#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACAP2	23527	hgsc.bcm.edu	37	3	195022890	195022890	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:195022890T>A	ENST00000326793.6	-	14	1360	c.1130A>T	c.(1129-1131)aAa>aTa	p.K377I		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	377					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TGGAGATGATTTCTTATCCAG	0.373																																																	0													99.0	113.0	108.0					3																	195022890		2203	4300	6503	SO:0001583	missense	23527				CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1130A>T	3.37:g.195022890T>A	ENSP00000324287:p.Lys377Ile	Somatic		WXS	SOLID	Phase_I	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	37	CCDS33924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.66|17.66	3.444794|3.444794	0.63178|0.63178	.|.	.|.	ENSG00000114331|ENSG00000114331	ENST00000439758|ENST00000326793	.|T	.|0.50813	.|0.73	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.126440	.|0.64402	.|D	.|0.000001	T|T	0.36276|0.36276	0.0961|0.0961	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|P	.|0.43973	.|0.823	.|B	.|0.41510	.|0.359	T|T	0.16600|0.16600	-1.0397|-1.0397	5|10	.|0.34782	.|T	.|0.22	.|.	15.06|15.06	0.71944|0.71944	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|377	.|Q15057	.|ACAP2_HUMAN	D|I	251|377	.|ENSP00000324287:K377I	.|ENSP00000324287:K377I	E|K	-|-	3|2	2|0	ACAP2|ACAP2	196504179|196504179	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.070000|4.070000	0.57548|0.57548	2.155000|2.155000	0.67459|0.67459	0.482000|0.482000	0.46254|0.46254	GAA|AAA		0.373	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2		NM_012287	
ACCSL	390110	hgsc.bcm.edu;ucsc.edu	37	11	44081417	44081417	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr11:44081417G>A	ENST00000378832.1	+	14	1710	c.1654G>A	c.(1654-1656)Gag>Aag	p.E552K		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	552					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TGTGCTGCAGGAGCAGAAGGA	0.532																																																	0													321.0	320.0	320.0					11																	44081417		2038	4200	6238	SO:0001583	missense	390110				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1654G>A	11.37:g.44081417G>A	ENSP00000368109:p.Glu552Lys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000378832.1	37	CCDS41636.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623416	0.46840	.	.	ENSG00000205126	ENST00000378832	T	0.23754	1.89	3.74	2.83	0.33086	Pyridoxal phosphate-dependent transferase, major domain (1);	0.059177	0.64402	D	0.000003	T	0.13072	0.0317	N	0.19112	0.55	0.09310	N	0.999995	B	0.28378	0.209	B	0.26094	0.066	T	0.22068	-1.0227	10	0.18276	T	0.48	-3.2179	7.2116	0.25937	0.1208:0.0:0.8792:0.0	.	552	Q4AC99	1A1L2_HUMAN	K	552	ENSP00000368109:E552K	ENSP00000368109:E552K	E	+	1	0	ACCSL	44037993	0.004000	0.15560	0.005000	0.12908	0.072000	0.16883	0.859000	0.27858	1.155000	0.42497	0.561000	0.74099	GAG		0.532	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1		NM_001031854	
ACP6	51205	hgsc.bcm.edu;ucsc.edu	37	1	147119248	147119248	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:147119248T>G	ENST00000369238.6	-	10	1711	c.1264A>C	c.(1264-1266)Atg>Ctg	p.M422L	ACP6_ENST00000460583.1_5'UTR	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	422					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					CCAACTTCCATCACCTGAGTT	0.423																																																	0													161.0	158.0	159.0					1																	147119248		2203	4300	6503	SO:0001583	missense	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.1264A>C	1.37:g.147119248T>G	ENSP00000358241:p.Met422Leu	Somatic		WXS	SOLID	Phase_I	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	ENST00000369238.6	37	CCDS928.1	.	.	.	.	.	.	.	.	.	.	T	3.259	-0.151517	0.06585	.	.	ENSG00000162836	ENST00000369238	T	0.10192	2.9	4.35	-6.89	0.01660	.	1.504300	0.03535	N	0.223014	T	0.01156	0.0038	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41502	-0.9505	10	0.10377	T	0.69	.	1.6508	0.02771	0.1192:0.2953:0.2451:0.3404	.	422	Q9NPH0	PPA6_HUMAN	L	422	ENSP00000358241:M422L	ENSP00000358241:M422L	M	-	1	0	ACP6	145585872	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.189000	0.09629	-1.546000	0.01717	-1.249000	0.01516	ATG		0.423	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2		NM_016361	
ACSL4	2182	hgsc.bcm.edu	37	X	108926066	108926066	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chrX:108926066G>C	ENST00000469796.2	-	4	807	c.411C>G	c.(409-411)aaC>aaG	p.N137K	ACSL4_ENST00000348502.6_Missense_Mutation_p.N96K|ACSL4_ENST00000340800.2_Missense_Mutation_p.N137K			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	137					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	CACTACCAAAGTTATTCACTC	0.393																																					Pancreas(188;358 2127 38547 41466 45492)												0													148.0	128.0	134.0					X																	108926066		2203	4300	6503	SO:0001583	missense	2182			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.411C>G	X.37:g.108926066G>C	ENSP00000419171:p.Asn137Lys	Somatic		WXS	SOLID	Phase_I	D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	CCDS14548.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.522368	0.27211	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800;ENST00000505855;ENST00000502391	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.55	1.12	0.20585	AMP-dependent synthetase/ligase (1);	0.226039	0.51477	D	0.000094	T	0.36524	0.0970	M	0.62154	1.92	0.37591	D	0.920197	B	0.21225	0.053	B	0.25759	0.063	T	0.23226	-1.0194	10	0.21540	T	0.41	-21.5204	9.9708	0.41752	0.4213:0.0:0.5787:0.0	.	137	O60488	ACSL4_HUMAN	K	96;137;137;96;137	ENSP00000262835:N96K;ENSP00000419171:N137K;ENSP00000339787:N137K;ENSP00000424808:N96K	ENSP00000339787:N137K	N	-	3	2	ACSL4	108812722	0.974000	0.33945	1.000000	0.80357	0.958000	0.62258	0.371000	0.20450	0.139000	0.18822	0.529000	0.55759	AAC		0.393	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2		NM_004458	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128984499	128984499	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr5:128984499C>T	ENST00000274487.4	+	13	2139	c.1994C>T	c.(1993-1995)tCt>tTt	p.S665F	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	665	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGGCTAGATTCTGAAGCAAGG	0.328																																																	0													78.0	81.0	80.0					5																	128984499		2203	4300	6503	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1994C>T	5.37:g.128984499C>T	ENSP00000274487:p.Ser665Phe	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	4.956	0.177522	0.09443	.	.	ENSG00000145808	ENST00000274487	T	0.53206	0.63	4.2	4.2	0.49525	.	0.562990	0.16809	N	0.198624	T	0.21103	0.0508	N	0.02775	-0.495	0.39040	D	0.960104	P	0.38195	0.622	B	0.39738	0.308	T	0.04509	-1.0946	9	.	.	.	.	4.8767	0.13660	0.2156:0.6755:0.0:0.1089	.	665	Q8TE59	ATS19_HUMAN	F	665	ENSP00000274487:S665F	.	S	+	2	0	ADAMTS19	129012398	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.386000	0.44380	2.624000	0.88883	0.655000	0.94253	TCT		0.328	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2		NM_133638	
AGFG1	3267	hgsc.bcm.edu;ucsc.edu	37	2	228398343	228398343	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:228398343C>A	ENST00000310078.8	+	7	1153	c.893C>A	c.(892-894)aCc>aAc	p.T298N	AGFG1_ENST00000409979.2_Missense_Mutation_p.T322N|AGFG1_ENST00000373671.3_Missense_Mutation_p.T258N|AGFG1_ENST00000409315.1_Missense_Mutation_p.T298N|AGFG1_ENST00000409171.1_Missense_Mutation_p.T298N	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	298					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						GATTTTGGAACCTTCAATACT	0.403																																																	0													102.0	98.0	99.0					2																	228398343		2203	4300	6503	SO:0001583	missense	3267				CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.893C>A	2.37:g.228398343C>A	ENSP00000312059:p.Thr298Asn	Somatic		WXS	SOLID	Phase_I	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	ENST00000310078.8	37	CCDS2467.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583009	0.46006	.	.	ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171;ENST00000456594	T;T;T;T;T	0.25414	1.8;1.99;1.91;1.94;1.99	5.14	3.3	0.37823	.	0.367377	0.30704	N	0.009060	T	0.12178	0.0296	N	0.08118	0	0.32209	N	0.576827	B;B;B;B	0.18741	0.012;0.004;0.03;0.002	B;B;B;B	0.18561	0.01;0.009;0.022;0.007	T	0.19257	-1.0311	10	0.13853	T	0.58	.	11.6487	0.51275	0.1353:0.7219:0.1428:0.0	.	258;298;322;298	P52594-2;P52594-3;E9PHX7;P52594	.;.;.;AGFG1_HUMAN	N	322;307;298;298;258;298;220	ENSP00000387282:T322N;ENSP00000312059:T298N;ENSP00000387154:T298N;ENSP00000362775:T258N;ENSP00000387218:T298N	ENSP00000312059:T298N	T	+	2	0	AGFG1	228106587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.284000	0.65627	0.533000	0.28675	0.655000	0.94253	ACC		0.403	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2		NM_004504	
APPBP2	10513	hgsc.bcm.edu;ucsc.edu	37	17	58529363	58529363	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:58529363T>G	ENST00000083182.3	-	12	1669	c.1382A>C	c.(1381-1383)cAa>cCa	p.Q461P		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	461					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			ACCAAGAAGTTGTTCTTTAAT	0.323																																																	0													99.0	98.0	98.0					17																	58529363		2203	4297	6500	SO:0001583	missense	10513			AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1382A>C	17.37:g.58529363T>G	ENSP00000083182:p.Gln461Pro	Somatic		WXS	SOLID	Phase_I	A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	ENST00000083182.3	37	CCDS32699.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.601750	0.46423	.	.	ENSG00000062725	ENST00000083182	T	0.63744	-0.06	5.2	5.2	0.72013	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	L	0.32530	0.975	0.80722	D	1	P	0.44877	0.845	P	0.55824	0.785	T	0.64711	-0.6343	10	0.46703	T	0.11	-11.1371	10.9572	0.47364	0.14:0.0:0.0:0.86	.	461	Q92624	APBP2_HUMAN	P	461	ENSP00000083182:Q461P	ENSP00000083182:Q461P	Q	-	2	0	APPBP2	55884145	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.657000	0.67996	1.969000	0.57287	0.373000	0.22412	CAA		0.323	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1		NM_006380	
ARHGAP20	57569	hgsc.bcm.edu;ucsc.edu	37	11	110451543	110451543	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr11:110451543G>T	ENST00000260283.4	-	16	2411	c.2127C>A	c.(2125-2127)gaC>gaA	p.D709E	ARHGAP20_ENST00000524756.1_Missense_Mutation_p.D686E|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.D673E|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.D673E|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.D683E|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.D252E|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.D683E	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	709					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		AATCCAGATAGTCGATGCTGG	0.498																																																	0													64.0	64.0	64.0					11																	110451543		2201	4298	6499	SO:0001583	missense	57569			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2127C>A	11.37:g.110451543G>T	ENSP00000260283:p.Asp709Glu	Somatic		WXS	SOLID	Phase_I	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388435	0.61956	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.10960	2.85;2.85;2.82;2.85;2.85;2.85;2.85	5.71	3.78	0.43462	.	0.226096	0.37483	N	0.002070	T	0.11623	0.0283	M	0.63428	1.95	0.09310	N	1	P;P;P	0.41848	0.763;0.651;0.763	B;B;B	0.37144	0.242;0.039;0.121	T	0.14035	-1.0487	10	0.52906	T	0.07	.	8.7291	0.34487	0.2466:0.0:0.7534:0.0	.	683;709;686	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	E	709;683;252;686;673;683;673	ENSP00000260283:D709E;ENSP00000349660:D683E;ENSP00000437905:D252E;ENSP00000432076:D686E;ENSP00000436319:D673E;ENSP00000436522:D683E;ENSP00000431399:D673E	ENSP00000260283:D709E	D	-	3	2	ARHGAP20	109956753	0.998000	0.40836	0.001000	0.08648	0.949000	0.60115	3.656000	0.54467	0.714000	0.32081	0.655000	0.94253	GAC		0.498	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1		NM_020809	
ATF6	22926	hgsc.bcm.edu;ucsc.edu	37	1	161736220	161736220	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:161736220G>T	ENST00000367942.3	+	1	137	c.70G>T	c.(70-72)Gat>Tat	p.D24Y	RP11-474I16.8_ENST00000431097.2_RNA	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	24	Transcription activation.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	TCACAGGCTGGATGAAGATTG	0.577																																																	0													79.0	76.0	77.0					1																	161736220		2203	4300	6503	SO:0001583	missense	22926			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.70G>T	1.37:g.161736220G>T	ENSP00000356919:p.Asp24Tyr	Somatic		WXS	SOLID	Phase_I	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	ENST00000367942.3	37	CCDS1235.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090098	0.36855	.	.	ENSG00000118217	ENST00000367942	T	0.15603	2.41	4.52	2.65	0.31530	.	1.252660	0.05510	N	0.559995	T	0.07999	0.0200	L	0.40543	1.245	0.30447	N	0.7756609999999999	B;P	0.38922	0.34;0.651	B;B	0.41946	0.371;0.172	T	0.31336	-0.9947	9	0.66056	D	0.02	-15.5103	7.0903	0.25279	0.206:0.0:0.794:0.0	.	24;25	P18850;Q59H30	ATF6A_HUMAN;.	Y	24	ENSP00000356919:D24Y	ENSP00000356919:D24Y	D	+	1	0	ATF6	160002844	0.817000	0.29147	0.054000	0.19295	0.835000	0.47333	2.418000	0.44662	0.640000	0.30582	0.561000	0.74099	GAT		0.577	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2		NM_007348	
ATXN7	6314	hgsc.bcm.edu;ucsc.edu	37	3	63938069	63938069	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:63938069G>C	ENST00000295900.6	+	5	959	c.409G>C	c.(409-411)Ggt>Cgt	p.G137R	ATXN7_ENST00000398590.3_Missense_Mutation_p.G137R|ATXN7_ENST00000538065.1_Missense_Mutation_p.G137R|ATXN7_ENST00000487717.1_Missense_Mutation_p.G137R	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	137					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		GCCAATATTTGGTTTCTGTCC	0.408																																																	0													213.0	199.0	203.0					3																	63938069		1937	4151	6088	SO:0001583	missense	6314			AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.409G>C	3.37:g.63938069G>C	ENSP00000295900:p.Gly137Arg	Somatic		WXS	SOLID	Phase_I	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	37	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.995500	0.93167	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.60378	-0.7275	10	0.87932	D	0	-7.8962	19.4212	0.94721	0.0:0.0:1.0:0.0	.	137;137	O15265-2;O15265	.;ATX7_HUMAN	R	137	ENSP00000381590:G137R;ENSP00000295900:G137R;ENSP00000420234:G137R;ENSP00000439585:G137R	ENSP00000295900:G137R	G	+	1	0	ATXN7	63913109	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.734000	0.98822	2.674000	0.91012	0.467000	0.42956	GGT		0.408	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1		NM_000333	
