#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ANKRD52	283373	hgsc.bcm.edu	37	12	56646070	56646070	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr12:56646070C>T	ENST00000267116.7	-	14	1521	c.1400G>A	c.(1399-1401)gGt>gAt	p.G467D		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	467										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						CTGGTAGCTACCGTTAGCAGC	0.557																																																	0													70.0	72.0	72.0					12																	56646070		2031	4184	6215	SO:0001583	missense	283373			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.1400G>A	12.37:g.56646070C>T	ENSP00000267116:p.Gly467Asp	Somatic		WXS	SOLID	Phase_I	A6NE79|B1Q2K2	Missense_Mutation	SNP	ENST00000267116.7	37	CCDS44920.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711119	0.89112	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	T	0.73897	-0.79	5.3	5.3	0.74995	Ankyrin repeat-containing domain (4);	0.113307	0.64402	D	0.000014	D	0.84397	0.5463	M	0.73962	2.25	0.80722	D	1	D	0.63046	0.992	P	0.61477	0.889	D	0.83465	0.0056	10	0.38643	T	0.18	.	18.1167	0.89558	0.0:1.0:0.0:0.0	.	467	Q8NB46	ANR52_HUMAN	D	467	ENSP00000267116:G467D	ENSP00000267116:G467D	G	-	2	0	ANKRD52	54932337	1.000000	0.71417	0.982000	0.44146	0.971000	0.66376	7.716000	0.84723	2.655000	0.90218	0.557000	0.71058	GGT		0.557	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1		NM_173595	
APBA3	9546	hgsc.bcm.edu	37	19	3754020	3754020	+	Silent	SNP	G	G	C	rs61731066	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr19:3754020G>C	ENST00000316757.3	-	5	1046	c.846C>G	c.(844-846)tcC>tcG	p.S282S	AC005954.3_ENST00000591962.1_RNA|AC005954.4_ENST00000586503.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	282	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGTACCTGGGAGTCCGCTG	0.706													G|||	86	0.0171725	0.0091	0.036	5008	,	,		12207	0.0		0.0308	False		,,,				2504	0.0184																0								G		41,4365	35.2+/-66.4	0,41,2162	27.0	25.0	26.0		846	1.7	1.0	19	dbSNP_129	26	286,8314	97.2+/-158.9	4,278,4018	no	coding-synonymous	APBA3	NM_004886.3		4,319,6180	CC,CG,GG		3.3256,0.9305,2.5142		282/576	3754020	327,12679	2203	4300	6503	SO:0001819	synonymous_variant	9546			AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.846C>G	19.37:g.3754020G>C		Somatic		WXS	SOLID	Phase_I	O60483|Q9UPZ2	Silent	SNP	ENST00000316757.3	37	CCDS12110.1																																																																																				0.706	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453634.2			
APBB2	323	hgsc.bcm.edu	37	4	40892444	40892444	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr4:40892444C>A	ENST00000295974.8	-	12	2092	c.1463G>T	c.(1462-1464)aGc>aTc	p.S488I	APBB2_ENST00000513140.1_Missense_Mutation_p.S467I|APBB2_ENST00000506352.1_Missense_Mutation_p.S467I|APBB2_ENST00000508593.1_Missense_Mutation_p.S489I	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	488	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						GTGCAGCACGCTGCGGTCCAT	0.617																																					Ovarian(3;20 75 16686 49997)												0													81.0	83.0	83.0					4																	40892444		2161	4271	6432	SO:0001583	missense	323			U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.1463G>T	4.37:g.40892444C>A	ENSP00000295974:p.Ser488Ile	Somatic		WXS	SOLID	Phase_I	B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	ENST00000295974.8	37	CCDS54761.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.03|15.03|15.03	2.713293|2.713293|2.713293	0.48517|0.48517|0.48517	.|.|.	.|.|.	ENSG00000163697|ENSG00000163697|ENSG00000163697	ENST00000513493|ENST00000513611|ENST00000295974;ENST00000316212;ENST00000513140;ENST00000508593;ENST00000506352	.|.|T;T;T;T	.|.|0.20463	.|.|2.07;2.07;2.07;2.07	5.78|5.78|5.78	-0.704|-0.704|-0.704	0.11256|0.11256|0.11256	.|.|Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	.|.|0.610145	.|.|0.17953	.|.|N	.|.|0.156421	T|T|T	0.26593|0.26593|0.26593	0.0650|0.0650|0.0650	L|L|L	0.36672|0.36672|0.36672	1.1|1.1|1.1	0.25583|0.25583|0.25583	N|N|N	0.986775|0.986775|0.986775	.|.|B;B;B;B	.|.|0.30033	.|.|0.029;0.266;0.225;0.266	.|.|B;B;B;B	.|.|0.37015	.|.|0.055;0.185;0.239;0.185	T|T|T	0.49113|0.49113|0.49113	-0.8973|-0.8973|-0.8973	5|5|10	.|.|0.72032	.|.|D	.|.|0.01	-7.6985|-7.6985|-7.6985	25.9718|25.9718|25.9718	0.99995|0.99995|0.99995	0.0:0.8006:0.1994:0.0|0.0:0.8006:0.1994:0.0|0.0:0.8006:0.1994:0.0	.|.|.	.|.|450;489;467;488	.|.|B4DJ88;E9PG87;Q92870-2;Q92870	.|.|.;.;.;APBB2_HUMAN	S|H|I	25|457|488;487;467;489;467	.|.|ENSP00000295974:S488I;ENSP00000426018:S467I;ENSP00000427211:S489I;ENSP00000421539:S467I	.|.|ENSP00000295974:S488I	A|Q|S	-|-|-	1|3|2	0|2|0	APBB2|APBB2|APBB2	40587201|40587201|40587201	0.659000|0.659000|0.659000	0.27411|0.27411|0.27411	0.012000|0.012000|0.012000	0.15200|0.15200|0.15200	0.986000|0.986000|0.986000	0.74619|0.74619|0.74619	0.934000|0.934000|0.934000	0.28910|0.28910|0.28910	-0.177000|-0.177000|-0.177000	0.10690|0.10690|0.10690	-0.282000|-0.282000|-0.282000	0.10007|0.10007|0.10007	GCG|CAG|AGC		0.617	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3		NM_173075	
ARID3B	10620	hgsc.bcm.edu	37	15	74836314	74836316	+	In_Frame_Del	DEL	CAA	CAA	-	rs8043032|rs529059345|rs540147284	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr15:74836314_74836316delCAA	ENST00000346246.5	+	2	268_270	c.37_39delCAA	c.(37-39)caadel	p.Q15del		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	15	Gln-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						gcagcagcagcaacaacagaagc	0.571																																																	0										1115,3137		140,835,1151						2.7	0.9			20	850,7396		47,756,3320	no	coding	ARID3B	NM_006465.2		187,1591,4471	A1A1,A1R,RR		10.308,26.223,15.7225				1965,10533				SO:0001651	inframe_deletion	10620				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.37_39delCAA	15.37:g.74836317_74836319delCAA	ENSP00000343126:p.Gln15del	Somatic		WXS	SOLID	Phase_I	O95443|Q59HC9|Q6P9C9	In_Frame_Del	DEL	ENST00000346246.5	37	CCDS10264.1																																																																																				0.571	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280688.2		NM_006465	
ASB11	140456	hgsc.bcm.edu;ucsc.edu	37	X	15320875	15320875	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chrX:15320875A>G	ENST00000480796.1	-	2	286	c.236T>C	c.(235-237)cTg>cCg	p.L79P	ASB11_ENST00000537676.1_Missense_Mutation_p.L58P|ASB11_ENST00000380470.3_Missense_Mutation_p.L79P|ASB11_ENST00000344384.4_Missense_Mutation_p.L58P			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	79					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					TTTAAGGGCCAGTAAGCGCCC	0.433																																																	0													89.0	80.0	83.0					X																	15320875		2203	4300	6503	SO:0001583	missense	140456			AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.236T>C	X.37:g.15320875A>G	ENSP00000417914:p.Leu79Pro	Somatic		WXS	SOLID	Phase_I	E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	ENST00000480796.1	37	CCDS14164.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100189	0.76983	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	T;T;T;T	0.63913	-0.07;0.68;-0.07;-0.07	5.69	5.69	0.88448	Ankyrin repeat-containing domain (4);	0.000000	0.51477	D	0.000091	T	0.61974	0.2390	N	0.10809	0.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.64283	-0.6444	10	0.30854	T	0.27	-8.6778	13.6886	0.62531	1.0:0.0:0.0:0.0	.	79;79;58	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	P	58;79;58;79	ENSP00000445465:L58P;ENSP00000369837:L79P;ENSP00000343408:L58P;ENSP00000417914:L79P	ENSP00000343408:L58P	L	-	2	0	ASB11	15230796	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.598000	0.82745	1.912000	0.55364	0.486000	0.48141	CTG		0.433	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055852.2			
ATP8B4	79895	hgsc.bcm.edu;ucsc.edu	37	15	50154547	50154547	+	Silent	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr15:50154547C>T	ENST00000284509.6	-	27	3333	c.3192G>A	c.(3190-3192)caG>caA	p.Q1064Q	ATP8B4_ENST00000559829.1_Silent_p.Q1064Q	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1064						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		AGATGCACTTCTGGGTCAGGG	0.388																																																	0													89.0	82.0	85.0					15																	50154547		2196	4295	6491	SO:0001819	synonymous_variant	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3192G>A	15.37:g.50154547C>T		Somatic		WXS	SOLID	Phase_I	Q9H727	Silent	SNP	ENST00000284509.6	37	CCDS32238.1																																																																																				0.388	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1		NM_024837	
BCAS1	8537	hgsc.bcm.edu;ucsc.edu	37	20	52583461	52583461	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr20:52583461G>A	ENST00000395961.3	-	9	1500	c.1334C>T	c.(1333-1335)gCg>gTg	p.A445V	BCAS1_ENST00000371435.2_Intron|BCAS1_ENST00000434986.2_Intron|BCAS1_ENST00000371440.3_Missense_Mutation_p.A476V	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	445						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			TCTGAGAAACGCCATCAGAGA	0.483																																																	0													225.0	218.0	221.0					20																	52583461		2203	4300	6503	SO:0001583	missense	8537			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.1334C>T	20.37:g.52583461G>A	ENSP00000379290:p.Ala445Val	Somatic		WXS	SOLID	Phase_I	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	37	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945381	0.34377	.	.	ENSG00000064787	ENST00000448484;ENST00000371440;ENST00000395961	T;T;T	0.08458	3.09;3.09;3.09	5.81	4.78	0.61160	.	0.777423	0.12428	N	0.469784	T	0.12263	0.0298	M	0.61703	1.905	0.80722	D	1	D;P;P	0.56287	0.975;0.919;0.919	P;B;B	0.46299	0.511;0.259;0.259	T	0.02026	-1.1227	10	0.37606	T	0.19	-10.1778	6.7348	0.23403	0.1436:0.0:0.8564:0.0	.	445;445;445	B2RCQ5;A0AVG7;O75363	.;.;BCAS1_HUMAN	V	338;476;445	ENSP00000396361:A338V;ENSP00000360495:A476V;ENSP00000379290:A445V	ENSP00000360495:A476V	A	-	2	0	BCAS1	52016868	0.558000	0.26554	0.988000	0.46212	0.801000	0.45260	1.392000	0.34486	2.736000	0.93811	0.655000	0.94253	GCG		0.483	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2		NM_003657	
C2orf66	401027	hgsc.bcm.edu;ucsc.edu	37	2	197674050	197674050	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:197674050G>A	ENST00000342506.2	-	1	950	c.62C>T	c.(61-63)gCa>gTa	p.A21V		NM_213608.2	NP_998773.1	Q6UXQ4	CB066_HUMAN	chromosome 2 open reading frame 66	21						extracellular region (GO:0005576)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9						CAGGAGAGGTGCTCTGGTCAT	0.502																																																	0													193.0	175.0	181.0					2																	197674050		2203	4300	6503	SO:0001583	missense	401027				CCDS2317.1	2q33.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000187944	ENSG00000187944			33809	protein-coding gene	gene with protein product							Standard	NM_213608		Approved	UNQ6411	uc002utv.3	Q6UXQ4	OTTHUMG00000132742	ENST00000342506.2:c.62C>T	2.37:g.197674050G>A	ENSP00000339384:p.Ala21Val	Somatic		WXS	SOLID	Phase_I	B2RNW3	Missense_Mutation	SNP	ENST00000342506.2	37	CCDS2317.1	.	.	.	.	.	.	.	.	.	.	G	6.063	0.379920	0.11466	.	.	ENSG00000187944	ENST00000342506	.	.	.	4.2	-1.12	0.09808	.	0.334006	0.21166	N	0.079079	T	0.22475	0.0542	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.27502	-1.0072	9	0.10636	T	0.68	1.3819	8.4601	0.32923	0.6893:0.0:0.3107:0.0	.	21	Q6UXQ4	CB066_HUMAN	V	21	.	ENSP00000339384:A21V	A	-	2	0	C2orf66	197382295	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.265000	0.18515	-0.118000	0.11851	0.655000	0.94253	GCA		0.502	C2orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256102.1		NM_213608	
