensin, beta 107A	9				V -> F (in Ref. 5; AAM93909). {ECO:0000305}.	defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)									COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AAAATAAAGACAAATATTTTC	0.398																																																	0													6.0	5.0	5.0					8																	7673126		1631	3605	5236	SO:0001583	missense	245910			AF540979	CCDS43699.1	8p23.1	2011-03-29		2005-02-25	ENSG00000186572	ENSG00000186572		"""Defensins, beta"""	18086	protein-coding gene	gene with protein product				DEFB107		11854508	Standard	NM_001037668		Approved	DEFB-7	uc003wrq.1	Q8IZN7	OTTHUMG00000150013	ENST00000335021.2:c.25G>T	8.37:g.7673126C>A	ENSP00000334681:p.Val9Phe	Somatic		WXS	SOLID	Phase_I	B2RPM1|Q30E75|Q8NET2	Missense_Mutation	SNP	ENST00000335021.2	37	CCDS43699.1	1053	0.48214285714285715	254	0.516260162601626	154	0.425414364640884	315	0.5506993006993007	330	0.43535620052770446	.	0.001	-3.340153	0.00017	.	.	ENSG00000186572	ENST00000335021	.	.	.	2.78	-0.0409	0.13870	.	0.814536	0.10413	N	0.677651	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.45145	-0.9281	5	0.02654	T	1	1.4033	3.7734	0.08650	0.3812:0.4524:0.1663:0.0	.	.	.	.	F	9	.	ENSP00000334681:V9F	V	-	1	0	DEFB107A	7710536	0.071000	0.21146	0.007000	0.13788	0.050000	0.14768	0.080000	0.14802	-0.305000	0.08831	-0.310000	0.09108	GTC		0.398	DEFB107A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315760.1			
DUSP3	1845	hgsc.bcm.edu;ucsc.edu	37	17	41847147	41847147	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr17:41847147G>A	ENST00000226004.3	-	3	451	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C	DUSP3_ENST00000397937.2_Missense_Mutation_p.R89C	NM_004090.3	NP_004081.1	P51452	DUS3_HUMAN	dual specificity phosphatase 3	130	Tyrosine-protein phosphatase.				in utero embryonic development (GO:0001701)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of JNK cascade (GO:0046329)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of mitotic cell cycle (GO:0045931)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	7		Breast(137;0.00725)		BRCA - Breast invasive adenocarcinoma(366;0.116)		GTTGGGGAGCGGCTATAACCT	0.597																																					Esophageal Squamous(114;1511 1593 4801 6912 51717)												0													84.0	76.0	79.0					17																	41847147		2203	4300	6503	SO:0001583	missense	1845			BC035701	CCDS11469.1	17q21	2011-06-09	2008-02-04			ENSG00000108861		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3069	protein-coding gene	gene with protein product		600183	"""vaccinia virus phosphatase VH1-related"""	VHR		7829094	Standard	NM_004090		Approved		uc002ied.4	P51452		ENST00000226004.3:c.388C>T	17.37:g.41847147G>A	ENSP00000226004:p.Arg130Cys	Somatic		WXS	SOLID	Phase_I	D3DX45|Q5U0J1|Q8IYJ9	Missense_Mutation	SNP	ENST00000226004.3	37	CCDS11469.1	.	.	.	.	.	.	.	.	.	.	G	35	5.416041	0.96092	.	.	ENSG00000108861	ENST00000226004;ENST00000397937	D;D	0.98381	-4.9;-4.9	5.63	5.63	0.86233	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.97415	4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98376	1.0556	10	0.87932	D	0	-39.3019	19.6709	0.95911	0.0:0.0:1.0:0.0	.	130;130	B5BUI8;P51452	.;DUS3_HUMAN	C	130;89	ENSP00000226004:R130C;ENSP00000443014:R89C	ENSP00000226004:R130C	R	-	1	0	DUSP3	39202673	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.841000	0.99482	2.636000	0.89361	0.655000	0.94253	CGC		0.597	DUSP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453503.1		NM_004090	
EPHA3	2042	hgsc.bcm.edu	37	3	89468539	89468539	+	Splice_Site	SNP	A	A	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr3:89468539A>T	ENST00000336596.2	+	11	2298	c.2073A>T	c.(2071-2073)aaA>aaT	p.K691N	EPHA3_ENST00000494014.1_Splice_Site_p.K691N	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	691	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TTGTTACCAAAAGTAAGTAAA	0.408										TSP Lung(6;0.00050)																																							0													89.0	85.0	86.0					3																	89468539		2203	4297	6500	SO:0001630	splice_region_variant	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2074+1A>T	3.37:g.89468539A>T		Somatic		WXS	SOLID	Phase_I	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.986729	0.53934	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.83335	-1.71;-1.71	5.71	1.92	0.25849	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.053681	0.64402	D	0.000001	T	0.71204	0.3312	N	0.21240	0.645	0.51482	D	0.999925	P	0.40066	0.701	B	0.41691	0.364	T	0.61983	-0.6950	9	.	.	.	.	9.6426	0.39848	0.7993:0.0:0.2007:0.0	.	691	P29320	EPHA3_HUMAN	N	691	ENSP00000337451:K691N;ENSP00000419190:K691N	.	K	+	3	2	EPHA3	89551229	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	1.885000	0.39678	0.093000	0.17368	0.460000	0.39030	AAA		0.408	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1		NM_005233	Missense_Mutation
ERLIN2	11160	hgsc.bcm.edu;ucsc.edu	37	8	37611039	37611039	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr8:37611039G>A	ENST00000276461.5	+	11	878	c.811G>A	c.(811-813)Gcc>Acc	p.A271T	ERLIN2_ENST00000519638.1_Missense_Mutation_p.A271T	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2	271	Interaction with ERLIN1.				cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			AATAGCCGAAGCCAATAAGGT	0.532																																																	0													57.0	53.0	54.0					8																	37611039		2203	4300	6503	SO:0001583	missense	11160			AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005	ENST00000276461.5:c.811G>A	8.37:g.37611039G>A	ENSP00000276461:p.Ala271Thr	Somatic		WXS	SOLID	Phase_I	A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Missense_Mutation	SNP	ENST00000276461.5	37	CCDS6095.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381337	0.82792	.	.	ENSG00000147475	ENST00000276461;ENST00000521644;ENST00000519638	T;T;T	0.74106	-0.81;-0.81;-0.81	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.74412	0.3713	M	0.67625	2.065	0.80722	D	1	P	0.48834	0.916	B	0.39935	0.314	T	0.76979	-0.2758	10	0.46703	T	0.11	-17.69	20.1169	0.97940	0.0:0.0:1.0:0.0	.	271	O94905	ERLN2_HUMAN	T	271	ENSP00000276461:A271T;ENSP00000429621:A271T;ENSP00000428112:A271T	ENSP00000276461:A271T	A	+	1	0	ERLIN2	37730197	1.000000	0.71417	0.995000	0.50966	0.441000	0.31987	5.430000	0.66501	2.835000	0.97688	0.591000	0.81541	GCC		0.532	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376712.2		NM_007175	
EXPH5	23086	hgsc.bcm.edu;ucsc.edu	37	11	108384025	108384025	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:108384025T>G	ENST00000265843.4	-	6	2319	c.2209A>C	c.(2209-2211)Aac>Cac	p.N737H	EXPH5_ENST00000428840.1_Missense_Mutation_p.N661H|EXPH5_ENST00000525344.1_Missense_Mutation_p.N730H|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Missense_Mutation_p.N549H	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	737					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GGTAAAGAGTTTGAGATCCCT	0.403																																																	0													84.0	91.0	89.0					11																	108384025		2201	4298	6499	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2209A>C	11.37:g.108384025T>G	ENSP00000265843:p.Asn737His	Somatic		WXS	SOLID	Phase_I	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	T	12.07	1.827057	0.32329	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.04551	4.2;4.12;3.97;4.2;4.04;3.6	5.93	-2.63	0.06133	.	0.925488	0.09267	N	0.825714	T	0.09818	0.0241	M	0.62723	1.935	0.09310	N	1	D	0.59767	0.986	P	0.54100	0.742	T	0.18840	-1.0324	10	0.54805	T	0.06	-0.5037	5.8773	0.18836	0.0:0.3554:0.2592:0.3854	.	737	Q8NEV8	EXPH5_HUMAN	H	737;661;549;730;661;549	ENSP00000265843:N737H;ENSP00000391966:N661H;ENSP00000411390:N549H;ENSP00000432546:N730H;ENSP00000432683:N661H;ENSP00000446434:N549H	ENSP00000265843:N737H	N	-	1	0	EXPH5	107889235	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.011000	0.12721	-0.370000	0.08016	-0.460000	0.05396	AAC		0.403	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1		NM_015065	
ABHD17C	58489	hgsc.bcm.edu;ucsc.edu	37	15	81046580	81046580	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr15:81046580A>G	ENST00000258884.4	+	3	986	c.859A>G	c.(859-861)Atg>Gtg	p.M287V	ABHD17C_ENST00000559506.1_3'UTR|ABHD17C_ENST00000558464.1_Missense_Mutation_p.M253V|ABHD17C_ENST00000560609.1_Missense_Mutation_p.M52V	NM_021214.1	NP_067037.1	Q6PCB6	AB17C_HUMAN	abhydrolase domain containing 17C	287							hydrolase activity (GO:0016787)										TGGCCTAGCGATGTACGAGCG	0.483																																																	0													74.0	72.0	72.0					15																	81046580		1949	4141	6090	SO:0001583	missense	58489				CCDS45323.1	15q25.1	2013-03-15	2013-03-15	2013-03-15	ENSG00000136379	ENSG00000136379		"""Abhydrolase domain containing"""	26925	protein-coding gene	gene with protein product			"""family with sequence similarity 108, member C1"""	FAM108C1			Standard	NM_021214		Approved		uc002bfu.3	Q6PCB6		ENST00000258884.4:c.859A>G	15.37:g.81046580A>G	ENSP00000258884:p.Met287Val	Somatic		WXS	SOLID	Phase_I	Q1RMD6|Q9NPM1	Missense_Mutation	SNP	ENST00000258884.4	37	CCDS45323.1	.	.	.	.	.	.	.	.	.	.	A	9.310	1.055406	0.19907	.	.	ENSG00000136379	ENST00000258884	T	0.42131	0.98	5.48	4.36	0.52297	.	0.099573	0.64402	N	0.000003	T	0.27629	0.0679	N	0.16166	0.38	0.44985	D	0.998001	B;B	0.13594	0.005;0.008	B;B	0.19666	0.026;0.022	T	0.05649	-1.0872	10	0.62326	D	0.03	.	11.1372	0.48381	0.9283:0.0:0.0717:0.0	.	287;253	Q6PCB6;Q6PCB6-2	F108C_HUMAN;.	V	287	ENSP00000258884:M287V	ENSP00000258884:M287V	M	+	1	0	FAM108C1	78833635	0.990000	0.36364	0.928000	0.36995	0.231000	0.25187	3.017000	0.49615	0.922000	0.37019	0.528000	0.53228	ATG		0.483	ABHD17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417652.1		NM_021214	
FAM129A	116496	hgsc.bcm.edu;ucsc.edu	37	1	184859254	184859254	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:184859254G>T	ENST00000367511.3	-	4	614	c.421C>A	c.(421-423)Cca>Aca	p.P141T		NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	141					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						AGAGGGTCTGGGAAATGCCTG	0.448																																																	0													93.0	90.0	91.0					1																	184859254		2203	4300	6503	SO:0001583	missense	116496			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.421C>A	1.37:g.184859254G>T	ENSP00000356481:p.Pro141Thr	Somatic		WXS	SOLID	Phase_I	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194270	0.78902	.	.	ENSG00000135842	ENST00000367511	T	0.15487	2.42	5.71	5.71	0.89125	.	0.054186	0.85682	D	0.000000	T	0.40297	0.1111	M	0.62723	1.935	0.48452	D	0.999655	D	0.89917	1.0	D	0.91635	0.999	T	0.09100	-1.0690	10	0.72032	D	0.01	-6.3917	15.358	0.74443	0.0:0.0:1.0:0.0	.	141	Q9BZQ8	NIBAN_HUMAN	T	141	ENSP00000356481:P141T	ENSP00000356481:P141T	P	-	1	0	FAM129A	183125877	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.784000	0.68990	2.687000	0.91594	0.655000	0.94253	CCA		0.448	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1			
FAM166B	730112	hgsc.bcm.edu;ucsc.edu	37	9	35563020	35563020	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr9:35563020T>A	ENST00000399742.2	-	3	414	c.344A>T	c.(343-345)gAg>gTg	p.E115V	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	115										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						ACTCAGAGCCTCGGCCCAGAC	0.532																																																	0													54.0	52.0	53.0					9																	35563020		1960	4137	6097	SO:0001583	missense	730112			BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.344A>T	9.37:g.35563020T>A	ENSP00000382646:p.Glu115Val	Somatic		WXS	SOLID	Phase_I	A1L3B2|B7ZBJ0	Missense_Mutation	SNP	ENST00000399742.2	37	CCDS56572.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949786	0.73787	.	.	ENSG00000215187	ENST00000399742;ENST00000537504	.	.	.	5.67	5.67	0.87782	.	0.324869	0.18704	U	0.133488	T	0.77785	0.4182	M	0.75447	2.3	0.40512	D	0.980746	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.87578	0.997;0.997;0.942;0.998	T	0.78778	-0.2071	9	0.49607	T	0.09	-21.379	12.2915	0.54820	0.0:0.0:0.0:1.0	.	115;115;115;115	B7ZW33;B7ZW26;A8MTA8;A8MTA8-2	.;.;F166B_HUMAN;.	V	115	.	ENSP00000382646:E115V	E	-	2	0	FAM166B	35553020	0.997000	0.39634	0.996000	0.52242	0.787000	0.44495	2.679000	0.46909	2.151000	0.67156	0.460000	0.39030	GAG		0.532	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336563.1		NM_001099951	
FCGR1B	2210	hgsc.bcm.edu	37	1	120927292	120927292	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:120927292T>C	ENST00000369384.4	-	5	730	c.688A>G	c.(688-690)Aat>Gat	p.N230D	RP11-439A17.9_ENST00000457996.1_RNA|RP11-439A17.10_ENST00000426275.1_RNA|FCGR1B_ENST00000369383.4_Missense_Mutation_p.N138D|FCGR1B_ENST00000472543.1_5'Flank	NM_001017986.3	NP_001017986.1	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor (CD64)	230					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|Fc receptor signaling pathway (GO:0038093)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	immunoglobulin receptor activity (GO:0019763)			breast(1)|endometrium(1)|lung(2)	4	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)	Intravenous Immunoglobulin(DB00028)	ATTTCTAAATTCCACTTTTTC	0.363																																																	0													5.0	6.0	6.0					1																	120927292		1801	3770	5571	SO:0001583	missense	2210				CCDS72844.1, CCDS72845.1, CCDS72846.1	1p11.2	2013-01-11	2005-02-02		ENSG00000198019	ENSG00000198019		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3614	protein-coding gene	gene with protein product		601502	"""Fc fragment of IgG, high affinity Ib, receptor for (CD64)"""			8697799, 9763663	Standard	NM_001017986		Approved	CD64b	uc001eip.3	Q92637	OTTHUMG00000040903	ENST00000369384.4:c.688A>G	1.37:g.120927292T>C	ENSP00000358391:p.Asn230Asp	Somatic		WXS	SOLID	Phase_I	Q7KZ13|Q92638	Missense_Mutation	SNP	ENST00000369384.4	37	CCDS30821.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.72|11.72	1.721600|1.721600	0.30503|0.30503	.|.	.|.	ENSG00000198019|ENSG00000198019	ENST00000369178|ENST00000369384;ENST00000369383	.|T;T	.|0.03860	.|5.02;3.78	1.96|1.96	0.723|0.723	0.18231|0.18231	.|.	.|3.080580	.|0.01490	.|N	.|0.017043	T|T	0.01222|0.01222	0.0040|0.0040	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999999|0.999999	.|P;B	.|0.51057	.|0.941;0.057	.|B;B	.|0.40134	.|0.32;0.015	T|T	0.39643|0.39643	-0.9604|-0.9604	5|10	.|0.25751	.|T	.|0.34	.|.	4.0064|4.0064	0.09603|0.09603	0.3193:0.0:0.0:0.6807|0.3193:0.0:0.0:0.6807	.|.	.|138;230	.|Q92637-3;Q92637	.|.;FCGRB_HUMAN	G|D	214|230;138	.|ENSP00000358391:N230D;ENSP00000358390:N138D	.|ENSP00000358390:N138D	E|N	-|-	2|1	0|0	FCGR1B|FCGR1B	120728815|120728815	0.002000|0.002000	0.14202|0.14202	0.229000|0.229000	0.23960|0.23960	0.637000|0.637000	0.38172|0.38172	0.025000|0.025000	0.13577|0.13577	0.193000|0.193000	0.20303|0.20303	0.155000|0.155000	0.16302|0.16302	GAA|AAT		0.363	FCGR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098241.1			
