#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMDEC1	27299	hgsc.bcm.edu;ucsc.edu	37	8	24254839	24254839	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr8:24254839A>G	ENST00000256412.4	+	6	717	c.497A>G	c.(496-498)gAc>gGc	p.D166G	RP11-624C23.1_ENST00000519689.1_RNA|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.D87G|RP11-624C23.1_ENST00000523578.1_RNA|ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.D87G	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	166					immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		AAAAGCACAGACGAGAAAGAA	0.443																																					Ovarian(147;687 1849 3699 25981 31337)												0													171.0	165.0	167.0					8																	24254839		2203	4300	6503	SO:0001583	missense	27299			Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.497A>G	8.37:g.24254839A>G	ENSP00000256412:p.Asp166Gly	Somatic		WXS	SOLID	Phase_I	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	37	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	A	8.326	0.825412	0.16749	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.05580	3.42;3.42;3.42	5.53	4.37	0.52481	Peptidase M12B, propeptide (1);	0.281545	0.30575	N	0.009339	T	0.10380	0.0254	M	0.65320	2	0.09310	N	1	P	0.41546	0.754	B	0.44163	0.443	T	0.10776	-1.0615	10	0.52906	T	0.07	-16.9783	8.2249	0.31562	0.9101:0.0:0.0899:0.0	.	166	O15204	ADEC1_HUMAN	G	166;87;87	ENSP00000256412:D166G;ENSP00000442592:D87G;ENSP00000428993:D87G	ENSP00000256412:D166G	D	+	2	0	ADAMDEC1	24310784	0.521000	0.26258	0.006000	0.13384	0.050000	0.14768	2.342000	0.43992	0.941000	0.37499	0.455000	0.32223	GAC		0.443	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2		NM_014479	
ADCY1	107	hgsc.bcm.edu	37	7	45697340	45697340	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr7:45697340C>A	ENST00000297323.7	+	6	1185	c.1163C>A	c.(1162-1164)gCc>gAc	p.A388D	ADCY1_ENST00000432715.1_Missense_Mutation_p.A163D	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	388					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GTGGCTGAAGCCACCGAGGTG	0.612																																																	0													84.0	66.0	72.0					7																	45697340		2203	4300	6503	SO:0001583	missense	107			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1163C>A	7.37:g.45697340C>A	ENSP00000297323:p.Ala388Asp	Somatic		WXS	SOLID	Phase_I	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212376	0.79240	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	T;T	0.80393	-1.37;-1.37	4.44	4.44	0.53790	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	L	0.38953	1.18	0.80722	D	1	B;D	0.56968	0.028;0.978	B;P	0.59643	0.035;0.861	T	0.77536	-0.2551	10	0.21014	T	0.42	.	14.9371	0.70964	0.0:1.0:0.0:0.0	.	388;163	Q08828;C9J1J0	ADCY1_HUMAN;.	D	163;388;388	ENSP00000392721:A163D;ENSP00000297323:A388D	ENSP00000297323:A388D	A	+	2	0	ADCY1	45663865	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	5.384000	0.66225	2.446000	0.82766	0.655000	0.94253	GCC		0.612	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2		NM_021116	
AK2	204	hgsc.bcm.edu	37	1	33478920	33478920	+	Silent	SNP	G	G	A	rs111261425		TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr1:33478920G>A	ENST00000373449.2	-	6	623	c.582C>T	c.(580-582)acC>acT	p.T194T	RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000548033.1_Silent_p.T152T|AK2_ENST00000480134.1_3'UTR|AK2_ENST00000467905.1_Silent_p.T194T|AK2_ENST00000491241.1_5'Flank|AK2_ENST00000354858.6_Silent_p.T194T	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGAGTGGGGTGGTTTGAGTGT	0.532																																																	0													114.0	105.0	108.0					1																	33478920		2203	4300	6503	SO:0001819	synonymous_variant	204			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.582C>T	1.37:g.33478920G>A		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000373449.2	37	CCDS373.1																																																																																				0.532	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1		NM_001625	