C4orf29	80167	hgsc.bcm.edu;ucsc.edu	37	4	128949871	128949871	+	Missense_Mutation	SNP	A	A	G	rs375508834		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr4:128949871A>G	ENST00000444616.1	+	10	1188	c.941A>G	c.(940-942)aAa>aGa	p.K314R	C4orf29_ENST00000398965.1_Missense_Mutation_p.K314R|C4orf29_ENST00000388795.5_Missense_Mutation_p.K266R			Q0P651	CD029_HUMAN	chromosome 4 open reading frame 29	314						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						TCAACCAACAAAAGTGGTTAT	0.378																																																	0								A	ARG/LYS	1,3803		0,1,1901	91.0	90.0	90.0		941	0.5	1.0	4		90	0,8260		0,0,4130	no	missense	C4orf29	NM_001039717.1	26	0,1,6031	GG,GA,AA		0.0,0.0263,0.0083	benign	314/415	128949871	1,12063	1902	4130	6032	SO:0001583	missense	80167			AK024759	CCDS47131.1	4q28.2	2008-02-05			ENSG00000164074	ENSG00000164074			26111	protein-coding gene	gene with protein product						12477932	Standard	XM_006714318		Approved	FLJ21106	uc021xrt.1	Q0P651	OTTHUMG00000133304	ENST00000444616.1:c.941A>G	4.37:g.128949871A>G	ENSP00000397229:p.Lys314Arg	Somatic		WXS	SOLID	Phase_I	A1A4W8|A1A4W9|Q9H7A7	Missense_Mutation	SNP	ENST00000444616.1	37		.	.	.	.	.	.	.	.	.	.	A	7.996	0.754393	0.15778	2.63E-4	0.0	ENSG00000164074	ENST00000454347;ENST00000398961;ENST00000398965;ENST00000444616;ENST00000388795;ENST00000545758;ENST00000437077	.	.	.	4.35	0.528	0.17089	.	0.545828	0.20902	N	0.083632	T	0.23727	0.0574	N	0.24115	0.695	0.22511	N	0.999039	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.0	T	0.17018	-1.0383	9	0.22706	T	0.39	-19.3209	8.2557	0.31756	0.6073:0.0:0.3927:0.0	.	266;314	B7WP89;Q0P651	.;CD029_HUMAN	R	314;145;314;314;266;232;221	.	ENSP00000373447:K266R	K	+	2	0	C4orf29	129169321	0.998000	0.40836	0.984000	0.44739	0.737000	0.42083	1.380000	0.34351	0.242000	0.21303	-0.256000	0.11100	AAA		0.378	C4orf29-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257098.1		NM_001039717	
CACNA1I	8911	hgsc.bcm.edu	37	22	39966976	39966976	+	Silent	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr22:39966976C>T	ENST00000402142.3	+	1	219	c.219C>T	c.(217-219)atC>atT	p.I73I	CACNA1I_ENST00000400164.3_Silent_p.I73I|CACNA1I_ENST00000404898.1_Silent_p.I73I|CACNA1I_ENST00000336649.4_Silent_p.I73I|CACNA1I_ENST00000407673.1_Silent_p.I73I|CACNA1I_ENST00000401624.1_Silent_p.I73I	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	73					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.I73M(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	ACTGGTGCATCAAGATGGTGT	0.622																																																	1	Substitution - Missense(1)	breast(1)											72.0	79.0	77.0					22																	39966976		2099	4207	6306	SO:0001819	synonymous_variant	8911			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.219C>T	22.37:g.39966976C>T		Somatic		WXS	SOLID	Phase_I	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	CCDS46710.1																																																																																				0.622	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1		NM_001003406	
CCT7	10574	hgsc.bcm.edu	37	2	73471736	73471736	+	Missense_Mutation	SNP	C	C	A	rs369515793		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:73471736C>A	ENST00000258091.5	+	6	652	c.511C>A	c.(511-513)Cag>Aag	p.Q171K	CCT7_ENST00000540468.1_Missense_Mutation_p.Q84K|CCT7_ENST00000473786.1_3'UTR|CCT7_ENST00000537131.1_Missense_Mutation_p.Q71K|CCT7_ENST00000538797.1_Missense_Mutation_p.Q43K|CCT7_ENST00000539919.1_Missense_Mutation_p.Q127K|CCT7_ENST00000398422.2_Intron	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	171					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						GATCTCCCAGCAGAAAGCTTT	0.502																																																	0													57.0	57.0	57.0					2																	73471736		2047	4212	6259	SO:0001583	missense	10574			AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.511C>A	2.37:g.73471736C>A	ENSP00000258091:p.Gln171Lys	Somatic		WXS	SOLID	Phase_I	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Missense_Mutation	SNP	ENST00000258091.5	37	CCDS46336.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.210487	0.58343	.	.	ENSG00000135624	ENST00000540468;ENST00000539919;ENST00000258091;ENST00000537131;ENST00000538797;ENST00000409081	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	4.89	4.89	0.63831	.	0.118711	0.64402	D	0.000015	T	0.81861	0.4912	M	0.72894	2.215	0.80722	D	1	P;B;B;P;P	0.44986	0.556;0.04;0.009;0.633;0.847	B;B;B;P;P	0.53954	0.236;0.049;0.012;0.61;0.738	T	0.77202	-0.2674	10	0.06891	T	0.86	-20.3397	15.9615	0.79933	0.0:1.0:0.0:0.0	.	84;43;71;129;171	B7Z4Z7;B7Z1C9;F5GZK5;B8ZZC9;Q99832	.;.;.;.;TCPH_HUMAN	K	84;127;171;71;43;129	ENSP00000442058:Q84K;ENSP00000437824:Q127K;ENSP00000258091:Q171K;ENSP00000444379:Q71K;ENSP00000438462:Q43K	ENSP00000258091:Q171K	Q	+	1	0	CCT7	73325244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.827000	0.62723	2.712000	0.92718	0.563000	0.77884	CAG		0.502	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2			
CDCA5	113130	hgsc.bcm.edu	37	11	64846929	64846929	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr11:64846929G>A	ENST00000275517.3	-	5	746	c.574C>T	c.(574-576)Ccc>Tcc	p.P192S	CDCA5_ENST00000404147.3_Missense_Mutation_p.P192S	NM_080668.3	NP_542399.1	Q96FF9	CDCA5_HUMAN	cell division cycle associated 5	192					double-strand break repair (GO:0006302)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|regulation of cohesin localization to chromatin (GO:0071922)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CAAACCCTGGGGACCTCGGTG	0.597																																																	0													63.0	71.0	68.0					11																	64846929		2201	4297	6498	SO:0001583	missense	113130			BG354578	CCDS8091.1	11q13.1	2011-01-31			ENSG00000146670	ENSG00000146670			14626	protein-coding gene	gene with protein product	"""sororin"""	609374				12188893, 15837422	Standard	NM_080668		Approved		uc001ocp.2	Q96FF9	OTTHUMG00000150420	ENST00000275517.3:c.574C>T	11.37:g.64846929G>A	ENSP00000275517:p.Pro192Ser	Somatic		WXS	SOLID	Phase_I	A8K625	Missense_Mutation	SNP	ENST00000275517.3	37	CCDS8091.1	.	.	.	.	.	.	.	.	.	.	G	6.154	0.396564	0.11638	.	.	ENSG00000146670	ENST00000275517;ENST00000404147	T;T	0.42131	0.98;0.98	5.52	-0.321	0.12717	.	0.504675	0.22458	N	0.059786	T	0.31389	0.0795	M	0.70595	2.14	0.09310	N	1	B	0.28419	0.211	B	0.25614	0.062	T	0.14671	-1.0464	10	0.29301	T	0.29	.	1.6958	0.02862	0.1653:0.1183:0.2942:0.4222	.	192	Q96FF9	CDCA5_HUMAN	S	192	ENSP00000275517:P192S;ENSP00000385711:P192S	ENSP00000275517:P192S	P	-	1	0	CDCA5	64603505	0.918000	0.31147	0.016000	0.15963	0.048000	0.14542	0.457000	0.21875	-0.033000	0.13736	-0.182000	0.12963	CCC		0.597	CDCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385186.1		NM_080668	
CDK5RAP1	51654	hgsc.bcm.edu	37	20	31946927	31946927	+	Silent	SNP	G	G	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr20:31946927G>T	ENST00000357886.4	-	15	1881	c.1728C>A	c.(1726-1728)atC>atA	p.I576I	CDK5RAP1_ENST00000473997.1_Silent_p.I472I|CDK5RAP1_ENST00000346416.2_Silent_p.I562I|CDK5RAP1_ENST00000339269.5_Silent_p.I485I			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	576	CDK5R1-binding.|TRAM.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						TGGCTGAGGTGATCTGAAAGA	0.507																																																	0													102.0	94.0	97.0					20																	31946927		2203	4300	6503	SO:0001819	synonymous_variant	51654			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1728C>A	20.37:g.31946927G>T		Somatic		WXS	SOLID	Phase_I	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Silent	SNP	ENST00000357886.4	37		.	.	.	.	.	.	.	.	.	.	G	4.524	0.097250	0.08681	.	.	ENSG00000101391	ENST00000427097	.	.	.	5.2	2.23	0.28157	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.987	4.0535	0.09806	0.2574:0.0:0.579:0.1636	.	.	.	.	X	231	.	.	S	-	2	0	CDK5RAP1	31410588	1.000000	0.71417	0.978000	0.43139	0.248000	0.25809	0.329000	0.19698	0.449000	0.26747	0.655000	0.94253	TCA		0.507	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1		NM_016408	
CHAF1A	10036	hgsc.bcm.edu	37	19	4428837	4428837	+	Silent	SNP	G	G	A	rs373495353		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr19:4428837G>A	ENST00000301280.5	+	8	1655	c.1554G>A	c.(1552-1554)ctG>ctA	p.L518L	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	518					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCAGCCCCTGAGGTCCGGAC	0.592								Chromatin Structure																																									0													36.0	40.0	39.0					19																	4428837		2203	4300	6503	SO:0001819	synonymous_variant	10036			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1554G>A	19.37:g.4428837G>A		Somatic		WXS	SOLID	Phase_I	Q6NXG5|Q7Z7K3|Q9UJY8	Silent	SNP	ENST00000301280.5	37	CCDS32875.1																																																																																				0.592	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2		NM_005483	
CHN1	1123	hgsc.bcm.edu;ucsc.edu	37	2	175742775	175742775	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:175742775G>T	ENST00000409900.3	-	6	655	c.342C>A	c.(340-342)caC>caA	p.H114Q	CHN1_ENST00000488080.1_Intron|CHN1_ENST00000409156.3_Missense_Mutation_p.H114Q	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	114	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TCACCAGATCGTGGATGGACT	0.438			T	TAF15	extraskeletal myxoid chondrosarcoma																																			Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	0													157.0	148.0	151.0					2																	175742775		1939	4158	6097	SO:0001583	missense	1123				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.342C>A	2.37:g.175742775G>T	ENSP00000386741:p.His114Gln	Somatic		WXS	SOLID	Phase_I	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	ENST00000409900.3	37	CCDS46455.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189605	0.57909	.	.	ENSG00000128656	ENST00000409900;ENST00000409156	D;D	0.87491	-2.26;-2.26	5.67	3.86	0.44501	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.86669	0.5988	N	0.20357	0.565	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.85130	0.971;0.997	D	0.85298	0.1071	10	0.51188	T	0.08	.	9.0043	0.36102	0.2506:0.0:0.7494:0.0	.	114;114	B4DV19;P15882	.;CHIN_HUMAN	Q	114	ENSP00000386741:H114Q;ENSP00000386470:H114Q	ENSP00000386470:H114Q	H	-	3	2	CHN1	175451021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.902000	0.39848	0.738000	0.32606	0.655000	0.94253	CAC		0.438	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334453.1		NM_001822	