FRMPD1	22844	hgsc.bcm.edu;ucsc.edu	37	9	37731077	37731077	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr9:37731077G>T	ENST00000539465.1	+	9	1428	c.835G>T	c.(835-837)Gcc>Tcc	p.A279S	FRMPD1_ENST00000536622.1_Missense_Mutation_p.A101S|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.A279S|FRMPD1_ENST00000541302.1_Missense_Mutation_p.A148S			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	279	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGACCCCGTGGCCTTTGAATA	0.512																																																	0													89.0	91.0	90.0					9																	37731077		2203	4300	6503	SO:0001583	missense	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.835G>T	9.37:g.37731077G>T	ENSP00000444411:p.Ala279Ser	Somatic		WXS	SOLID	Phase_I	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910586	0.72983	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.64	5.64	0.86602	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);	0.180487	0.49305	D	0.000151	T	0.52964	0.1767	L	0.54323	1.7	0.58432	D	0.99999	P;P	0.52463	0.834;0.953	P;P	0.53313	0.583;0.723	T	0.49062	-0.8978	10	0.45353	T	0.12	-17.733	17.1917	0.86881	0.0:0.0:1.0:0.0	.	148;279	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	S	279;279;101;148	ENSP00000366995:A279S;ENSP00000444411:A279S;ENSP00000437762:A101S;ENSP00000444804:A148S	ENSP00000366995:A279S	A	+	1	0	FRMPD1	37721077	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.672000	0.54583	2.666000	0.90696	0.655000	0.94253	GCC		0.512	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1		NM_014907	
FNBP1	23048	hgsc.bcm.edu;ucsc.edu	37	9	132741632	132741632	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr9:132741632T>A	ENST00000446176.2	-	3	348	c.162A>T	c.(160-162)caA>caT	p.Q54H	FNBP1_ENST00000420781.1_Missense_Mutation_p.Q54H|FNBP1_ENST00000355681.3_Missense_Mutation_p.Q54H	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	54	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Interaction with microtubules. {ECO:0000250}.|Required for self-association and induction of membrane tubulation.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TCTTTTTAGGTTGGTACTTCT	0.333			T	MLL	AML																																			Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	0													172.0	164.0	167.0					9																	132741632		1815	4082	5897	SO:0001583	missense	23048			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.162A>T	9.37:g.132741632T>A	ENSP00000413625:p.Gln54His	Somatic		WXS	SOLID	Phase_I	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	37	CCDS48040.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.64|14.64	2.596801|2.596801	0.46318|0.46318	.|.	.|.	ENSG00000187239|ENSG00000187239	ENST00000449089|ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000355681	.|T;T;T	.|0.17691	.|2.26;2.26;2.26	5.47|5.47	3.11|3.11	0.35812|0.35812	.|Fps/Fes/Fer/CIP4 homology (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.22282|0.22282	0.0537|0.0537	L|L	0.58969|0.58969	1.84|1.84	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.29646	.|0.117;0.253;0.128;0.043;0.229	.|B;B;B;B;B	.|0.39531	.|0.139;0.302;0.124;0.187;0.196	T|T	0.02743|0.02743	-1.1116|-1.1116	5|10	.|0.59425	.|D	.|0.04	-28.1451|-28.1451	9.1832|9.1832	0.37154|0.37154	0.0:0.1484:0.0:0.8516|0.0:0.1484:0.0:0.8516	.|.	.|54;54;54;54;54	.|B7ZL12;B7ZL13;B7ZL14;Q96RU3-3;Q96RU3	.|.;.;.;.;FNBP1_HUMAN	I|H	16|54	.|ENSP00000413625:Q54H;ENSP00000407548:Q54H;ENSP00000347907:Q54H	.|ENSP00000347907:Q54H	N|Q	-|-	2|3	0|2	FNBP1|FNBP1	131781453|131781453	0.998000|0.998000	0.40836|0.40836	0.999000|0.999000	0.59377|0.59377	0.991000|0.991000	0.79684|0.79684	0.377000|0.377000	0.20552|0.20552	0.378000|0.378000	0.24764|0.24764	0.454000|0.454000	0.30748|0.30748	AAC|CAA		0.333	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2			
FTCD	10841	hgsc.bcm.edu	37	21	47570414	47570414	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr21:47570414C>G	ENST00000291670.5	-	6	705	c.662G>C	c.(661-663)gGc>gCc	p.G221A	FTCD_ENST00000355384.2_Missense_Mutation_p.G221A|FTCD_ENST00000397743.1_Missense_Mutation_p.G221A|FTCD_ENST00000359679.2_Missense_Mutation_p.G221A|FTCD_ENST00000397746.3_Missense_Mutation_p.G221A|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000397748.1_Missense_Mutation_p.G221A|FTCD_ENST00000498355.2_5'UTR	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	221	Formiminotransferase C-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	CCAGCCAATGCCCTGAACTTT	0.577																																																	0													126.0	115.0	118.0					21																	47570414		2203	4300	6503	SO:0001583	missense	10841			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.662G>C	21.37:g.47570414C>G	ENSP00000291670:p.Gly221Ala	Somatic		WXS	SOLID	Phase_I	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	ENST00000291670.5	37	CCDS13731.1	.	.	.	.	.	.	.	.	.	.	C	2.799	-0.249573	0.05867	.	.	ENSG00000160282	ENST00000291670;ENST00000397748;ENST00000359679;ENST00000355384;ENST00000397746;ENST00000397743	T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	4.83	2.91	0.33838	Formiminotransferas, N- and C-terminal subdomains (1);Formiminotransferase, C-terminal subdomain (2);Formiminotransferase catalytic domain (1);	0.377447	0.28927	N	0.013692	T	0.46580	0.1400	N	0.05467	-0.045	0.46356	D	0.999003	B;B;B	0.29253	0.239;0.201;0.184	B;B;B	0.37943	0.171;0.114;0.261	T	0.36311	-0.9753	10	0.02654	T	1	.	14.509	0.67772	0.0:0.5383:0.4617:0.0	.	221;221;221	B7WPK3;O95954-2;O95954	.;.;FTCD_HUMAN	A	221	ENSP00000291670:G221A;ENSP00000380856:G221A;ENSP00000352707:G221A;ENSP00000347545:G221A;ENSP00000380854:G221A;ENSP00000380851:G221A	ENSP00000291670:G221A	G	-	2	0	FTCD	46394842	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	0.735000	0.26115	0.398000	0.25338	-0.219000	0.12488	GGC		0.577	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1		NM_006657	
GPR112	139378	hgsc.bcm.edu;ucsc.edu	37	X	135432122	135432122	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chrX:135432122C>G	ENST00000394143.1	+	6	6548	c.6257C>G	c.(6256-6258)aCt>aGt	p.T2086S	GPR112_ENST00000287534.4_Missense_Mutation_p.T2023S|GPR112_ENST00000370652.1_Missense_Mutation_p.T2086S|GPR112_ENST00000412101.1_Missense_Mutation_p.T1881S|GPR112_ENST00000394141.1_Missense_Mutation_p.T1881S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2086					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GGCTTCCCAACTTCTCTCCCT	0.473																																																	0													219.0	167.0	184.0					X																	135432122		2203	4300	6503	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6257C>G	X.37:g.135432122C>G	ENSP00000377699:p.Thr2086Ser	Somatic		WXS	SOLID	Phase_I	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	12.05	1.822450	0.32237	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.40756	1.05;1.05;1.02;1.25;1.02	3.6	-0.552	0.11818	.	.	.	.	.	T	0.18045	0.0433	N	0.17082	0.46	0.09310	N	1	B;B;B	0.32918	0.123;0.047;0.39	B;B;B	0.24541	0.052;0.013;0.054	T	0.18808	-1.0325	9	0.15066	T	0.55	.	4.1789	0.10365	0.0:0.3975:0.3655:0.237	.	2023;1881;2086	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	S	2086;2086;1881;2023;1881	ENSP00000377699:T2086S;ENSP00000359686:T2086S;ENSP00000416526:T1881S;ENSP00000287534:T2023S;ENSP00000377697:T1881S	ENSP00000287534:T2023S	T	+	2	0	GPR112	135259788	0.032000	0.19561	0.004000	0.12327	0.592000	0.36648	0.067000	0.14510	-0.391000	0.07763	-0.362000	0.07510	ACT		0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			
GPR98	84059	hgsc.bcm.edu;ucsc.edu	37	5	89925092	89925092	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr5:89925092C>G	ENST00000405460.2	+	9	1671	c.1575C>G	c.(1573-1575)aaC>aaG	p.N525K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	525					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTATGGAAAACCAGAAGATTG	0.353																																																	0													77.0	74.0	75.0					5																	89925092		1865	4094	5959	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1575C>G	5.37:g.89925092C>G	ENSP00000384582:p.Asn525Lys	Somatic		WXS	SOLID	Phase_I	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.52|13.52	2.261669|2.261669	0.39995|0.39995	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.35048|.	1.33|.	5.68|5.68	0.47|0.47	0.16747|0.16747	.|.	0.307617|.	0.39834|.	N|.	0.001244|.	T|T	0.59348|0.59348	0.2187|0.2187	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	P|.	0.44627|.	0.839|.	B|.	0.39379|.	0.298|.	T|T	0.52578|0.52578	-0.8557|-0.8557	10|5	0.59425|.	D|.	0.04|.	.|.	10.3457|10.3457	0.43906|0.43906	0.0:0.4604:0.0:0.5396|0.0:0.4604:0.0:0.5396	.|.	525|.	Q8WXG9|.	GPR98_HUMAN|.	K|A	525|114	ENSP00000384582:N525K|.	ENSP00000296619:N525K|.	N|P	+|+	3|1	2|0	GPR98|GPR98	89960848|89960848	0.786000|0.786000	0.28738|0.28738	0.992000|0.992000	0.48379|0.48379	0.999000|0.999000	0.98932|0.98932	-0.111000|-0.111000	0.10807|0.10807	-0.219000|-0.219000	0.10003|0.10003	0.655000|0.655000	0.94253|0.94253	AAC|CCA		0.353	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2		NM_032119	
HAX1	10456	hgsc.bcm.edu;ucsc.edu	37	1	154247938	154247938	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:154247938G>C	ENST00000328703.7	+	6	946	c.733G>C	c.(733-735)Gca>Cca	p.A245P	HAX1_ENST00000532105.1_Missense_Mutation_p.A117P|HAX1_ENST00000483970.2_Missense_Mutation_p.A253P|HAX1_ENST00000457918.2_Missense_Mutation_p.A197P	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	245	Involved in ATP2A2 binding.|Involved in GNA13 binding.|Involved in HCLS1 binding.|Involved in PKD2 binding.|Required for localization in sarcoplasmic reticulum. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCGACACGAAGCAGATAGCAG	0.502									Kostmann syndrome																																								0													134.0	140.0	138.0					1																	154247938		2203	4300	6503	SO:0001583	missense	10456	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.733G>C	1.37:g.154247938G>C	ENSP00000329002:p.Ala245Pro	Somatic		WXS	SOLID	Phase_I	A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	ENST00000328703.7	37	CCDS1064.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532569	0.85812	.	.	ENSG00000143575	ENST00000328703;ENST00000457918;ENST00000483970;ENST00000435087;ENST00000532105	T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55	5.13	3.24	0.37175	.	0.295351	0.31102	N	0.008249	T	0.71005	0.3289	M	0.76002	2.32	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.992;0.999	T	0.62666	-0.6806	10	0.38643	T	0.18	-1.5588	7.7283	0.28773	0.0892:0.1649:0.7459:0.0	.	253;219;197;245	O00165-2;O00165-3;O00165-5;O00165	.;.;.;HAX1_HUMAN	P	245;197;253;249;117	ENSP00000329002:A245P;ENSP00000411448:A197P;ENSP00000435088:A253P;ENSP00000394920:A249P;ENSP00000433951:A117P	ENSP00000329002:A245P	A	+	1	0	HAX1	152514562	0.850000	0.29656	0.008000	0.14137	0.535000	0.34838	2.097000	0.41748	0.539000	0.28788	0.563000	0.77884	GCA		0.502	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087650.1		NM_006118	
HDAC6	10013	hgsc.bcm.edu	37	X	48681739	48681739	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chrX:48681739G>A	ENST00000334136.5	+	25	3108	c.2930G>A	c.(2929-2931)gGc>gAc	p.G977D	HDAC6_ENST00000376619.2_Missense_Mutation_p.G977D|HDAC6_ENST00000444343.2_Missense_Mutation_p.G991D			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	977					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GCCACGCTGGGCCAGACTACC	0.637																																					Pancreas(112;205 1675 2305 8976 15959)												0													26.0	25.0	25.0					X																	48681739		2194	4296	6490	SO:0001583	missense	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2930G>A	X.37:g.48681739G>A	ENSP00000334061:p.Gly977Asp	Somatic		WXS	SOLID	Phase_I	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067421	0.36470	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	T;T;T	0.56103	0.48;0.49;0.49	4.17	-4.84	0.03151	.	.	.	.	.	T	0.21509	0.0518	N	0.03608	-0.345	0.09310	N	0.999991	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.31194	-0.9952	9	0.10636	T	0.68	.	8.3513	0.32303	0.231:0.0:0.618:0.151	.	967;340;625;977	B4DZN1;B3KY98;B3KVK5;Q9UBN7	.;.;.;HDAC6_HUMAN	D	991;977;977	ENSP00000398566:G991D;ENSP00000334061:G977D;ENSP00000365804:G977D	ENSP00000334061:G977D	G	+	2	0	HDAC6	48566683	0.000000	0.05858	0.000000	0.03702	0.894000	0.52154	-0.797000	0.04570	-1.174000	0.02754	-0.340000	0.08031	GGC		0.637	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2		NM_006044	
HERC2	8924	hgsc.bcm.edu;ucsc.edu	37	15	28414709	28414709	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr15:28414709G>C	ENST00000261609.7	-	66	10258	c.10150C>G	c.(10150-10152)Ctc>Gtc	p.L3384V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AATGACAAGAGAATCTTGGCA	0.418																																																	0													92.0	87.0	88.0					15																	28414709		2203	4300	6503	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10150C>G	15.37:g.28414709G>C	ENSP00000261609:p.Leu3384Val	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	8.975	0.973885	0.18736	.	.	ENSG00000128731	ENST00000261609	T	0.37058	1.22	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.47930	0.1472	L	0.37750	1.13	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.14699	-1.0463	10	0.06236	T	0.91	.	20.0634	0.97698	0.0:0.0:1.0:0.0	.	3384	O95714	HERC2_HUMAN	V	3384	ENSP00000261609:L3384V	ENSP00000261609:L3384V	L	-	1	0	HERC2	26088304	1.000000	0.71417	0.639000	0.29394	0.844000	0.47949	7.639000	0.83342	2.817000	0.96982	0.643000	0.83706	CTC		0.418	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2		NM_004667	