BANP	54971	hgsc.bcm.edu	37	16	88052146	88052146	+	Silent	SNP	C	C	T	rs17850504	byFrequency	TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr16:88052146C>T	ENST00000393207.1	+	7	965	c.744C>T	c.(742-744)gcC>gcT	p.A248A	BANP_ENST00000393208.2_Silent_p.A217A|BANP_ENST00000355163.5_Silent_p.A223A|BANP_ENST00000479780.2_Silent_p.A217A|BANP_ENST00000286122.7_Silent_p.A248A|BANP_ENST00000538234.1_Silent_p.A256A|BANP_ENST00000355022.4_Silent_p.A217A	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	248	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.|Interaction with CUX1 and HDAC1. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GCCGCACGGCCGAGAAGATGG	0.647													c|||	260	0.0519169	0.0061	0.1037	5008	,	,		19807	0.003		0.1153	False		,,,				2504	0.0624																0								C	,,,,,,	113,4281	84.4+/-122.9	1,111,2085	55.0	44.0	48.0		768,669,651,768,744,651,651	-2.1	1.0	16	dbSNP_123	48	1129,7471	231.2+/-265.3	74,981,3245	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BANP	NM_001173539.1,NM_001173540.1,NM_001173541.1,NM_001173542.1,NM_001173543.1,NM_017869.3,NM_079837.2	,,,,,,	75,1092,5330	TT,TC,CC		13.1279,2.5717,9.5583	,,,,,,	256/506,223/498,217/467,256/509,248/520,217/470,217/492	88052146	1242,11752	2197	4300	6497	SO:0001819	synonymous_variant	54971			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.744C>T	16.37:g.88052146C>T		Somatic		WXS	SOLID	Phase_I	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Silent	SNP	ENST00000393207.1	37	CCDS54054.1																																																																																				0.647	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269166.1		NM_017869	
BEND5	79656	hgsc.bcm.edu	37	1	49202004	49202004	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:49202004T>C	ENST00000371833.3	-	5	1101	c.1015A>G	c.(1015-1017)Aaa>Gaa	p.K339E	AGBL4_ENST00000371839.1_Intron|BEND5_ENST00000476096.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	339	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.					Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						CTTCTGTTTTTCAGAACATCT	0.468																																																	0													162.0	152.0	155.0					1																	49202004		2203	4300	6503	SO:0001583	missense	79656			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.1015A>G	1.37:g.49202004T>C	ENSP00000360899:p.Lys339Glu	Somatic		WXS	SOLID	Phase_I	D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	ENST00000371833.3	37	CCDS552.2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565394	0.86439	.	.	ENSG00000162373	ENST00000371833;ENST00000294347	T	0.44482	0.92	5.35	5.35	0.76521	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.50240	0.1604	L	0.27053	0.805	0.58432	D	0.999994	D	0.69078	0.997	D	0.77004	0.989	T	0.46148	-0.9212	9	.	.	.	-1.9664	14.5028	0.67734	0.0:0.0:0.0:1.0	.	339	Q7L4P6	BEND5_HUMAN	E	339;51	ENSP00000360899:K339E	.	K	-	1	0	BEND5	48974591	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.649000	0.83500	2.035000	0.60131	0.454000	0.30748	AAA		0.468	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1		NM_024603	
BCAS2	10286	hgsc.bcm.edu	37	1	115112664	115112664	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:115112664C>G	ENST00000369541.3	-	6	547	c.500G>C	c.(499-501)aGa>aCa	p.R167T	BCAS2_ENST00000485021.1_5'UTR	NM_005872.2	NP_005863.1	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	167					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cell junction (GO:0030054)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)				biliary_tract(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)	13	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATGTTCTTTCTCTGCCAGTT	0.294																																																	0													105.0	96.0	99.0					1																	115112664		2201	4298	6499	SO:0001583	missense	10286			AB020623	CCDS874.1	1p13.2	2010-01-25			ENSG00000116752	ENSG00000116752			975	protein-coding gene	gene with protein product		605783				9731529, 10403562	Standard	NM_005872		Approved	DAM1, SPF27, Snt309	uc001efa.3	O75934	OTTHUMG00000011898	ENST00000369541.3:c.500G>C	1.37:g.115112664C>G	ENSP00000358554:p.Arg167Thr	Somatic		WXS	SOLID	Phase_I	Q6FGS0	Missense_Mutation	SNP	ENST00000369541.3	37	CCDS874.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745511	0.89663	.	.	ENSG00000116752	ENST00000369541	.	.	.	5.36	5.36	0.76844	.	0.055739	0.64402	D	0.000001	D	0.83599	0.5289	M	0.89785	3.06	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	D	0.86510	0.1809	9	0.87932	D	0	-17.1148	19.4399	0.94815	0.0:1.0:0.0:0.0	.	167	O75934	SPF27_HUMAN	T	167	.	ENSP00000358554:R167T	R	-	2	0	BCAS2	114914187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.362000	0.79507	2.672000	0.90937	0.655000	0.94253	AGA		0.294	BCAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032871.1		NM_005872	
BTBD9	114781	hgsc.bcm.edu;ucsc.edu	37	6	38224273	38224273	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr6:38224273C>A	ENST00000481247.1	-	9	1625	c.1474G>T	c.(1474-1476)Gat>Tat	p.D492Y	BTBD9_ENST00000408958.1_Missense_Mutation_p.D424Y|BTBD9_ENST00000419706.2_Missense_Mutation_p.D462Y|BTBD9_ENST00000403056.1_Missense_Mutation_p.D492Y|BTBD9_ENST00000314100.6_Missense_Mutation_p.D424Y	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	492					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)					breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						CTTCGATCATCACAATCCCAA	0.423																																																	0													94.0	88.0	90.0					6																	38224273		1869	4105	5974	SO:0001583	missense	114781				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.1474G>T	6.37:g.38224273C>A	ENSP00000418751:p.Asp492Tyr	Somatic		WXS	SOLID	Phase_I	Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	ENST00000481247.1	37	CCDS47418.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898615	0.72639	.	.	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	4.97	4.97	0.65823	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000001	D	0.89836	0.6830	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.993	D	0.91934	0.5557	10	0.87932	D	0	.	17.2001	0.86903	0.0:1.0:0.0:0.0	.	462;492	Q494V9;Q96Q07	.;BTBD9_HUMAN	Y	424;492;462;492;424	ENSP00000323408:D424Y;ENSP00000418751:D492Y;ENSP00000415365:D462Y;ENSP00000386121:D492Y;ENSP00000386211:D424Y	ENSP00000323408:D424Y	D	-	1	0	BTBD9	38332251	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.641000	0.74324	2.584000	0.87258	0.563000	0.77884	GAT		0.423	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2		NM_152733	
PRR30	339779	hgsc.bcm.edu;ucsc.edu	37	2	27360063	27360063	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:27360063G>T	ENST00000335524.3	-	3	1660	c.1135C>A	c.(1135-1137)Cct>Act	p.P379T	PREB_ENST00000260643.2_5'Flank|PREB_ENST00000406567.3_5'Flank|PREB_ENST00000416802.1_5'Flank	NM_178553.3	NP_848648.2	Q53SZ7	PRR30_HUMAN		379										cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGCCCGAGGTGGAGGCCCG	0.602																																																	0													106.0	111.0	109.0					2																	27360063		2203	4300	6503	SO:0001583	missense	339779																														ENST00000335524.3:c.1135C>A	2.37:g.27360063G>T	ENSP00000335017:p.Pro379Thr	Somatic		WXS	SOLID	Phase_I	Q86UE2	Missense_Mutation	SNP	ENST00000335524.3	37	CCDS1739.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.159510	0.00321	.	.	ENSG00000186143	ENST00000335524	T	0.28255	1.62	4.55	2.71	0.32032	.	0.687345	0.12035	N	0.505581	T	0.14098	0.0341	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.35076	-0.9803	10	0.07325	T	0.83	0.0013	5.4413	0.16511	0.1048:0.0:0.6815:0.2137	.	379	Q53SZ7	CB053_HUMAN	T	379	ENSP00000335017:P379T	ENSP00000335017:P379T	P	-	1	0	C2orf53	27213567	0.008000	0.16893	0.000000	0.03702	0.046000	0.14306	1.137000	0.31479	0.617000	0.30160	0.561000	0.74099	CCT		0.602	C2orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250188.1			
CADM2	253559	hgsc.bcm.edu;ucsc.edu	37	3	85961677	85961677	+	Silent	SNP	G	G	A	rs375253682		TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:85961677G>A	ENST00000407528.2	+	5	719	c.657G>A	c.(655-657)caG>caA	p.Q219Q	CADM2_ENST00000405615.2_Silent_p.Q221Q|CADM2_ENST00000383699.3_Silent_p.Q228Q	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	219	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TAGCCATGCAGGTGCTAGAAA	0.478																																																	0													108.0	94.0	98.0					3																	85961677		2203	4300	6503	SO:0001819	synonymous_variant	253559			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.657G>A	3.37:g.85961677G>A		Somatic		WXS	SOLID	Phase_I	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Silent	SNP	ENST00000407528.2	37	CCDS54614.1																																																																																				0.478	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1		NM_153184	
CCT8L2	150160	hgsc.bcm.edu	37	22	17072822	17072822	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr22:17072822C>T	ENST00000359963.3	-	1	878	c.619G>A	c.(619-621)Gcg>Acg	p.A207T		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	207					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CCGGGCAGCGCGCACACCCCA	0.617																																																	0													64.0	63.0	63.0					22																	17072822		2203	4300	6503	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.619G>A	22.37:g.17072822C>T	ENSP00000353048:p.Ala207Thr	Somatic		WXS	SOLID	Phase_I	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	4.492	0.091233	0.08632	.	.	ENSG00000198445	ENST00000359963	T	0.76839	-1.05	1.78	-3.56	0.04626	.	1.965940	0.03364	N	0.197938	T	0.64864	0.2637	.	.	.	0.09310	N	1	B	0.13594	0.008	B	0.14023	0.01	T	0.47420	-0.9119	9	0.59425	D	0.04	-1.6843	3.3836	0.07264	0.2022:0.456:0.0:0.3418	.	207	Q96SF2	TCPQM_HUMAN	T	207	ENSP00000353048:A207T	ENSP00000353048:A207T	A	-	1	0	CCT8L2	15452822	0.395000	0.25254	0.019000	0.16419	0.033000	0.12548	-0.256000	0.08757	-1.184000	0.02720	-0.552000	0.04208	GCG		0.617	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			
CDH17	1015	hgsc.bcm.edu	37	8	95183103	95183103	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr8:95183103C>A	ENST00000027335.3	-	8	1018	c.894G>T	c.(892-894)ttG>ttT	p.L298F	CDH17_ENST00000450165.2_Missense_Mutation_p.L298F|CDH17_ENST00000441892.2_Intron	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	298	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CTTCTCGGTCCAAGGGCTGAG	0.428																																																	0													156.0	155.0	156.0					8																	95183103		2203	4300	6503	SO:0001583	missense	1015			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.894G>T	8.37:g.95183103C>A	ENSP00000027335:p.Leu298Phe	Somatic		WXS	SOLID	Phase_I	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133242	0.77662	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.74737	-0.87;-0.87	5.95	5.08	0.68730	Cadherin (4);Cadherin-like (1);	0.000000	0.44483	D	0.000446	D	0.89332	0.6685	H	0.94886	3.595	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.91713	0.5383	10	0.87932	D	0	-13.5993	12.7411	0.57253	0.0:0.9211:0.0:0.0789	.	298	Q12864	CAD17_HUMAN	F	298	ENSP00000027335:L298F;ENSP00000401468:L298F	ENSP00000027335:L298F	L	-	3	2	CDH17	95252279	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.531000	0.53546	1.518000	0.48934	0.650000	0.86243	TTG		0.428	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1		NM_004063	
CDHR1	92211	hgsc.bcm.edu;ucsc.edu	37	10	85960364	85960364	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr10:85960364C>T	ENST00000372117.3	+	6	549	c.446C>T	c.(445-447)cCt>cTt	p.P149L	CDHR1_ENST00000332904.3_Missense_Mutation_p.P149L|CDHR1_ENST00000440770.2_5'Flank	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	149	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CAGGACATACCTGCTGGGAGC	0.597																																																	0													84.0	61.0	68.0					10																	85960364		2203	4300	6503	SO:0001583	missense	92211			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.446C>T	10.37:g.85960364C>T	ENSP00000361189:p.Pro149Leu	Somatic		WXS	SOLID	Phase_I	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094411	0.56075	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.01647	4.71;4.71	5.44	4.53	0.55603	Cadherin (4);Cadherin-like (1);	0.303131	0.36740	N	0.002434	T	0.03305	0.0096	L	0.60067	1.865	0.80722	D	1	B;B	0.16802	0.019;0.014	B;B	0.24848	0.015;0.056	T	0.44375	-0.9332	10	0.35671	T	0.21	-6.4291	14.4543	0.67407	0.1488:0.8512:0.0:0.0	.	149;149	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	L	149	ENSP00000331063:P149L;ENSP00000361189:P149L	ENSP00000331063:P149L	P	+	2	0	CDHR1	85950344	0.998000	0.40836	0.996000	0.52242	0.945000	0.59286	3.357000	0.52277	1.260000	0.44134	-0.182000	0.12963	CCT		0.597	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1		NM_033100	
CLDND1	56650	hgsc.bcm.edu;ucsc.edu	37	3	98240229	98240229	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:98240229C>A	ENST00000503004.1	-	2	919	c.40G>T	c.(40-42)Gtg>Ttg	p.V14L	CLDND1_ENST00000341181.6_Missense_Mutation_p.V14L|CLDND1_ENST00000502288.1_Intron|CLDND1_ENST00000510545.1_Missense_Mutation_p.V14L|CLDND1_ENST00000437922.1_Missense_Mutation_p.V37L|CLDND1_ENST00000394181.2_Missense_Mutation_p.V14L|CLDND1_ENST00000511081.1_Intron|CLDND1_ENST00000394185.2_Missense_Mutation_p.V14L|RP11-227H4.5_ENST00000502999.1_RNA|CLDND1_ENST00000508503.1_5'UTR|CLDND1_ENST00000394180.2_Missense_Mutation_p.V14L|CLDND1_ENST00000507874.1_Missense_Mutation_p.V14L|CLDND1_ENST00000513287.1_Missense_Mutation_p.V14L			Q9NY35	CLDN1_HUMAN	claudin domain containing 1	14						apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	9						AGGCTAAGCACACAAGCAATT	0.403																																																	0													105.0	100.0	102.0					3																	98240229		2203	4300	6503	SO:0001583	missense	56650			AF116664	CCDS2930.1, CCDS43116.1	3q12.1	2005-12-23	2005-12-23	2005-12-23		ENSG00000080822			1322	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 4"""	C3orf4			Standard	NM_001040181		Approved		uc003dst.3	Q9NY35		ENST00000503004.1:c.40G>T	3.37:g.98240229C>A	ENSP00000421226:p.Val14Leu	Somatic		WXS	SOLID	Phase_I	B3KQR1|D3DN36|F2Z2D9|Q502Y8|Q6UVX2|Q9BUZ9|Q9NZZ5|Q9Y4S9	Missense_Mutation	SNP	ENST00000503004.1	37	CCDS2930.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.789780	0.31685	.	.	ENSG00000080822	ENST00000507874;ENST00000341181;ENST00000437922;ENST00000394180;ENST00000503004;ENST00000394185;ENST00000394181;ENST00000510545;ENST00000513287;ENST00000513452;ENST00000502299;ENST00000508902;ENST00000514537;ENST00000515620;ENST00000507944;ENST00000508659;ENST00000508071;ENST00000513130;ENST00000506575	T;T;T;T;T;T;T;T;T;T;T;T	0.38560	1.55;1.49;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.58;1.57;1.13	5.14	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.30448	0.0765	L	0.32530	0.975	0.80722	D	1	P;P;B	0.38148	0.62;0.62;0.005	B;B;B	0.32211	0.142;0.087;0.018	T	0.08659	-1.0711	10	0.46703	T	0.11	-13.49	13.3827	0.60778	0.0:0.8406:0.1594:0.0	.	14;14;14	D6RCR8;Q9NY35;Q9NY35-2	.;CLDN1_HUMAN;.	L	14;14;37;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14	ENSP00000340247:V14L;ENSP00000388457:V37L;ENSP00000377734:V14L;ENSP00000421226:V14L;ENSP00000377739:V14L;ENSP00000377735:V14L;ENSP00000423590:V14L;ENSP00000426869:V14L;ENSP00000425539:V14L;ENSP00000420913:V14L;ENSP00000421413:V14L;ENSP00000423151:V14L	ENSP00000340247:V14L	V	-	1	0	CLDND1	99722919	1.000000	0.71417	1.000000	0.80357	0.283000	0.27025	4.180000	0.58296	1.128000	0.42052	-0.175000	0.13238	GTG		0.403	CLDND1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359071.1		NM_019895	