COL11A1	1301	hgsc.bcm.edu;ucsc.edu	37	1	103354185	103354185	+	Splice_Site	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr1:103354185C>T	ENST00000370096.3	-	62	4868	c.4556G>A	c.(4555-4557)gGa>gAa	p.G1519E	COL11A1_ENST00000358392.2_Splice_Site_p.G1531E|COL11A1_ENST00000512756.1_Splice_Site_p.G1403E|COL11A1_ENST00000353414.4_Splice_Site_p.G1480E	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1519	Collagen-like 8.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCCAGCGGGTCCCTGTTAGAA	0.413																																																	0													68.0	70.0	69.0					1																	103354185		2203	4300	6503	SO:0001630	splice_region_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4555-1G>A	1.37:g.103354185C>T		Somatic		WXS	SOLID	Phase_I	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977220	0.74360	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99619	-6.28;-6.28;-6.28;-6.28	5.67	5.67	0.87782	.	0.053328	0.85682	D	0.000000	D	0.99846	0.9929	H	0.97440	4.005	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.998	D	0.96852	0.9626	10	0.87932	D	0	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	1403;1480;1531;1519;739	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	E	1519;1531;1480;739;1403	ENSP00000359114:G1519E;ENSP00000351163:G1531E;ENSP00000302551:G1480E;ENSP00000426533:G1403E	ENSP00000302551:G1480E	G	-	2	0	COL11A1	103126773	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.487000	0.81328	2.680000	0.91292	0.655000	0.94253	GGA		0.413	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1		NM_080630	Missense_Mutation
CPSF2	53981	hgsc.bcm.edu;ucsc.edu	37	14	92624218	92624218	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr14:92624218A>T	ENST00000298875.4	+	13	2096	c.1811A>T	c.(1810-1812)cAc>cTc	p.H604L		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	604					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		AGTGAAACTCACATCTACCAG	0.418																																					Ovarian(78;28 1788 18702 44111)												0													63.0	64.0	64.0					14																	92624218		2203	4300	6503	SO:0001583	missense	53981			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.1811A>T	14.37:g.92624218A>T	ENSP00000298875:p.His604Leu	Somatic		WXS	SOLID	Phase_I	B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	ENST00000298875.4	37	CCDS9902.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.1|20.1	3.939443|3.939443	0.73557|0.73557	.|.	.|.	ENSG00000165934|ENSG00000165934	ENST00000298875|ENST00000555244	T|.	0.43688|.	0.94|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74245|0.74245	0.3691|0.3691	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	P|.	0.39424|.	0.673|.	P|.	0.44732|.	0.459|.	T|T	0.74194|0.74194	-0.3744|-0.3744	10|5	0.42905|.	T|.	0.14|.	.|.	16.0499|16.0499	0.80749|0.80749	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	604|.	Q9P2I0|.	CPSF2_HUMAN|.	L|S	604|121	ENSP00000298875:H604L|.	ENSP00000298875:H604L|.	H|T	+|+	2|1	0|0	CPSF2|CPSF2	91693971|91693971	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.843000|0.843000	0.47879|0.47879	7.220000|7.220000	0.78008|0.78008	2.193000|2.193000	0.70182|0.70182	0.533000|0.533000	0.62120|0.62120	CAC|ACA		0.418	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1			
DDX23	9416	hgsc.bcm.edu;ucsc.edu	37	12	49233687	49233687	+	Silent	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr12:49233687C>T	ENST00000308025.3	-	5	499	c.420G>A	c.(418-420)caG>caA	p.Q140Q	DDX23_ENST00000553182.1_5'UTR	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	140	Glu-rich.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						GGGATAATGGCTGGGCCTGAA	0.458																																																	0													99.0	97.0	97.0					12																	49233687		2203	4300	6503	SO:0001819	synonymous_variant	9416			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.420G>A	12.37:g.49233687C>T		Somatic		WXS	SOLID	Phase_I	B2R600|B4DH15|O43188	Silent	SNP	ENST00000308025.3	37	CCDS8770.1																																																																																				0.458	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2		NM_004818	
DDX50	79009	hgsc.bcm.edu;ucsc.edu	37	10	70673216	70673216	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr10:70673216G>C	ENST00000373585.3	+	6	934	c.827G>C	c.(826-828)aGt>aCt	p.S276T	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	276	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						CATCTGCAGAGTGGCCGATTG	0.393																																																	0													152.0	143.0	146.0					10																	70673216		2203	4300	6503	SO:0001583	missense	79009			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.827G>C	10.37:g.70673216G>C	ENSP00000362687:p.Ser276Thr	Somatic		WXS	SOLID	Phase_I	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565454	0.45694	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.13420	2.59	5.09	5.09	0.68999	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.082300	0.85682	D	0.000000	T	0.09291	0.0229	N	0.17901	0.54	0.37521	D	0.917549	B;B	0.30236	0.274;0.146	B;B	0.30401	0.115;0.101	T	0.11717	-1.0576	10	0.72032	D	0.01	-7.7474	8.1499	0.31134	0.1388:0.0:0.8612:0.0	.	276;276	Q9BQ39;B4DED6	DDX50_HUMAN;.	T	276	ENSP00000362687:S276T	ENSP00000362687:S276T	S	+	2	0	DDX50	70343222	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.046000	0.71029	2.530000	0.85305	0.462000	0.41574	AGT		0.393	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1		NM_024045	
EPC2	26122	hgsc.bcm.edu;ucsc.edu	37	2	149520266	149520266	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:149520266A>C	ENST00000258484.6	+	6	877	c.843A>C	c.(841-843)gaA>gaC	p.E281D		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	281					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		ATGGTGGTGAAATCCTTAATG	0.313																																																	0													68.0	59.0	62.0					2																	149520266		1825	4081	5906	SO:0001583	missense	26122			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.843A>C	2.37:g.149520266A>C	ENSP00000258484:p.Glu281Asp	Somatic		WXS	SOLID	Phase_I	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	37	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.997382	0.74818	.	.	ENSG00000135999	ENST00000258484	.	.	.	5.44	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.74764	0.3759	M	0.78223	2.4	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.73266	-0.4037	9	0.34782	T	0.22	-4.3835	11.1506	0.48455	0.9276:0.0:0.0724:0.0	.	281	Q52LR7	EPC2_HUMAN	D	281	.	ENSP00000258484:E281D	E	+	3	2	EPC2	149236736	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.089000	0.41672	0.918000	0.36919	0.477000	0.44152	GAA		0.313	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1		NM_015630	
FNDC3B	64778	hgsc.bcm.edu;ucsc.edu	37	3	172115178	172115178	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr3:172115178T>A	ENST00000336824.4	+	26	3627	c.3528T>A	c.(3526-3528)gaT>gaA	p.D1176E	FNDC3B_ENST00000415807.2_Missense_Mutation_p.D1176E|FNDC3B_ENST00000416957.1_Missense_Mutation_p.D1176E	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	1176					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGCCTACTGATGAACAGTTTG	0.418																																																	0													196.0	169.0	178.0					3																	172115178		2203	4300	6503	SO:0001583	missense	64778			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.3528T>A	3.37:g.172115178T>A	ENSP00000338523:p.Asp1176Glu	Somatic		WXS	SOLID	Phase_I	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.415690	0.62511	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.33216	1.42;1.42;1.42	5.76	-1.07	0.09968	.	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	M	0.63843	1.955	0.80722	D	1	D	0.59357	0.985	P	0.58013	0.831	T	0.40021	-0.9585	10	0.52906	T	0.07	-22.2439	12.6039	0.56513	0.0:0.4414:0.0:0.5586	.	1176	Q53EP0	FND3B_HUMAN	E	1176	ENSP00000411242:D1176E;ENSP00000338523:D1176E;ENSP00000389094:D1176E	ENSP00000338523:D1176E	D	+	3	2	FNDC3B	173597872	1.000000	0.71417	0.997000	0.53966	0.925000	0.55904	0.786000	0.26844	-0.121000	0.11787	-0.456000	0.05471	GAT		0.418	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2		NM_022763	
HARS2	23438	hgsc.bcm.edu;ucsc.edu	37	5	140076951	140076951	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr5:140076951G>A	ENST00000230771.3	+	10	1380	c.1157G>A	c.(1156-1158)gGg>gAg	p.G386E	HARS2_ENST00000437649.2_Missense_Mutation_p.G312E|HARS2_ENST00000435019.2_Missense_Mutation_p.G346E|HARS2_ENST00000508522.1_Missense_Mutation_p.G361E|HARS2_ENST00000432671.2_Missense_Mutation_p.G272E|HARS2_ENST00000448069.2_Missense_Mutation_p.G214E|ZMAT2_ENST00000274712.3_5'Flank	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	386					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGCATTGGGGTTGAGCGA	0.557																																																	0													67.0	65.0	65.0					5																	140076951		2203	4300	6503	SO:0001583	missense	23438			U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.1157G>A	5.37:g.140076951G>A	ENSP00000230771:p.Gly386Glu	Somatic		WXS	SOLID	Phase_I	B4DDY8	Missense_Mutation	SNP	ENST00000230771.3	37	CCDS4238.1	.	.	.	.	.	.	.	.	.	.	g	26.7	4.759424	0.89932	.	.	ENSG00000112855	ENST00000230771;ENST00000435019;ENST00000437649;ENST00000432671;ENST00000508522;ENST00000448069;ENST00000427675	T;T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82;-0.82	5.67	5.67	0.87782	Aminoacyl-tRNA synthetase, class II (1);	0.091610	0.85682	D	0.000000	D	0.92551	0.7634	H	0.98918	4.37	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.997	D	0.95207	0.8322	10	0.87932	D	0	-2.8342	19.3952	0.94604	0.0:0.0:1.0:0.0	.	239;214;312;361;386	E9PD60;B4DQ67;E9PG66;B4DDY8;P49590	.;.;.;.;SYHM_HUMAN	E	386;346;312;272;361;214;225	ENSP00000230771:G386E;ENSP00000412887:G346E;ENSP00000411708:G312E;ENSP00000415007:G272E;ENSP00000423616:G361E;ENSP00000407105:G214E	ENSP00000230771:G386E	G	+	2	0	HARS2	140057135	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	9.553000	0.98118	2.673000	0.90976	0.655000	0.94253	GGG		0.557	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2		NM_012208	
GEMIN5	25929	hgsc.bcm.edu;ucsc.edu	37	5	154278063	154278063	+	Silent	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr5:154278063C>T	ENST00000285873.7	-	23	3357	c.3282G>A	c.(3280-3282)gaG>gaA	p.E1094E		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1094					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCAGAAGCAGCTCTTGGGCAC	0.537																																																	0													104.0	103.0	103.0					5																	154278063		2203	4300	6503	SO:0001819	synonymous_variant	25929			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.3282G>A	5.37:g.154278063C>T		Somatic		WXS	SOLID	Phase_I	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	37	CCDS4330.1																																																																																				0.537	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1			
JAK3	3718	hgsc.bcm.edu	37	19	17945471	17945471	+	Silent	SNP	G	G	A	rs35458530	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr19:17945471G>A	ENST00000527670.1	-	16	2288	c.2259C>T	c.(2257-2259)gcC>gcT	p.A753A	JAK3_ENST00000534444.1_Silent_p.A753A|JAK3_ENST00000458235.1_Silent_p.A753A			P52333	JAK3_HUMAN	Janus kinase 3	753	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GAATCAGCAGGGCCAGCTCTG	0.582		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""								G|||	23	0.00459265	0.003	0.0058	5008	,	,		14422	0.0		0.0129	False		,,,				2504	0.002							Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0								G		8,4398	12.9+/-30.5	0,8,2195	52.0	60.0	58.0		2259	-0.1	0.1	19	dbSNP_126	58	117,8483	59.1+/-120.7	0,117,4183	no	coding-synonymous	JAK3	NM_000215.3		0,125,6378	AA,AG,GG		1.3605,0.1816,0.9611		753/1125	17945471	125,12881	2203	4300	6503	SO:0001819	synonymous_variant	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2259C>T	19.37:g.17945471G>A		Somatic		WXS	SOLID	Phase_I	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Silent	SNP	ENST00000527670.1	37	CCDS12366.1																																																																																				0.582	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1		NM_000215	