HERC2	8924	hgsc.bcm.edu;ucsc.edu	37	15	28414719	28414719	+	Silent	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr15:28414719A>G	ENST00000261609.7	-	66	10248	c.10140T>C	c.(10138-10140)ctT>ctC	p.L3380L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAATCTTGGCAAGAGAAGGGC	0.418																																																	0													92.0	88.0	89.0					15																	28414719		2203	4300	6503	SO:0001819	synonymous_variant	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10140T>C	15.37:g.28414719A>G		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																				0.418	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2		NM_004667	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32497905	32497905	+	Nonsense_Mutation	SNP	G	G	A	rs71549219	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:32497905G>A	ENST00000374975.3	-	1	159	c.97C>T	c.(97-99)Cga>Tga	p.R33*		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						CACTTACGTCGGGTGTCCCCA	0.532																																																	0													102.0	104.0	103.0					6																	32497905		2203	4300	6503	SO:0001587	stop_gained	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.97C>T	6.37:g.32497905G>A	ENSP00000364114:p.Arg33*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	20.8	4.052468	0.75960	.	.	ENSG00000198502	ENST00000374975	.	.	.	4.54	-1.14	0.09741	.	2.794840	0.01443	N	0.015168	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6489	0.12585	0.4628:0.1756:0.3616:0.0	.	.	.	.	X	33	.	ENSP00000364114:R33X	R	-	1	2	HLA-DRB5	32605883	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.309000	0.08145	-0.500000	0.06614	0.485000	0.47835	CGA		0.532	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2		NM_002125	
RP3-470B24.5	0	hgsc.bcm.edu	37	6	168376847	168376847	+	lincRNA	SNP	C	C	G	rs77867907		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:168376847C>G	ENST00000538528.1	-	0	772																											GTGTGGGGAGCAGGAGGCAGT	0.617																																																	0													32.0	30.0	30.0					6																	168376847		692	1591	2283			100128124																															6.37:g.168376847C>G		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000538528.1	37																																																																																					0.617	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
HMCN1	83872	hgsc.bcm.edu	37	1	185704113	185704113	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:185704113G>C	ENST00000271588.4	+	1	431	c.202G>C	c.(202-204)Gag>Cag	p.E68Q	HMCN1_ENST00000367492.2_Missense_Mutation_p.E68Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	68	VWFA.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAAAATTTTGGAGACGTCTTT	0.413																																																	0													109.0	114.0	113.0					1																	185704113		2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.202G>C	1.37:g.185704113G>C	ENSP00000271588:p.Glu68Gln	Somatic		WXS	SOLID	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171751	0.94807	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.13089	2.62;2.62	5.7	5.7	0.88788	von Willebrand factor, type A (1);	0.000000	0.64402	D	0.000003	T	0.27489	0.0675	N	0.21324	0.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.02975	-1.1087	10	0.72032	D	0.01	.	19.4334	0.94781	0.0:0.0:1.0:0.0	.	68	Q96RW7	HMCN1_HUMAN	Q	68	ENSP00000271588:E68Q;ENSP00000356462:E68Q	ENSP00000271588:E68Q	E	+	1	0	HMCN1	183970736	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.638000	0.98445	2.683000	0.91414	0.650000	0.86243	GAG		0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
LGALSL	29094	hgsc.bcm.edu;ucsc.edu	37	2	64682738	64682738	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:64682738G>T	ENST00000238875.5	+	3	578	c.124G>T	c.(124-126)Ggg>Tgg	p.G42W	AC008074.3_ENST00000441630.1_RNA|LGALSL_ENST00000409537.2_Missense_Mutation_p.G42W	NM_014181.2	NP_054900.2	Q3ZCW2	LEGL_HUMAN	lectin, galactoside-binding-like	42	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.					intracellular (GO:0005622)	carbohydrate binding (GO:0030246)										TCCATTTTGTGGGCACATTAA	0.483																																																	0													119.0	107.0	111.0					2																	64682738		2203	4300	6503	SO:0001583	missense	0			AF161508	CCDS1877.1	2p14	2011-08-15			ENSG00000119862	ENSG00000119862			25012	protein-coding gene	gene with protein product	"""galectin-related protein"""					11042152, 16682780	Standard	NM_014181		Approved	HSPC159, GRP	uc002scy.4	Q3ZCW2	OTTHUMG00000129541	ENST00000238875.5:c.124G>T	2.37:g.64682738G>T	ENSP00000238875:p.Gly42Trp	Somatic		WXS	SOLID	Phase_I	B2RBG8|D6W5E8|Q6P5T6|Q9P005	Missense_Mutation	SNP	ENST00000238875.5	37	CCDS1877.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.441791	0.83993	.	.	ENSG00000119862	ENST00000238875;ENST00000409537	D;D	0.97161	-4.27;-4.27	4.91	4.91	0.64330	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (3);Concanavalin A-like lectin/glucanase, subgroup (1);	0.098116	0.64402	D	0.000001	D	0.98664	0.9552	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99835	1.1057	10	0.87932	D	0	-13.4538	18.0998	0.89503	0.0:0.0:1.0:0.0	.	42	Q3ZCW2	LEGL_HUMAN	W	42	ENSP00000238875:G42W;ENSP00000386242:G42W	ENSP00000238875:G42W	G	+	1	0	AC008074.1	64536242	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.072000	0.93986	2.267000	0.75376	0.561000	0.74099	GGG		0.483	LGALSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251731.2		NM_014181	
ITPKB	3707	hgsc.bcm.edu	37	1	226924364	226924364	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:226924364G>A	ENST00000272117.3	-	1	795	c.796C>T	c.(796-798)Cgc>Tgc	p.R266C	ITPKB_ENST00000366784.1_Missense_Mutation_p.R266C|ITPKB_ENST00000429204.1_Missense_Mutation_p.R266C			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	266					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GAGCCACAGCGGGGACTGGCA	0.602																																					Colon(84;110 1851 5306 33547)												0													47.0	48.0	48.0					1																	226924364		2203	4299	6502	SO:0001583	missense	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.796C>T	1.37:g.226924364G>A	ENSP00000272117:p.Arg266Cys	Somatic		WXS	SOLID	Phase_I	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	g	8.979	0.974860	0.18736	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.28454	1.67;1.67;1.61	4.27	0.0109	0.14085	.	1.620900	0.03342	N	0.194925	T	0.17066	0.0410	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26087	-1.0113	10	0.54805	T	0.06	.	5.4736	0.16684	0.2722:0.1474:0.5804:0.0	.	266	P27987	IP3KB_HUMAN	C	266	ENSP00000272117:R266C;ENSP00000411152:R266C;ENSP00000355748:R266C	ENSP00000272117:R266C	R	-	1	0	ITPKB	224990987	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.190000	0.32126	0.203000	0.20529	-0.993000	0.02533	CGC		0.602	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1		NM_002221	
ITPR3	3710	hgsc.bcm.edu	37	6	33662730	33662730	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:33662730G>A	ENST00000374316.5	+	58	8875	c.7815G>A	c.(7813-7815)atG>atA	p.M2605I	ITPR3_ENST00000605930.1_Missense_Mutation_p.M2605I			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2605					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCCCCCGGATGCGGGCCATGT	0.547																																																	0													66.0	60.0	62.0					6																	33662730		2203	4300	6503	SO:0001583	missense	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7815G>A	6.37:g.33662730G>A	ENSP00000363435:p.Met2605Ile	Somatic		WXS	SOLID	Phase_I	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	36	5.639387	0.96693	.	.	ENSG00000096433	ENST00000374316	T	0.43294	0.95	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	M	0.86573	2.825	0.80722	D	1	D	0.57571	0.98	D	0.63192	0.912	T	0.69928	-0.5012	10	0.72032	D	0.01	-53.1273	19.7706	0.96363	0.0:0.0:1.0:0.0	.	2605	Q14573	ITPR3_HUMAN	I	2605	ENSP00000363435:M2605I	ENSP00000363435:M2605I	M	+	3	0	ITPR3	33770708	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.697000	0.92050	0.655000	0.94253	ATG		0.547	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2		NM_002224	
LEO1	123169	hgsc.bcm.edu	37	15	52254683	52254683	+	Silent	SNP	T	T	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr15:52254683T>C	ENST00000299601.5	-	3	882	c.822A>G	c.(820-822)gcA>gcG	p.A274A	LEO1_ENST00000315141.5_Silent_p.A274A	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	274	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		CACTGCCTCTTGCAGATTCTA	0.363																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0													68.0	62.0	64.0					15																	52254683		2195	4293	6488	SO:0001819	synonymous_variant	123169			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.822A>G	15.37:g.52254683T>C		Somatic		WXS	SOLID	Phase_I	Q96N99	Silent	SNP	ENST00000299601.5	37	CCDS10146.1																																																																																				0.363	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2		NM_138792	
LRRC34	151827	hgsc.bcm.edu;ucsc.edu	37	3	169514626	169514626	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr3:169514626T>A	ENST00000316515.7	-	7	956	c.680A>T	c.(679-681)cAc>cTc	p.H227L	RP11-362K14.6_ENST00000602835.1_RNA|LRRC34_ENST00000522830.1_Missense_Mutation_p.H211L|LRRC34_ENST00000446859.1_Missense_Mutation_p.H272L|RP11-362K14.7_ENST00000602913.1_RNA|LRRC34_ENST00000524327.1_5'UTR|LRRC34_ENST00000522526.2_Missense_Mutation_p.H240L	NM_153353.4	NP_699184.2	Q8IZ02	LRC34_HUMAN	leucine rich repeat containing 34	227										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)	10	all_cancers(22;4.12e-22)|all_epithelial(15;7.54e-27)|all_lung(20;1.63e-16)|Lung NSC(18;6.92e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			CTTACACATGTGTAGTGCAAC	0.368																																																	0													139.0	121.0	127.0					3																	169514626		2203	4300	6503	SO:0001583	missense	151827			AK095125	CCDS3208.1, CCDS3208.2, CCDS54672.1	3q26.2	2014-03-18			ENSG00000171757	ENSG00000171757			28408	protein-coding gene	gene with protein product						12477932	Standard	NM_153353		Approved	MGC27085	uc003ffy.3	Q8IZ02	OTTHUMG00000164419	ENST00000316515.7:c.680A>T	3.37:g.169514626T>A	ENSP00000326150:p.His227Leu	Somatic		WXS	SOLID	Phase_I	B4DEJ7|E9PBH2|G5E9T7	Missense_Mutation	SNP	ENST00000316515.7	37		.	.	.	.	.	.	.	.	.	.	T	14.98	2.696722	0.48202	.	.	ENSG00000171757	ENST00000446859;ENST00000316515;ENST00000522830;ENST00000522526;ENST00000528597	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.7	5.97	4.82	0.62117	.	0.040228	0.85682	D	0.000000	T	0.70307	0.3209	M	0.90082	3.085	0.58432	D	0.999999	D;D;D;D;D	0.76494	0.958;0.986;0.998;0.999;0.999	P;P;D;D;D	0.83275	0.699;0.741;0.982;0.974;0.996	T	0.72197	-0.4363	10	0.15952	T	0.53	-15.4762	12.104	0.53801	0.0:0.0667:0.0:0.9333	.	259;211;211;272;227	B4DHF2;B3KT77;G3V115;G5E9T7;Q8IZ02	.;.;.;.;LRC34_HUMAN	L	272;227;211;240;21	ENSP00000414635:H272L;ENSP00000326150:H227L;ENSP00000429593:H211L;ENSP00000429278:H240L;ENSP00000436883:H21L	ENSP00000326150:H227L	H	-	2	0	LRRC34	170997320	1.000000	0.71417	0.068000	0.19968	0.005000	0.04900	4.687000	0.61708	1.103000	0.41568	0.524000	0.50904	CAC		0.368	LRRC34-201	KNOWN	basic	protein_coding	protein_coding			NM_153353	
MAP4K4	9448	hgsc.bcm.edu;ucsc.edu	37	2	102490653	102490653	+	Silent	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:102490653C>A	ENST00000347699.4	+	23	2745	c.2745C>A	c.(2743-2745)acC>acA	p.T915T	MAP4K4_ENST00000425019.1_Silent_p.T948T|MAP4K4_ENST00000413150.2_Silent_p.T830T|MAP4K4_ENST00000456652.1_Silent_p.T714T|MAP4K4_ENST00000350878.4_Silent_p.T955T|MAP4K4_ENST00000324219.4_Silent_p.T996T|MAP4K4_ENST00000302217.5_Silent_p.T718T|MAP4K4_ENST00000350198.4_Silent_p.T834T	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	915	Mediates interaction with RAP2A.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AGAGTGACACCCCGGAGATTC	0.478																																																	0													117.0	115.0	116.0					2																	102490653		1939	4140	6079	SO:0001819	synonymous_variant	9448			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2745C>A	2.37:g.102490653C>A		Somatic		WXS	SOLID	Phase_I	O75172|Q9NST7	Silent	SNP	ENST00000347699.4	37	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	C	9.140	1.013706	0.19277	.	.	ENSG00000071054	ENST00000421882	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	T	0.58366	0.2117	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56992	-0.7887	4	.	.	.	.	8.0178	0.30391	0.2765:0.649:0.0:0.0745	.	.	.	.	T	732	.	.	P	+	1	0	MAP4K4	101857085	0.888000	0.30383	1.000000	0.80357	0.994000	0.84299	-0.088000	0.11198	2.551000	0.86045	0.655000	0.94253	CCC		0.478	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1		NM_004834	
MCM6	4175	hgsc.bcm.edu	37	2	136626383	136626383	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:136626383C>A	ENST00000264156.2	-	4	473	c.413G>T	c.(412-414)aGt>aTt	p.S138I		NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	138					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CACCTGCCCACTGATGCGAGT	0.473																																					Ovarian(196;141 2104 8848 24991 25939)												0													113.0	106.0	109.0					2																	136626383		2203	4300	6503	SO:0001583	missense	4175				CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.413G>T	2.37:g.136626383C>A	ENSP00000264156:p.Ser138Ile	Somatic		WXS	SOLID	Phase_I	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	37	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958286	0.92726	.	.	ENSG00000076003	ENST00000264156	T	0.13089	2.62	5.63	4.75	0.60458	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.035719	0.85682	D	0.000000	T	0.36358	0.0964	M	0.90977	3.165	0.80722	D	1	P	0.47034	0.889	P	0.49561	0.615	T	0.51332	-0.8719	10	0.54805	T	0.06	-17.3369	16.6586	0.85235	0.0:0.8702:0.1298:0.0	.	138	Q14566	MCM6_HUMAN	I	138	ENSP00000264156:S138I	ENSP00000264156:S138I	S	-	2	0	MCM6	136342853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.666000	0.83877	1.365000	0.46057	0.557000	0.71058	AGT		0.473	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1		NM_005915	