CUL9	23113	hgsc.bcm.edu;ucsc.edu	37	6	43182827	43182827	+	Missense_Mutation	SNP	C	C	A	rs146106470		TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr6:43182827C>A	ENST00000252050.4	+	30	5783	c.5699C>A	c.(5698-5700)gCc>gAc	p.A1900D	CUL9_ENST00000354495.3_Missense_Mutation_p.A1790D|CUL9_ENST00000372647.2_Missense_Mutation_p.A1872D|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1900					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GTGCTGGAGGCCTGGCAGAAG	0.557																																																	0													82.0	86.0	85.0					6																	43182827		2203	4300	6503	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5699C>A	6.37:g.43182827C>A	ENSP00000252050:p.Ala1900Asp	Somatic		WXS	SOLID	Phase_I	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820539	0.90873	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.79141	-1.24;-1.24;-1.16	5.33	5.33	0.75918	Cullin protein, neddylation domain (1);	0.515153	0.22384	N	0.060773	D	0.85792	0.5779	M	0.66939	2.045	0.58432	D	0.999996	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.996;0.996	D	0.86984	0.2106	10	0.87932	D	0	-22.4243	19.0368	0.92982	0.0:1.0:0.0:0.0	.	1790;1872;1900	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	D	1900;1790;1872	ENSP00000252050:A1900D;ENSP00000346490:A1790D;ENSP00000361730:A1872D	ENSP00000252050:A1900D	A	+	2	0	CUL9	43290805	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.013000	0.70776	2.492000	0.84095	0.655000	0.94253	GCC		0.557	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2		NM_015089	
DDX23	9416	hgsc.bcm.edu;ucsc.edu	37	12	49224320	49224320	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr12:49224320G>C	ENST00000308025.3	-	17	2474	c.2395C>G	c.(2395-2397)Cca>Gca	p.P799A		NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	799	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						TGGGCATCTGGGTGGTTGGCT	0.562																																																	0													113.0	101.0	105.0					12																	49224320		2203	4300	6503	SO:0001583	missense	9416			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.2395C>G	12.37:g.49224320G>C	ENSP00000310723:p.Pro799Ala	Somatic		WXS	SOLID	Phase_I	B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	37	CCDS8770.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625949	0.87560	.	.	ENSG00000174243	ENST00000308025	T	0.19669	2.13	5.97	5.97	0.96955	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.41789	0.1174	L	0.46741	1.465	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.01626	-1.1309	10	0.40728	T	0.16	-9.642	19.1994	0.93704	0.0:0.0:1.0:0.0	.	799	Q9BUQ8	DDX23_HUMAN	A	799	ENSP00000310723:P799A	ENSP00000310723:P799A	P	-	1	0	DDX23	47510587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.744000	0.98853	2.837000	0.97791	0.655000	0.94253	CCA		0.562	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2		NM_004818	
DEF8	54849	hgsc.bcm.edu	37	16	90020723	90020723	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr16:90020723G>T	ENST00000268676.7	+	3	335	c.246G>T	c.(244-246)caG>caT	p.Q82H	DEF8_ENST00000567874.1_Intron|DEF8_ENST00000563795.1_Missense_Mutation_p.Q21H|DEF8_ENST00000563594.1_Missense_Mutation_p.Q21H|DEF8_ENST00000418391.2_Missense_Mutation_p.Q21H|DEF8_ENST00000569453.1_Missense_Mutation_p.Q21H|DEF8_ENST00000570182.1_Missense_Mutation_p.Q21H	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	82					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		TCAACAAGCAGTCTGGGCCGA	0.637																																																	0													75.0	73.0	73.0					16																	90020723		2198	4300	6498	SO:0001583	missense	54849			AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.246G>T	16.37:g.90020723G>T	ENSP00000268676:p.Gln82His	Somatic		WXS	SOLID	Phase_I	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Missense_Mutation	SNP	ENST00000268676.7	37	CCDS10989.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749911	0.30955	.	.	ENSG00000140995	ENST00000268676;ENST00000418391	T;T	0.47177	0.85;0.86	4.99	2.99	0.34606	.	0.507825	0.20701	N	0.087273	T	0.40448	0.1117	L	0.60455	1.87	0.28158	N	0.929125	B;B;B;B	0.09022	0.0;0.0;0.001;0.002	B;B;B;B	0.10450	0.001;0.002;0.001;0.005	T	0.40496	-0.9560	10	0.62326	D	0.03	-18.9866	5.8024	0.18422	0.1681:0.3039:0.528:0.0	.	21;21;82;21	Q6ZN54-5;Q6ZN54-3;Q6ZN54;Q6ZN54-2	.;.;DEFI8_HUMAN;.	H	82;21	ENSP00000268676:Q82H;ENSP00000412784:Q21H	ENSP00000268676:Q82H	Q	+	3	2	DEF8	88548224	0.938000	0.31826	0.606000	0.28943	0.677000	0.39632	1.376000	0.34306	0.601000	0.29879	0.561000	0.74099	CAG		0.637	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1		NM_207514	
DEPTOR	64798	hgsc.bcm.edu;ucsc.edu	37	8	121021276	121021276	+	Silent	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr8:121021276T>C	ENST00000286234.5	+	8	1135	c.1005T>C	c.(1003-1005)ggT>ggC	p.G335G	DEPTOR_ENST00000518057.1_3'UTR|DEPTOR_ENST00000523492.1_Silent_p.G234G	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	335	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						AGATTGTTGGTGACGCGGTTG	0.532																																																	0													172.0	113.0	133.0					8																	121021276		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.1005T>C	8.37:g.121021276T>C		Somatic		WXS	SOLID	Phase_I	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Silent	SNP	ENST00000286234.5	37	CCDS6331.1																																																																																				0.532	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1		NM_022783	
DOLPP1	57171	hgsc.bcm.edu	37	9	131848530	131848530	+	Missense_Mutation	SNP	C	C	T	rs140111931		TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr9:131848530C>T	ENST00000372546.4	+	6	606	c.574C>T	c.(574-576)Ccc>Tcc	p.P192S	DOLPP1_ENST00000540102.1_Intron|DOLPP1_ENST00000406974.3_Intron	NM_020438.4	NP_065171.2	Q86YN1	DOPP1_HUMAN	dolichyldiphosphatase 1	192					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|lipid biosynthetic process (GO:0008610)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichyldiphosphatase activity (GO:0047874)	p.P192S(1)		endometrium(3)|kidney(2)|lung(7)|skin(1)	13						CCCGCTGTTCCCCAGGATAGC	0.637																																																	1	Substitution - Missense(1)	skin(1)											84.0	65.0	72.0					9																	131848530		2203	4300	6503	SO:0001583	missense	57171			BC009493	CCDS6918.1, CCDS48039.1	9q34.1	2013-05-21	2013-05-21		ENSG00000167130	ENSG00000167130	3.6.1.43		29565	protein-coding gene	gene with protein product	"""linked to Surfeit genes in Fugu rubripes 2"""	614516	"""dolichyl pyrophosphate phosphatase 1"""			10369878, 12198133	Standard	NM_020438		Approved	LSFR2	uc004bxc.3	Q86YN1	OTTHUMG00000020771	ENST00000372546.4:c.574C>T	9.37:g.131848530C>T	ENSP00000361625:p.Pro192Ser	Somatic		WXS	SOLID	Phase_I	A8K3U8|B0QZG4|Q96GF8|Q9Y3G1	Missense_Mutation	SNP	ENST00000372546.4	37	CCDS6918.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910528	0.92107	.	.	ENSG00000167130	ENST00000372546	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.84683	0.5526	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86609	0.1871	9	0.62326	D	0.03	-10.8493	18.4663	0.90757	0.0:1.0:0.0:0.0	.	192	Q86YN1	DOPP1_HUMAN	S	192	.	ENSP00000361625:P192S	P	+	1	0	DOLPP1	130888351	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.457000	0.80775	2.604000	0.88044	0.456000	0.33151	CCC		0.637	DOLPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054548.4		NM_020438	
DPY19L4	286148	hgsc.bcm.edu	37	8	95793334	95793334	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr8:95793334A>C	ENST00000414645.2	+	16	1754	c.1655A>C	c.(1654-1656)gAa>gCa	p.E552A		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	552						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					TTAATGACAGAATTAATGGAA	0.308																																																	0													60.0	62.0	61.0					8																	95793334		2203	4295	6498	SO:0001583	missense	286148				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1655A>C	8.37:g.95793334A>C	ENSP00000389630:p.Glu552Ala	Somatic		WXS	SOLID	Phase_I	Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	ENST00000414645.2	37	CCDS34924.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.409996	0.83340	.	.	ENSG00000156162	ENST00000414645	T	0.58060	0.36	5.34	5.34	0.76211	.	0.050452	0.85682	D	0.000000	T	0.64382	0.2593	M	0.74647	2.275	0.58432	D	0.999997	P	0.52170	0.951	P	0.51297	0.665	T	0.68554	-0.5378	10	0.52906	T	0.07	-17.1083	15.356	0.74428	1.0:0.0:0.0:0.0	.	552	Q7Z388	D19L4_HUMAN	A	552	ENSP00000389630:E552A	ENSP00000389630:E552A	E	+	2	0	DPY19L4	95862510	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.291000	0.89927	2.023000	0.59567	0.455000	0.32223	GAA		0.308	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379339.1		NM_181787	
DUOXA1	90527	hgsc.bcm.edu;ucsc.edu	37	15	45412946	45412946	+	Missense_Mutation	SNP	C	C	T	rs75981505	byFrequency	TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr15:45412946C>T	ENST00000560572.1	-	4	403	c.398G>A	c.(397-399)cGc>cAc	p.R133H	DUOXA1_ENST00000558422.1_Missense_Mutation_p.R88H|DUOXA1_ENST00000558996.1_Missense_Mutation_p.R88H|DUOXA1_ENST00000430224.2_Missense_Mutation_p.R88H|DUOXA1_ENST00000559014.1_Missense_Mutation_p.R133H|DUOXA1_ENST00000267803.4_Missense_Mutation_p.R133H	NM_001276266.1	NP_001263195.1	Q1HG43	DOXA1_HUMAN	dual oxidase maturation factor 1	133					hydrogen peroxide metabolic process (GO:0042743)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R133H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		CTCACCCAGGCGCCAGGTGAA	0.567													C|||	2	0.000399361	0.0	0.0	5008	,	,		19898	0.001		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						C	HIS/ARG	0,4396		0,0,2198	161.0	162.0	162.0		398	-2.4	1.0	15	dbSNP_131	162	2,8594	3.0+/-9.4	0,2,4296	yes	missense	DUOXA1	NM_144565.2	29	0,2,6494	TT,TC,CC		0.0233,0.0,0.0154	benign	133/484	45412946	2,12990	2198	4298	6496	SO:0001583	missense	90527			BC029819	CCDS10119.1, CCDS61619.1, CCDS61620.1, CCDS61621.1	15q21.1	2006-11-29	2006-01-23	2006-07-25	ENSG00000140254	ENSG00000140254			26507	protein-coding gene	gene with protein product		612771				16651268	Standard	NM_144565		Approved	FLJ32334, NUMBIP, NIP, mol	uc010bec.4	Q1HG43	OTTHUMG00000131352	ENST00000560572.1:c.398G>A	15.37:g.45412946C>T	ENSP00000454084:p.Arg133His	Somatic		WXS	SOLID	Phase_I	Q8N6K9|Q96MI4	Missense_Mutation	SNP	ENST00000560572.1	37		.	.	.	.	.	.	.	.	.	.	C	13.35	2.211640	0.39102	0.0	2.33E-4	ENSG00000140254	ENST00000267803;ENST00000430224	T;T	0.55413	0.52;0.52	5.44	-2.44	0.06502	.	0.576970	0.20211	N	0.096902	T	0.32285	0.0824	N	0.24115	0.695	0.23528	N	0.997485	B;B;B;B	0.21905	0.062;0.014;0.008;0.031	B;B;B;B	0.24541	0.054;0.011;0.014;0.036	T	0.19844	-1.0293	10	0.54805	T	0.06	-6.7677	7.3991	0.26954	0.0:0.3832:0.1165:0.5003	.	88;88;133;133	B5M0C0;B5M0B8;Q1HG43;A8K9Q6	.;.;DOXA1_HUMAN;.	H	133;88	ENSP00000267803:R133H;ENSP00000415512:R88H	ENSP00000267803:R133H	R	-	2	0	DUOXA1	43200238	0.000000	0.05858	0.981000	0.43875	0.718000	0.41266	-1.290000	0.02777	-0.291000	0.09012	-0.133000	0.14855	CGC		0.567	DUOXA1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000416242.1		NM_144565	
DUSP27	92235	hgsc.bcm.edu;ucsc.edu	37	1	167096184	167096184	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:167096184G>T	ENST00000361200.2	+	6	1982	c.1816G>T	c.(1816-1818)Gag>Tag	p.E606*	DUSP27_ENST00000443333.1_Nonsense_Mutation_p.E606*|DUSP27_ENST00000271385.5_Nonsense_Mutation_p.E606*|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	606					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TGAGAACAAGGAGGAGGTGGT	0.607																																																	0													51.0	50.0	50.0					1																	167096184		2203	4300	6503	SO:0001587	stop_gained	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1816G>T	1.37:g.167096184G>T	ENSP00000354483:p.Glu606*	Somatic		WXS	SOLID	Phase_I	A0AUM4|Q9C074	Nonsense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	40	7.987504	0.98596	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	.	.	.	5.22	4.31	0.51392	.	0.168757	0.37623	N	0.002004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.9768	15.9944	0.80230	0.0:0.1349:0.8651:0.0	.	.	.	.	X	606	.	ENSP00000271385:E606X	E	+	1	0	DUSP27	165362808	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.462000	0.66707	1.201000	0.43203	-0.134000	0.14843	GAG		0.607	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1		NM_001080426	
EIF2AK2	5610	hgsc.bcm.edu	37	2	37374007	37374007	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:37374007T>A	ENST00000233057.4	-	4	551	c.229A>T	c.(229-231)Aag>Tag	p.K77*	EIF2AK2_ENST00000395127.2_Nonsense_Mutation_p.K77*|EIF2AK2_ENST00000405334.1_Nonsense_Mutation_p.K77*	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	77	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				TTCTTTTCCTTATTAAGTATC	0.343																																																	0													142.0	137.0	139.0					2																	37374007		2203	4299	6502	SO:0001587	stop_gained	5610			BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.229A>T	2.37:g.37374007T>A	ENSP00000233057:p.Lys77*	Somatic		WXS	SOLID	Phase_I	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Nonsense_Mutation	SNP	ENST00000233057.4	37	CCDS1786.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.755453	0.89843	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334;ENST00000379156;ENST00000411537;ENST00000390013	.	.	.	4.68	0.733	0.18289	.	0.684628	0.13860	N	0.357705	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8028	5.3359	0.15957	0.0:0.0949:0.3467:0.5584	.	.	.	.	X	77	.	ENSP00000233057:K77X	K	-	1	0	EIF2AK2	37227511	0.000000	0.05858	0.031000	0.17742	0.040000	0.13550	-0.533000	0.06157	0.020000	0.15106	0.528000	0.53228	AAG		0.343	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2		NM_002759	
EPC2	26122	hgsc.bcm.edu	37	2	149447846	149447846	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:149447846G>A	ENST00000258484.6	+	2	251	c.217G>A	c.(217-219)Gtc>Atc	p.V73I	EPC2_ENST00000409654.1_Missense_Mutation_p.V73I	NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	73					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		AGAGAGTATGGTCATTCCTGT	0.378																																																	0													166.0	155.0	159.0					2																	149447846		1888	4117	6005	SO:0001583	missense	26122			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.217G>A	2.37:g.149447846G>A	ENSP00000258484:p.Val73Ile	Somatic		WXS	SOLID	Phase_I	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	37	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315543	0.81469	.	.	ENSG00000135999	ENST00000457184;ENST00000258484;ENST00000409654;ENST00000397424;ENST00000449013	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	5.67	5.67	0.87782	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.42017	0.1184	N	0.02985	-0.445	0.80722	D	1	D	0.63046	0.992	D	0.77004	0.989	T	0.53301	-0.8458	10	0.23891	T	0.37	-2.7129	19.7784	0.96405	0.0:0.0:1.0:0.0	.	73	Q52LR7	EPC2_HUMAN	I	49;73;73;2;22	ENSP00000415543:V49I;ENSP00000258484:V73I;ENSP00000387097:V73I;ENSP00000380569:V2I;ENSP00000395431:V22I	ENSP00000258484:V73I	V	+	1	0	EPC2	149164316	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.658000	0.90341	0.591000	0.81541	GTC		0.378	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1		NM_015630	