JPH1	56704	hgsc.bcm.edu	37	8	75157095	75157095	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr8:75157095G>C	ENST00000342232.4	-	4	1614	c.1574C>G	c.(1573-1575)gCg>gGg	p.A525G	JPH1_ENST00000518195.1_5'Flank	NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	525					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GGGCACAACCGCTCCTGCCTC	0.562																																																	0													81.0	66.0	71.0					8																	75157095		2203	4300	6503	SO:0001583	missense	56704			AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.1574C>G	8.37:g.75157095G>C	ENSP00000344488:p.Ala525Gly	Somatic		WXS	SOLID	Phase_I	B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	37	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	G	7.417	0.635913	0.14386	.	.	ENSG00000104369	ENST00000342232	T	0.57595	0.39	5.17	4.3	0.51218	.	0.631850	0.16790	N	0.199431	T	0.33059	0.0850	N	0.22421	0.69	0.09310	N	1	B	0.32160	0.358	B	0.22880	0.042	T	0.10894	-1.0610	10	0.23302	T	0.38	.	9.8822	0.41240	0.1539:0.0:0.8461:0.0	.	525	Q9HDC5	JPH1_HUMAN	G	525	ENSP00000344488:A525G	ENSP00000344488:A525G	A	-	2	0	JPH1	75319649	0.005000	0.15991	0.036000	0.18154	0.520000	0.34377	1.505000	0.35736	1.425000	0.47237	0.655000	0.94253	GCG		0.562	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1			
KDM6B	23135	hgsc.bcm.edu	37	17	7755027	7755027	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr17:7755027G>T	ENST00000448097.2	+	17	4409	c.4078G>T	c.(4078-4080)Ggc>Tgc	p.G1360C	KDM6B_ENST00000254846.5_Missense_Mutation_p.G1360C			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1360	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						AACATCCACGGGCAACATGCT	0.662											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													18.0	18.0	18.0					17																	7755027		2182	4279	6461	SO:0001583	missense	23135			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4078G>T	17.37:g.7755027G>T	ENSP00000412513:p.Gly1360Cys	Somatic	644	WXS	SOLID	Phase_I	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	18.71	3.681312	0.68042	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.72725	-0.68;-0.68	5.12	5.12	0.69794	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.116385	0.56097	D	0.000029	T	0.82061	0.4955	L	0.58669	1.825	0.80722	D	1	B;D	0.89917	0.431;1.0	B;D	0.78314	0.253;0.991	T	0.83202	-0.0078	10	0.87932	D	0	-16.5003	17.8586	0.88773	0.0:0.0:1.0:0.0	.	1360;1360	O15054;O15054-1	KDM6B_HUMAN;.	C	1360	ENSP00000254846:G1360C;ENSP00000412513:G1360C	ENSP00000254846:G1360C	G	+	1	0	KDM6B	7695752	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.377000	0.79668	2.834000	0.97654	0.650000	0.86243	GGC		0.662	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1		XM_043272	
KIDINS220	57498	hgsc.bcm.edu;ucsc.edu	37	2	8891618	8891618	+	Silent	SNP	G	G	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:8891618G>C	ENST00000256707.3	-	23	3349	c.3168C>G	c.(3166-3168)ccC>ccG	p.P1056P	KIDINS220_ENST00000427284.1_Silent_p.P1056P|KIDINS220_ENST00000473731.1_Silent_p.P1056P|KIDINS220_ENST00000418530.1_Silent_p.P1014P	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1056					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCCGTAGTTTGGGATCTAGGT	0.328																																																	0													94.0	92.0	92.0					2																	8891618		1809	4070	5879	SO:0001819	synonymous_variant	57498			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3168C>G	2.37:g.8891618G>C		Somatic		WXS	SOLID	Phase_I	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	ENST00000256707.3	37	CCDS42650.1																																																																																				0.328	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2		NM_020738	
KRT86	3892	hgsc.bcm.edu;ucsc.edu	37	12	52695702	52695703	+	Start_Codon_Ins	INS	-	-	G			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr12:52695702_52695703insG	ENST00000423955.2	+	0	180_181				KRT86_ENST00000544024.1_Start_Codon_Ins|KRT86_ENST00000293525.5_Start_Codon_Ins			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		AAAAGCACCATGACTTGTGGAT	0.634																																																	0																																										SO:0001582	initiator_codon_variant	3892			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.3dupG	12.37:g.52695703_52695703dupG		Somatic		WXS	SOLID	Phase_I	P78387	Frame_Shift_Ins	INS	ENST00000423955.2	37	CCDS41785.1																																																																																				0.634	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1		NM_002284	
KRTAP7-1	337878	hgsc.bcm.edu	37	21	32201969	32201969	+	RNA	DEL	G	G	-	rs35359062|rs397778172		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr21:32201969delG	ENST00000452750.1	-	0	109							Q8IUC3	KRA71_HUMAN	keratin associated protein 7-1 (gene/pseudogene)							intermediate filament (GO:0005882)											TGGTCCCATAGAATAGGGTAT	0.502																																																	0													63.0	65.0	64.0					21																	32201969		692	1591	2283			337878			AJ457063	CCDS74780.1	21q22.1	2014-04-10	2010-03-12		ENSG00000184586	ENSG00000274749		"""Keratin associated proteins"""	18934	protein-coding gene	gene with protein product			"""keratin associated protein 7-1"""			12359730	Standard	NM_181606		Approved	KAP7.1	uc011adj.2	Q8IUC3	OTTHUMG00000188305		21.37:g.32201969delG		Somatic		WXS	SOLID	Phase_I	Q3LI56	Frame_Shift_Del	DEL	ENST00000452750.1	37																																																																																					0.502	KRTAP7-1-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000128248.3		NM_181606	
LAX1	54900	hgsc.bcm.edu;ucsc.edu	37	1	203741246	203741246	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr1:203741246T>C	ENST00000442561.2	+	4	751	c.361T>C	c.(361-363)Tcc>Ccc	p.S121P	LAX1_ENST00000367217.5_Missense_Mutation_p.S105P|LAX1_ENST00000367215.1_3'UTR	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	121					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAGCCTCCTCTCCAGAAATTC	0.493																																																	0													117.0	111.0	113.0					1																	203741246		2203	4300	6503	SO:0001583	missense	54900			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.361T>C	1.37:g.203741246T>C	ENSP00000406970:p.Ser121Pro	Somatic		WXS	SOLID	Phase_I	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	T	17.05	3.291185	0.59976	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.16	4.02	0.46733	.	0.102880	0.44097	D	0.000486	T	0.42698	0.1214	L	0.47716	1.5	0.32798	N	0.500265	P;P	0.45634	0.863;0.863	P;P	0.44647	0.456;0.456	T	0.59878	-0.7371	9	0.87932	D	0	-18.851	7.9927	0.30250	0.0:0.0972:0.0:0.9028	.	105;121	B7Z744;Q8IWV1	.;LAX1_HUMAN	P	121;105	.	ENSP00000356186:S105P	S	+	1	0	LAX1	202007869	0.994000	0.37717	1.000000	0.80357	0.922000	0.55478	2.003000	0.40844	2.068000	0.61886	0.533000	0.62120	TCC		0.493	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3		NM_017773	
LRBA	987	hgsc.bcm.edu	37	4	151358010	151358010	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr4:151358010C>T	ENST00000357115.3	-	46	7063	c.6820G>A	c.(6820-6822)Gga>Aga	p.G2274R	LRBA_ENST00000510413.1_Missense_Mutation_p.G2263R|LRBA_ENST00000507224.1_Missense_Mutation_p.G2263R|LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.G2263R	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2274	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.		G -> R (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G2274R(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TTCAGAGCTCCTATTGGCTGC	0.393																																																	1	Substitution - Missense(1)	breast(1)											72.0	62.0	65.0					4																	151358010		2203	4300	6503	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6820G>A	4.37:g.151358010C>T	ENSP00000349629:p.Gly2274Arg	Somatic		WXS	SOLID	Phase_I	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	C	34	5.333637	0.95758	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	5.93	5.93	0.95920	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.94794	0.8319	H	0.96996	3.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95720	0.8765	10	0.87932	D	0	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	2274;2263;164	P50851;P50851-2;Q68D03	LRBA_HUMAN;.;.	R	2263;2263;2274;2263	ENSP00000446299:G2263R;ENSP00000421552:G2263R;ENSP00000349629:G2274R;ENSP00000422180:G2263R	ENSP00000349629:G2274R	G	-	1	0	LRBA	151577460	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.743000	0.85020	2.798000	0.96311	0.655000	0.94253	GGA		0.393	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			
MC2R	4158	hgsc.bcm.edu;ucsc.edu	37	18	13885200	13885200	+	Silent	SNP	G	G	T	rs147706299	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr18:13885200G>T	ENST00000327606.3	-	2	498	c.318C>A	c.(316-318)atC>atA	p.I106I		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	106					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)			breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	ACAGGGAGTCGATGATGTCAT	0.498																																					Colon(141;1584 1782 35999 48227 48692)												0													121.0	87.0	99.0					18																	13885200		2203	4300	6503	SO:0001819	synonymous_variant	4158				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.318C>A	18.37:g.13885200G>T		Somatic		WXS	SOLID	Phase_I	A8K016|Q3MI45|Q504X6	Silent	SNP	ENST00000327606.3	37	CCDS11869.1																																																																																				0.498	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2			
MMP27	64066	hgsc.bcm.edu;ucsc.edu	37	11	102564646	102564646	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr11:102564646C>A	ENST00000260229.4	-	8	1275	c.1184G>T	c.(1183-1185)tGg>tTg	p.W395L		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	395					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CCTCCAGCACCAAATGCCCAC	0.358																																																	0													114.0	108.0	110.0					11																	102564646		2203	4299	6502	SO:0001583	missense	64066			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1184G>T	11.37:g.102564646C>A	ENSP00000260229:p.Trp395Leu	Somatic		WXS	SOLID	Phase_I	Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	CCDS8319.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.973281	0.34848	.	.	ENSG00000137675	ENST00000260229	T	0.02369	4.32	4.79	3.8	0.43715	Hemopexin/matrixin (2);	0.309234	0.23468	N	0.047849	T	0.01489	0.0048	N	0.03194	-0.395	0.26601	N	0.973021	B	0.11235	0.004	B	0.04013	0.001	T	0.41610	-0.9499	10	0.56958	D	0.05	.	6.6219	0.22808	0.0:0.7219:0.0:0.2781	.	395	Q9H306	MMP27_HUMAN	L	395	ENSP00000260229:W395L	ENSP00000260229:W395L	W	-	2	0	MMP27	102069856	0.003000	0.15002	1.000000	0.80357	0.995000	0.86356	1.363000	0.34159	2.467000	0.83353	0.655000	0.94253	TGG		0.358	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1		NM_022122	