MARS2	92935	hgsc.bcm.edu	37	2	198571042	198571042	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:198571042T>G	ENST00000282276.6	+	1	956	c.913T>G	c.(913-915)Tct>Gct	p.S305A	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	305					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	GCCGGCCACCTCTCATATCAT	0.517																																																	0													79.0	83.0	82.0					2																	198571042		2203	4300	6503	SO:0001583	missense	92935			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.913T>G	2.37:g.198571042T>G	ENSP00000282276:p.Ser305Ala	Somatic		WXS	SOLID	Phase_I	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	CCDS33358.1	.	.	.	.	.	.	.	.	.	.	T	7.522	0.656864	0.14580	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.44482	0.92	5.26	2.42	0.29668	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.379769	0.28821	N	0.014035	T	0.12178	0.0296	N	0.01122	-1.005	0.21220	N	0.99975	B	0.11235	0.004	B	0.09377	0.004	T	0.11743	-1.0575	10	0.41790	T	0.15	-1.4985	1.9816	0.03427	0.1609:0.0992:0.166:0.5739	.	305	Q96GW9	SYMM_HUMAN	A	305;232	ENSP00000282276:S305A	ENSP00000282276:S305A	S	+	1	0	MARS2	198279287	0.990000	0.36364	0.821000	0.32701	0.996000	0.88848	2.450000	0.44943	0.798000	0.33994	0.533000	0.62120	TCT		0.517	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1		NM_138395	
MED17	9440	hgsc.bcm.edu	37	11	93526948	93526948	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:93526948A>C	ENST00000251871.3	+	4	979	c.692A>C	c.(691-693)gAt>gCt	p.D231A		NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	231					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACAGATCTCGATCTGGATAAA	0.303																																																	0													72.0	74.0	73.0					11																	93526948		2201	4296	6497	SO:0001583	missense	9440			AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.692A>C	11.37:g.93526948A>C	ENSP00000251871:p.Asp231Ala	Somatic		WXS	SOLID	Phase_I	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	37	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.906367	0.72868	.	.	ENSG00000042429	ENST00000251871;ENST00000427225;ENST00000528786	T;T	0.55234	0.53;0.53	5.47	5.47	0.80525	.	0.044267	0.85682	D	0.000000	T	0.66346	0.2780	M	0.61703	1.905	0.80722	D	1	D	0.61697	0.99	D	0.65684	0.937	T	0.62229	-0.6898	10	0.16896	T	0.51	-24.2179	15.554	0.76177	1.0:0.0:0.0:0.0	.	231	Q9NVC6	MED17_HUMAN	A	231;201;123	ENSP00000251871:D231A;ENSP00000433626:D123A	ENSP00000251871:D231A	D	+	2	0	MED17	93166596	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	9.221000	0.95188	2.095000	0.63458	0.533000	0.62120	GAT		0.303	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2		NM_004268	
MUC16	94025	hgsc.bcm.edu;ucsc.edu	37	19	9087220	9087220	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:9087220A>G	ENST00000397910.4	-	1	4798	c.4595T>C	c.(4594-4596)tTa>tCa	p.L1532S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1532	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACAGTTGTTAAGTCCCCAGT	0.473																																																	0													328.0	306.0	313.0					19																	9087220		2034	4193	6227	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4595T>C	19.37:g.9087220A>G	ENSP00000381008:p.Leu1532Ser	Somatic		WXS	SOLID	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	1.054	-0.675028	0.03378	.	.	ENSG00000181143	ENST00000397910	T	0.03181	4.02	0.821	-0.475	0.12104	.	.	.	.	.	T	0.02083	0.0065	N	0.08118	0	.	.	.	D	0.55172	0.97	B	0.43680	0.427	T	0.43376	-0.9395	8	0.87932	D	0	.	2.7312	0.05227	0.5768:0.0:0.0:0.4232	.	1532	B5ME49	.	S	1532	ENSP00000381008:L1532S	ENSP00000381008:L1532S	L	-	2	0	MUC16	8948220	0.001000	0.12720	0.057000	0.19452	0.085000	0.17905	-0.371000	0.07513	-0.250000	0.09555	0.260000	0.18958	TTA		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MUC6	4588	hgsc.bcm.edu	37	11	1018289	1018289	+	Silent	SNP	C	C	T	rs77222781		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:1018289C>T	ENST00000421673.2	-	31	4562	c.4512G>A	c.(4510-4512)ccG>ccA	p.P1504P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1504	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CACTGGTGGTCGGCGTTATTG	0.562																																																	0													245.0	262.0	256.0					11																	1018289		2172	4275	6447	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4512G>A	11.37:g.1018289C>T		Somatic		WXS	SOLID	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2		XM_290540	
NBPF3	84224	hgsc.bcm.edu	37	1	21798206	21798206	+	Silent	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:21798206A>G	ENST00000318249.5	+	5	941	c.591A>G	c.(589-591)ggA>ggG	p.G197G	NBPF3_ENST00000342104.5_Silent_p.G197G|NBPF3_ENST00000318220.6_Silent_p.G141G|NBPF3_ENST00000454000.2_Silent_p.G127G	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	197						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ACTCCCAGGGACGGGACCTCC	0.592																																																	0													80.0	89.0	86.0					1																	21798206		2203	4300	6503	SO:0001819	synonymous_variant	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.591A>G	1.37:g.21798206A>G		Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	37	CCDS216.1																																																																																				0.592	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NBPF3	84224	hgsc.bcm.edu	37	1	21808128	21808128	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:21808128A>T	ENST00000318249.5	+	13	1822	c.1472A>T	c.(1471-1473)gAc>gTc	p.D491V	NBPF3_ENST00000342104.5_Missense_Mutation_p.D479V|NBPF3_ENST00000318220.6_Missense_Mutation_p.D435V|NBPF3_ENST00000454000.2_Missense_Mutation_p.D421V	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	491	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAGCCTGAGGACTTGCAGGAC	0.488																																																	0													62.0	73.0	70.0					1																	21808128		2202	4298	6500	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1472A>T	1.37:g.21808128A>T	ENSP00000316782:p.Asp491Val	Somatic		WXS	SOLID	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.636860	0.00007	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.02103	4.45;4.45;4.45;4.45;4.45	0.766	-1.53	0.08611	DUF1220 (2);	.	.	.	.	T	0.00468	0.0015	N	0.00102	-2.13	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.36817	-0.9732	9	0.02654	T	1	.	2.1133	0.03708	0.2551:0.3586:0.0:0.3863	.	421;479;491	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	V	421;435;491;479;435	ENSP00000415711:D421V;ENSP00000316739:D435V;ENSP00000316782:D491V;ENSP00000340336:D479V;ENSP00000391865:D435V	ENSP00000316739:D435V	D	+	2	0	NBPF3	21680715	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.375000	0.07475	-1.691000	0.01430	-2.159000	0.00328	GAC		0.488	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
OR2J2	26707	hgsc.bcm.edu;ucsc.edu	37	6	29141432	29141433	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:29141432_29141433insA	ENST00000377167.2	+	1	122_123	c.20_21insA	c.(19-24)gcaagtfs	p.S8fs		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						AAAAAAAATGCAAGTTCGGAAG	0.361																																																	0																																										SO:0001589	frameshift_variant	26707				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.22dupA	6.37:g.29141434_29141434dupA	ENSP00000366372:p.Ser8fs	Somatic		WXS	SOLID	Phase_I	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Frame_Shift_Ins	INS	ENST00000377167.2	37	CCDS43434.1																																																																																				0.361	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			
OR2M7	391196	hgsc.bcm.edu	37	1	248487282	248487282	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:248487282C>T	ENST00000317965.2	-	1	617	c.589G>A	c.(589-591)Gag>Aag	p.E197K		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AAAATAACCTCTTCAAATATT	0.423																																																	0													238.0	234.0	235.0					1																	248487282		2203	4297	6500	SO:0001583	missense	391196			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.589G>A	1.37:g.248487282C>T	ENSP00000324557:p.Glu197Lys	Somatic		WXS	SOLID	Phase_I	B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	0.610	-0.825308	0.02755	.	.	ENSG00000177186	ENST00000317965	T	0.00099	8.73	1.55	-3.11	0.05299	GPCR, rhodopsin-like superfamily (1);	1.250850	0.06236	U	0.689496	T	0.00073	0.0002	N	0.05078	-0.115	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.01480	-1.1344	10	0.17832	T	0.49	.	4.9652	0.14087	0.0:0.408:0.1607:0.4313	.	197	Q8NG81	OR2M7_HUMAN	K	197	ENSP00000324557:E197K	ENSP00000324557:E197K	E	-	1	0	OR2M7	246553905	0.000000	0.05858	0.011000	0.14972	0.108000	0.19459	-0.373000	0.07494	-1.025000	0.03334	-1.050000	0.02344	GAG		0.423	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1		NM_001004691	
OR2T35	403244	hgsc.bcm.edu	37	1	248801633	248801633	+	Silent	SNP	A	A	G	rs74901534	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:248801633A>G	ENST00000317450.3	-	1	926	c.927T>C	c.(925-927)ggT>ggC	p.G309G		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTGGGAGGAACCACATCTCC	0.542																																																	0													14.0	5.0	8.0					1																	248801633		1962	2871	4833	SO:0001819	synonymous_variant	403244			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.927T>C	1.37:g.248801633A>G		Somatic		WXS	SOLID	Phase_I	Q6IEY7	Silent	SNP	ENST00000317450.3	37	CCDS31123.1																																																																																				0.542	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097130.1		NM_001001827	
PABPC1	26986	hgsc.bcm.edu	37	8	101730043	101730043	+	Missense_Mutation	SNP	G	G	C	rs113614781	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr8:101730043G>C	ENST00000318607.5	-	3	1589	c.461C>G	c.(460-462)gCt>gGt	p.A154G	PABPC1_ENST00000519596.1_5'Flank|PABPC1_ENST00000519004.1_Missense_Mutation_p.A109G|PABPC1_ENST00000522387.1_Missense_Mutation_p.A122G	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	154	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TTTTTCAATAGCTCTTTCAGC	0.328																																																	0													85.0	80.0	82.0					8																	101730043		2203	4300	6503	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.461C>G	8.37:g.101730043G>C	ENSP00000313007:p.Ala154Gly	Somatic		WXS	SOLID	Phase_I	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	35|35|35	5.597741|5.597741|5.597741	0.96602|0.96602|0.96602	.|.|.	.|.|.	ENSG00000070756|ENSG00000070756|ENSG00000070756	ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387|ENST00000519100|ENST00000523555	T;T;T|.|.	0.37915|.|.	1.17;1.17;1.17|.|.	5.18|5.18|5.18	5.18|5.18|5.18	0.71444|0.71444|0.71444	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000007|.|.	D|D|D	0.85243|0.85243|0.85243	0.5652|0.5652|0.5652	M|M|M	0.90082|0.90082|0.90082	3.085|3.085|3.085	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D|.|.	0.89917|.|.	1.0;0.998;0.998|.|.	D;D;D|.|.	0.85130|.|.	0.997;0.972;0.959|.|.	D|D|D	0.87829|0.87829|0.87829	0.2643|0.2643|0.2643	10|5|5	0.87932|.|.	D|.|.	0|.|.	.|.|.	19.0658|19.0658|19.0658	0.93110|0.93110|0.93110	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	122;154;154|.|.	E7ERJ7;B3KT93;P11940|.|.	.;.;PABP1_HUMAN|.|.	G|V|R	154;154;109;122|26|100	ENSP00000313007:A154G;ENSP00000429594:A109G;ENSP00000429395:A122G|.|.	ENSP00000313007:A154G|.|.	A|L|S	-|-|-	2|1|3	0|2|2	PABPC1|PABPC1|PABPC1	101799219|101799219|101799219	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.996000|0.996000|0.996000	0.88848|0.88848|0.88848	8.005000|8.005000|8.005000	0.88553|0.88553|0.88553	2.580000|2.580000|2.580000	0.87095|0.87095|0.87095	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GCT|CTA|AGC		0.328	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52584502	52584502	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr3:52584502A>G	ENST00000296302.7	-	29	4833	c.4832T>C	c.(4831-4833)cTg>cCg	p.L1611P	RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000394830.3_Missense_Mutation_p.L1504P|PBRM1_ENST00000409114.3_Missense_Mutation_p.L1574P|PBRM1_ENST00000409057.1_Missense_Mutation_p.L1556P|PBRM1_ENST00000356770.4_Missense_Mutation_p.L1524P|PBRM1_ENST00000409767.1_Missense_Mutation_p.L1519P|PBRM1_ENST00000410007.1_Missense_Mutation_p.L1531P|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000337303.4_Missense_Mutation_p.L1504P			Q86U86	PB1_HUMAN	polybromo 1	1611					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AATGTATTTCAGGTAGGCCTC	0.502			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													72.0	72.0	72.0					3																	52584502		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4832T>C	3.37:g.52584502A>G	ENSP00000296302:p.Leu1611Pro	Somatic		WXS	SOLID	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	A	18.39	3.612900	0.66672	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767	T;T;T;T;T;T;T;T	0.56275	0.49;0.5;0.59;0.56;0.47;0.49;1.07;0.56	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	T	0.72187	0.3429	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;0.998;0.999;0.999	D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999;0.995;0.998;0.998	T	0.75557	-0.3276	10	0.87932	D	0	-7.3077	15.9958	0.80243	1.0:0.0:0.0:0.0	.	