PIEZO1	9780	hgsc.bcm.edu	37	16	88802748	88802748	+	Silent	SNP	C	C	T	rs61742623	byFrequency	TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr16:88802748C>T	ENST00000301015.9	-	12	1611	c.1365G>A	c.(1363-1365)acG>acA	p.T455T	RP5-1142A6.2_ENST00000440406.2_RNA|RP5-1142A6.2_ENST00000567968.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	455					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GGCTGCGCACCGTCCAGATGA	0.642													C|||	225	0.0449281	0.0507	0.0346	5008	,	,		16919	0.001		0.1213	False		,,,				2504	0.0112																0								C		77,1307		2,73,617	78.0	96.0	91.0		1365	-10.4	0.2	16	dbSNP_129	91	411,2771		31,349,1211	no	coding-synonymous	PIEZO1	NM_001142864.2		33,422,1828	TT,TC,CC		12.9164,5.5636,10.6877		455/2522	88802748	488,4078	692	1591	2283	SO:0001819	synonymous_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.1365G>A	16.37:g.88802748C>T		Somatic		WXS	SOLID	Phase_I	A6NHT9|A7E2B7|Q0KKZ9	Silent	SNP	ENST00000301015.9	37	CCDS54058.1	142	0.06501831501831502	25	0.0508130081300813	11	0.03038674033149171	0	0.0	106	0.13984168865435356	C	10.74	1.434953	0.25813	0.055636	0.129164	ENSG00000103335	ENST00000451779	.	.	.	5.22	-10.4	0.00318	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.21386	P	0.99970801	.	.	.	.	.	.	T	0.13495	-1.0507	3	.	.	.	-17.6325	1.4595	0.02392	0.2141:0.2121:0.3362:0.2376	.	.	.	.	S	401	.	.	G	-	1	0	FAM38A	87330249	0.000000	0.05858	0.220000	0.23810	0.995000	0.86356	-8.695000	0.00017	-1.648000	0.01510	0.591000	0.81541	GGT		0.642	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4		NM_014745	
GON4L	54856	hgsc.bcm.edu	37	1	155733233	155733233	+	Silent	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:155733233T>C	ENST00000368331.1	-	22	4644	c.4596A>G	c.(4594-4596)gcA>gcG	p.A1532A	GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000437809.1_Silent_p.A1532A|GON4L_ENST00000271883.5_Silent_p.A1532A	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1532	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCATTCcttctgcttcttctt	0.502																																																	0													39.0	39.0	39.0					1																	155733233		1968	4178	6146	SO:0001819	synonymous_variant	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4596A>G	1.37:g.155733233T>C		Somatic		WXS	SOLID	Phase_I	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																					0.502	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_032292	
SLC52A1	55065	hgsc.bcm.edu	37	17	4936580	4936582	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	GCC	GCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:4936580_4936582delGCC	ENST00000424747.1	-	4	1820_1822	c.1108_1110delGGC	c.(1108-1110)ggcdel	p.G370del	SLC52A1_ENST00000512825.2_Intron|SLC52A1_ENST00000254853.5_In_Frame_Del_p.G370del	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	370					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)										CTGCAGTGGTGCCCACCAGGGGT	0.626																																																	0																																										SO:0001651	inframe_deletion	0			AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.1108_1110delGGC	17.37:g.4936580_4936582delGCC	ENSP00000399979:p.Gly370del	Somatic		WXS	SOLID	Phase_I	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	In_Frame_Del	DEL	ENST00000424747.1	37	CCDS11066.1																																																																																				0.626	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1		NM_017986	
GPATCH8	23131	hgsc.bcm.edu;ucsc.edu	37	17	42475998	42475998	+	Silent	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:42475998C>T	ENST00000591680.1	-	8	3477	c.3447G>A	c.(3445-3447)ggG>ggA	p.G1149G	GPATCH8_ENST00000434000.1_Silent_p.G1071G	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1149							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CTGGGAGCTTCCCTATCAGTG	0.552																																																	0													139.0	145.0	143.0					17																	42475998		2203	4300	6503	SO:0001819	synonymous_variant	23131			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.3447G>A	17.37:g.42475998C>T		Somatic		WXS	SOLID	Phase_I	B9EGP9|O60300|Q8TB99	Silent	SNP	ENST00000591680.1	37	CCDS32666.1																																																																																				0.552	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1		NM_001002909	
HCN2	610	hgsc.bcm.edu	37	19	605090	605090	+	Silent	SNP	C	C	T	rs56279131	byFrequency	TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr19:605090C>T	ENST00000251287.2	+	3	1139	c.1086C>T	c.(1084-1086)agC>agT	p.S362S		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	362					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCTGGCCAGCGCGGTGATGA	0.642													c|||	29	0.00579073	0.0	0.0043	5008	,	,		9212	0.0		0.0179	False		,,,				2504	0.0082				Melanoma(145;1175 2427 8056 36306)												0								C		17,4389		0,17,2186	81.0	68.0	72.0		1086	-2.7	0.9	19	dbSNP_129	72	201,8391		1,199,4096	no	coding-synonymous	HCN2	NM_001194.3		1,216,6282	TT,TC,CC		2.3394,0.3858,1.6772		362/890	605090	218,12780	2203	4296	6499	SO:0001819	synonymous_variant	610			AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1086C>T	19.37:g.605090C>T		Somatic		WXS	SOLID	Phase_I	O60742|O60743|O75267|Q9UBS2	Silent	SNP	ENST00000251287.2	37	CCDS12035.1																																																																																				0.642	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452100.1		NM_001194	
HHAT	55733	hgsc.bcm.edu;ucsc.edu	37	1	210573841	210573841	+	Silent	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:210573841G>T	ENST00000367010.1	+	5	530	c.303G>T	c.(301-303)ggG>ggT	p.G101G	HHAT_ENST00000413764.2_Silent_p.G101G|HHAT_ENST00000537898.1_Intron|HHAT_ENST00000261458.3_Silent_p.G101G|HHAT_ENST00000308852.6_Silent_p.G56G|HHAT_ENST00000391905.3_Silent_p.G101G|HHAT_ENST00000545154.1_Silent_p.G102G|HHAT_ENST00000541565.1_Intron|HHAT_ENST00000545781.1_Silent_p.G38G	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	101					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TGCTCTATGGGATGTGGGCCT	0.567											OREG0012978	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													121.0	109.0	113.0					1																	210573841		2203	4300	6503	SO:0001819	synonymous_variant	55733			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.303G>T	1.37:g.210573841G>T		Somatic	2191	WXS	SOLID	Phase_I	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Silent	SNP	ENST00000367010.1	37	CCDS1495.1																																																																																				0.567	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1		NM_018194	
HMGCLL1	54511	hgsc.bcm.edu;ucsc.edu	37	6	55406919	55406919	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr6:55406919C>A	ENST00000398661.2	-	3	349	c.218G>T	c.(217-219)gGa>gTa	p.G73V	HMGCLL1_ENST00000308161.4_Missense_Mutation_p.G43V|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.G43V|HMGCLL1_ENST00000428842.1_Missense_Mutation_p.G43V|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.G43V|HMGCLL1_ENST00000508459.1_Missense_Mutation_p.G43V	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	73					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			CTCAGGGAGTCCAGATAACTG	0.338																																					Ovarian(35;840 893 7837 15538 42887)												0													79.0	72.0	74.0					6																	55406919		1815	4081	5896	SO:0001583	missense	54511			AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.218G>T	6.37:g.55406919C>A	ENSP00000381654:p.Gly73Val	Somatic		WXS	SOLID	Phase_I	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	C	9.866	1.197633	0.22037	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000508459;ENST00000308161;ENST00000428842	D;D;D;D;D;D	0.98164	-4.64;-4.59;-4.51;-3.91;-4.76;-3.63	5.51	4.65	0.58169	.	0.286591	0.34067	N	0.004300	D	0.96836	0.8967	N	0.19112	0.55	0.80722	D	1	D;D;B;B;B;B	0.76494	0.999;0.999;0.037;0.171;0.081;0.086	D;D;B;B;B;B	0.68765	0.941;0.96;0.033;0.085;0.053;0.035	D	0.98057	1.0391	10	0.59425	D	0.04	-21.6048	14.0984	0.65039	0.0:0.9281:0.0:0.0719	.	43;43;43;43;43;73	B7Z4D4;B7Z212;F8W793;G5E9S9;Q8TB92-2;Q8TB92	.;.;.;.;.;HMGC2_HUMAN	V	43;73;43;43;43;43	ENSP00000274901:G43V;ENSP00000381654:G73V;ENSP00000359887:G43V;ENSP00000424309:G43V;ENSP00000309737:G43V;ENSP00000412924:G43V	ENSP00000274901:G43V	G	-	2	0	HMGCLL1	55514878	1.000000	0.71417	0.998000	0.56505	0.153000	0.21895	1.381000	0.34362	1.343000	0.45638	0.655000	0.94253	GGA		0.338	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1		XM_166383	
HNRNPU	3192	hgsc.bcm.edu;ucsc.edu	37	1	245022575	245022575	+	Splice_Site	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:245022575A>G	ENST00000283179.9	-	5	1281		c.e5+1		HNRNPU_ENST00000444376.2_Splice_Site			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)						CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			AAGAAGCTTTACCAAGTAACA	0.368																																					NSCLC(33;911 1010 3329 23631 49995)												0													112.0	112.0	112.0					1																	245022575		2202	4300	6502	SO:0001630	splice_region_variant	3192			X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.1117+1T>C	1.37:g.245022575A>G		Somatic		WXS	SOLID	Phase_I	O75507|Q8N174|Q96HY9|Q9BQ09	Splice_Site	SNP	ENST00000283179.9	37	CCDS41479.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.015052	0.75161	.	.	ENSG00000153187	ENST00000444376;ENST00000283179;ENST00000427948;ENST00000440865	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9552	0.79884	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HNRNPU	243089198	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.287000	0.95975	2.219000	0.72066	0.482000	0.46254	.		0.368	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097163.3		NM_031844	Intron
IRF9	10379	hgsc.bcm.edu;ucsc.edu	37	14	24632648	24632648	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr14:24632648G>A	ENST00000396864.3	+	4	713	c.426G>A	c.(424-426)agG>agA	p.R142R	RP11-468E2.4_ENST00000558468.1_3'UTR|IRF9_ENST00000557894.1_Silent_p.R40R	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	142					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R142S(1)		NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		CCTCTGAGAGGAAGGAGGAAG	0.532																																																	1	Substitution - Missense(1)	ovary(1)											172.0	160.0	164.0					14																	24632648		2203	4300	6503	SO:0001819	synonymous_variant	10379			M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.426G>A	14.37:g.24632648G>A		Somatic		WXS	SOLID	Phase_I	D3DS61	Silent	SNP	ENST00000396864.3	37	CCDS9615.1																																																																																				0.532	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071927.2			
ITGAE	3682	hgsc.bcm.edu;ucsc.edu	37	17	3667207	3667207	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:3667207T>C	ENST00000263087.4	-	3	301	c.203A>G	c.(202-204)cAt>cGt	p.H68R		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	68					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		GGAACATCGATGGAGGGGCCC	0.567																																					NSCLC(182;635 2928 8995 38788)												0													86.0	80.0	82.0					17																	3667207		2203	4300	6503	SO:0001583	missense	3682			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.203A>G	17.37:g.3667207T>C	ENSP00000263087:p.His68Arg	Somatic		WXS	SOLID	Phase_I	Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	T	11.52	1.662985	0.29515	.	.	ENSG00000083457	ENST00000263087	D	0.97066	-4.23	3.76	3.76	0.43208	.	.	.	.	.	D	0.94212	0.8142	L	0.43923	1.385	0.09310	N	1	B	0.30763	0.294	B	0.30251	0.113	D	0.90266	0.4304	9	0.87932	D	0	.	9.1616	0.37025	0.0:0.0:0.0:1.0	.	68	P38570	ITAE_HUMAN	R	68	ENSP00000263087:H68R	ENSP00000263087:H68R	H	-	2	0	ITGAE	3613956	0.094000	0.21725	0.177000	0.23020	0.012000	0.07955	2.031000	0.41117	1.957000	0.56846	0.421000	0.28195	CAT		0.567	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1		NM_002208	
ITIH2	3698	hgsc.bcm.edu;ucsc.edu	37	10	7780665	7780665	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr10:7780665T>C	ENST00000358415.4	+	16	2205	c.2039T>C	c.(2038-2040)aTg>aCg	p.M680T	ITIH2_ENST00000379587.4_Missense_Mutation_p.M669T	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	680					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						GTGATCTCCATGCTGGCACAA	0.572																																																	0													126.0	107.0	113.0					10																	7780665		2203	4300	6503	SO:0001583	missense	3698			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.2039T>C	10.37:g.7780665T>C	ENSP00000351190:p.Met680Thr	Somatic		WXS	SOLID	Phase_I	Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	CCDS31141.1	.	.	.	.	.	.	.	.	.	.	T	4.864	0.160583	0.09287	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.01397	4.94;4.94	5.23	5.23	0.72850	.	0.728615	0.11175	U	0.591612	T	0.01765	0.0056	L	0.36672	1.1	0.35830	D	0.825246	B	0.11235	0.004	B	0.08055	0.003	T	0.48340	-0.9044	10	0.13108	T	0.6	-15.6647	12.5059	0.55981	0.0:0.0:0.0:1.0	.	680	P19823	ITIH2_HUMAN	T	680;669	ENSP00000351190:M680T;ENSP00000368906:M669T	ENSP00000351190:M680T	M	+	2	0	ITIH2	7820671	0.937000	0.31787	0.239000	0.24122	0.005000	0.04900	2.600000	0.46240	1.985000	0.57927	0.454000	0.30748	ATG		0.572	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2		NM_002216	
ITSN2	50618	hgsc.bcm.edu;ucsc.edu	37	2	24493591	24493591	+	Silent	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:24493591A>G	ENST00000355123.4	-	20	2747	c.2304T>C	c.(2302-2304)ttT>ttC	p.F768F	ITSN2_ENST00000361999.3_Silent_p.F741F|ITSN2_ENST00000406921.3_Silent_p.F768F|SCARNA21_ENST00000515996.1_RNA	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	768	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTTGCTTCAAAGGGGTATA	0.308																																																	0													130.0	123.0	125.0					2																	24493591		2203	4299	6502	SO:0001819	synonymous_variant	50618			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2304T>C	2.37:g.24493591A>G		Somatic		WXS	SOLID	Phase_I	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	ENST00000355123.4	37	CCDS1710.2																																																																																				0.308	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2		NM_006277	
KCNH3	23416	hgsc.bcm.edu	37	12	49950251	49950251	+	Missense_Mutation	SNP	C	C	G	rs113209368	byFrequency	TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr12:49950251C>G	ENST00000257981.6	+	13	2827	c.2567C>G	c.(2566-2568)cCt>cGt	p.P856R	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	856					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						AGCCCCTCCCCTGGACCAGGT	0.602													C|||	162	0.0323482	0.0038	0.0519	5008	,	,		18702	0.0		0.0547	False		,,,				2504	0.0675																0								C	ARG/PRO	70,4336	62.3+/-99.4	0,70,2133	53.0	48.0	50.0		2567	5.2	1.0	12	dbSNP_132	50	634,7966	159.1+/-212.4	27,580,3693	yes	missense	KCNH3	NM_012284.1	103	27,650,5826	GG,GC,CC		7.3721,1.5887,5.4129	benign	856/1084	49950251	704,12302	2203	4300	6503	SO:0001583	missense	23416			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2567C>G	12.37:g.49950251C>G	ENSP00000257981:p.Pro856Arg	Somatic		WXS	SOLID	Phase_I	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	76	0.0347985347985348	3	0.006097560975609756	24	0.06629834254143646	0	0.0	49	0.06464379947229551	C	17.52	3.411384	0.62399	0.015887	0.073721	ENSG00000135519	ENST00000257981	D	0.98777	-5.13	6.04	5.16	0.70880	.	0.000000	0.43919	D	0.000506	T	0.70518	0.3233	N	0.08118	0	0.35735	D	0.818209	D	0.61080	0.989	P	0.47573	0.55	D	0.84904	0.0844	10	0.17369	T	0.5	.	11.04	0.47825	0.0:0.9157:0.0:0.0843	.	856	Q9ULD8	KCNH3_HUMAN	R	856	ENSP00000257981:P856R	ENSP00000257981:P856R	P	+	2	0	KCNH3	48236518	0.893000	0.30496	0.983000	0.44433	0.949000	0.60115	3.227000	0.51262	1.571000	0.49722	0.563000	0.77884	CCT		0.602	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2		NM_012284	