MORC2	22880	hgsc.bcm.edu;ucsc.edu	37	22	31346363	31346363	+	Splice_Site	SNP	T	T	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr22:31346363T>A	ENST00000397641.3	-	4	634	c.226A>T	c.(226-228)Agt>Tgt	p.S76C	MORC2_ENST00000215862.4_Splice_Site_p.S14C			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	76						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CATCACTTACTTGGATCCATT	0.438																																																	0													88.0	80.0	83.0					22																	31346363		2203	4300	6503	SO:0001630	splice_region_variant	22880			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.226+1A>T	22.37:g.31346363T>A		Somatic		WXS	SOLID	Phase_I	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	T	22.0	4.229065	0.79688	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.74421	-0.84;-0.84	5.65	5.65	0.86999	ATPase-like, ATP-binding domain (4);	0.232527	0.50627	D	0.000116	T	0.74764	0.3759	M	0.62723	1.935	0.80722	D	1	P	0.50710	0.938	P	0.46758	0.526	T	0.75695	-0.3228	9	.	.	.	.	12.1154	0.53861	0.0:0.0:0.1432:0.8568	.	76	Q9Y6X9	MORC2_HUMAN	C	76;14	ENSP00000380763:S76C;ENSP00000215862:S14C	.	S	-	1	0	MORC2	29676363	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.423000	0.59861	2.157000	0.67596	0.528000	0.53228	AGT		0.438	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2		NM_014941	Missense_Mutation
NECAP2	55707	hgsc.bcm.edu;ucsc.edu	37	1	16775619	16775619	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr1:16775619C>G	ENST00000337132.5	+	5	502	c.412C>G	c.(412-414)Caa>Gaa	p.Q138E	NECAP2_ENST00000504551.2_Missense_Mutation_p.Q77E|NECAP2_ENST00000457722.2_Missense_Mutation_p.Q112E|NECAP2_ENST00000406746.1_Missense_Mutation_p.Q138E|NECAP2_ENST00000443980.2_Missense_Mutation_p.Q138E	NM_001145278.1|NM_018090.4	NP_001138750.1|NP_060560.1	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2	138					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		ATTTGCAAAACAAGCCCAGAA	0.532																																																	0													96.0	75.0	82.0					1																	16775619		2203	4300	6503	SO:0001583	missense	55707			AK021938	CCDS173.1, CCDS44066.1, CCDS44067.1	1p36.13	2008-02-05			ENSG00000157191	ENSG00000157191			25528	protein-coding gene	gene with protein product		611624				14555962, 15494011	Standard	NM_001145277		Approved	FLJ10420	uc001ayq.3	Q9NVZ3	OTTHUMG00000002313	ENST00000337132.5:c.412C>G	1.37:g.16775619C>G	ENSP00000338746:p.Gln138Glu	Somatic		WXS	SOLID	Phase_I	B4DY19|E9PGQ8|Q5VSU4|Q5VSU5|Q9H7L1|Q9H8L1	Missense_Mutation	SNP	ENST00000337132.5	37	CCDS173.1	.	.	.	.	.	.	.	.	.	.	C	5.839	0.338952	0.11069	.	.	ENSG00000157191	ENST00000337132;ENST00000504551;ENST00000457722;ENST00000406746;ENST00000263498;ENST00000443980;ENST00000492095	T;T;T;T;T;T	0.41400	1.0;1.62;1.0;1.0;1.0;1.0	5.71	4.77	0.60923	.	0.050732	0.85682	D	0.000000	T	0.19725	0.0474	N	0.04508	-0.205	0.53688	D	0.999977	B;B;B	0.15930	0.012;0.014;0.015	B;B;B	0.19946	0.016;0.018;0.027	T	0.10177	-1.0641	10	0.02654	T	1	-12.6039	14.6258	0.68621	0.0:0.8544:0.1456:0.0	.	112;138;138	Q9NVZ3-4;Q9NVZ3-2;Q9NVZ3	.;.;NECP2_HUMAN	E	138;77;112;138;138;138;138	ENSP00000338746:Q138E;ENSP00000424509:Q77E;ENSP00000407091:Q112E;ENSP00000383925:Q138E;ENSP00000391942:Q138E;ENSP00000427620:Q138E	ENSP00000263498:Q138E	Q	+	1	0	NECAP2	16648206	0.994000	0.37717	1.000000	0.80357	0.982000	0.71751	1.592000	0.36676	2.691000	0.91804	0.563000	0.77884	CAA		0.532	NECAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006680.2		NM_018090	
NFE2L2	4780	hgsc.bcm.edu;ucsc.edu	37	2	178096052	178096052	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:178096052C>A	ENST00000397062.3	-	5	1833	c.1279G>T	c.(1279-1281)Gag>Tag	p.E427*	NFE2L2_ENST00000446151.2_Nonsense_Mutation_p.E404*|NFE2L2_ENST00000464747.1_Nonsense_Mutation_p.E411*|NFE2L2_ENST00000397063.4_Nonsense_Mutation_p.E411*	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	427					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AATTCTTTCTCTGGTGTGTTC	0.468			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	0													158.0	147.0	151.0					2																	178096052		1973	4186	6159	SO:0001587	stop_gained	4780				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.1279G>T	2.37:g.178096052C>A	ENSP00000380252:p.Glu427*	Somatic		WXS	SOLID	Phase_I	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Nonsense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504234	0.64410	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627	.	.	.	5.83	2.17	0.27698	.	0.400516	0.31660	N	0.007280	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0103	5.4187	0.16388	0.0:0.2077:0.1365:0.6558	.	.	.	.	X	411;427;404;155	.	ENSP00000380252:E427X	E	-	1	0	NFE2L2	177804298	.	.	0.945000	0.38365	0.884000	0.51177	.	.	0.137000	0.18759	-1.339000	0.01253	GAG		0.468	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4		NM_006164	
NOTCH3	4854	hgsc.bcm.edu	37	19	15300136	15300136	+	Silent	SNP	A	A	G	rs61749020	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr19:15300136A>G	ENST00000263388.2	-	7	1215	c.1140T>C	c.(1138-1140)ccT>ccC	p.P380P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	380	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGAAGCCGGGAGGACAGGTGC	0.602													A|||	76	0.0151757	0.0212	0.0173	5008	,	,		16950	0.0		0.0229	False		,,,				2504	0.0133																0								A		83,4323	69.2+/-107.0	1,81,2121	82.0	84.0	83.0		1140	-5.0	0.0	19	dbSNP_129	83	327,8273	112.0+/-172.2	8,311,3981	no	coding-synonymous	NOTCH3	NM_000435.2		9,392,6102	GG,GA,AA		3.8023,1.8838,3.1524		380/2322	15300136	410,12596	2203	4300	6503	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1140T>C	19.37:g.15300136A>G		Somatic		WXS	SOLID	Phase_I	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																				0.602	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1		NM_000435	
NUP160	23279	hgsc.bcm.edu;ucsc.edu	37	11	47857324	47857324	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr11:47857324T>C	ENST00000378460.2	-	7	1026	c.980A>G	c.(979-981)tAt>tGt	p.Y327C	NUP160_ENST00000532747.1_3'UTR|NUP160_ENST00000528071.1_Missense_Mutation_p.Y213C|NUP160_ENST00000530326.1_Missense_Mutation_p.Y213C	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	327					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CACAGGGACATACTCCAGCAT	0.448																																																	0													164.0	144.0	150.0					11																	47857324		2201	4298	6499	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.980A>G	11.37:g.47857324T>C	ENSP00000367721:p.Tyr327Cys	Somatic		WXS	SOLID	Phase_I	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.472819	0.63737	.	.	ENSG00000030066	ENST00000378460;ENST00000426372;ENST00000530326;ENST00000528071	T;T;T	0.49720	0.77;0.77;0.77	5.38	1.2	0.21068	.	0.283582	0.35235	N	0.003346	T	0.55081	0.1898	L	0.51422	1.61	0.80722	D	1	D	0.65815	0.995	P	0.62885	0.908	T	0.50197	-0.8856	10	0.39692	T	0.17	.	10.9398	0.47266	0.5697:0.0:0.0:0.4303	.	327	Q12769	NU160_HUMAN	C	327;77;213;213	ENSP00000367721:Y327C;ENSP00000433590:Y213C;ENSP00000432367:Y213C	ENSP00000367721:Y327C	Y	-	2	0	NUP160	47813900	0.996000	0.38824	0.998000	0.56505	0.908000	0.53690	1.536000	0.36072	0.247000	0.21414	0.482000	0.46254	TAT		0.448	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2		NM_015231	
OGG1	4968	hgsc.bcm.edu	37	3	9798842	9798842	+	3'UTR	SNP	A	A	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr3:9798842A>T	ENST00000344629.7	+	0	1389				OGG1_ENST00000349503.5_Intron|OGG1_ENST00000339511.5_3'UTR|OGG1_ENST00000302003.7_Missense_Mutation_p.T355S|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000302036.7_Intron|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000449570.2_Intron			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase						acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					TAGATGGGGCACCCTGGACAA	0.612								Base excision repair (BER), DNA glycosylases																																									0													90.0	97.0	95.0					3																	9798842		2203	4300	6503	SO:0001624	3_prime_UTR_variant	4968			U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.*8A>T	3.37:g.9798842A>T		Somatic		WXS	SOLID	Phase_I	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	37	CCDS2581.1	.	.	.	.	.	.	.	.	.	.	A	3.164	-0.171545	0.06421	.	.	ENSG00000114026	ENST00000302003;ENST00000339542	T	0.59772	0.24	4.77	-9.54	0.00572	.	.	.	.	.	T	0.22126	0.0533	N	0.04508	-0.205	0.09310	N	0.999999	B;B;B;B	0.10296	0.0;0.003;0.001;0.001	B;B;B;B	0.16289	0.003;0.015;0.005;0.001	T	0.12016	-1.0564	9	0.10111	T	0.7	.	3.916	0.09224	0.5641:0.1546:0.1355:0.1458	.	142;126;355;355	F8WA07;Q9HCR8;O15527-3;E5KPN0	.;.;.;.	S	355;142	ENSP00000305584:T355S	ENSP00000305584:T355S	T	+	1	0	OGG1	9773842	0.000000	0.05858	0.000000	0.03702	0.095000	0.18619	-1.633000	0.02022	-2.512000	0.00503	-0.182000	0.12963	ACC		0.612	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2		NM_016821	
OXCT1	5019	hgsc.bcm.edu;ucsc.edu	37	5	41807505	41807505	+	Silent	SNP	T	T	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr5:41807505T>A	ENST00000196371.5	-	8	928	c.768A>T	c.(766-768)ccA>ccT	p.P256P	OXCT1_ENST00000509987.1_Silent_p.P70P	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	256					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	GGATGTCTTCTGGAGCAAATG	0.313																																																	0													107.0	107.0	107.0					5																	41807505		2203	4300	6503	SO:0001819	synonymous_variant	5019			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.768A>T	5.37:g.41807505T>A		Somatic		WXS	SOLID	Phase_I	B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	CCDS3937.1																																																																																				0.313	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2		NM_000436	
PAAF1	80227	hgsc.bcm.edu;ucsc.edu	37	11	73620605	73620605	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr11:73620605T>A	ENST00000310571.3	+	7	747	c.694T>A	c.(694-696)Tcc>Acc	p.S232T	PAAF1_ENST00000544909.1_Missense_Mutation_p.S233T|PAAF1_ENST00000535604.1_Missense_Mutation_p.S117T|PAAF1_ENST00000544552.1_Missense_Mutation_p.S215T|PAAF1_ENST00000376384.5_Missense_Mutation_p.S215T|PAAF1_ENST00000536003.1_Missense_Mutation_p.S215T|PAAF1_ENST00000541951.1_Missense_Mutation_p.S117T	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	232					viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					TGCTGACAACTCCATAAACCT	0.488																																																	0													155.0	139.0	145.0					11																	73620605		2200	4293	6493	SO:0001583	missense	80227			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.694T>A	11.37:g.73620605T>A	ENSP00000311665:p.Ser232Thr	Somatic		WXS	SOLID	Phase_I	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Missense_Mutation	SNP	ENST00000310571.3	37	CCDS8226.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.336|8.336	0.827675|0.827675	0.16749|0.16749	.|.	.|.	ENSG00000175575|ENSG00000175575	ENST00000540659|ENST00000541951;ENST00000310571;ENST00000504441;ENST00000543814;ENST00000535604;ENST00000536003;ENST00000544552;ENST00000546039;ENST00000376384;ENST00000544909	.|T;T;T;T;T;T;T;T;T;T	.|0.80393	.|1.17;1.17;-1.37;-1.37;1.17;1.17;1.17;2.3;1.17;1.17	5.06|5.06	5.06|5.06	0.68205|0.68205	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.093731	.|0.47455	.|D	.|0.000233	T|T	0.78052|0.78052	0.4223|0.4223	L|L	0.50333|0.50333	1.59|1.59	0.30005|0.30005	N|N	0.815661|0.815661	.|D;B	.|0.54964	.|0.969;0.001	.|P;B	.|0.51895	.|0.683;0.0	T|T	0.71052|0.71052	-0.4704|-0.4704	5|10	.|0.08381	.|T	.|0.77	-7.397|-7.397	9.9149|9.9149	0.41427|0.41427	0.0:0.0:0.1712:0.8288|0.0:0.0:0.1712:0.8288	.|.	.|215;232	.|Q9BRP4-2;Q9BRP4	.|.;PAAF1_HUMAN	H|T	72|117;232;215;215;117;215;215;96;215;233	.|ENSP00000441333:S117T;ENSP00000311665:S232T;ENSP00000439747:S215T;ENSP00000438894:S215T;ENSP00000438789:S117T;ENSP00000438124:S215T;ENSP00000441494:S215T;ENSP00000439877:S96T;ENSP00000365564:S215T;ENSP00000438071:S233T	.|ENSP00000311665:S232T	L|S	+|+	2|1	0|0	PAAF1|PAAF1	73298253|73298253	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.109000|0.109000	0.19521|0.19521	1.350000|1.350000	0.34010|0.34010	1.922000|1.922000	0.55676|0.55676	0.459000|0.459000	0.35465|0.35465	CTC|TCC		0.488	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397885.1		NM_025155	