1531;1504;1556;1574;1519;1611;1524;1504	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	P	1524;1504;1611;1504;1556;1531;1574;1519	ENSP00000349213:L1524P;ENSP00000378307:L1504P;ENSP00000296302:L1611P;ENSP00000338302:L1504P;ENSP00000386593:L1556P;ENSP00000386529:L1531P;ENSP00000386643:L1574P;ENSP00000386601:L1519P	ENSP00000296302:L1611P	L	-	2	0	PBRM1	52559542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.188000	0.69820	0.533000	0.62120	CTG		0.502	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PDPR	55066	hgsc.bcm.edu	37	16	70172890	70172890	+	Missense_Mutation	SNP	C	C	T	rs112617700		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr16:70172890C>T	ENST00000288050.4	+	11	2236	c.1279C>T	c.(1279-1281)Cgc>Tgc	p.R427C	PDPR_ENST00000398122.3_Missense_Mutation_p.R327C|PDPR_ENST00000568530.1_Missense_Mutation_p.R427C|PDPR_ENST00000562100.1_3'UTR	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	427					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.R427C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCAGAGCAGCCGCACCTTTCT	0.512																																																	1	Substitution - Missense(1)	stomach(1)											20.0	21.0	21.0					16																	70172890		1801	4043	5844	SO:0001583	missense	55066				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1279C>T	16.37:g.70172890C>T	ENSP00000288050:p.Arg427Cys	Somatic		WXS	SOLID	Phase_I	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	CCDS45520.1	287	0.13141025641025642	69	0.1402439024390244	43	0.11878453038674033	51	0.08916083916083917	124	0.16358839050131926	C	29.1	4.978510	0.92982	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055	D;D	0.85773	-2.03;-2.03	4.42	4.42	0.53409	.	0.119515	0.64402	D	0.000017	T	0.03136	0.0092	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	1.0;0.998	P;P	0.56216	0.794;0.676	T	0.26087	-1.0113	10	0.72032	D	0.01	.	16.0044	0.80349	0.0:1.0:0.0:0.0	.	155;427	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	C	427;327;155	ENSP00000288050:R427C;ENSP00000381190:R327C	ENSP00000205055:R155C	R	+	1	0	PDPR	68730391	1.000000	0.71417	0.996000	0.52242	0.954000	0.61252	7.645000	0.83430	1.985000	0.57927	0.455000	0.32223	CGC		0.512	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1		NM_017990	
POLR3A	11128	hgsc.bcm.edu;ucsc.edu	37	10	79761970	79761970	+	Missense_Mutation	SNP	G	G	T	rs137961403		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr10:79761970G>T	ENST00000372371.3	-	17	2481	c.2344C>A	c.(2344-2346)Ctg>Atg	p.L782M		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	782					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GAGCCGCACAGAGCCATGGTG	0.587																																																	0													74.0	60.0	64.0					10																	79761970		2203	4297	6500	SO:0001583	missense	11128			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2344C>A	10.37:g.79761970G>T	ENSP00000361446:p.Leu782Met	Somatic		WXS	SOLID	Phase_I	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600641	0.66332	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.77489	-1.1	5.49	2.44	0.29823	RNA polymerase Rpb1, domain 4 (1);	0.067303	0.64402	D	0.000009	D	0.83603	0.5290	M	0.73753	2.245	0.58432	D	0.999998	D	0.60575	0.988	D	0.63703	0.917	T	0.82016	-0.0666	9	.	.	.	-17.2577	8.4632	0.32940	0.1401:0.1275:0.7324:0.0	.	782	O14802	RPC1_HUMAN	M	782	ENSP00000361446:L782M	.	L	-	1	2	POLR3A	79431976	1.000000	0.71417	0.859000	0.33776	0.986000	0.74619	6.027000	0.70881	0.797000	0.33971	0.655000	0.94253	CTG		0.587	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1		NM_007055	
POTED	317754	hgsc.bcm.edu	37	21	14987811	14987811	+	Missense_Mutation	SNP	C	C	T	rs56121372	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr21:14987811C>T	ENST00000299443.5	+	3	782	c.730C>T	c.(730-732)Cac>Tac	p.H244Y		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	244						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						TACCGCTCTACACTATGCTAT	0.378																																																	0																																										SO:0001583	missense	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.730C>T	21.37:g.14987811C>T	ENSP00000299443:p.His244Tyr	Somatic		WXS	SOLID	Phase_I	C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079600	0.36662	.	.	ENSG00000166351	ENST00000299443	T	0.79247	-1.25	1.4	1.4	0.22301	Ankyrin repeat-containing domain (3);	0.000000	0.49916	D	0.000133	D	0.84133	0.5405	M	0.83692	2.655	0.35193	D	0.77354	D	0.56287	0.975	D	0.63283	0.913	D	0.85907	0.1438	10	0.66056	D	0.02	.	6.2468	0.20823	0.0:1.0:0.0:0.0	rs56121372	244	Q86YR6	POTED_HUMAN	Y	244	ENSP00000299443:H244Y	ENSP00000299443:H244Y	H	+	1	0	POTED	13909682	0.996000	0.38824	0.237000	0.24090	0.033000	0.12548	4.427000	0.59888	1.081000	0.41110	0.184000	0.17185	CAC		0.378	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1		NM_174981	
POTEG	404785	hgsc.bcm.edu	37	14	19553436	19553436	+	Missense_Mutation	SNP	C	C	T	rs28406802	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr14:19553436C>T	ENST00000409832.3	+	1	72	c.20C>T	c.(19-21)tCa>tTa	p.S7L		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	7										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GAGGCTGGTTCAATGCCGGCT	0.577													C|||	1260	0.251597	0.2678	0.2781	5008	,	,		34012	0.2371		0.2137	False		,,,				2504	0.2648																0													2.0	3.0	2.0					14																	19553436		578	1600	2178	SO:0001583	missense	404785				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.20C>T	14.37:g.19553436C>T	ENSP00000386971:p.Ser7Leu	Somatic		WXS	SOLID	Phase_I	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	c	11.05	1.524203	0.27299	.	.	ENSG00000222036	ENST00000409832	T	0.34275	1.37	0.436	0.436	0.16549	.	.	.	.	.	T	0.35770	0.0943	N	0.24115	0.695	0.09310	N	1	D	0.59767	0.986	P	0.58210	0.835	T	0.19418	-1.0306	8	0.87932	D	0	.	.	.	.	.	7	Q6S5H5	POTEG_HUMAN	L	7	ENSP00000386971:S7L	ENSP00000386971:S7L	S	+	2	0	POTEG	18623436	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.949000	0.03893	0.465000	0.27167	0.165000	0.16767	TCA		0.577	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1		NM_001005356	
PRSS1	5644	hgsc.bcm.edu	37	7	142457343	142457343	+	Missense_Mutation	SNP	C	C	T	rs374597855		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr7:142457343C>T	ENST00000311737.7	+	1	14	c.8C>T	c.(7-9)cCa>cTa	p.P3L	PRSS1_ENST00000486171.1_Missense_Mutation_p.P3L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	3					cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	ACCATGAATCCACTCCTGATC	0.572																																																	0													232.0	165.0	188.0					7																	142457343		2203	4300	6503	SO:0001583	missense	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.8C>T	7.37:g.142457343C>T	ENSP00000308720:p.Pro3Leu	Somatic		WXS	SOLID	Phase_I	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.759626	0.00657	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.88046	-2.33;-2.32	3.32	2.43	0.29744	.	0.646181	0.15525	U	0.257821	T	0.71863	0.3390	N	0.13168	0.305	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.10450	0.005;0.001	T	0.54302	-0.8314	10	0.10902	T	0.67	.	7.2033	0.25893	0.0:0.7761:0.0:0.2238	.	3;3	B4DDX6;P07477	.;TRY1_HUMAN	L	3	ENSP00000417854:P3L;ENSP00000308720:P3L	ENSP00000308720:P3L	P	+	2	0	PRSS1	142136917	0.001000	0.12720	0.080000	0.20451	0.047000	0.14425	1.171000	0.31896	0.690000	0.31570	-0.531000	0.04308	CCA		0.572	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			
PRSS1	5644	hgsc.bcm.edu	37	7	142457347	142457347	+	Silent	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr7:142457347C>T	ENST00000311737.7	+	1	18	c.12C>T	c.(10-12)ctC>ctT	p.L4L	PRSS1_ENST00000486171.1_Silent_p.L4L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	4				L -> F (in Ref. 7; AAI28227). {ECO:0000305}.	cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.L4L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TGAATCCACTCCTGATCCTTA	0.562																																																	1	Substitution - coding silent(1)	lung(1)											228.0	163.0	185.0					7																	142457347		2203	4300	6503	SO:0001819	synonymous_variant	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.12C>T	7.37:g.142457347C>T		Somatic		WXS	SOLID	Phase_I	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																				0.562	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			
PRUNE2	158471	hgsc.bcm.edu	37	9	79318381	79318381	+	Silent	SNP	A	A	T	rs376038487|rs113471142|rs11267615	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr9:79318381A>T	ENST00000376718.3	-	9	8271	c.8148T>A	c.(8146-8148)gcT>gcA	p.A2716A	PRUNE2_ENST00000428286.1_Silent_p.A2357A	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2716					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CATGGGTGACAGCCTGCAACG	0.517																																																	0													77.0	59.0	65.0					9																	79318381		1171	2533	3704	SO:0001819	synonymous_variant	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8148T>A	9.37:g.79318381A>T		Somatic		WXS	SOLID	Phase_I	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	CCDS47982.1	517	0.2367216117216117	87	0.17682926829268292	64	0.17679558011049723	229	0.40034965034965037	137	0.18073878627968337	A	10.34	1.323317	0.24080	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.89	-3.37	0.04898	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47394	-0.9121	4	.	.	.	0.0386	8.1474	0.31119	0.3085:0.5438:0.0655:0.0822	.	.	.	.	S	2038	.	.	C	-	1	0	PRUNE2	78508201	0.025000	0.19082	0.206000	0.23566	0.391000	0.30476	-0.020000	0.12525	-0.420000	0.07427	0.477000	0.44152	TGT		0.517	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2		NM_138818	
PTK2	5747	hgsc.bcm.edu	37	8	141745400	141745400	+	Silent	SNP	G	G	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr8:141745400G>T	ENST00000522684.1	-	22	2209	c.1980C>A	c.(1978-1980)gcC>gcA	p.A660A	PTK2_ENST00000517887.1_Silent_p.A704A|PTK2_ENST00000519465.1_Silent_p.A288A|PTK2_ENST00000395218.2_Silent_p.A660A|PTK2_ENST00000538769.1_Silent_p.A328A|PTK2_ENST00000519419.1_Silent_p.A704A|MIR151A_ENST00000521276.1_RNA|PTK2_ENST00000521059.1_Silent_p.A660A|PTK2_ENST00000340930.3_Silent_p.A660A|PTK2_ENST00000535192.1_Silent_p.A660A	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	660	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TGGGGTCATAGGCCCAGCATT	0.522																																																	0													90.0	73.0	79.0					8																	141745400		2203	4300	6503	SO:0001819	synonymous_variant	5747			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1980C>A	8.37:g.141745400G>T		Somatic		WXS	SOLID	Phase_I	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	ENST00000522684.1	37	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346026	0.24426	.	.	ENSG00000169398	ENST00000519654	.	.	.	5.51	-0.133	0.13485	.	.	.	.	.	T	0.50718	0.1632	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37596	-0.9699	4	.	.	.	.	5.4239	0.16415	0.2058:0.0825:0.5834:0.1283	.	.	.	.	I	671	.	.	L	-	1	2	PTK2	141814582	0.895000	0.30542	0.997000	0.53966	0.987000	0.75469	-0.241000	0.08940	0.040000	0.15660	-0.150000	0.13652	CTA		0.522	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5		NM_005607	
PUF60	22827	hgsc.bcm.edu	37	8	144899131	144899131	+	Silent	SNP	C	C	A	rs368018307		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr8:144899131C>A	ENST00000526683.1	-	11	1884	c.1329G>T	c.(1327-1329)tcG>tcT	p.S443S	SCRIB_ENST00000356994.2_5'Flank|PUF60_ENST00000456095.2_Silent_p.S414S|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000349157.6_Silent_p.S426S|SCRIB_ENST00000320476.3_5'Flank|PUF60_ENST00000453551.2_Silent_p.S400S|PUF60_ENST00000527197.1_Silent_p.S397S|PUF60_ENST00000524570.1_5'Flank|PUF60_ENST00000313352.7_Silent_p.S383S	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	443	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CGCTACTGCCCGAGATGCTCA	0.642																																																	0													33.0	31.0	31.0					8																	144899131		2142	4247	6389	SO:0001819	synonymous_variant	22827			AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1329G>T	8.37:g.144899131C>A		Somatic		WXS	SOLID	Phase_I	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	37	CCDS47934.1																																																																																				0.642	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1		NM_014281	
RASSF7	8045	hgsc.bcm.edu	37	11	563219	563219	+	Nonsense_Mutation	SNP	C	C	T	rs139977222		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:563219C>T	ENST00000397583.3	+	4	1286	c.853C>T	c.(853-855)Cga>Tga	p.R285*	C11orf35_ENST00000329451.3_5'Flank|RASSF7_ENST00000344375.4_Nonsense_Mutation_p.R285*|MIR210HG_ENST00000500447.1_lincRNA|RASSF7_ENST00000454668.2_Nonsense_Mutation_p.R285*|RASSF7_ENST00000397582.3_Nonsense_Mutation_p.R285*|RASSF7_ENST00000431809.1_Nonsense_Mutation_p.R285*	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	285					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R285*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAGCTGAACCGAGAGCTCCG	0.662																																					Pancreas(184;1170 3913 7268)												1	Substitution - Nonsense(1)	skin(1)											34.0	37.0	36.0					11																	563219		2203	4298	6501	SO:0001587	stop_gained	8045			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.853C>T	11.37:g.563219C>T	ENSP00000380713:p.Arg285*	Somatic		WXS	SOLID	Phase_I	G5E9N9|Q3KP41|Q3KP42	Nonsense_Mutation	SNP	ENST00000397583.3	37	CCDS7702.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595891	0.86953	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	.	.	.	3.24	0.896	0.19253	.	0.063749	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	4.3404	9.5426	0.39262	0.7015:0.2984:0.0:0.0	.	.	.	.	X	285	.	ENSP00000344226:R285X	R	+	1	2	RASSF7	553219	1.000000	0.71417	0.996000	0.52242	0.469000	0.32828	2.164000	0.42387	0.515000	0.28320	0.462000	0.41574	CGA		0.662	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254972.2		NM_003475	