KDM2B	84678	hgsc.bcm.edu;ucsc.edu	37	12	122013702	122013702	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr12:122013702C>A	ENST00000377071.4	-	3	406	c.334G>T	c.(334-336)Gat>Tat	p.D112Y	KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000377069.4_Missense_Mutation_p.D81Y|KDM2B_ENST00000538046.2_Missense_Mutation_p.D112Y	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	112					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CCCAGTCCATCCTTTTCTCGA	0.408																																																	0													161.0	157.0	158.0					12																	122013702		1873	4087	5960	SO:0001583	missense	84678			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.334G>T	12.37:g.122013702C>A	ENSP00000366271:p.Asp112Tyr	Somatic		WXS	SOLID	Phase_I	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426821	0.83667	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000397478;ENST00000261824;ENST00000446152;ENST00000539371	T;T;T	0.51325	2.28;1.68;0.71	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000018	T	0.71409	0.3336	M	0.88570	2.965	0.80722	D	1	P;D;P	0.60575	0.515;0.988;0.922	B;P;B	0.57425	0.323;0.82;0.361	T	0.77474	-0.2574	10	0.72032	D	0.01	-21.0977	19.4987	0.95085	0.0:1.0:0.0:0.0	.	112;112;81	E7EML5;Q8NHM5;A8MRS1	.;KDM2B_HUMAN;.	Y	112;81;112;112;112;75;81	ENSP00000366269:D81Y;ENSP00000366271:D112Y;ENSP00000398279:D75Y	ENSP00000261824:D112Y	D	-	1	0	KDM2B	120498085	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.982000	0.76173	2.609000	0.88269	0.460000	0.39030	GAT		0.408	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2		NM_032590	
KDR	3791	hgsc.bcm.edu;ucsc.edu	37	4	55968633	55968633	+	Missense_Mutation	SNP	G	G	A	rs200338299		TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr4:55968633G>A	ENST00000263923.4	-	14	2325	c.2030C>T	c.(2029-2031)aCg>aTg	p.T677M		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	677	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.T677M(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATACTTGTCGTCTGATTCTC	0.443			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)			G|||	1	0.000199681	0.0	0.0	5008	,	,		18066	0.0		0.001	False		,,,				2504	0.0							Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	1	Substitution - Missense(1)	large_intestine(1)											183.0	152.0	162.0					4																	55968633		2203	4300	6503	SO:0001583	missense	3791			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2030C>T	4.37:g.55968633G>A	ENSP00000263923:p.Thr677Met	Somatic		WXS	SOLID	Phase_I	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	13.06	2.124355	0.37533	.	.	ENSG00000128052	ENST00000263923	T	0.68624	-0.34	6.02	6.02	0.97574	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.105383	0.64402	D	0.000003	D	0.83326	0.5230	M	0.81802	2.56	0.46044	D	0.998835	D	0.89917	1.0	D	0.78314	0.991	T	0.81230	-0.1027	10	0.39692	T	0.17	.	20.1146	0.97924	0.0:0.0:1.0:0.0	.	677	P35968	VGFR2_HUMAN	M	677	ENSP00000263923:T677M	ENSP00000263923:T677M	T	-	2	0	KDR	55663390	1.000000	0.71417	0.971000	0.41717	0.177000	0.22998	4.984000	0.63838	2.855000	0.98099	0.655000	0.94253	ACG		0.443	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			
KIAA1549	57670	hgsc.bcm.edu	37	7	138546115	138546115	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr7:138546115A>G	ENST00000422774.1	-	16	5065	c.5017T>C	c.(5017-5019)Tac>Cac	p.Y1673H	KIAA1549_ENST00000242365.4_Missense_Mutation_p.Y1623H|KIAA1549_ENST00000440172.1_Missense_Mutation_p.Y1673H			Q9HCM3	K1549_HUMAN	KIAA1549	1673						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GGTGGGATGTACTGGGAGGCC	0.642			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													33.0	40.0	37.0					7																	138546115		2063	4198	6261	SO:0001583	missense	57670				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.5017T>C	7.37:g.138546115A>G	ENSP00000416040:p.Tyr1673His	Somatic		WXS	SOLID	Phase_I	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055155	0.75960	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.29142	1.58;1.59;1.61	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	L	0.60455	1.87	0.54753	D	0.999985	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.999;0.998	T	0.53085	-0.8488	10	0.66056	D	0.02	.	13.418	0.60980	1.0:0.0:0.0:0.0	.	1673;457;1673;457	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	H	1673;1623;1673	ENSP00000406661:Y1673H;ENSP00000242365:Y1623H;ENSP00000416040:Y1673H	ENSP00000242365:Y1623H	Y	-	1	0	KIAA1549	138196655	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.681000	0.91228	2.010000	0.58986	0.460000	0.39030	TAC		0.642	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			
LAMB3	3914	hgsc.bcm.edu	37	1	209796913	209796913	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:209796913G>A	ENST00000356082.4	-	16	2429	c.2295C>T	c.(2293-2295)ccC>ccT	p.P765P	LAMB3_ENST00000367030.3_Silent_p.P765P|MIR4260_ENST00000583107.1_RNA|LAMB3_ENST00000391911.1_Silent_p.P765P	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	765	Domain II.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CCACAAGCTTGGGGCTGCCGG	0.642																																																	0													82.0	73.0	76.0					1																	209796913		2203	4300	6503	SO:0001819	synonymous_variant	3914			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2295C>T	1.37:g.209796913G>A		Somatic		WXS	SOLID	Phase_I	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Silent	SNP	ENST00000356082.4	37	CCDS1487.1																																																																																				0.642	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2		NM_000228	
LIMA1	51474	hgsc.bcm.edu	37	12	50589647	50589647	+	Silent	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr12:50589647C>T	ENST00000341247.4	-	8	1145	c.996G>A	c.(994-996)ctG>ctA	p.L332L	LIMA1_ENST00000547825.1_Silent_p.L30L|LIMA1_ENST00000552909.1_Silent_p.L172L|LIMA1_ENST00000552491.1_Silent_p.L30L|LIMA1_ENST00000552823.1_Silent_p.L172L|LIMA1_ENST00000552008.1_5'UTR|LIMA1_ENST00000552783.1_Silent_p.L172L|LIMA1_ENST00000394943.3_Silent_p.L332L	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	332					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						AACGGACTGCCAGGCTATTCT	0.378																																																	0													63.0	61.0	62.0					12																	50589647		2203	4300	6503	SO:0001819	synonymous_variant	51474			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.996G>A	12.37:g.50589647C>T		Somatic		WXS	SOLID	Phase_I	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Silent	SNP	ENST00000341247.4	37	CCDS8802.1																																																																																				0.378	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2		NM_016357	
MAN1A2	10905	hgsc.bcm.edu;ucsc.edu	37	1	117984948	117984948	+	Splice_Site	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:117984948G>A	ENST00000356554.3	+	6	1685		c.e6+1			NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2						cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		ATTTGAAAAGGTAACTCTATG	0.358																																					Ovarian(33;199 881 8228 13687 31538)												1	Unknown(1)	skin(1)											101.0	102.0	102.0					1																	117984948		2203	4300	6503	SO:0001630	splice_region_variant	10905			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.950+1G>A	1.37:g.117984948G>A		Somatic		WXS	SOLID	Phase_I	Q9H510	Splice_Site	SNP	ENST00000356554.3	37	CCDS895.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314702	0.81358	.	.	ENSG00000198162	ENST00000356554;ENST00000369450;ENST00000449370	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5985	0.76606	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAN1A2	117786471	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.989000	0.88205	2.743000	0.94032	0.591000	0.81541	.		0.358	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1		NM_006699	Intron
MEGF8	1954	hgsc.bcm.edu	37	19	42840365	42840365	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr19:42840365A>G	ENST00000251268.6	+	6	1111	c.1111A>G	c.(1111-1113)Acc>Gcc	p.T371A	MEGF8_ENST00000334370.4_Missense_Mutation_p.T371A	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	371					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCTTGACAGCACCAGCGGGGG	0.662																																																	0													48.0	51.0	50.0					19																	42840365		2005	4158	6163	SO:0001583	missense	1954			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1111A>G	19.37:g.42840365A>G	ENSP00000251268:p.Thr371Ala	Somatic		WXS	SOLID	Phase_I	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	A	6.559	0.471517	0.12461	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.65916	-0.18;-0.18	4.43	-2.78	0.05859	.	.	.	.	.	T	0.25158	0.0611	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23226	-1.0194	9	0.07990	T	0.79	.	3.0774	0.06251	0.2642:0.4903:0.0997:0.1458	.	371	Q7Z7M0-2	.	A	371	ENSP00000334219:T371A;ENSP00000251268:T371A	ENSP00000251268:T371A	T	+	1	0	MEGF8	47532205	0.004000	0.15560	0.002000	0.10522	0.588000	0.36517	-0.058000	0.11750	-0.395000	0.07715	0.397000	0.26171	ACC		0.662	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1		NM_001410	
MPHOSPH8	54737	hgsc.bcm.edu	37	13	20208028	20208028	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr13:20208028C>G	ENST00000361479.5	+	1	208	c.140C>G	c.(139-141)gCc>gGc	p.A47G	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.A47G	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	47					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GGAGCGGAGGCCTTTGGCGAC	0.622																																																	0													54.0	43.0	47.0					13																	20208028		2202	4300	6502	SO:0001583	missense	54737			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.140C>G	13.37:g.20208028C>G	ENSP00000355388:p.Ala47Gly	Somatic		WXS	SOLID	Phase_I	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	37	CCDS9287.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502091	0.26949	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.35605	1.31;1.3	4.49	1.81	0.25067	.	.	.	.	.	T	0.27205	0.0667	L	0.36672	1.1	0.23956	N	0.996354	B;P;P	0.46784	0.18;0.873;0.884	B;B;B	0.43838	0.083;0.385;0.433	T	0.09357	-1.0678	9	0.38643	T	0.18	.	4.4461	0.11598	0.1556:0.5883:0.0:0.2561	.	47;47;47	Q99549;Q99549-2;B3KS10	MPP8_HUMAN;.;.	G	47	ENSP00000414663:A47G;ENSP00000355388:A47G	ENSP00000355388:A47G	A	+	2	0	MPHOSPH8	19106028	0.709000	0.27886	0.146000	0.22360	0.071000	0.16799	0.522000	0.22909	0.253000	0.21552	0.561000	0.74099	GCC		0.622	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2		NM_017520	
NARF	26502	hgsc.bcm.edu;ucsc.edu	37	17	80430448	80430448	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:80430448T>A	ENST00000309794.11	+	5	592	c.394T>A	c.(394-396)Tat>Aat	p.Y132N	NARF_ENST00000412079.2_Intron|NARF_ENST00000581743.1_3'UTR|NARF_ENST00000390006.4_Missense_Mutation_p.Y73N|NARF_ENST00000345415.7_Missense_Mutation_p.Y84N|NARF_ENST00000457415.3_Missense_Mutation_p.Y132N	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	132						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			AGGGGTGCACTATGTATTTGA	0.438																																																	0													127.0	117.0	120.0					17																	80430448		2203	4300	6503	SO:0001583	missense	26502			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.394T>A	17.37:g.80430448T>A	ENSP00000309899:p.Tyr132Asn	Somatic		WXS	SOLID	Phase_I	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	T	9.998	1.232820	0.22626	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.61	5.61	0.85477	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.059130	0.64402	D	0.000001	T	0.71484	0.3345	M	0.91140	3.18	0.80722	D	1	D;D;D;D	0.67145	0.995;0.965;0.996;0.996	D;P;D;D	0.77004	0.981;0.797;0.989;0.964	T	0.74922	-0.3499	10	0.39692	T	0.17	-15.4659	9.5304	0.39191	0.0:0.0779:0.0:0.9221	.	132;84;132;132	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	N	73;132;132;84	ENSP00000374656:Y73N;ENSP00000363739:Y132N;ENSP00000309899:Y132N;ENSP00000283996:Y84N	ENSP00000309899:Y132N	Y	+	1	0	NARF	78023737	1.000000	0.71417	0.983000	0.44433	0.175000	0.22909	3.620000	0.54203	2.160000	0.67779	0.529000	0.55759	TAT		0.438	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2		NM_031968	
NASP	4678	hgsc.bcm.edu;ucsc.edu	37	1	46083164	46083164	+	Silent	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:46083164A>G	ENST00000350030.3	+	14	2274	c.2187A>G	c.(2185-2187)aaA>aaG	p.K729K	NASP_ENST00000372052.4_Silent_p.K363K|NASP_ENST00000530073.1_3'UTR|NASP_ENST00000537798.1_Silent_p.K665K|NASP_ENST00000351223.3_Silent_p.K390K|NASP_ENST00000402363.3_Silent_p.K731K	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	729					blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					GTCCCCGGAAAGATGATGCAA	0.448																																																	0													86.0	86.0	86.0					1																	46083164		2203	4300	6503	SO:0001819	synonymous_variant	4678			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.2187A>G	1.37:g.46083164A>G		Somatic		WXS	SOLID	Phase_I	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Silent	SNP	ENST00000350030.3	37	CCDS524.1	.	.	.	.	.	.	.	.	.	.	A	9.660	1.143874	0.21205	.	.	ENSG00000132780	ENST00000531612	T	0.53640	0.61	4.56	3.39	0.38822	.	0.197009	0.52532	D	0.000080	T	0.46889	0.1416	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25882	-1.0119	7	0.24483	T	0.36	-17.3222	10.6029	0.45377	0.9223:0.0:0.0777:0.0	.	.	.	.	R	229	ENSP00000437116:K229R	ENSP00000437116:K229R	K	+	2	0	NASP	45855751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.309000	0.59135	0.832000	0.34804	0.460000	0.39030	AAG		0.448	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2		NM_002482	
NBR1	4077	hgsc.bcm.edu;ucsc.edu	37	17	41327859	41327859	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:41327859A>T	ENST00000422280.1	+	2	502	c.43A>T	c.(43-45)Att>Ttt	p.I15F	NBR1_ENST00000389312.4_Missense_Mutation_p.I15F|NBR1_ENST00000589872.1_Missense_Mutation_p.I15F|NBR1_ENST00000542611.1_Missense_Mutation_p.I15F|NBR1_ENST00000590996.1_Missense_Mutation_p.I15F|NBR1_ENST00000341165.6_Missense_Mutation_p.I15F	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	15					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		TAAAAATGAAATTCAAAGCTT	0.388																																																	0													88.0	79.0	82.0					17																	41327859		1818	4071	5889	SO:0001583	missense	4077			X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.43A>T	17.37:g.41327859A>T	ENSP00000411250:p.Ile15Phe	Somatic		WXS	SOLID	Phase_I	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	37	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	.	15.75	2.926058	0.52759	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.43688	1.87;0.94;1.87;1.87	4.91	3.82	0.43975	Phox/Bem1p (2);	0.558514	0.17559	N	0.169887	T	0.30135	0.0755	N	0.22421	0.69	0.29835	N	0.829665	B;B;B	0.30281	0.275;0.273;0.131	B;B;B	0.35278	0.054;0.169;0.199	T	0.29488	-1.0010	10	0.66056	D	0.02	-2.0397	7.0648	0.25145	0.6984:0.1542:0.0:0.1475	.	15;15;15	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	F	15	ENSP00000411250:I15F;ENSP00000437545:I15F;ENSP00000343479:I15F;ENSP00000373963:I15F	ENSP00000343479:I15F	I	+	1	0	NBR1	38581385	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.627000	0.46469	0.885000	0.36088	0.383000	0.25322	ATT		0.388	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1		NM_005899	