PDZD8	118987	hgsc.bcm.edu;ucsc.edu	37	10	119043260	119043260	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr10:119043260T>C	ENST00000334464.5	-	5	3223	c.2984A>G	c.(2983-2985)aAc>aGc	p.N995S	PDZD8_ENST00000482496.1_5'Flank	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	995					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TCCTGTGCTGTTTCCCCGTTT	0.473																																																	0													251.0	252.0	251.0					10																	119043260		2203	4300	6503	SO:0001583	missense	118987			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2984A>G	10.37:g.119043260T>C	ENSP00000334642:p.Asn995Ser	Somatic		WXS	SOLID	Phase_I	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.624226	0.00117	.	.	ENSG00000165650	ENST00000334464	D	0.84800	-1.9	5.96	-1.42	0.08913	.	0.745300	0.13191	N	0.406747	T	0.57359	0.2048	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52931	-0.8509	10	0.05620	T	0.96	-10.9758	7.8347	0.29363	0.0:0.2735:0.4668:0.2597	.	995	Q8NEN9	PDZD8_HUMAN	S	995	ENSP00000334642:N995S	ENSP00000334642:N995S	N	-	2	0	PDZD8	119033250	0.000000	0.05858	0.173000	0.22940	0.959000	0.62525	-0.037000	0.12164	0.125000	0.18397	-0.256000	0.11100	AAC		0.473	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1		NM_173791	
PKIA	5569	hgsc.bcm.edu;ucsc.edu	37	8	79510666	79510666	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr8:79510666G>C	ENST00000396418.2	+	3	533	c.47G>C	c.(46-48)aGa>aCa	p.R16T	PKIA_ENST00000518467.1_Missense_Mutation_p.R16T|PKIA_ENST00000352966.5_Missense_Mutation_p.R16T	NM_006823.3|NM_181839.2	NP_006814.1|NP_862822.1	P61925	IPKA_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor alpha	16		Important for inhibition. {ECO:0000250}.			negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP-dependent protein kinase inhibitor activity (GO:0004862)|protein kinase A catalytic subunit binding (GO:0034236)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	6						GCTTCAGGAAGAACAGGTAGA	0.373																																																	0													153.0	143.0	147.0					8																	79510666		2203	4300	6503	SO:0001583	missense	5569			S76965	CCDS6222.1	8q21.13	2014-08-12			ENSG00000171033	ENSG00000171033			9017	protein-coding gene	gene with protein product		606059		PRKACN1		1770951	Standard	NM_006823		Approved		uc003ybb.3	P61925	OTTHUMG00000164618	ENST00000396418.2:c.47G>C	8.37:g.79510666G>C	ENSP00000379696:p.Arg16Thr	Somatic		WXS	SOLID	Phase_I	P04541|Q6IAV2	Missense_Mutation	SNP	ENST00000396418.2	37	CCDS6222.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534763	0.64972	.	.	ENSG00000171033	ENST00000396418;ENST00000352966;ENST00000518467	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.82623	0.5077	.	.	.	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	T	0.82692	-0.0331	7	.	.	.	.	19.1925	0.93672	0.0:0.0:1.0:0.0	.	16	P61925	IPKA_HUMAN	T	16	.	.	R	+	2	0	PKIA	79673221	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.555000	0.90693	2.529000	0.85273	0.585000	0.79938	AGA		0.373	PKIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379420.1			
PLCD4	84812	hgsc.bcm.edu;ucsc.edu	37	2	219500531	219500531	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr2:219500531C>A	ENST00000450993.2	+	14	2248	c.1909C>A	c.(1909-1911)Cag>Aag	p.Q637K	PLCD4_ENST00000432688.1_Missense_Mutation_p.Q669K|PLCD4_ENST00000417849.1_Missense_Mutation_p.Q637K|RP11-548H3.1_ENST00000607946.1_RNA	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	637	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GATCAGCGGTCAGCAACTCCC	0.562																																																	0													46.0	48.0	48.0					2																	219500531		1954	4138	6092	SO:0001583	missense	84812			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1909C>A	2.37:g.219500531C>A	ENSP00000388631:p.Gln637Lys	Somatic		WXS	SOLID	Phase_I	Q53FS8	Missense_Mutation	SNP	ENST00000450993.2	37	CCDS46516.1	.	.	.	.	.	.	.	.	.	.	C	33	5.235163	0.95207	.	.	ENSG00000115556	ENST00000450993;ENST00000417849;ENST00000432688	T;T;T	0.65916	-0.18;-0.18;-0.18	5.37	5.37	0.77165	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.76111	0.3942	L	0.51422	1.61	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.77267	-0.2651	10	0.87932	D	0	.	18.9044	0.92454	0.0:1.0:0.0:0.0	.	637	Q9BRC7	PLCD4_HUMAN	K	637;637;669	ENSP00000388631:Q637K;ENSP00000396942:Q637K;ENSP00000396185:Q669K	ENSP00000396942:Q637K	Q	+	1	0	PLCD4	219208775	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.609000	0.82925	2.793000	0.96121	0.655000	0.94253	CAG		0.562	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1			
PPP1R10	5514	hgsc.bcm.edu	37	6	30570687	30570687	+	Silent	SNP	T	T	A	rs567936494|rs368947097	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr6:30570687T>A	ENST00000376511.2	-	18	2445	c.1893A>T	c.(1891-1893)ccA>ccT	p.P631P		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	631	Gly-rich.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						CAGGACCCCCTGGTGGGAAAC	0.547																																																	0								T		11,4359		0,11,2174	20.0	22.0	21.0		1893	-0.7	1.0	6		21	7,8515		0,7,4254	no	coding-synonymous	PPP1R10	NM_002714.2		0,18,6428	AA,AT,TT		0.0821,0.2517,0.1396		631/941	30570687	18,12874	2185	4261	6446	SO:0001819	synonymous_variant	5514			Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.1893A>T	6.37:g.30570687T>A		Somatic		WXS	SOLID	Phase_I	O00405	Silent	SNP	ENST00000376511.2	37	CCDS4681.1																																																																																				0.547	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2		NM_002714	
PTCH1	5727	hgsc.bcm.edu	37	9	98242754	98242754	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr9:98242754C>T	ENST00000331920.6	-	6	1162	c.863G>A	c.(862-864)gGt>gAt	p.G288D	PTCH1_ENST00000421141.1_Missense_Mutation_p.G137D|PTCH1_ENST00000430669.2_Missense_Mutation_p.G222D|PTCH1_ENST00000429896.2_Missense_Mutation_p.G137D|PTCH1_ENST00000375274.2_Missense_Mutation_p.G287D|PTCH1_ENST00000548379.1_5'UTR|PTCH1_ENST00000437951.1_Missense_Mutation_p.G222D|PTCH1_ENST00000418258.1_Missense_Mutation_p.G137D	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	288					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.G288D(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GTAACCATGACCAACCTCAGC	0.507																																																	1	Substitution - Missense(1)	skin(1)											120.0	117.0	118.0					9																	98242754		2203	4300	6503	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.863G>A	9.37:g.98242754C>T	ENSP00000332353:p.Gly288Asp	Somatic		WXS	SOLID	Phase_I	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	32	5.137868	0.94517	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271;ENST00000548420;ENST00000553011;ENST00000551845;ENST00000547672;ENST00000546820	D;D;D;D;D;D;D;D;T;D;D;D;D	0.91577	-2.87;-2.83;-2.82;-2.82;-2.83;-2.82;-2.87;-2.66;-1.16;-2.1;-2.1;-2.1;-2.1	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.95118	0.8418	M	0.71581	2.175	0.80722	D	1	D;P;D;P	0.89917	1.0;0.92;1.0;0.869	D;P;D;B	0.97110	1.0;0.674;0.997;0.418	D	0.93648	0.6970	10	0.39692	T	0.17	-18.3885	20.2187	0.98312	0.0:1.0:0.0:0.0	.	137;222;287;288	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	D	288;222;137;137;222;137;287;5;8;137;137;137;137	ENSP00000332353:G288D;ENSP00000389744:G222D;ENSP00000399981:G137D;ENSP00000396135:G137D;ENSP00000410287:G222D;ENSP00000414823:G137D;ENSP00000364423:G287D;ENSP00000364420:G5D;ENSP00000449078:G8D;ENSP00000447797:G137D;ENSP00000447008:G137D;ENSP00000447878:G137D;ENSP00000448843:G137D	ENSP00000332353:G288D	G	-	2	0	PTCH1	97282575	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.780000	0.95670	0.655000	0.94253	GGT		0.507	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2		NM_000264	
PTPN5	84867	hgsc.bcm.edu	37	11	18787397	18787397	+	Silent	SNP	G	G	T	rs528333442		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr11:18787397G>T	ENST00000358540.2	-	3	484	c.54C>A	c.(52-54)tcC>tcA	p.S18S	PTPN5_ENST00000396171.4_Silent_p.S18S|PTPN5_ENST00000396170.1_Silent_p.S18S|PTPN5_ENST00000396167.2_Silent_p.S18S|PTPN5_ENST00000396168.1_5'UTR	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	18					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						CCCCTCCCTCGGAGTCATCAG	0.552																																																	0													64.0	51.0	56.0					11																	18787397		2198	4292	6490	SO:0001819	synonymous_variant	84867			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.54C>A	11.37:g.18787397G>T		Somatic		WXS	SOLID	Phase_I	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Silent	SNP	ENST00000358540.2	37	CCDS7845.1																																																																																				0.552	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2		NM_001039970	
RET	5979	hgsc.bcm.edu;ucsc.edu	37	10	43608353	43608353	+	Silent	SNP	C	C	T	rs201209972	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr10:43608353C>T	ENST00000355710.3	+	9	1933	c.1701C>T	c.(1699-1701)gaC>gaT	p.D567D	RET_ENST00000340058.5_Silent_p.D567D	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	567					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCTGCCCCGACGGCCACTGCG	0.587		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma				C|||	2	0.000399361	0.0	0.0014	5008	,	,		19949	0.0		0.0	False		,,,				2504	0.001				Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0								C	,	0,4406		0,0,2203	105.0	78.0	87.0		1701,1701	-10.5	0.0	10		87	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	RET	NM_020630.4,NM_020975.4	,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,	567/1073,567/1115	43608353	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	5979	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1701C>T	10.37:g.43608353C>T		Somatic		WXS	SOLID	Phase_I	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	37	CCDS7200.1																																																																																				0.587	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2		NM_020975	