ROBO3	64221	hgsc.bcm.edu	37	11	124741007	124741007	+	Silent	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr11:124741007C>A	ENST00000397801.1	+	7	1323	c.1131C>A	c.(1129-1131)gcC>gcA	p.A377A	ROBO3_ENST00000538940.1_Silent_p.A355A	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	377	Ig-like C2-type 4.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CCCCACCTGCCATCTTCTGGC	0.622																																																	0													26.0	30.0	29.0					11																	124741007		1949	4134	6083	SO:0001819	synonymous_variant	64221			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1131C>A	11.37:g.124741007C>A		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000397801.1	37	CCDS44755.1																																																																																				0.622	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1		XM_370663	
RRNAD1	51093	hgsc.bcm.edu	37	1	156706497	156706497	+	Silent	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:156706497G>A	ENST00000368216.4	+	8	2010	c.1380G>A	c.(1378-1380)aaG>aaA	p.K460K	RRNAD1_ENST00000476229.1_3'UTR|MRPL24_ENST00000478899.1_5'Flank|RRNAD1_ENST00000481920.1_3'UTR|RRNAD1_ENST00000368218.4_3'UTR	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	460						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						TGGCCACCAAGATGCCCCTGG	0.537																																																	0													79.0	73.0	75.0					1																	156706497		2203	4300	6503	SO:0001819	synonymous_variant	51093			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1380G>A	1.37:g.156706497G>A		Somatic		WXS	SOLID	Phase_I	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Silent	SNP	ENST00000368216.4	37	CCDS1154.1																																																																																				0.537	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1		NM_015997	
RSPH10B	222967	hgsc.bcm.edu	37	7	5972412	5972412	+	Splice_Site	SNP	C	C	G	rs201048235		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr7:5972412C>G	ENST00000405415.1	-	18	2620		c.e18+1		RSPH10B_ENST00000535104.1_Intron|RSPH10B_ENST00000441023.2_Splice_Site|RSPH10B_ENST00000337579.3_Splice_Site|RSPH10B_ENST00000404406.1_Splice_Site|RSPH10B_ENST00000539903.1_Splice_Site			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)											breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		AAAATACTCACTGCTCTCAGA	0.294																																																	0													2.0	1.0	2.0					7																	5972412		916	1839	2755	SO:0001630	splice_region_variant	222967				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.2233+1G>C	7.37:g.5972412C>G		Somatic		WXS	SOLID	Phase_I	A6NMW7|Q86ST9|Q8NE68	Splice_Site	SNP	ENST00000405415.1	37	CCDS34598.1	13	0.005952380952380952	8	0.016260162601626018	0	0.0	0	0.0	5	0.006596306068601583	c	10.25	1.298232	0.23650	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	.	.	.	3.28	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3698	0.44046	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RSPH10B	5938938	0.991000	0.36638	0.568000	0.28447	0.016000	0.09150	2.823000	0.48081	1.880000	0.54463	0.579000	0.79373	.		0.294	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325465.2		NM_173565	Intron
ZBED9	114821	hgsc.bcm.edu	37	6	28543057	28543057	+	Silent	SNP	T	T	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:28543057T>C	ENST00000452236.2	-	3	2042	c.1425A>G	c.(1423-1425)caA>caG	p.Q475Q	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						TATCCTCAGTTTGTTCTGCAG	0.423																																																	0													105.0	106.0	105.0					6																	28543057		2203	4300	6503	SO:0001819	synonymous_variant	114821																														ENST00000452236.2:c.1425A>G	6.37:g.28543057T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000452236.2	37	CCDS34355.1																																																																																				0.423	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			
SESTD1	91404	hgsc.bcm.edu	37	2	179997085	179997085	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:179997085A>C	ENST00000428443.3	-	10	1234	c.918T>G	c.(916-918)atT>atG	p.I306M		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	306							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			GGGAGGCCCTAATGGAGTCTC	0.458																																																	0													173.0	185.0	181.0					2																	179997085		2203	4300	6503	SO:0001583	missense	91404			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.918T>G	2.37:g.179997085A>C	ENSP00000415332:p.Ile306Met	Somatic		WXS	SOLID	Phase_I	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	A	14.35	2.508001	0.44558	.	.	ENSG00000187231	ENST00000428443	T	0.35789	1.29	6.0	-10.5	0.00291	.	0.085529	0.85682	D	0.000000	T	0.12008	0.0292	N	0.03608	-0.345	0.31670	N	0.64452	B	0.18461	0.028	B	0.11329	0.006	T	0.14643	-1.0465	9	.	.	.	-14.8141	17.6689	0.88211	0.1968:0.0:0.7157:0.0875	.	306	Q86VW0	SESD1_HUMAN	M	306	ENSP00000415332:I306M	.	I	-	3	3	SESTD1	179705330	0.001000	0.12720	0.383000	0.26132	0.973000	0.67179	-1.137000	0.03219	-1.972000	0.01001	-0.312000	0.09012	ATT		0.458	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2		NM_178123	
SF3B1	23451	hgsc.bcm.edu;ucsc.edu	37	2	198257042	198257042	+	Silent	SNP	A	A	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:198257042A>C	ENST00000335508.6	-	25	3991	c.3900T>G	c.(3898-3900)ctT>ctG	p.L1300L		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1300					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AGATATAGTCAAGTTCATAAC	0.323			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0													86.0	88.0	87.0					2																	198257042		2203	4300	6503	SO:0001819	synonymous_variant	23451			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3900T>G	2.37:g.198257042A>C		Somatic		WXS	SOLID	Phase_I	E9PCH3	Silent	SNP	ENST00000335508.6	37	CCDS33356.1																																																																																				0.323	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			
SH3RF2	153769	hgsc.bcm.edu;ucsc.edu	37	5	145428752	145428752	+	Silent	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr5:145428752C>T	ENST00000511217.1	+	6	1318	c.1266C>T	c.(1264-1266)tcC>tcT	p.S422S	SH3RF2_ENST00000359120.4_Silent_p.S422S			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	422	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGGCGTCTCCTTGGTCACCG	0.602											OREG0016895	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													69.0	69.0	69.0					5																	145428752		2203	4300	6503	SO:0001819	synonymous_variant	153769			AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1266C>T	5.37:g.145428752C>T		Somatic	1694	WXS	SOLID	Phase_I	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	ENST00000511217.1	37	CCDS4280.1																																																																																				0.602	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1		NM_152550	
SIGLEC7	27036	hgsc.bcm.edu;ucsc.edu	37	19	51645785	51645785	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:51645785C>G	ENST00000317643.6	+	1	228	c.159C>G	c.(157-159)gaC>gaG	p.D53E	SIGLEC7_ENST00000600577.1_Missense_Mutation_p.D53E|SIGLEC7_ENST00000305628.7_Missense_Mutation_p.D53E	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	53	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		ACCCAGTGGACAGCCAGACTG	0.562																																																	0													146.0	109.0	122.0					19																	51645785		2203	4300	6503	SO:0001583	missense	27036			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.159C>G	19.37:g.51645785C>G	ENSP00000323328:p.Asp53Glu	Somatic		WXS	SOLID	Phase_I	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	ENST00000317643.6	37	CCDS12826.1	.	.	.	.	.	.	.	.	.	.	.	1.335	-0.595726	0.03771	.	.	ENSG00000168995	ENST00000317643;ENST00000305628;ENST00000536156	T;T;T	0.21734	1.99;1.99;1.99	2.62	-5.24	0.02789	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	4.519710	0.01195	N	0.007423	T	0.09818	0.0241	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.0;0.002	T	0.21827	-1.0234	10	0.15499	T	0.54	.	3.9911	0.09537	0.1431:0.5652:0.1514:0.1403	.	53;53;53	Q9Y286-4;Q9Y286-2;Q9Y286	.;.;SIGL7_HUMAN	E	53	ENSP00000323328:D53E;ENSP00000306757:D53E;ENSP00000437609:D53E	ENSP00000306757:D53E	D	+	3	2	SIGLEC7	56337597	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.979000	0.01493	-2.534000	0.00489	-0.729000	0.03580	GAC		0.562	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2		NM_016543	
SLC34A2	10568	hgsc.bcm.edu	37	4	25667856	25667856	+	Silent	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr4:25667856C>A	ENST00000382051.3	+	5	536	c.486C>A	c.(484-486)acC>acA	p.T162T	SLC34A2_ENST00000504570.1_Silent_p.T161T|SLC34A2_ENST00000510033.2_3'UTR|SLC34A2_ENST00000503434.1_Silent_p.T161T	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	162					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCTCCAGCACCTCAACGTCCA	0.562			T	ROS1	NSCLC																																			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0													128.0	114.0	118.0					4																	25667856		2203	4300	6503	SO:0001819	synonymous_variant	10568			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.486C>A	4.37:g.25667856C>A		Somatic		WXS	SOLID	Phase_I	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	ENST00000382051.3	37	CCDS3435.1																																																																																				0.562	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1		NM_006424	
SLC39A10	57181	hgsc.bcm.edu;ucsc.edu	37	2	196593015	196593015	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:196593015C>G	ENST00000409086.3	+	9	2554	c.2279C>G	c.(2278-2280)aCa>aGa	p.T760R	SLC39A10_ENST00000541054.1_Missense_Mutation_p.T310R|SLC39A10_ENST00000359634.5_Missense_Mutation_p.T760R	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	760					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AATAACATCACACTTTGGATC	0.408																																																	0													253.0	216.0	229.0					2																	196593015		2203	4300	6503	SO:0001583	missense	57181				CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.2279C>G	2.37:g.196593015C>G	ENSP00000386766:p.Thr760Arg	Somatic		WXS	SOLID	Phase_I	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158092	0.78114	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.50548	0.74;0.74;0.74	5.4	4.53	0.55603	.	0.045219	0.85682	D	0.000000	T	0.57417	0.2052	L	0.52573	1.65	0.80722	D	1	P	0.50819	0.939	P	0.58130	0.833	T	0.56805	-0.7918	10	0.40728	T	0.16	.	14.1635	0.65461	0.0:0.9285:0.0:0.0715	.	760	Q9ULF5	S39AA_HUMAN	R	760;760;310	ENSP00000386766:T760R;ENSP00000352655:T760R;ENSP00000437787:T310R	ENSP00000352655:T760R	T	+	2	0	SLC39A10	196301260	1.000000	0.71417	0.981000	0.43875	0.992000	0.81027	7.604000	0.82830	1.527000	0.49086	0.655000	0.94253	ACA		0.408	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1		XM_047707	
SLFN13	146857	hgsc.bcm.edu;ucsc.edu	37	17	33769171	33769171	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr17:33769171A>G	ENST00000285013.6	-	5	1608	c.1333T>C	c.(1333-1335)Tgg>Cgg	p.W445R	SLFN13_ENST00000534689.1_Missense_Mutation_p.W127R|SLFN13_ENST00000533791.1_Missense_Mutation_p.W445R|SLFN13_ENST00000360502.2_Missense_Mutation_p.W127R|SLFN13_ENST00000526861.1_Missense_Mutation_p.W445R|SLFN13_ENST00000542635.1_Missense_Mutation_p.W445R	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	445						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TCCACAGCCCAGCTTCTAGAG	0.498																																																	0													86.0	78.0	81.0					17																	33769171		2203	4300	6503	SO:0001583	missense	146857			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1333T>C	17.37:g.33769171A>G	ENSP00000285013:p.Trp445Arg	Somatic		WXS	SOLID	Phase_I	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	37	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	a	14.70	2.612589	0.46631	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	T;T;T;T;T;T	0.62941	2.36;1.73;2.36;2.36;1.73;-0.01	3.09	1.95	0.26073	.	0.000000	0.43416	D	0.000564	T	0.76695	0.4023	M	0.86651	2.83	0.30399	N	0.780221	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.99	T	0.72384	-0.4310	10	0.87932	D	0	.	5.3675	0.16121	0.7476:0.0:0.0:0.2524	.	127;445	Q68D06-2;Q68D06	.;SLN13_HUMAN	R	445;127;445;445;127;114	ENSP00000285013:W445R;ENSP00000353692:W127R;ENSP00000434439:W445R;ENSP00000444016:W445R;ENSP00000435442:W127R;ENSP00000435328:W114R	ENSP00000285013:W445R	W	-	1	0	SLFN13	30793284	1.000000	0.71417	0.999000	0.59377	0.869000	0.49853	5.571000	0.67404	0.358000	0.24211	0.172000	0.16884	TGG		0.498	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1		NM_144682	
SNX11	29916	hgsc.bcm.edu	37	17	46190702	46190702	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr17:46190702C>T	ENST00000393405.2	+	5	523	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	SNX11_ENST00000439357.2_Intron|SNX11_ENST00000578861.1_3'UTR|SNX11_ENST00000359238.2_Missense_Mutation_p.R57W|SNX11_ENST00000452859.2_5'UTR|SNX11_ENST00000582104.1_Missense_Mutation_p.R49W|SNX11_ENST00000580219.1_Missense_Mutation_p.R49W	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	57	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						TTCCTGTGTGCGGCGCCGCTA	0.473																																																	0													187.0	182.0	184.0					17																	46190702		2203	4300	6503	SO:0001583	missense	29916			AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.169C>T	17.37:g.46190702C>T	ENSP00000377059:p.Arg57Trp	Somatic		WXS	SOLID	Phase_I	B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	ENST00000393405.2	37	CCDS11526.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451282	0.84209	.	.	ENSG00000002919	ENST00000393405;ENST00000359238	T;T	0.40225	1.04;1.04	5.38	5.38	0.77491	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67070	-0.5763	10	0.87932	D	0	-3.5289	12.948	0.58384	0.1622:0.8378:0.0:0.0	.	49;57	B4DPY5;Q9Y5W9	.;SNX11_HUMAN	W	57	ENSP00000377059:R57W;ENSP00000352175:R57W	ENSP00000352175:R57W	R	+	1	2	SNX11	43545701	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.344000	0.52174	2.529000	0.85273	0.557000	0.71058	CGG		0.473	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443423.1			