NEB	4703	hgsc.bcm.edu	37	2	152467134	152467134	+	Missense_Mutation	SNP	G	G	T	rs200591649		TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:152467134G>T	ENST00000172853.10	-	76	11332	c.11185C>A	c.(11185-11187)Ctt>Att	p.L3729I	NEB_ENST00000604864.1_Missense_Mutation_p.L3972I|NEB_ENST00000427231.2_Missense_Mutation_p.L3972I|NEB_ENST00000603639.1_Missense_Mutation_p.L3972I|NEB_ENST00000397345.3_Missense_Mutation_p.L3972I|NEB_ENST00000409198.1_Missense_Mutation_p.L3729I			P20929	NEBU_HUMAN	nebulin	3729					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTGGTGTAAAGTTTCTAGGGA	0.423																																																	0													129.0	124.0	126.0					2																	152467134		1897	4115	6012	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11185C>A	2.37:g.152467134G>T	ENSP00000172853:p.Leu3729Ile	Somatic		WXS	SOLID	Phase_I	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	17.08	3.298430	0.60195	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.87	5.0	0.66597	.	0.277370	0.35207	N	0.003369	T	0.51193	0.1660	M	0.65320	2	0.80722	D	1	P	0.41102	0.738	P	0.44921	0.464	T	0.47302	-0.9128	10	0.22706	T	0.39	.	15.443	0.75204	0.0666:0.0:0.9334:0.0	.	3729	P20929	NEBU_HUMAN	I	3729;3972;3972;3729	ENSP00000386259:L3729I;ENSP00000380505:L3972I;ENSP00000416578:L3972I;ENSP00000172853:L3729I	ENSP00000172853:L3729I	L	-	1	0	NEB	152175380	0.970000	0.33590	1.000000	0.80357	0.954000	0.61252	1.449000	0.35123	1.625000	0.50366	0.655000	0.94253	CTT		0.423	NEB-201	KNOWN	basic	protein_coding	protein_coding			NM_004543	
NMBR	4829	hgsc.bcm.edu	37	6	142409628	142409628	+	Silent	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr6:142409628C>T	ENST00000258042.1	-	1	308	c.168G>A	c.(166-168)gtG>gtA	p.V56V	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	56					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		CCAGCAAGCCCACGGTGATGA	0.597																																																	0													82.0	74.0	77.0					6																	142409628		2203	4300	6503	SO:0001819	synonymous_variant	4829				CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.168G>A	6.37:g.142409628C>T		Somatic		WXS	SOLID	Phase_I	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	CCDS5196.1																																																																																				0.597	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1			
NRXN2	9379	hgsc.bcm.edu;ucsc.edu	37	11	64417942	64417942	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr11:64417942G>A	ENST00000377551.1	-	14	3298	c.3087C>T	c.(3085-3087)ggC>ggT	p.G1029G	NRXN2_ENST00000265459.6_Silent_p.G1029G|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000377559.3_Silent_p.G989G|NRXN2_ENST00000409571.1_Silent_p.G1022G			Q9P2S2	NRX2A_HUMAN	neurexin 2	1029	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GGTTTCGGGCGCCATTGGAGT	0.617																																																	0													196.0	168.0	177.0					11																	64417942		2201	4297	6498	SO:0001819	synonymous_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3087C>T	11.37:g.64417942G>A		Somatic		WXS	SOLID	Phase_I	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																				0.617	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3		NM_015080	
PAPPA2	60676	hgsc.bcm.edu;ucsc.edu	37	1	176525830	176525830	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:176525830G>T	ENST00000367662.3	+	2	1536	c.372G>T	c.(370-372)gaG>gaT	p.E124D	PAPPA2_ENST00000367661.3_Missense_Mutation_p.E124D	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	124					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CAGTTGAAGAGCCGGCTGCCC	0.532																																																	0													114.0	114.0	114.0					1																	176525830		2049	4198	6247	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.372G>T	1.37:g.176525830G>T	ENSP00000356634:p.Glu124Asp	Somatic		WXS	SOLID	Phase_I	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	8.441	0.850797	0.17034	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.30981	4.75;1.51	4.33	1.35	0.21983	.	1.402880	0.05017	U	0.471976	T	0.17023	0.0409	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.26815	-1.0092	10	0.54805	T	0.06	-0.6937	5.2127	0.15327	0.0897:0.1436:0.6219:0.1449	.	124;124	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	D	124	ENSP00000356634:E124D;ENSP00000356633:E124D	ENSP00000356633:E124D	E	+	3	2	PAPPA2	174792453	0.000000	0.05858	0.061000	0.19648	0.000000	0.00434	0.014000	0.13333	-0.166000	0.10890	-1.268000	0.01426	GAG		0.532	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			
PDGFB	5155	hgsc.bcm.edu	37	22	39621821	39621821	+	Silent	SNP	C	C	A	rs148231529		TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr22:39621821C>A	ENST00000331163.6	-	6	1420	c.633G>T	c.(631-633)cgG>cgT	p.R211R	PDGFB_ENST00000381551.4_Silent_p.R196R	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	211					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)	p.R211R(1)	COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					CTCGCACCGTCCGAATGGTCA	0.592			T	COL1A1	DFSP																																			Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	1	Substitution - coding silent(1)	skin(1)											110.0	86.0	94.0					22																	39621821		2203	4300	6503	SO:0001819	synonymous_variant	5155				CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.633G>T	22.37:g.39621821C>A		Somatic		WXS	SOLID	Phase_I	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Silent	SNP	ENST00000331163.6	37	CCDS13987.1																																																																																				0.592	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321043.1		NM_002608	
PIK3R5	23533	hgsc.bcm.edu	37	17	8791992	8791992	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:8791992A>C	ENST00000447110.1	-	10	1236	c.1112T>G	c.(1111-1113)cTc>cGc	p.L371R	PIK3R5_ENST00000584803.1_Missense_Mutation_p.L371R|PIK3R5_ENST00000581552.1_Missense_Mutation_p.L371R	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	371					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						ATGGCGCGAGAGGGCCGGCCC	0.637																																					NSCLC(18;589 615 7696 20311 50332)												0													65.0	69.0	68.0					17																	8791992		2203	4300	6503	SO:0001583	missense	23533			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1112T>G	17.37:g.8791992A>C	ENSP00000392812:p.Leu371Arg	Somatic		WXS	SOLID	Phase_I	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	37	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	A	8.924	0.961859	0.18583	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	D	0.82803	-1.65	5.51	5.51	0.81932	.	0.403824	0.25935	N	0.027350	D	0.83376	0.5241	N	0.24115	0.695	0.39711	D	0.971322	D	0.54397	0.966	P	0.58331	0.837	D	0.86648	0.1896	10	0.87932	D	0	-31.2461	15.2751	0.73737	1.0:0.0:0.0:0.0	.	371	Q8WYR1	PI3R5_HUMAN	R	371	ENSP00000392812:L371R	ENSP00000269300:L371R	L	-	2	0	PIK3R5	8732717	0.981000	0.34729	0.344000	0.25628	0.259000	0.26198	5.561000	0.67339	2.096000	0.63516	0.528000	0.53228	CTC		0.637	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2		NM_014308	
PLAC8L1	153770	hgsc.bcm.edu;ucsc.edu	37	5	145483813	145483813	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr5:145483813T>A	ENST00000311450.4	-	1	119	c.62A>T	c.(61-63)tAc>tTc	p.Y21F	RP11-118M9.3_ENST00000514002.1_RNA	NM_001029869.1	NP_001025040.1	A1L4L8	PL8L1_HUMAN	PLAC8-like 1	21										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|stomach(2)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGAGGTGAGTATATGTTGAG	0.393																																																	0													117.0	109.0	111.0					5																	145483813		2203	4300	6503	SO:0001583	missense	153770				CCDS34264.1	5q32	2008-02-05			ENSG00000173261	ENSG00000173261			31746	protein-coding gene	gene with protein product							Standard	XM_005268381		Approved		uc003lnv.3	A1L4L8	OTTHUMG00000163418	ENST00000311450.4:c.62A>T	5.37:g.145483813T>A	ENSP00000309087:p.Tyr21Phe	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000311450.4	37	CCDS34264.1	.	.	.	.	.	.	.	.	.	.	T	7.945	0.743676	0.15642	.	.	ENSG00000173261	ENST00000311450	T	0.43294	0.95	4.66	4.66	0.58398	.	0.739814	0.12576	N	0.456846	T	0.22044	0.0531	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.12863	-1.0531	10	0.11182	T	0.66	-0.1473	10.6563	0.45678	0.0:0.0:0.0:1.0	.	21	A1L4L8	PL8L1_HUMAN	F	21	ENSP00000309087:Y21F	ENSP00000309087:Y21F	Y	-	2	0	PLAC8L1	145464006	0.000000	0.05858	0.256000	0.24389	0.029000	0.11900	0.309000	0.19332	2.084000	0.62774	0.460000	0.39030	TAC		0.393	PLAC8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373290.1		XM_087761	
POLR1A	25885	hgsc.bcm.edu;ucsc.edu	37	2	86327173	86327173	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr2:86327173C>A	ENST00000263857.6	-	2	578	c.200G>T	c.(199-201)tGc>tTc	p.C67F	POLR1A_ENST00000409681.1_Missense_Mutation_p.C67F			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	67					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GTCCTGCACGCAGGTGGAGCA	0.552																																																	0													85.0	90.0	88.0					2																	86327173		2008	4181	6189	SO:0001583	missense	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.200G>T	2.37:g.86327173C>A	ENSP00000263857:p.Cys67Phe	Somatic		WXS	SOLID	Phase_I	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093027	0.76756	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.81078	-1.45;-1.45	5.78	5.78	0.91487	RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	D	0.92883	0.7736	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93963	0.7242	10	0.87932	D	0	-18.2928	19.9976	0.97389	0.0:1.0:0.0:0.0	.	67;67	B9ZVN9;O95602	.;RPA1_HUMAN	F	67	ENSP00000263857:C67F;ENSP00000386300:C67F	ENSP00000263857:C67F	C	-	2	0	POLR1A	86180684	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.251000	0.78297	2.737000	0.93849	0.563000	0.77884	TGC		0.552	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2		NM_015425	
PPEF2	5470	hgsc.bcm.edu	37	4	76787408	76787408	+	Silent	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr4:76787408T>C	ENST00000286719.7	-	15	2210	c.1854A>G	c.(1852-1854)tcA>tcG	p.S618S		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	618					detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGTTGTCTGCTGAGCTGTTCA	0.537																																					NSCLC(105;1359 1603 15961 44567 47947)												0													196.0	159.0	172.0					4																	76787408		2203	4300	6503	SO:0001819	synonymous_variant	5470			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1854A>G	4.37:g.76787408T>C		Somatic		WXS	SOLID	Phase_I	O14831	Silent	SNP	ENST00000286719.7	37	CCDS34013.1																																																																																				0.537	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1		NM_006239	
PPP2CB	5516	hgsc.bcm.edu	37	8	30643766	30643766	+	Silent	SNP	T	T	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr8:30643766T>G	ENST00000221138.4	-	7	1365	c.915A>C	c.(913-915)ccA>ccC	p.P305P	PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	305					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	GGAAGTAGTCTGGGGTGCGCC	0.408																																																	0													37.0	37.0	37.0					8																	30643766		2201	4297	6498	SO:0001819	synonymous_variant	5516				CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.915A>C	8.37:g.30643766T>G		Somatic		WXS	SOLID	Phase_I	D3DSV4|P11082|Q6FHK5	Silent	SNP	ENST00000221138.4	37	CCDS6079.1																																																																																				0.408	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376527.2		NM_001009552	
PPP2R1A	5518	hgsc.bcm.edu;ucsc.edu	37	19	52729234	52729234	+	Nonstop_Mutation	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr19:52729234A>G	ENST00000322088.6	+	15	1828	c.1770A>G	c.(1768-1770)tgA>tgG	p.*590W	PPP2R1A_ENST00000462990.1_Nonstop_Mutation_p.*411W|PPP2R1A_ENST00000444322.2_Nonstop_Mutation_p.*535W|CTD-2525I3.3_ENST00000599125.1_RNA|CTD-2525I3.3_ENST00000593857.1_RNA	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	0					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CTCTCGCCTGATGCTGGAAGA	0.577			Mis		clear cell ovarian carcinoma																																			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	0													231.0	193.0	206.0					19																	52729234		2203	4300	6503	SO:0001578	stop_lost	5518				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1770A>G	19.37:g.52729234A>G	ENSP00000324804:p.*590Trpext*74	Somatic		WXS	SOLID	Phase_I	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.528270	0.44969	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000436460;ENST00000444322	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4624	0.44587	1.0:0.0:0.0:0.0	.	.	.	.	W	580;510;590;157;535	.	.	X	+	3	0	PPP2R1A	57421046	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.106000	0.41835	2.040000	0.60383	0.528000	0.53228	TGA		0.577	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2		NM_014225	
PTPRT	11122	hgsc.bcm.edu;ucsc.edu	37	20	41385109	41385109	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr20:41385109G>A	ENST00000373187.1	-	6	851	c.852C>T	c.(850-852)atC>atT	p.I284I	PTPRT_ENST00000373201.1_Silent_p.I284I|PTPRT_ENST00000373193.3_Silent_p.I284I|PTPRT_ENST00000373184.1_Silent_p.I284I|PTPRT_ENST00000356100.2_Silent_p.I284I|PTPRT_ENST00000373198.4_Silent_p.I284I|PTPRT_ENST00000373190.1_Silent_p.I284I			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	284	Ig-like C2-type.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CACCTTTCACGATCAGCTCCG	0.577																																																	0													53.0	53.0	53.0					20																	41385109		2139	4244	6383	SO:0001819	synonymous_variant	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.852C>T	20.37:g.41385109G>A		Somatic		WXS	SOLID	Phase_I	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																				0.577	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			
RAP2B	5912	hgsc.bcm.edu;ucsc.edu	37	3	152880655	152880664	+	Frame_Shift_Del	DEL	CGGCGGGCAC	CGGCGGGCAC	-			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	CGGCGGGCAC	CGGCGGGCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:152880655_152880664delCGGCGGGCAC	ENST00000323534.2	+	1	627_636	c.173_182delCGGCGGGCAC	c.(172-183)acggcgggcaccfs	p.TAGT58fs	RP11-529G21.2_ENST00000487827.1_RNA	NM_002886.2	NP_002877.2	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family	58					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			ATCCTGGATACGGCGGGCACCGAGCAGTTC	0.586																																																	0																																										SO:0001589	frameshift_variant	5912				CCDS3170.1	3q25.2	2014-05-09			ENSG00000181467	ENSG00000181467			9862	protein-coding gene	gene with protein product	"""Ras-related protein RAP-2B"", ""small GTP binding protein"", ""Ras family small GTP binding protein RAP2B"""	179541				2118648	Standard	NM_002886		Approved		uc003ezr.3	P61225	OTTHUMG00000159655	ENST00000323534.2:c.173_182delCGGCGGGCAC	3.37:g.152880655_152880664delCGGCGGGCAC	ENSP00000319096:p.Thr58fs	Somatic		WXS	SOLID	Phase_I	P17964|Q96EG5|Q9CXG0	Frame_Shift_Del	DEL	ENST00000323534.2	37	CCDS3170.1																																																																																				0.586	RAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356707.1		NM_002886	