RFC2	5982	hgsc.bcm.edu	37	7	73661019	73661019	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr7:73661019T>A	ENST00000055077.3	-	5	467	c.407A>T	c.(406-408)aAg>aTg	p.K136M	RFC2_ENST00000352131.3_Intron	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	136					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						AATGATGATCTTATGTCGGCC	0.373																																																	0													182.0	170.0	174.0					7																	73661019		2203	4300	6503	SO:0001583	missense	5982				CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.407A>T	7.37:g.73661019T>A	ENSP00000055077:p.Lys136Met	Somatic		WXS	SOLID	Phase_I	B5BU07|D3DXG3|P32846|Q9BU93	Missense_Mutation	SNP	ENST00000055077.3	37	CCDS5568.1	.	.	.	.	.	.	.	.	.	.	t	26.5	4.741841	0.89573	.	.	ENSG00000049541	ENST00000055077	D	0.93247	-3.19	5.12	5.12	0.69794	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97701	0.9246	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98855	1.0760	10	0.87932	D	0	.	14.0527	0.64747	0.0:0.0:0.0:1.0	.	136	P35250	RFC2_HUMAN	M	136	ENSP00000055077:K136M	ENSP00000055077:K136M	K	-	2	0	RFC2	73298955	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.706000	0.84615	2.064000	0.61679	0.519000	0.50382	AAG		0.373	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2		NM_181471	
ZBED9	114821	hgsc.bcm.edu	37	6	28543264	28543264	+	Silent	SNP	C	C	T	rs17336532	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr6:28543264C>T	ENST00000452236.2	-	3	1835	c.1218G>A	c.(1216-1218)ttG>ttA	p.L406L	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						TTAATGACCGCAAAAAAGTTA	0.373													C|||	892	0.178115	0.1899	0.1729	5008	,	,		19492	0.1419		0.173	False		,,,				2504	0.2086																0								C		786,3614	288.1+/-279.7	64,658,1478	47.0	50.0	49.0		1218	3.5	1.0	6	dbSNP_123	49	1767,6833	311.6+/-310.4	184,1399,2717	no	coding-synonymous	SCAND3	NM_052923.1		248,2057,4195	TT,TC,CC		20.5465,17.8636,19.6385		406/1326	28543264	2553,10447	2200	4300	6500	SO:0001819	synonymous_variant	114821																														ENST00000452236.2:c.1218G>A	6.37:g.28543264C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000452236.2	37	CCDS34355.1																																																																																				0.373	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			
SI	6476	hgsc.bcm.edu	37	3	164777762	164777762	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr3:164777762A>T	ENST00000264382.3	-	10	1136	c.1074T>A	c.(1072-1074)agT>agA	p.S358R		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	358	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AATTCCAGCGACTTAGTTGGA	0.373										HNSCC(35;0.089)																																							0													133.0	146.0	142.0					3																	164777762		2203	4300	6503	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1074T>A	3.37:g.164777762A>T	ENSP00000264382:p.Ser358Arg	Somatic		WXS	SOLID	Phase_I	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	A	18.18	3.567647	0.65651	.	.	ENSG00000090402	ENST00000264382	D	0.93189	-3.18	5.49	1.71	0.24356	Glycoside hydrolase, superfamily (1);	0.082013	0.85682	D	0.000000	D	0.97523	0.9189	H	0.98256	4.185	0.45194	D	0.998201	D	0.89917	1.0	D	0.97110	1.0	D	0.96269	0.9197	10	0.62326	D	0.03	.	9.7063	0.40218	0.7068:0.0:0.2932:0.0	.	358	P14410	SUIS_HUMAN	R	358	ENSP00000264382:S358R	ENSP00000264382:S358R	S	-	3	2	SI	166260456	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	1.428000	0.34892	0.372000	0.24591	0.397000	0.26171	AGT		0.373	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1		NM_001041	
SLC4A4	8671	hgsc.bcm.edu	37	4	72313420	72313420	+	Silent	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr4:72313420C>T	ENST00000264485.5	+	9	1140	c.1023C>T	c.(1021-1023)ggC>ggT	p.G341G	SLC4A4_ENST00000512686.1_Silent_p.G297G|SLC4A4_ENST00000425175.1_Silent_p.G341G|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000340595.3_Silent_p.G297G|SLC4A4_ENST00000351898.6_Silent_p.G341G	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	341					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	ACGAGATTGGCAGAGCCATTG	0.438																																																	0													175.0	144.0	155.0					4																	72313420		2203	4300	6503	SO:0001819	synonymous_variant	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1023C>T	4.37:g.72313420C>T		Somatic		WXS	SOLID	Phase_I	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	CCDS43236.1																																																																																				0.438	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1		NM_003759	
SMAD4	4089	hgsc.bcm.edu	37	18	48604770	48604770	+	Missense_Mutation	SNP	G	G	A	rs377767378		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr18:48604770G>A	ENST00000342988.3	+	12	2130	c.1592G>A	c.(1591-1593)cGg>cAg	p.R531Q	SMAD4_ENST00000398417.2_Missense_Mutation_p.R531Q|SMAD4_ENST00000588745.1_Missense_Mutation_p.R435Q|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	531	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CACTTACACCGGGCCCTCCAG	0.478																																																	38	Whole gene deletion(36)|Unknown(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)											83.0	84.0	84.0					18																	48604770		2203	4300	6503	SO:0001583	missense	4089			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1592G>A	18.37:g.48604770G>A	ENSP00000341551:p.Arg531Gln	Somatic		WXS	SOLID	Phase_I	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796503	0.90453	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98822	-5.16;-5.16	6.07	6.07	0.98685	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99338	1.0911	10	0.46703	T	0.11	.	19.4308	0.94765	0.0:0.0:1.0:0.0	.	531	Q13485	SMAD4_HUMAN	Q	531	ENSP00000341551:R531Q;ENSP00000381452:R531Q	ENSP00000341551:R531Q	R	+	2	0	SMAD4	46858768	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.633000	0.98432	2.885000	0.99019	0.655000	0.94253	CGG		0.478	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3		NM_005359	
SORCS1	114815	hgsc.bcm.edu;ucsc.edu	37	10	108447986	108447986	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr10:108447986G>T	ENST00000263054.6	-	10	1531	c.1524C>A	c.(1522-1524)gaC>gaA	p.D508E	SORCS1_ENST00000344440.6_Missense_Mutation_p.D508E|SORCS1_ENST00000369698.1_Missense_Mutation_p.D43E	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	508					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TTAGATCCGTGTCCGGCGCCT	0.478																																																	0													110.0	100.0	103.0					10																	108447986		2203	4300	6503	SO:0001583	missense	114815			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1524C>A	10.37:g.108447986G>T	ENSP00000263054:p.Asp508Glu	Somatic		WXS	SOLID	Phase_I	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316066	0.40996	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.32272	1.46;1.46;1.46	6.17	4.32	0.51571	VPS10 (1);	0.116222	0.64402	D	0.000010	T	0.19366	0.0465	N	0.20401	0.57	0.26209	N	0.979327	B;B;B;B;B	0.20550	0.009;0.046;0.016;0.027;0.046	B;B;B;B;B	0.24394	0.024;0.053;0.053;0.024;0.053	T	0.18681	-1.0329	9	.	.	.	-31.8376	10.5554	0.45114	0.2074:0.0:0.7926:0.0	.	508;508;508;508;508	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	E	43;508;508	ENSP00000358712:D43E;ENSP00000263054:D508E;ENSP00000345964:D508E	.	D	-	3	2	SORCS1	108437976	1.000000	0.71417	0.752000	0.31206	0.953000	0.61014	1.588000	0.36633	0.918000	0.36919	0.655000	0.94253	GAC		0.478	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4		NM_052918	
SOX7	83595	hgsc.bcm.edu	37	8	10583337	10583337	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr8:10583337C>T	ENST00000304501.1	-	2	1156	c.1078G>A	c.(1078-1080)Gtg>Atg	p.V360M	SOX7_ENST00000553390.1_Missense_Mutation_p.V412M|SOX7_ENST00000554914.1_Missense_Mutation_p.V412M	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	360	Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V360L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		GTTGGTGTCACCTGGGAGACC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											76.0	70.0	72.0					8																	10583337		2203	4300	6503	SO:0001583	missense	83595			AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.1078G>A	8.37:g.10583337C>T	ENSP00000301921:p.Val360Met	Somatic		WXS	SOLID	Phase_I	B4DKV0|Q53YD0	Missense_Mutation	SNP	ENST00000304501.1	37	CCDS5977.1	.	.	.	.	.	.	.	.	.	.	C	8.188	0.795260	0.16327	.	.	ENSG00000171056;ENSG00000171056;ENSG00000258724	ENST00000304501;ENST00000553390;ENST00000554914	T;T;T	0.76448	-1.02;-1.02;-1.02	4.53	2.74	0.32292	.	0.770706	0.11610	U	0.546869	T	0.62816	0.2459	N	0.22421	0.69	0.24442	N	0.994523	B;B	0.31256	0.316;0.002	B;B	0.28553	0.091;0.011	T	0.52457	-0.8573	10	0.46703	T	0.11	.	8.205	0.31449	0.0:0.7324:0.0:0.2676	.	412;360	B4DKV0;Q9BT81	.;SOX7_HUMAN	M	360;412;412	ENSP00000301921:V360M;ENSP00000452017:V412M;ENSP00000451145:V412M	ENSP00000346908:V412M	V	-	1	0	SOX7;CTD-2135J3.4	10620747	0.269000	0.24143	1.000000	0.80357	0.493000	0.33554	0.808000	0.27154	0.527000	0.28560	-0.254000	0.11334	GTG		0.592	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207131.1			
STARD9	57519	hgsc.bcm.edu;ucsc.edu	37	15	42977628	42977628	+	Silent	SNP	T	T	C	rs143692879	byFrequency	TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr15:42977628T>C	ENST00000290607.7	+	23	3909	c.3852T>C	c.(3850-3852)caT>caC	p.H1284H		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1284					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						tccaaccccattgtgagctcc	0.527													T|||	3	0.000599042	0.0	0.0	5008	,	,		20166	0.0		0.003	False		,,,				2504	0.0																0								T		3,1381		0,3,689	68.0	57.0	60.0		3852	-3.3	0.0	15	dbSNP_134	60	14,3166		1,12,1577	no	coding-synonymous	STARD9	NM_020759.2		1,15,2266	CC,CT,TT		0.4403,0.2168,0.3725		1284/4701	42977628	17,4547	692	1590	2282	SO:0001819	synonymous_variant	57519			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.3852T>C	15.37:g.42977628T>C		Somatic		WXS	SOLID	Phase_I	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Silent	SNP	ENST00000290607.7	37	CCDS53935.1																																																																																				0.527	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431094.1			
TBC1D1	23216	hgsc.bcm.edu;ucsc.edu	37	4	38029477	38029477	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr4:38029477G>T	ENST00000261439.4	+	7	1634	c.1279G>T	c.(1279-1281)Gcg>Tcg	p.A427S	TBC1D1_ENST00000508802.1_Missense_Mutation_p.A427S	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	427					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						TCAGGAGCAGGCGACTATTTT	0.373																																																	0													70.0	70.0	70.0					4																	38029477		2203	4300	6503	SO:0001583	missense	23216			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1279G>T	4.37:g.38029477G>T	ENSP00000261439:p.Ala427Ser	Somatic		WXS	SOLID	Phase_I	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	CCDS33972.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	20.1|20.1|20.1	3.936741|3.936741|3.936741	0.73557|0.73557|0.73557	.|.|.	.|.|.	ENSG00000065882|ENSG00000065882|ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803|ENST00000510573|ENST00000513936	T;T;T|.|.	0.19806|.|.	3.47;3.87;2.12|.|.	5.15|5.15|5.15	5.15|5.15|5.15	0.70609|0.70609|0.70609	.|.|.	0.000000|.|.	0.56097|.|.	D|.|.	0.000039|.|.	T|T|T	0.75910|0.75910|0.75910	0.3914|0.3914|0.3914	M|M|M	0.74881|0.74881|0.74881	2.28|2.28|2.28	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D|.|.	0.76494|.|.	0.999;0.999;0.976;0.999|.|.	D;D;P;D|.|.	0.70487|.|.	0.945;0.969;0.53;0.945|.|.	T|T|T	0.76252|0.76252|0.76252	-0.3027|-0.3027|-0.3027	10|5|5	0.48119|.|.	T|.|.	0.1|.|.	-15.036|-15.036|-15.036	17.4085|17.4085|17.4085	0.87480|0.87480|0.87480	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	427;427;159;427|.|.	B9A6J6;E9PGH8;Q6PJJ8;Q86TI0|.|.	.;.;.;TBCD1_HUMAN|.|.	S|V|S	427;427;298|74|23	ENSP00000423651:A427S;ENSP00000261439:A427S;ENSP00000396877:A298S|.|.	ENSP00000261439:A427S|.|.	A|G|R	+|+|+	1|2|3	0|0|2	TBC1D1|TBC1D1|TBC1D1	37705872|37705872|37705872	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.983000|0.983000|0.983000	0.44433|0.44433|0.44433	0.910000|0.910000|0.910000	0.53928|0.53928|0.53928	6.860000|6.860000|6.860000	0.75473|0.75473|0.75473	2.391000|2.391000|2.391000	0.81399|0.81399|0.81399	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCG|GGC|AGG		0.373	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2		NM_015173	