SNX9	51429	hgsc.bcm.edu;ucsc.edu	37	6	158330994	158330994	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr6:158330994C>T	ENST00000392185.3	+	9	1057	c.886C>T	c.(886-888)Cgt>Tgt	p.R296C		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	296	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)	p.R296C(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		GTTATATGAGCGTCTCCTGGT	0.413																																																	1	Substitution - Missense(1)	endometrium(1)											212.0	219.0	217.0					6																	158330994		2203	4300	6503	SO:0001583	missense	51429			AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.886C>T	6.37:g.158330994C>T	ENSP00000376024:p.Arg296Cys	Somatic		WXS	SOLID	Phase_I	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	37	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660724	0.88154	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	T	0.42131	0.98	5.56	5.56	0.83823	Phox homologous domain (5);	0.145674	0.64402	D	0.000012	T	0.57446	0.2054	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64651	-0.6357	10	0.87932	D	0	-22.51	19.8818	0.96901	0.0:1.0:0.0:0.0	.	296	Q9Y5X1	SNX9_HUMAN	C	296;296;96	ENSP00000376024:R296C	ENSP00000252631:R96C	R	+	1	0	SNX9	158250982	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	5.738000	0.68613	1.483000	0.48342	-0.150000	0.13652	CGT		0.413	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1			
SPAG17	200162	hgsc.bcm.edu;ucsc.edu	37	1	118658052	118658052	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:118658052C>G	ENST00000336338.5	-	4	393	c.328G>C	c.(328-330)Gca>Cca	p.A110P		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	110						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATTGCTTTTGCTGCCGTTAAC	0.343																																																	0													53.0	58.0	56.0					1																	118658052		2202	4299	6501	SO:0001583	missense	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.328G>C	1.37:g.118658052C>G	ENSP00000337804:p.Ala110Pro	Somatic		WXS	SOLID	Phase_I	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034382	0.75617	.	.	ENSG00000155761	ENST00000336338	T	0.74947	-0.89	5.92	5.02	0.67125	.	0.048946	0.85682	D	0.000000	T	0.80248	0.4588	M	0.72118	2.19	0.35275	D	0.780781	D	0.71674	0.998	D	0.67548	0.952	D	0.84430	0.0576	10	0.72032	D	0.01	.	14.2407	0.65954	0.0:0.9289:0.0:0.0711	.	110	Q6Q759	SPG17_HUMAN	P	110	ENSP00000337804:A110P	ENSP00000337804:A110P	A	-	1	0	SPAG17	118459575	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	3.398000	0.52579	1.522000	0.49001	0.655000	0.94253	GCA		0.343	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1		NM_206996	
SPATS2	65244	hgsc.bcm.edu;ucsc.edu	37	12	49854814	49854814	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr12:49854814C>A	ENST00000553127.1	+	4	532	c.19C>A	c.(19-21)Cag>Aag	p.Q7K	SPATS2_ENST00000321898.6_Missense_Mutation_p.Q7K|SPATS2_ENST00000547865.1_Missense_Mutation_p.Q7K|SPATS2_ENST00000552918.1_Missense_Mutation_p.Q7K			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	7						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						GAAACAGAACCAGAAGGGTAA	0.338																																																	0													103.0	102.0	102.0					12																	49854814		2203	4300	6503	SO:0001583	missense	65244			AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.19C>A	12.37:g.49854814C>A	ENSP00000448228:p.Gln7Lys	Somatic		WXS	SOLID	Phase_I	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	ENST00000553127.1	37	CCDS31794.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887486	0.33348	.	.	ENSG00000123352	ENST00000550997;ENST00000549538;ENST00000548654;ENST00000550643;ENST00000548710;ENST00000548377;ENST00000549298;ENST00000553127;ENST00000321898;ENST00000551540;ENST00000552918;ENST00000548777;ENST00000547865;ENST00000552171	.	.	.	5.85	4.96	0.65561	.	0.325278	0.28241	N	0.016078	T	0.26085	0.0636	N	0.14661	0.345	0.21933	N	0.999465	B	0.16603	0.018	B	0.16722	0.016	T	0.14587	-1.0467	9	0.30854	T	0.27	7.7068	11.0601	0.47942	0.0:0.9147:0.0:0.0853	.	7	Q86XZ4	SPAS2_HUMAN	K	7	.	ENSP00000326841:Q7K	Q	+	1	0	SPATS2	48141081	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	1.988000	0.40697	1.478000	0.48253	0.563000	0.77884	CAG		0.338	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404023.1		NM_023071	
SSC5D	284297	hgsc.bcm.edu	37	19	56029201	56029201	+	Missense_Mutation	SNP	C	C	A	rs74585733	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:56029201C>A	ENST00000389623.6	+	14	3581	c.3558C>A	c.(3556-3558)caC>caA	p.H1186Q		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1186	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						cgacccctcaccccaccacca	0.597													-|||	788	0.157348	0.2769	0.1859	5008	,	,		9487	0.2044		0.0736	False		,,,				2504	0.0133																0													257.0	252.0	253.0					19																	56029201		692	1591	2283	SO:0001583	missense	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3558C>A	19.37:g.56029201C>A	ENSP00000374274:p.His1186Gln	Somatic		WXS	SOLID	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	348	0.15934065934065933	131	0.266260162601626	51	0.1408839779005525	111	0.19405594405594406	55	0.07255936675461741	-	4.218	0.039350	0.08148	.	.	ENSG00000179954	ENST00000389623	T	0.01145	5.27	2.33	-4.67	0.03319	.	.	.	.	.	T	0.00012	0.0000	N	0.20986	0.625	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39722	-0.9600	8	0.02654	T	1	.	5.1952	0.15233	0.4243:0.4168:0.1589:0.0	.	1186	A1L4H1	SRCRL_HUMAN	Q	1186	ENSP00000374274:H1186Q	ENSP00000374274:H1186Q	H	+	3	2	SSC5D	60721013	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.398000	0.02509	-0.989000	0.03485	-2.918000	0.00090	CAC		0.597	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2		XM_001718392	
SSC5D	284297	hgsc.bcm.edu	37	19	56029543	56029543	+	Silent	SNP	C	C	T	rs114559746	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:56029543C>T	ENST00000389623.6	+	14	3923	c.3900C>T	c.(3898-3900)caC>caT	p.H1300H		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1300	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						caacccctcaccccaccatga	0.647																																																	0													255.0	262.0	260.0					19																	56029543		692	1591	2283	SO:0001819	synonymous_variant	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3900C>T	19.37:g.56029543C>T		Somatic		WXS	SOLID	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																				0.647	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2		XM_001718392	
SSC5D	284297	hgsc.bcm.edu	37	19	56029556	56029556	+	Missense_Mutation	SNP	C	C	G	rs200305118	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:56029556C>G	ENST00000389623.6	+	14	3936	c.3913C>G	c.(3913-3915)Cct>Gct	p.P1305A		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1305	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						caccatgactcctgaccccac	0.632													-|||	793	0.158347	0.2799	0.1859	5008	,	,		8238	0.2044		0.0746	False		,,,				2504	0.0133																0													287.0	291.0	290.0					19																	56029556		692	1591	2283	SO:0001583	missense	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3913C>G	19.37:g.56029556C>G	ENSP00000374274:p.Pro1305Ala	Somatic		WXS	SOLID	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	8.570	0.879813	0.17467	.	.	ENSG00000179954	ENST00000389623	T	0.01397	4.94	2.81	-0.351	0.12602	.	.	.	.	.	T	0.00815	0.0027	N	0.19112	0.55	0.09310	N	1	B	0.32829	0.386	B	0.21546	0.035	T	0.47509	-0.9112	9	0.22109	T	0.4	.	1.7314	0.02932	0.314:0.4108:0.0:0.2752	.	1305	A1L4H1	SRCRL_HUMAN	A	1305	ENSP00000374274:P1305A	ENSP00000374274:P1305A	P	+	1	0	SSC5D	60721368	0.000000	0.05858	0.006000	0.13384	0.148000	0.21650	-0.191000	0.09601	0.228000	0.21019	0.165000	0.16767	CCT		0.632	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2		XM_001718392	
SSC5D	284297	hgsc.bcm.edu	37	19	56029577	56029577	+	Missense_Mutation	SNP	T	T	G	rs145888701|rs200457993		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:56029577T>G	ENST00000389623.6	+	14	3957	c.3934T>G	c.(3934-3936)Tac>Gac	p.Y1312D		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1312	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						cacgaccccttaccccaccac	0.622																																																	0													317.0	302.0	307.0					19																	56029577		692	1591	2283	SO:0001583	missense	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3934T>G	19.37:g.56029577T>G	ENSP00000374274:p.Tyr1312Asp	Somatic		WXS	SOLID	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	4.328	0.060251	0.08339	.	.	ENSG00000179954	ENST00000389623	T	0.01159	5.25	2.51	-0.204	0.13200	.	.	.	.	.	T	0.00754	0.0025	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47711	-0.9096	9	0.24483	T	0.36	.	2.7529	0.05286	0.0:0.4047:0.2526:0.3427	.	1312	A1L4H1	SRCRL_HUMAN	D	1312	ENSP00000374274:Y1312D	ENSP00000374274:Y1312D	Y	+	1	0	SSC5D	60721389	0.000000	0.05858	0.003000	0.11579	0.088000	0.18126	-0.278000	0.08490	-0.038000	0.13624	-1.229000	0.01577	TAC		0.622	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2		XM_001718392	
SSC5D	284297	hgsc.bcm.edu	37	19	56029606	56029606	+	Silent	SNP	G	G	A	rs76326175	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:56029606G>A	ENST00000389623.6	+	14	3986	c.3963G>A	c.(3961-3963)acG>acA	p.T1321T		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1321	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						atcccaccacgacccctcacc	0.607																																																	0													341.0	321.0	327.0					19																	56029606		692	1591	2283	SO:0001819	synonymous_variant	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3963G>A	19.37:g.56029606G>A		Somatic		WXS	SOLID	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																				0.607	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2		XM_001718392	
TAPBPL	55080	hgsc.bcm.edu;ucsc.edu	37	12	6567862	6567862	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr12:6567862T>A	ENST00000266556.7	+	5	1121	c.956T>A	c.(955-957)cTc>cAc	p.L319H	TAPBPL_ENST00000545700.1_3'UTR	NM_018009.4	NP_060479.3	Q9BX59	TPSNR_HUMAN	TAP binding protein-like	319	Ig-like C1-type.				negative regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			endometrium(2)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	6						CTGCCCACCCTCATCTGCGAC	0.542																																																	0													147.0	131.0	136.0					12																	6567862		2203	4300	6503	SO:0001583	missense	55080			AK001005	CCDS8546.1	12p13.31	2013-01-11						"""Immunoglobulin superfamily / C1-set domain containing"""	30683	protein-coding gene	gene with protein product		607081				11920573	Standard	NM_018009		Approved	TAPBP-R, FLJ10143, TAPBPR	uc001qog.4	Q9BX59		ENST00000266556.7:c.956T>A	12.37:g.6567862T>A	ENSP00000266556:p.Leu319His	Somatic		WXS	SOLID	Phase_I	Q9NWB8	Missense_Mutation	SNP	ENST00000266556.7	37	CCDS8546.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.105698	0.77096	.	.	ENSG00000139192	ENST00000266556	T	0.32988	1.43	5.05	5.05	0.67936	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67258	0.2874	H	0.97131	3.945	0.46167	D	0.998904	D	0.89917	1.0	D	0.97110	1.0	T	0.77661	-0.2504	10	0.87932	D	0	-19.7061	11.5033	0.50450	0.0:0.0:0.0:1.0	.	319	Q9BX59	TPSNR_HUMAN	H	319	ENSP00000266556:L319H	ENSP00000266556:L319H	L	+	2	0	TAPBPL	6438123	1.000000	0.71417	0.355000	0.25773	0.083000	0.17756	5.233000	0.65337	2.039000	0.60335	0.528000	0.53228	CTC		0.542	TAPBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399263.1		NM_018009	
TARBP1	6894	hgsc.bcm.edu;ucsc.edu	37	1	234563467	234563467	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr1:234563467A>C	ENST00000040877.1	-	18	3105	c.3106T>G	c.(3106-3108)Ttc>Gtc	p.F1036V		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1036					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGTGTATTGAAGACTCCAGTC	0.318																																																	0													76.0	76.0	76.0					1																	234563467		2203	4300	6503	SO:0001583	missense	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3106T>G	1.37:g.234563467A>C	ENSP00000040877:p.Phe1036Val	Somatic		WXS	SOLID	Phase_I	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.008979	0.75046	.	.	ENSG00000059588	ENST00000040877	T	0.30981	1.51	4.9	3.78	0.43462	Armadillo-type fold (1);	0.156175	0.64402	D	0.000020	T	0.31949	0.0813	M	0.71581	2.175	0.51482	D	0.999925	P	0.46621	0.881	B	0.39805	0.31	T	0.17806	-1.0357	10	0.56958	D	0.05	-9.7578	10.6202	0.45476	0.924:0.0:0.076:0.0	.	1036	Q13395	TARB1_HUMAN	V	1036	ENSP00000040877:F1036V	ENSP00000040877:F1036V	F	-	1	0	TARBP1	232630090	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.745000	0.68672	1.012000	0.39366	0.533000	0.62120	TTC		0.318	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1		NM_005646	
TAS2R3	50831	hgsc.bcm.edu	37	7	141464682	141464682	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr7:141464682C>A	ENST00000247879.2	+	1	786	c.724C>A	c.(724-726)Ctc>Atc	p.L242I	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	242					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					cttcttctttctcttcttact	0.428																																																	0													87.0	78.0	81.0					7																	141464682		2203	4300	6503	SO:0001583	missense	50831			AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.724C>A	7.37:g.141464682C>A	ENSP00000247879:p.Leu242Ile	Somatic		WXS	SOLID	Phase_I	A4D1U2|Q645W2|Q75MV6	Missense_Mutation	SNP	ENST00000247879.2	37	CCDS5867.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822878	0.50739	.	.	ENSG00000127362	ENST00000247879	T	0.38887	1.11	5.71	4.82	0.62117	.	0.255414	0.31484	N	0.007563	T	0.66982	0.2845	M	0.90870	3.155	0.24539	N	0.994072	D	0.63046	0.992	P	0.61201	0.885	T	0.65792	-0.6082	10	0.72032	D	0.01	.	11.5573	0.50755	0.0:0.9121:0.0:0.0879	.	242	Q9NYW6	TA2R3_HUMAN	I	242	ENSP00000247879:L242I	ENSP00000247879:L242I	L	+	1	0	TAS2R3	141111151	0.000000	0.05858	0.794000	0.32065	0.124000	0.20399	-0.547000	0.06055	1.394000	0.46624	0.557000	0.71058	CTC		0.428	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349288.1			