RBBP6	5930	hgsc.bcm.edu;ucsc.edu	37	16	24580912	24580912	+	Silent	SNP	A	A	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr16:24580912A>G	ENST00000319715.4	+	17	3333	c.2901A>G	c.(2899-2901)gaA>gaG	p.E967E	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Silent_p.E933E	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	967					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CAGGTGTTGAAGAAAATAAAA	0.383																																																	0													59.0	63.0	61.0					16																	24580912		2178	4294	6472	SO:0001819	synonymous_variant	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.2901A>G	16.37:g.24580912A>G		Somatic		WXS	SOLID	Phase_I	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	ENST00000319715.4	37	CCDS10621.1																																																																																				0.383	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2		NM_006910	
RCSD1	92241	hgsc.bcm.edu	37	1	167663408	167663408	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:167663408G>T	ENST00000367854.3	+	5	674	c.343G>T	c.(343-345)Gtg>Ttg	p.V115L	RCSD1_ENST00000537350.1_Missense_Mutation_p.V85L	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	115					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					CAAGGCTATGGTGTCGCCATT	0.567																																																	0													87.0	81.0	83.0					1																	167663408		2203	4300	6503	SO:0001583	missense	92241			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.343G>T	1.37:g.167663408G>T	ENSP00000356828:p.Val115Leu	Somatic		WXS	SOLID	Phase_I	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	37	CCDS1263.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395190	0.83011	.	.	ENSG00000198771	ENST00000367854;ENST00000361496;ENST00000537350	T;T	0.49720	0.8;0.77	5.18	5.18	0.71444	.	0.254159	0.34603	N	0.003826	T	0.45776	0.1359	L	0.39085	1.19	0.29635	N	0.845137	D;D	0.76494	0.999;0.999	D;D	0.76071	0.963;0.987	T	0.38222	-0.9671	9	0.30078	T	0.28	-24.5326	12.4402	0.55621	0.0767:0.0:0.9233:0.0	.	85;115	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	L	115;91;85	ENSP00000356828:V115L;ENSP00000439409:V85L	ENSP00000355291:V91L	V	+	1	0	RCSD1	165930032	0.998000	0.40836	0.975000	0.42487	0.955000	0.61496	2.940000	0.49003	2.572000	0.86782	0.655000	0.94253	GTG		0.567	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1		NM_052862	
RIMS2	9699	hgsc.bcm.edu	37	8	104987673	104987673	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr8:104987673C>A	ENST00000436393.2	+	14	2441	c.2200C>A	c.(2200-2202)Cat>Aat	p.H734N	RIMS2_ENST00000507740.1_Missense_Mutation_p.H748N|RIMS2_ENST00000262231.10_Missense_Mutation_p.H795N|RIMS2_ENST00000406091.3_Missense_Mutation_p.H956N			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1018	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.H1023D(1)|p.H956D(1)|p.H748D(1)|p.H734D(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGGGTCTCCTCATCGAGTAGA	0.418										HNSCC(12;0.0054)																																							4	Substitution - Missense(4)	urinary_tract(4)											106.0	104.0	104.0					8																	104987673		1919	4126	6045	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2200C>A	8.37:g.104987673C>A	ENSP00000390665:p.His734Asn	Somatic		WXS	SOLID	Phase_I	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	C	21.2	4.118266	0.77323	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.20738	2.05;2.44;2.24;2.22;2.15;2.66	4.98	4.98	0.66077	.	.	.	.	.	T	0.45094	0.1325	L	0.57536	1.79	0.80722	D	1	D;B;D;D;D;D	0.65815	0.995;0.029;0.958;0.986;0.962;0.962	D;B;D;D;D;D	0.77004	0.989;0.105;0.943;0.974;0.946;0.946	T	0.39143	-0.9628	9	0.66056	D	0.02	.	18.6146	0.91297	0.0:1.0:0.0:0.0	.	1018;1018;734;795;748;956	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	N	956;971;956;1018;795;748;748;734	ENSP00000427018:H956N;ENSP00000384892:H956N;ENSP00000262231:H795N;ENSP00000423559:H748N;ENSP00000386228:H748N;ENSP00000390665:H734N	ENSP00000262231:H795N	H	+	1	0	RIMS2	105056849	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.586000	0.67503	2.474000	0.83562	0.561000	0.74099	CAT		0.418	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1		NM_001100117	
RREB1	6239	hgsc.bcm.edu	37	6	7231121	7231121	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr6:7231121G>A	ENST00000349384.6	+	10	3103	c.2789G>A	c.(2788-2790)tGc>tAc	p.C930Y	RREB1_ENST00000379933.3_Missense_Mutation_p.C930Y|RREB1_ENST00000379938.2_Missense_Mutation_p.C930Y|RREB1_ENST00000334984.6_Missense_Mutation_p.C930Y	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	930					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CCCTATGACTGCTCCATGGAG	0.577																																																	0													54.0	54.0	54.0					6																	7231121		2203	4300	6503	SO:0001583	missense	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2789G>A	6.37:g.7231121G>A	ENSP00000305560:p.Cys930Tyr	Somatic		WXS	SOLID	Phase_I	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490116	0.44249	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.12361	2.82;2.77;2.82;2.69	5.05	4.18	0.49190	.	0.280853	0.31177	N	0.008116	T	0.08846	0.0219	L	0.27053	0.805	0.40914	D	0.984254	D;D;B	0.57899	0.964;0.981;0.007	P;P;B	0.53593	0.73;0.541;0.01	T	0.06303	-1.0834	10	0.66056	D	0.02	-15.4336	9.943	0.41591	0.1538:0.0:0.8462:0.0	.	930;930;930	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	Y	930	ENSP00000369265:C930Y;ENSP00000369270:C930Y;ENSP00000305560:C930Y;ENSP00000335574:C930Y	ENSP00000335574:C930Y	C	+	2	0	RREB1	7176120	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.462000	0.66707	1.343000	0.45638	0.655000	0.94253	TGC		0.577	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			
SCYL3	57147	hgsc.bcm.edu;ucsc.edu	37	1	169831811	169831811	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:169831811G>A	ENST00000367770.1	-	9	1130	c.1083C>T	c.(1081-1083)atC>atT	p.I361I	SCYL3_ENST00000470238.1_5'UTR|SCYL3_ENST00000367771.6_Silent_p.I361I|SCYL3_ENST00000367772.4_Silent_p.I361I|RN7SL333P_ENST00000476398.2_RNA			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	361					cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CGTAGGCCTCGATGTGAGACA	0.547																																																	0													230.0	216.0	220.0					1																	169831811		2203	4300	6503	SO:0001819	synonymous_variant	57147			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.1083C>T	1.37:g.169831811G>A		Somatic		WXS	SOLID	Phase_I	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Silent	SNP	ENST00000367770.1	37	CCDS1287.1																																																																																				0.547	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4		NM_181093	
RYR2	6262	hgsc.bcm.edu;ucsc.edu	37	1	237778053	237778053	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:237778053G>A	ENST00000366574.2	+	37	5942	c.5625G>A	c.(5623-5625)ctG>ctA	p.L1875L	RYR2_ENST00000360064.6_Silent_p.L1873L|RYR2_ENST00000542537.1_Silent_p.L1859L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1875	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGCAAAGCTGCAAGGAGCTG	0.532																																																	0													48.0	51.0	50.0					1																	237778053		2048	4184	6232	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5625G>A	1.37:g.237778053G>A		Somatic		WXS	SOLID	Phase_I	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																				0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		NM_001035	
SEPT3	55964	hgsc.bcm.edu;ucsc.edu	37	22	42383241	42383241	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr22:42383241G>A	ENST00000396426.3	+	4	618	c.363G>A	c.(361-363)ctG>ctA	p.L121L	SEPT3_ENST00000396425.3_Silent_p.L121L|SEPT3_ENST00000328414.8_Intron|SEPT3_ENST00000406029.1_Silent_p.L57L|SEPT3_ENST00000291236.11_Silent_p.L57L	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	121	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						AAATGAAGCTGACCGTCATCG	0.502																																																	0													93.0	87.0	89.0					22																	42383241		2203	4300	6503	SO:0001819	synonymous_variant	55964			AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.363G>A	22.37:g.42383241G>A		Somatic		WXS	SOLID	Phase_I	B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Silent	SNP	ENST00000396426.3	37	CCDS14026.2																																																																																				0.502	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322051.1		NM_145734	
SLC33A1	9197	hgsc.bcm.edu;ucsc.edu	37	3	155547594	155547594	+	Silent	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:155547594C>T	ENST00000392845.3	-	5	1745	c.1365G>A	c.(1363-1365)gtG>gtA	p.V455V	SLC33A1_ENST00000359479.3_Silent_p.V455V			O00400	ACATN_HUMAN	solute carrier family 33 (acetyl-CoA transporter), member 1	455					acetyl-CoA transport (GO:0015876)|cell death (GO:0008219)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	acetyl-CoA transporter activity (GO:0008521)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	22			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CCAGATTGGACACGGTATTTA	0.418																																																	0													124.0	106.0	112.0					3																	155547594		2203	4300	6503	SO:0001819	synonymous_variant	9197			D88152	CCDS3173.1	3q25.31	2013-05-22		2002-12-06	ENSG00000169359	ENSG00000169359		"""Solute carriers"""	95	protein-coding gene	gene with protein product		603690	"""acetyl-Coenzyme A transporter"", ""spastic paraplegia 42 (autosomal dominant)"""	ACATN, SPG42		9096318, 19061983	Standard	NM_004733		Approved	AT-1, AT1	uc003fao.2	O00400	OTTHUMG00000158481	ENST00000392845.3:c.1365G>A	3.37:g.155547594C>T		Somatic		WXS	SOLID	Phase_I	B2R5Q2|D3DNK4	Silent	SNP	ENST00000392845.3	37	CCDS3173.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.270631	0.23221	.	.	ENSG00000169359	ENST00000475842	T	0.25579	1.79	5.76	0.489	0.16854	.	0.000000	0.85682	D	0.000000	T	0.17534	0.0421	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.08680	-1.0710	7	0.15952	T	0.53	-16.3601	5.5523	0.17097	0.2402:0.5628:0.0:0.197	.	.	.	.	I	175	ENSP00000419066:V175I	ENSP00000419066:V175I	V	-	1	0	SLC33A1	157030288	0.281000	0.24258	0.988000	0.46212	0.992000	0.81027	-0.384000	0.07389	0.070000	0.16634	0.585000	0.79938	GTC		0.418	SLC33A1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351130.3		NM_004733	
SMARCA2	6595	hgsc.bcm.edu;ucsc.edu	37	9	2081838	2081838	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr9:2081838G>T	ENST00000382203.1	+	15	2400	c.2191G>T	c.(2191-2193)Ggc>Tgc	p.G731C	SMARCA2_ENST00000382194.1_Missense_Mutation_p.G731C|SMARCA2_ENST00000349721.2_Missense_Mutation_p.G731C|SMARCA2_ENST00000357248.2_Missense_Mutation_p.G731C			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	731					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TCAGCTCCAGGGCCTGGAATG	0.428																																																	0													117.0	109.0	112.0					9																	2081838		2203	4300	6503	SO:0001583	missense	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2191G>T	9.37:g.2081838G>T	ENSP00000371638:p.Gly731Cys	Somatic		WXS	SOLID	Phase_I	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719718	0.89205	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41	5.52	5.52	0.82312	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	H	0.96365	3.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98968	1.0800	10	0.87932	D	0	-17.9432	19.4306	0.94762	0.0:0.0:1.0:0.0	.	332;731;731	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	C	731	ENSP00000265773:G731C;ENSP00000349788:G731C;ENSP00000371638:G731C;ENSP00000371629:G731C	ENSP00000265773:G731C	G	+	1	0	SMARCA2	2071838	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.610000	0.88304	0.591000	0.81541	GGC		0.428	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1		NM_003070	
SNX18	112574	hgsc.bcm.edu;ucsc.edu	37	5	53839014	53839014	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr5:53839014C>G	ENST00000381410.4	+	2	1817	c.1627C>G	c.(1627-1629)Ctt>Gtt	p.L543V	SNX18_ENST00000343017.6_3'UTR	NM_001102575.1	NP_001096045.1	Q96RF0	SNX18_HUMAN	sorting nexin 18	0	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				TACAGGAGCTCTTACCAAAGT	0.383																																																	0													70.0	68.0	68.0					5																	53839014		1862	4090	5952	SO:0001583	missense	112574			AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000381410.4:c.1627C>G	5.37:g.53839014C>G	ENSP00000370817:p.Leu543Val	Somatic		WXS	SOLID	Phase_I	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000381410.4	37	CCDS43317.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005749	0.74932	.	.	ENSG00000178996	ENST00000381410	T	0.14640	2.49	5.72	5.72	0.89469	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.80722	D	1	P	0.41978	0.767	P	0.45712	0.491	T	0.00525	-1.1689	8	0.27785	T	0.31	.	19.8891	0.96923	0.0:1.0:0.0:0.0	.	543	Q96RF0-2	.	V	543	ENSP00000370817:L543V	ENSP00000370817:L543V	L	+	1	0	SNX18	53874771	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.596000	0.61055	2.689000	0.91719	0.655000	0.94253	CTT		0.383	SNX18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214073.2			
SP2	6668	hgsc.bcm.edu;ucsc.edu	37	17	45993786	45993786	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr17:45993786C>G	ENST00000376741.4	+	3	486	c.349C>G	c.(349-351)Ccc>Gcc	p.P117A	AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000433001.1_RNA|AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000411573.2_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	117					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						TATCCAGAATCCCACCATGAT	0.502																																																	0													126.0	118.0	120.0					17																	45993786		2203	4300	6503	SO:0001583	missense	6668				CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.349C>G	17.37:g.45993786C>G	ENSP00000365931:p.Pro117Ala	Somatic		WXS	SOLID	Phase_I	A6NK74	Missense_Mutation	SNP	ENST00000376741.4	37	CCDS11521.2	.	.	.	.	.	.	.	.	.	.	C	18.20	3.572038	0.65765	.	.	ENSG00000167182	ENST00000376741;ENST00000322172	T	0.09255	3.0	5.38	4.4	0.53042	.	0.114348	0.64402	D	0.000010	T	0.29061	0.0722	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.01711	-1.1290	10	0.56958	D	0.05	.	13.4267	0.61030	0.0:0.9226:0.0:0.0774	.	117	Q02086	SP2_HUMAN	A	117;110	ENSP00000365931:P117A	ENSP00000316942:P110A	P	+	1	0	SP2	43348785	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	4.385000	0.59613	1.485000	0.48380	0.460000	0.39030	CCC		0.502	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316777.1		NM_003110	
SV2A	9900	hgsc.bcm.edu	37	1	149883492	149883492	+	Silent	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:149883492G>A	ENST00000369146.3	-	3	1153	c.663C>T	c.(661-663)ctC>ctT	p.L221L	SV2A_ENST00000369145.1_Silent_p.L221L	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	221					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GACCTCCCCAGAGGAAGGCTC	0.577																																																	0													54.0	44.0	47.0					1																	149883492		2203	4300	6503	SO:0001819	synonymous_variant	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.663C>T	1.37:g.149883492G>A		Somatic		WXS	SOLID	Phase_I	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	CCDS940.1																																																																																				0.577	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			