TERT	7015	hgsc.bcm.edu	37	5	1254527	1254527	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr5:1254527C>T	ENST00000310581.5	-	15	3308	c.3251G>A	c.(3250-3252)cGa>cAa	p.R1084Q	TERT_ENST00000296820.5_3'UTR|TERT_ENST00000334602.6_Missense_Mutation_p.R1021Q	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	1084	CTE.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	GACACGGTGTCGAGTCAGCTT	0.682									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																																								0													55.0	65.0	62.0					5																	1254527		2133	4256	6389	SO:0001583	missense	7015	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.3251G>A	5.37:g.1254527C>T	ENSP00000309572:p.Arg1084Gln	Somatic		WXS	SOLID	Phase_I	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	ENST00000310581.5	37	CCDS3861.2	.	.	.	.	.	.	.	.	.	.	c	0.696	-0.792593	0.02884	.	.	ENSG00000164362	ENST00000310581;ENST00000334602	D;D	0.96885	-4.16;-4.04	4.22	-1.92	0.07618	.	1.312180	0.05086	N	0.484410	D	0.90477	0.7017	L	0.41573	1.285	0.09310	N	1	B;B	0.24675	0.109;0.005	B;B	0.12156	0.007;0.002	T	0.79806	-0.1648	10	0.10636	T	0.68	-1.6572	1.3391	0.02150	0.1499:0.239:0.1575:0.4535	.	1021;1084	O14746-3;O14746	.;TERT_HUMAN	Q	1084;1021	ENSP00000309572:R1084Q;ENSP00000334346:R1021Q	ENSP00000309572:R1084Q	R	-	2	0	TERT	1307527	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.127000	0.03251	-0.215000	0.10063	-0.477000	0.04895	CGA		0.682	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2			
TGM1	7051	hgsc.bcm.edu;ucsc.edu	37	14	24727575	24727575	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr14:24727575C>T	ENST00000206765.6	-	9	1441	c.1318G>A	c.(1318-1320)Gac>Aac	p.D440N	TGM1_ENST00000544573.1_5'UTR	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	440					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	ATCCAGCAGTCGTTCCACACA	0.637																																																	0													48.0	47.0	47.0					14																	24727575		2203	4300	6503	SO:0001583	missense	7051			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1318G>A	14.37:g.24727575C>T	ENSP00000206765:p.Asp440Asn	Somatic		WXS	SOLID	Phase_I	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887233	0.72410	.	.	ENSG00000092295	ENST00000206765	D	0.95756	-3.8	4.91	4.91	0.64330	Transglutaminase-like (2);	0.000000	0.85682	D	0.000000	D	0.97504	0.9183	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.98050	1.0387	10	0.87932	D	0	-44.8672	15.6389	0.76981	0.0:1.0:0.0:0.0	.	440	P22735	TGM1_HUMAN	N	440	ENSP00000206765:D440N	ENSP00000206765:D440N	D	-	1	0	TGM1	23797415	1.000000	0.71417	0.974000	0.42286	0.446000	0.32137	7.606000	0.82863	2.565000	0.86533	0.561000	0.74099	GAC		0.637	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6		NM_000359	
TNRC18	84629	hgsc.bcm.edu	37	7	5434094	5434094	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr7:5434094A>G	ENST00000430969.1	-	3	668	c.320T>C	c.(319-321)cTg>cCg	p.L107P	TNRC18_ENST00000399537.4_Missense_Mutation_p.L107P|TNRC18_ENST00000399434.2_Missense_Mutation_p.L33P	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	107							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGCGGCCCACAGCTGCACCAT	0.677																																																	0													21.0	25.0	23.0					7																	5434094		1998	4127	6125	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.320T>C	7.37:g.5434094A>G	ENSP00000395538:p.Leu107Pro	Somatic		WXS	SOLID	Phase_I	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.388380	0.61956	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000434361;ENST00000399434	T;T	0.17691	2.26;2.26	4.49	4.49	0.54785	.	.	.	.	.	T	0.27278	0.0669	L	0.29908	0.895	0.58432	D	0.999997	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.995	T	0.01810	-1.1269	9	0.52906	T	0.07	.	10.1143	0.42581	1.0:0.0:0.0:0.0	.	33;107	A8MTZ4;O15417	.;TNC18_HUMAN	P	107;107;33;33	ENSP00000382452:L107P;ENSP00000395538:L107P	ENSP00000382364:L33P	L	-	2	0	TNRC18	5400620	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.348000	0.73009	1.893000	0.54813	0.459000	0.35465	CTG		0.677	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				
TRIP10	9322	hgsc.bcm.edu;ucsc.edu	37	19	6750048	6750048	+	Missense_Mutation	SNP	C	C	G	rs541652162		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr19:6750048C>G	ENST00000313244.9	+	12	1401	c.1366C>G	c.(1366-1368)Cgg>Ggg	p.R456G	TRIP10_ENST00000313285.8_Missense_Mutation_p.R400G|CTD-3128G10.6_ENST00000594056.1_RNA|TRIP10_ENST00000600428.1_Missense_Mutation_p.R292G|TRIP10_ENST00000596758.1_Missense_Mutation_p.R400G			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	456	Interaction with CDC42.|Interaction with PDE6G. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						CAACATTGAACGGCTGAAATT	0.587																																																	0													60.0	68.0	65.0					19																	6750048		2203	4300	6503	SO:0001583	missense	9322			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1366C>G	19.37:g.6750048C>G	ENSP00000320117:p.Arg456Gly	Somatic		WXS	SOLID	Phase_I	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	ENST00000313244.9	37		.	.	.	.	.	.	.	.	.	.	C	12.95	2.092863	0.36952	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.76968	-1.06;-1.06	4.98	-5.64	0.02466	.	0.066496	0.56097	D	0.000024	D	0.85017	0.5601	M	0.75264	2.295	0.20926	N	0.999829	D;D;D	0.89917	1.0;0.995;1.0	D;D;D	0.91635	0.989;0.968;0.999	T	0.81870	-0.0734	10	0.87932	D	0	-27.0339	17.7958	0.88570	0.8493:0.1507:0.0:0.0	.	400;456;400	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	G	400;456;400	ENSP00000320493:R400G;ENSP00000320117:R456G	ENSP00000320117:R456G	R	+	1	2	TRIP10	6701048	0.005000	0.15991	0.008000	0.14137	0.080000	0.17528	-0.016000	0.12613	-0.763000	0.04658	0.313000	0.20887	CGG		0.587	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2			
WDR76	79968	hgsc.bcm.edu;ucsc.edu	37	15	44136119	44136119	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr15:44136119G>T	ENST00000263795.6	+	8	969	c.899G>T	c.(898-900)gGc>gTc	p.G300V	WDR76_ENST00000381246.2_Missense_Mutation_p.G236V	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	300										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		AATTTAAATGGCATGGTCATT	0.328																																																	0													58.0	57.0	58.0					15																	44136119		2198	4298	6496	SO:0001583	missense	79968			AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.899G>T	15.37:g.44136119G>T	ENSP00000263795:p.Gly300Val	Somatic		WXS	SOLID	Phase_I	A0MNP5|Q05CI4	Missense_Mutation	SNP	ENST00000263795.6	37	CCDS10106.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.498758	0.44455	.	.	ENSG00000092470	ENST00000263795;ENST00000381246	D;D	0.83419	-1.72;-1.71	5.75	3.88	0.44766	.	0.395096	0.29956	N	0.010776	T	0.79575	0.4469	M	0.77820	2.39	0.50171	D	0.999857	P	0.36683	0.565	B	0.35353	0.201	T	0.74589	-0.3615	10	0.36615	T	0.2	-10.5299	6.1145	0.20120	0.1658:0.1548:0.6794:0.0	.	300	Q9H967	WDR76_HUMAN	V	300;236	ENSP00000263795:G300V;ENSP00000370645:G236V	ENSP00000263795:G300V	G	+	2	0	WDR76	41923411	0.102000	0.21896	1.000000	0.80357	0.946000	0.59487	0.643000	0.24750	0.781000	0.33589	0.455000	0.32223	GGC		0.328	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133482.2		NM_024908	
XPNPEP1	7511	hgsc.bcm.edu;ucsc.edu	37	10	111643872	111643874	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr10:111643872_111643874delGTG	ENST00000502935.1	-	9	900_902	c.781_783delCAC	c.(781-783)cacdel	p.H261del	XPNPEP1_ENST00000369680.4_In_Frame_Del_p.H218del|XPNPEP1_ENST00000322238.8_In_Frame_Del_p.H261del|XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000369683.1_In_Frame_Del_p.H147del					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		ATACTGGATTGTGCTCCACATCT	0.468											OREG0020527	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001651	inframe_deletion	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.781_783delCAC	10.37:g.111643872_111643874delGTG	ENSP00000421566:p.His261del	Somatic	1436	WXS	SOLID	Phase_I		In_Frame_Del	DEL	ENST00000502935.1	37	CCDS7560.2																																																																																				0.468	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2			
ZNF407	55628	hgsc.bcm.edu;ucsc.edu	37	18	72345311	72345311	+	Missense_Mutation	SNP	G	G	T	rs535825447		TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr18:72345311G>T	ENST00000299687.5	+	1	2336	c.2336G>T	c.(2335-2337)tGt>tTt	p.C779F	ZNF407_ENST00000309902.6_Missense_Mutation_p.C779F|ZNF407_ENST00000582337.1_Missense_Mutation_p.C779F|ZNF407_ENST00000577538.1_Missense_Mutation_p.C779F	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	779					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GAAAGGGTATGTATAGGTGCA	0.338																																																	0													106.0	105.0	106.0					18																	72345311		1850	4093	5943	SO:0001583	missense	55628			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.2336G>T	18.37:g.72345311G>T	ENSP00000299687:p.Cys779Phe	Somatic		WXS	SOLID	Phase_I	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757046	0.49468	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.12361	2.69;3.15	5.71	4.84	0.62591	.	0.326301	0.18810	U	0.130531	T	0.17704	0.0425	N	0.14661	0.345	0.39052	D	0.960348	P;D;P	0.67145	0.923;0.996;0.875	B;D;B	0.64321	0.375;0.924;0.307	T	0.03354	-1.1045	10	0.09843	T	0.71	.	14.8007	0.69913	0.0693:0.0:0.9307:0.0	.	779;779;779	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	F	779	ENSP00000299687:C779F;ENSP00000310359:C779F	ENSP00000299687:C779F	C	+	2	0	ZNF407	70474299	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	3.680000	0.54641	0.084000	0.17077	0.377000	0.23210	TGT		0.338	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1		NM_017757	
ZNF598	90850	hgsc.bcm.edu	37	16	2052325	2052325	+	Silent	SNP	C	C	T			TCGA-BP-4768-01A-01D-1366-10	TCGA-BP-4768-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	402c7965-466c-4117-a3c6-3e26aabd0ece	4ebf48fe-dd53-40aa-b19f-a8a21d1b0329	g.chr16:2052325C>T	ENST00000563630.1	-	5	854	c.612G>A	c.(610-612)gaG>gaA	p.E204E	ZNF598_ENST00000431526.1_Silent_p.E259E|ZNF598_ENST00000562103.1_Silent_p.E204E			Q86UK7	ZN598_HUMAN	zinc finger protein 598	259							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						TGAGGTCGATCTCGGTGCGGA	0.657																																																	0													61.0	71.0	68.0					16																	2052325		2167	4242	6409	SO:0001819	synonymous_variant	90850			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.612G>A	16.37:g.2052325C>T		Somatic		WXS	SOLID	Phase_I	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Silent	SNP	ENST00000563630.1	37																																																																																					0.657	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1		NM_178167	