TEKT4	150483	hgsc.bcm.edu	37	2	95541442	95541442	+	Missense_Mutation	SNP	C	C	T	rs201206924	byFrequency	TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr2:95541442C>T	ENST00000295201.4	+	5	1183	c.1046C>T	c.(1045-1047)tCg>tTg	p.S349L	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	349					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						TACCTGCGCTCGCACCGGCCC	0.632																																																	0													150.0	121.0	131.0					2																	95541442		2203	4300	6503	SO:0001583	missense	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1046C>T	2.37:g.95541442C>T	ENSP00000295201:p.Ser349Leu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	18.54	3.646771	0.67358	.	.	ENSG00000163060	ENST00000295201	T	0.02709	4.19	2.31	2.31	0.28768	.	0.289710	0.33875	N	0.004480	T	0.06872	0.0175	L	0.58101	1.795	0.80722	D	1	D	0.62365	0.991	P	0.54924	0.764	T	0.44513	-0.9323	10	0.30078	T	0.28	-9.7808	10.3248	0.43787	0.0:1.0:0.0:0.0	.	349	Q8WW24	TEKT4_HUMAN	L	349	ENSP00000295201:S349L	ENSP00000295201:S349L	S	+	2	0	TEKT4	94905169	0.094000	0.21725	0.968000	0.41197	0.447000	0.32167	2.536000	0.45693	1.314000	0.45095	0.281000	0.19383	TCG		0.632	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1		NM_144705	
TMCO3	55002	hgsc.bcm.edu	37	13	114149923	114149923	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr13:114149923C>G	ENST00000434316.2	+	2	386	c.27C>G	c.(25-27)ttC>ttG	p.F9L	TMCO3_ENST00000474393.1_3'UTR|TMCO3_ENST00000375391.1_Missense_Mutation_p.F9L	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	9						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GAAGCTTCTTCTGGGTGCTGT	0.622																																																	0													94.0	86.0	89.0					13																	114149923		2203	4300	6503	SO:0001583	missense	55002			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.27C>G	13.37:g.114149923C>G	ENSP00000389399:p.Phe9Leu	Somatic		WXS	SOLID	Phase_I	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	ENST00000434316.2	37	CCDS9537.1	.	.	.	.	.	.	.	.	.	.	C	2.260	-0.369472	0.05069	.	.	ENSG00000150403	ENST00000434316;ENST00000375391	T	0.27104	1.69	5.59	-0.116	0.13555	.	0.995760	0.08155	N	0.989364	T	0.08044	0.0201	N	0.03177	-0.4	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35649	-0.9780	10	0.06494	T	0.89	-10.6576	2.6793	0.05089	0.2228:0.1529:0.4434:0.1809	.	9;9	Q6UWJ1;Q6UWJ1-2	TMCO3_HUMAN;.	L	9	ENSP00000389399:F9L	ENSP00000364540:F9L	F	+	3	2	TMCO3	113197924	0.003000	0.15002	0.012000	0.15200	0.013000	0.08279	-0.321000	0.08018	0.035000	0.15519	0.650000	0.86243	TTC		0.622	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3		NM_017905	
TMX4	56255	hgsc.bcm.edu;ucsc.edu	37	20	7962956	7962956	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr20:7962956T>C	ENST00000246024.2	-	8	1207	c.992A>G	c.(991-993)gAg>gGg	p.E331G		NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	331	Glu-rich.				cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						TTCCACCACCTCTGTGTCAGC	0.527																																																	0													95.0	88.0	90.0					20																	7962956		2203	4300	6503	SO:0001583	missense	56255				CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.992A>G	20.37:g.7962956T>C	ENSP00000246024:p.Glu331Gly	Somatic		WXS	SOLID	Phase_I	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	ENST00000246024.2	37	CCDS13101.1	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134049	0.56828	.	.	ENSG00000125827	ENST00000246024	T	0.11604	2.76	5.72	3.38	0.38709	.	0.549745	0.18334	N	0.144392	T	0.11067	0.0270	L	0.57536	1.79	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.21999	-1.0229	10	0.72032	D	0.01	-8.6891	5.2502	0.15517	0.1553:0.0852:0.0:0.7595	.	331	Q9H1E5	TMX4_HUMAN	G	331	ENSP00000246024:E331G	ENSP00000246024:E331G	E	-	2	0	TMX4	7910956	0.836000	0.29430	0.029000	0.17559	0.546000	0.35178	2.725000	0.47294	1.002000	0.39104	0.455000	0.32223	GAG		0.527	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2		NM_021156	
TP53	7157	hgsc.bcm.edu;ucsc.edu	37	17	7573974	7573974	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr17:7573974C>A	ENST00000269305.4	-	10	1242	c.1053G>T	c.(1051-1053)aaG>aaT	p.K351N	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.K351N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	351	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*5(1)|p.L350fs*28(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTGGGCATCCTTGAGTTCCA	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	11	Whole gene deletion(8)|Deletion - Frameshift(2)|Unknown(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|urinary_tract(1)											60.0	46.0	50.0					17																	7573974		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1053G>T	17.37:g.7573974C>A	ENSP00000269305:p.Lys351Asn	Somatic		WXS	SOLID	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047119	0.75846	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.93247	-3.19;-3.19	5.43	-0.704	0.11256	p53, tetramerisation domain (3);	0.488693	0.23008	N	0.052999	D	0.93413	0.7899	M	0.75447	2.3	0.35877	D	0.828637	P	0.49447	0.924	P	0.55455	0.776	D	0.91209	0.4997	10	0.56958	D	0.05	-24.255	5.2391	0.15462	0.0:0.4493:0.1484:0.4023	.	351	P04637	P53_HUMAN	N	351;351;340	ENSP00000269305:K351N;ENSP00000391478:K351N	ENSP00000269305:K351N	K	-	3	2	TP53	7514699	0.994000	0.37717	0.912000	0.35992	0.971000	0.66376	0.410000	0.21098	0.019000	0.15079	0.561000	0.74099	AAG		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1		NM_000546	
TRANK1	9881	hgsc.bcm.edu;ucsc.edu	37	3	36872707	36872707	+	Silent	SNP	C	C	T	rs368926806		TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr3:36872707C>T	ENST00000429976.2	-	21	8482	c.8235G>A	c.(8233-8235)gcG>gcA	p.A2745A	TRANK1_ENST00000301807.6_Silent_p.A2195A|TRANK1_ENST00000428977.2_Silent_p.A2195A	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2745							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCCCCTCAAACGCTTTGCTGG	0.557													c|||	1	0.000199681	0.0	0.0	5008	,	,		20849	0.001		0.0	False		,,,				2504	0.0																0								C		1,3999		0,1,1999	69.0	70.0	70.0		8235	-9.0	0.0	3		70	6,8316		0,6,4155	no	coding-synonymous	TRANK1	NM_014831.2		0,7,6154	TT,TC,CC		0.0721,0.025,0.0568		2745/2926	36872707	7,12315	2000	4161	6161	SO:0001819	synonymous_variant	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.8235G>A	3.37:g.36872707C>T		Somatic		WXS	SOLID	Phase_I	Q8N8K0	Silent	SNP	ENST00000429976.2	37	CCDS46789.2																																																																																				0.557	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_014831	
UBR1	197131	hgsc.bcm.edu;ucsc.edu	37	15	43320014	43320014	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr15:43320014T>C	ENST00000290650.4	-	22	2470	c.2392A>G	c.(2392-2394)Act>Gct	p.T798A	UBR1_ENST00000382177.2_Intron	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	798					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TCTAAGCCAGTTTCATTATTT	0.303																																																	0													134.0	119.0	124.0					15																	43320014		2201	4298	6499	SO:0001583	missense	197131				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.2392A>G	15.37:g.43320014T>C	ENSP00000290650:p.Thr798Ala	Somatic		WXS	SOLID	Phase_I	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.308706	0.81247	.	.	ENSG00000159459	ENST00000290650;ENST00000546274	T	0.51325	0.71	5.31	5.31	0.75309	.	0.051633	0.85682	D	0.000000	T	0.48537	0.1505	L	0.55213	1.73	0.80722	D	1	B;D	0.58268	0.228;0.982	B;P	0.48063	0.109;0.565	T	0.40961	-0.9535	10	0.14656	T	0.56	-22.7226	15.4391	0.75168	0.0:0.0:0.0:1.0	.	798;798	B4DYL2;Q8IWV7	.;UBR1_HUMAN	A	798	ENSP00000290650:T798A	ENSP00000290650:T798A	T	-	1	0	UBR1	41107306	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.117000	0.77129	2.219000	0.72066	0.528000	0.53228	ACT		0.303	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1		NM_174916	
UGT8	7368	hgsc.bcm.edu;ucsc.edu	37	4	115585285	115585286	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr4:115585285_115585286delGA	ENST00000310836.6	+	3	1479_1480	c.957_958delGA	c.(955-960)gtgattfs	p.I320fs	UGT8_ENST00000394511.3_Frame_Shift_Del_p.I320fs	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	320					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		CTCAAAAAGTGATTTGGAGGTA	0.416																																																	0																																										SO:0001589	frameshift_variant	7368			AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.957_958delGA	4.37:g.115585285_115585286delGA	ENSP00000311648:p.Ile320fs	Somatic		WXS	SOLID	Phase_I	B3KXU7|O00196	Frame_Shift_Del	DEL	ENST00000310836.6	37	CCDS3705.1																																																																																				0.416	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256426.2		NM_003360	
ZNF180	7733	hgsc.bcm.edu	37	19	45001361	45001361	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:45001361G>A	ENST00000221327.4	-	2	388	c.107C>T	c.(106-108)cCa>cTa	p.P36L	ZNF180_ENST00000391956.4_Missense_Mutation_p.P36L|ZNF180_ENST00000585514.1_5'UTR|ZNF180_ENST00000592529.1_Missense_Mutation_p.P9L|ZNF180_ENST00000586637.1_Nonsense_Mutation_p.Q5*|ZNF180_ENST00000587047.1_Nonsense_Mutation_p.Q38*	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	36					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P36L(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CGGGGGCTCTGGGGGCTTCTC	0.612																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)												1	Substitution - Missense(1)	ovary(1)											41.0	39.0	40.0					19																	45001361		2203	4300	6503	SO:0001583	missense	7733			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.107C>T	19.37:g.45001361G>A	ENSP00000221327:p.Pro36Leu	Somatic		WXS	SOLID	Phase_I	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267915	0.40095	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.07688	3.23;3.17	3.74	-2.61	0.06171	.	.	.	.	.	T	0.03871	0.0109	N	0.14661	0.345	0.53688	A	0.999979	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.42882	-0.9425	8	0.72032	D	0.01	0.1136	0.7119	0.00926	0.3088:0.1651:0.3572:0.1689	.	36;35;36	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	L	36	ENSP00000221327:P36L;ENSP00000375818:P36L	ENSP00000221327:P36L	P	-	2	0	ZNF180	49693201	0.042000	0.20092	0.010000	0.14722	0.560000	0.35617	-0.115000	0.10741	-0.321000	0.08627	0.655000	0.94253	CCA		0.612	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1		NM_013256	
ZNF667	63934	hgsc.bcm.edu;ucsc.edu	37	19	56953747	56953747	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:56953747C>G	ENST00000504904.3	-	7	1336	c.617G>C	c.(616-618)gGg>gCg	p.G206A	ZNF667_ENST00000292069.6_Missense_Mutation_p.G206A|ZNF667_ENST00000342634.3_Missense_Mutation_p.G334A|ZNF667_ENST00000591790.1_3'UTR			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GAAGCTTTCCCCACATTTATT	0.383																																																	0													182.0	187.0	185.0					19																	56953747		2202	4300	6502	SO:0001583	missense	63934				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.617G>C	19.37:g.56953747C>G	ENSP00000439402:p.Gly206Ala	Somatic		WXS	SOLID	Phase_I	B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	ENST00000504904.3	37	CCDS12944.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.310958	0.40895	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000360227	T;T;T	0.57595	0.39;0.39;0.39	4.98	4.98	0.66077	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000402	T	0.75831	0.3903	M	0.86420	2.815	0.39739	D	0.971721	D;D	0.89917	1.0;1.0	D;D	0.80764	0.991;0.994	T	0.81527	-0.0892	10	0.87932	D	0	-11.2444	15.7879	0.78322	0.0:1.0:0.0:0.0	.	334;206	E7EPS0;Q5HYK9	.;ZN667_HUMAN	A	334;206;206;80	ENSP00000344699:G334A;ENSP00000439402:G206A;ENSP00000292069:G206A	ENSP00000292069:G206A	G	-	2	0	ZNF667	61645559	0.422000	0.25473	0.961000	0.40146	0.017000	0.09413	1.446000	0.35090	2.581000	0.87130	0.591000	0.81541	GGG		0.383	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458394.1		NM_022103	
ZNF134	7693	hgsc.bcm.edu	37	19	58132725	58132725	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4176-01A-02D-1366-10	TCGA-BP-4176-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33e2b6cb-7c03-4090-bef5-ba13f7271a19	1eba4efc-588d-4bd6-9a70-3dd29f262753	g.chr19:58132725C>G	ENST00000396161.5	+	3	1548	c.1238C>G	c.(1237-1239)tCc>tGc	p.S413C		NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		AGCTTAAGCTCCCACCTCAAT	0.463																																																	0													157.0	164.0	161.0					19																	58132725		2203	4300	6503	SO:0001583	missense	7693			U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.1238C>G	19.37:g.58132725C>G	ENSP00000379464:p.Ser413Cys	Somatic		WXS	SOLID	Phase_I	Q9Y4B2	Missense_Mutation	SNP	ENST00000396161.5	37	CCDS42638.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914210	0.72983	.	.	ENSG00000213762	ENST00000418193;ENST00000541849;ENST00000396161	T	0.08282	3.11	4.37	3.24	0.37175	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29684	0.0741	M	0.86343	2.81	0.09310	N	1	D	0.76494	0.999	P	0.61328	0.887	T	0.04386	-1.0955	9	0.72032	D	0.01	.	13.0978	0.59202	0.1612:0.8388:0.0:0.0	.	413	P52741	ZN134_HUMAN	C	480;333;413	ENSP00000379464:S413C	ENSP00000379464:S413C	S	+	2	0	ZNF134	62824537	0.028000	0.19301	0.016000	0.15963	0.995000	0.86356	1.142000	0.31540	2.408000	0.81797	0.563000	0.77884	TCC		0.463	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1		NM_003435	