SYCP2	10388	hgsc.bcm.edu;ucsc.edu	37	20	58455486	58455486	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr20:58455486G>T	ENST00000357552.3	-	31	3038	c.2813C>A	c.(2812-2814)aCt>aAt	p.T938N	SYCP2_ENST00000371001.2_Missense_Mutation_p.T938N			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	938					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTCTGTTTCAGTATCACTAAA	0.308																																																	0													92.0	82.0	86.0					20																	58455486		2195	4293	6488	SO:0001583	missense	10388			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2813C>A	20.37:g.58455486G>T	ENSP00000350162:p.Thr938Asn	Somatic		WXS	SOLID	Phase_I	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656697	0.47467	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.28666	1.83;1.83;1.6	6.01	0.068	0.14368	.	0.420814	0.24886	N	0.034807	T	0.27134	0.0665	M	0.63843	1.955	0.37193	D	0.904039	P	0.34724	0.465	B	0.32583	0.148	T	0.23297	-1.0192	10	0.72032	D	0.01	-5.8751	9.2006	0.37256	0.0:0.2463:0.3741:0.3797	.	938	Q9BX26	SYCP2_HUMAN	N	938	ENSP00000360040:T938N;ENSP00000350162:T938N;ENSP00000402456:T938N	ENSP00000350162:T938N	T	-	2	0	SYCP2	57888881	0.962000	0.33011	0.994000	0.49952	0.540000	0.34992	0.488000	0.22371	0.080000	0.16959	-0.182000	0.12963	ACT		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3		NM_014258	
TFDP2	7029	hgsc.bcm.edu;ucsc.edu	37	3	141693004	141693004	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:141693004T>G	ENST00000489671.1	-	8	979	c.549A>C	c.(547-549)agA>agC	p.R183S	TFDP2_ENST00000317104.7_Missense_Mutation_p.R107S|TFDP2_ENST00000499676.2_Missense_Mutation_p.R123S|TFDP2_ENST00000486111.1_Missense_Mutation_p.R123S|TFDP2_ENST00000477292.1_Missense_Mutation_p.R47S|TFDP2_ENST00000310282.6_Missense_Mutation_p.R123S|TFDP2_ENST00000467072.1_Missense_Mutation_p.R123S|TFDP2_ENST00000397991.4_Missense_Mutation_p.R155S|TFDP2_ENST00000479040.1_Missense_Mutation_p.R122S|TFDP2_ENST00000495310.1_Missense_Mutation_p.R86S			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	183					gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						CATCATAAACTCTTCGCCTAA	0.333																																																	0													94.0	88.0	90.0					3																	141693004		1832	4094	5926	SO:0001583	missense	7029			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.549A>C	3.37:g.141693004T>G	ENSP00000420616:p.Arg183Ser	Somatic		WXS	SOLID	Phase_I	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Missense_Mutation	SNP	ENST00000489671.1	37	CCDS54650.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.023028	0.75275	.	.	ENSG00000114126	ENST00000499676;ENST00000489671;ENST00000486111;ENST00000477292;ENST00000495310;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991;ENST00000467667;ENST00000478006;ENST00000497579	D;D;D;D;D;D;D;D;D;D;T;T	0.89810	-1.62;-1.76;-1.62;-2.38;-2.57;-1.62;-1.51;-1.62;-1.61;-1.77;-1.2;-1.11	5.77	3.43	0.39272	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95417	0.8512	H	0.96111	3.77	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.97110	1.0;0.998;0.99	D	0.94574	0.7773	10	0.87932	D	0	-9.0448	7.9857	0.30210	0.0:0.2173:0.0:0.7827	.	86;183;123	B7Z8L5;Q14188;Q14188-5	.;TFDP2_HUMAN;.	S	123;183;123;47;86;123;107;123;122;155;123;97;122	ENSP00000439782:R123S;ENSP00000420616:R183S;ENSP00000420599:R123S;ENSP00000418971:R47S;ENSP00000419036:R86S;ENSP00000418590:R123S;ENSP00000315668:R107S;ENSP00000309622:R123S;ENSP00000417585:R122S;ENSP00000381078:R155S;ENSP00000417726:R123S;ENSP00000417220:R122S	ENSP00000309622:R123S	R	-	3	2	TFDP2	143175694	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.818000	0.27295	1.017000	0.39495	0.455000	0.32223	AGA		0.333	TFDP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353294.4		NM_006286	
TTF2	8458	hgsc.bcm.edu;ucsc.edu	37	1	117641487	117641487	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:117641487G>A	ENST00000369466.4	+	22	3346	c.3302G>A	c.(3301-3303)cGa>cAa	p.R1101Q	TTF2_ENST00000480701.1_3'UTR	NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	1101	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GCTTGTGACCGAATTTACCGA	0.438																																																	0													145.0	133.0	137.0					1																	117641487		2203	4300	6503	SO:0001583	missense	8458			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.3302G>A	1.37:g.117641487G>A	ENSP00000358478:p.Arg1101Gln	Somatic		WXS	SOLID	Phase_I	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	ENST00000369466.4	37	CCDS892.1	.	.	.	.	.	.	.	.	.	.	G	35	5.438678	0.96168	.	.	ENSG00000116830	ENST00000369466;ENST00000427271	D;D	0.99143	-5.48;-5.48	5.22	5.22	0.72569	Helicase, C-terminal (3);	0.000000	0.31472	N	0.007596	D	0.99701	0.9886	H	0.99600	4.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97184	0.9853	10	0.87932	D	0	-13.6715	16.6163	0.84917	0.0:0.0:1.0:0.0	.	1101	Q9UNY4	TTF2_HUMAN	Q	1101;82	ENSP00000358478:R1101Q;ENSP00000408111:R82Q	ENSP00000358478:R1101Q	R	+	2	0	TTF2	117443010	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.301000	0.96167	2.594000	0.87642	0.462000	0.41574	CGA		0.438	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3			
TNR	7143	hgsc.bcm.edu;ucsc.edu	37	1	175372418	175372418	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:175372418G>T	ENST00000367674.2	-	4	1542	c.834C>A	c.(832-834)aaC>aaA	p.N278K	TNR_ENST00000263525.2_Missense_Mutation_p.N278K			Q92752	TENR_HUMAN	tenascin R	278	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AACAGGTACCGTTGGCACATC	0.622																																																	0													139.0	90.0	107.0					1																	175372418		2203	4300	6503	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.834C>A	1.37:g.175372418G>T	ENSP00000356646:p.Asn278Lys	Somatic		WXS	SOLID	Phase_I	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994809	0.54041	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.11277	2.79;2.79	6.04	-6.62	0.01813	.	0.000000	0.85682	D	0.000000	T	0.21427	0.0516	L	0.55743	1.74	0.52099	D	0.999945	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.927	T	0.02004	-1.1231	10	0.45353	T	0.12	.	15.6405	0.76997	0.7102:0.0:0.2898:0.0	.	278;278	B4DIX8;Q92752	.;TENR_HUMAN	K	278	ENSP00000356646:N278K;ENSP00000263525:N278K	ENSP00000263525:N278K	N	-	3	2	TNR	173639041	0.003000	0.15002	0.794000	0.32065	0.256000	0.26092	-1.236000	0.02925	-1.264000	0.02452	-0.367000	0.07326	AAC		0.622	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4		NM_003285	
TUBGCP6	85378	hgsc.bcm.edu;ucsc.edu	37	22	50682713	50682713	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr22:50682713G>T	ENST00000248846.5	-	1	280	c.176C>A	c.(175-177)cCt>cAt	p.P59H	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.P59H|HDAC10_ENST00000498366.1_5'Flank|MAPK12_ENST00000497036.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	59					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGACATGTCAGGCTGCAGCTG	0.517																																																	0													84.0	78.0	80.0					22																	50682713		2203	4300	6503	SO:0001583	missense	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.176C>A	22.37:g.50682713G>T	ENSP00000248846:p.Pro59His	Somatic		WXS	SOLID	Phase_I	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971703	0.53614	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.13420	2.99;2.59	4.27	4.27	0.50696	.	0.736339	0.13036	N	0.418923	T	0.21103	0.0508	L	0.27053	0.805	0.09310	N	1	D;D;D	0.76494	0.999;0.993;0.999	P;P;P	0.62014	0.897;0.835;0.894	T	0.06607	-1.0817	10	0.72032	D	0.01	.	10.2195	0.43188	0.0926:0.0:0.9074:0.0	.	59;59;59	A7E2V7;B2RWN4;Q96RT7	.;.;GCP6_HUMAN	H	59	ENSP00000248846:P59H;ENSP00000397387:P59H	ENSP00000248846:P59H	P	-	2	0	TUBGCP6	49024840	0.638000	0.27225	0.663000	0.29738	0.527000	0.34593	4.020000	0.57189	2.212000	0.71576	0.561000	0.74099	CCT		0.517	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3		NM_020461	
VCAN	1462	hgsc.bcm.edu;ucsc.edu	37	5	82837110	82837110	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr5:82837110C>T	ENST00000265077.3	+	8	8853	c.8288C>T	c.(8287-8289)cCa>cTa	p.P2763L	VCAN_ENST00000343200.5_Missense_Mutation_p.P1776L|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2763	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TCTTTTCAGCCAGAATTCTCT	0.433																																																	0													57.0	53.0	54.0					5																	82837110		2203	4300	6503	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8288C>T	5.37:g.82837110C>T	ENSP00000265077:p.Pro2763Leu	Somatic		WXS	SOLID	Phase_I	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568728	0.45798	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.66638	-0.22;-0.22	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000005	T	0.75932	0.3917	M	0.71581	2.175	0.80722	D	1	D;D	0.67145	0.986;0.996	P;P	0.56474	0.799;0.72	T	0.76291	-0.3013	10	0.51188	T	0.08	.	12.9124	0.58187	0.0:0.9254:0.0:0.0746	.	1776;2763	P13611-2;P13611	.;CSPG2_HUMAN	L	2763;1776	ENSP00000265077:P2763L;ENSP00000340062:P1776L	ENSP00000265077:P2763L	P	+	2	0	VCAN	82872866	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	3.256000	0.51492	2.941000	0.99782	0.655000	0.94253	CCA		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3		NM_004385	
ZBTB38	253461	hgsc.bcm.edu;ucsc.edu	37	3	141161504	141161504	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr3:141161504T>G	ENST00000514251.1	+	4	553	c.274T>G	c.(274-276)Tac>Gac	p.Y92D	ZBTB38_ENST00000441582.2_Missense_Mutation_p.Y92D|ZBTB38_ENST00000321464.5_Missense_Mutation_p.Y93D					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						TAATTATATCTACAGTTCCAC	0.418																																																	0													60.0	56.0	57.0					3																	141161504		1876	4106	5982	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.274T>G	3.37:g.141161504T>G	ENSP00000426387:p.Tyr92Asp	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.974403	0.74246	.	.	ENSG00000177311	ENST00000509842;ENST00000507722;ENST00000513258;ENST00000509883;ENST00000514251;ENST00000510338;ENST00000504673;ENST00000441582;ENST00000321464;ENST00000510726;ENST00000509813	D;D;D;D;D;D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	5.07	5.07	0.68467	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	H	0.97214	3.96	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96366	0.9270	10	0.05620	T	0.96	-32.8665	15.1317	0.72530	0.0:0.0:0.0:1.0	.	93;92	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	D	92;92;92;92;92;92;92;92;93;92;92	ENSP00000426931:Y92D;ENSP00000421037:Y92D;ENSP00000426288:Y92D;ENSP00000424254:Y92D;ENSP00000426387:Y92D;ENSP00000425705:Y92D;ENSP00000422347:Y92D;ENSP00000406955:Y92D;ENSP00000372635:Y93D;ENSP00000422081:Y92D;ENSP00000422894:Y92D	ENSP00000372635:Y93D	Y	+	1	0	ZBTB38	142644194	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.043000	0.60533	0.482000	0.46254	TAC		0.418	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			
ZNF112	7771	hgsc.bcm.edu;ucsc.edu	37	19	44832958	44832958	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr19:44832958T>A	ENST00000337401.4	-	5	1458	c.1370A>T	c.(1369-1371)cAt>cTt	p.H457L	ZNF112_ENST00000536500.1_Missense_Mutation_p.H474L|ZNF112_ENST00000354340.4_Missense_Mutation_p.H451L	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GTCCTGAAAATGTGAGGCCAG	0.383																																																	0													100.0	93.0	96.0					19																	44832958		2203	4300	6503	SO:0001583	missense	7771			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1370A>T	19.37:g.44832958T>A	ENSP00000337081:p.His457Leu	Somatic		WXS	SOLID	Phase_I	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	T	1.441	-0.567665	0.03910	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.05649	3.41;3.42;3.42	4.73	-1.12	0.09808	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.474047	0.15704	N	0.248749	T	0.03608	0.0103	L	0.48362	1.52	0.09310	N	1	B;B;B	0.34015	0.183;0.435;0.309	B;B;B	0.28139	0.039;0.086;0.039	T	0.40346	-0.9568	10	0.09338	T	0.73	-4.2101	1.7207	0.02911	0.1514:0.3623:0.1564:0.3299	.	456;474;457	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	L	457;457;451;474;456	ENSP00000337081:H457L;ENSP00000346305:H451L;ENSP00000441990:H474L	ENSP00000253426:H456L	H	-	2	0	ZNF285	49524798	0.000000	0.05858	0.006000	0.13384	0.354000	0.29330	-0.586000	0.05787	-0.163000	0.10946	0.459000	0.35465	CAT		0.383	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1		NM_013380	
ZNF423	23090	hgsc.bcm.edu;ucsc.edu	37	16	49670635	49670635	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr16:49670635T>C	ENST00000561648.1	-	4	2481	c.2428A>G	c.(2428-2430)Aag>Gag	p.K810E	ZNF423_ENST00000563137.2_Missense_Mutation_p.K750E|ZNF423_ENST00000562520.1_Missense_Mutation_p.K750E|ZNF423_ENST00000262383.2_Missense_Mutation_p.K810E|ZNF423_ENST00000535559.1_Missense_Mutation_p.K693E|ZNF423_ENST00000562871.1_Missense_Mutation_p.K750E|ZNF423_ENST00000567169.1_Missense_Mutation_p.K693E	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	810					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CTGCAGAACTTACAGTTATAC	0.572																																																	0													184.0	178.0	180.0					16																	49670635		2198	4300	6498	SO:0001583	missense	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2428A>G	16.37:g.49670635T>C	ENSP00000455426:p.Lys810Glu	Somatic		WXS	SOLID	Phase_I	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	T	11.91	1.779355	0.31502	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.27557	1.66;1.66	4.81	3.69	0.42338	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.252836	0.38837	N	0.001560	T	0.20129	0.0484	N	0.11870	0.19	0.24055	N	0.996032	B	0.33549	0.417	B	0.39935	0.314	T	0.19160	-1.0314	9	.	.	.	-13.397	11.5692	0.50824	0.0:0.0:0.1498:0.8502	.	810	Q2M1K9	ZN423_HUMAN	E	810;693	ENSP00000262383:K810E;ENSP00000442321:K693E	.	K	-	1	0	ZNF423	48228136	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	5.154000	0.64894	0.675000	0.31264	0.459000	0.35465	AAG		0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1		NM_015069	
ZNF644	84146	hgsc.bcm.edu;ucsc.edu	37	1	91404914	91404914	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4761-01A-01D-1366-10	TCGA-BP-4761-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9f040c94-45f7-4bf8-8942-874f64582355	31b833b1-bdf1-414a-9a37-36039d4a7204	g.chr1:91404914C>A	ENST00000370440.1	-	3	2214	c.1997G>T	c.(1996-1998)gGa>gTa	p.G666V	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.G666V|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	666					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TGAGGTTGATCCAAATGTTCG	0.378																																																	0													139.0	138.0	138.0					1																	91404914		2203	4300	6503	SO:0001583	missense	84146			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1997G>T	1.37:g.91404914C>A	ENSP00000359469:p.Gly666Val	Somatic		WXS	SOLID	Phase_I	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	37	CCDS731.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566723	0.28003	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	T;T	0.00630	6.1;6.1	6.02	5.08	0.68730	.	0.115539	0.64402	D	0.000015	T	0.00524	0.0017	L	0.51422	1.61	0.80722	D	1	B	0.15930	0.015	B	0.15052	0.012	T	0.64947	-0.6287	10	0.49607	T	0.09	-15.2539	17.4209	0.87515	0.0:0.8761:0.1239:0.0	.	666	Q9H582	ZN644_HUMAN	V	666;666;238	ENSP00000359469:G666V;ENSP00000337008:G666V	ENSP00000337008:G666V	G	-	2	0	ZNF644	91177502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.498000	0.35660	2.850000	0.98022	0.650000	0.86243	GGA		0.378	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2		NM_032186	