ATF1	466	hgsc.bcm.edu;ucsc.edu	37	12	51213502	51213502	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr12:51213502T>G	ENST00000262053.3	+	7	778	c.756T>G	c.(754-756)aaT>aaG	p.N252K	ATF1_ENST00000539132.1_Missense_Mutation_p.N117K	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	252	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	AAAATCAAAATAAAACTCTAA	0.318			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																			Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	0													35.0	39.0	38.0					12																	51213502		2203	4294	6497	SO:0001583	missense	466			BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.756T>G	12.37:g.51213502T>G	ENSP00000262053:p.Asn252Lys	Somatic		WXS	SOLID	Phase_I	B4DRF9|P25168|Q9H4A8	Missense_Mutation	SNP	ENST00000262053.3	37	CCDS8803.1	.	.	.	.	.	.	.	.	.	.	T	18.33	3.600863	0.66332	.	.	ENSG00000123268	ENST00000262053;ENST00000539132	T;T	0.71103	-0.54;-0.54	5.48	0.497	0.16902	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.87541	0.6203	H	0.97874	4.095	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.86372	0.1724	10	0.87932	D	0	-0.7867	8.6861	0.34238	0.0:0.5377:0.0:0.4623	.	252	P18846	ATF1_HUMAN	K	252;117	ENSP00000262053:N252K;ENSP00000438403:N117K	ENSP00000262053:N252K	N	+	3	2	ATF1	49499769	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	2.458000	0.45014	0.119000	0.18210	0.523000	0.50628	AAT		0.318	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404285.1		NM_005171	
CCZ1B	221960	hgsc.bcm.edu	37	7	6844681	6844681	+	Missense_Mutation	SNP	C	C	T	rs202100248	byFrequency	TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr7:6844681C>T	ENST00000316731.8	-	12	1566	c.994G>A	c.(994-996)Gtc>Atc	p.V332I	CCZ1B_ENST00000538180.1_Missense_Mutation_p.V189I	NM_198097.3	NP_932765.1	P86790	CCZ1B_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)	332						lysosome (GO:0005764)|membrane (GO:0016020)											GTTGGGTGGACAGAGGCTGGC	0.453																																																	0													50.0	52.0	51.0					7																	6844681		2018	3926	5944	SO:0001583	missense	0			BC010130	CCDS5354.1	7p22.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000146574	ENSG00000146574			21717	protein-coding gene	gene with protein product	"""similar to CGI-43 protein"""		"""chromosome 7 open reading frame 28B"""	C7orf28B		12477932	Standard	NM_198097		Approved	DKFZP586I1023, H_NH0577018.2, MGC19819	uc003sqx.2	P86790	OTTHUMG00000152441	ENST00000316731.8:c.994G>A	7.37:g.6844681C>T	ENSP00000314544:p.Val332Ile	Somatic		WXS	SOLID	Phase_I	A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	ENST00000316731.8	37	CCDS5354.1	293	0.13415750915750915	63	0.12804878048780488	65	0.17955801104972377	59	0.10314685314685315	106	0.13984168865435356	c	5.036	0.192387	0.09599	.	.	ENSG00000146574	ENST00000316731;ENST00000538180	.	.	.	3.03	0.431	0.16523	.	0.477014	0.23756	N	0.044862	T	0.00039	0.0001	.	.	.	0.22142	N	0.999339	.	.	.	.	.	.	T	0.19128	-1.0315	6	0.21540	T	0.41	-0.0961	3.8822	0.09083	0.0:0.3612:0.2028:0.436	.	.	.	.	I	332;189	.	ENSP00000314544:V332I	V	-	1	0	C7orf28B	6811206	0.036000	0.19791	0.004000	0.12327	0.062000	0.15995	0.635000	0.24629	-0.366000	0.08064	-0.463000	0.05309	GTC		0.453	CCZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246858.1		NM_198097	
CLCN3	1182	hgsc.bcm.edu	37	4	170611793	170611793	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr4:170611793G>A	ENST00000513761.1	+	6	1278	c.719G>A	c.(718-720)gGa>gAa	p.G240E	CLCN3_ENST00000504131.2_Missense_Mutation_p.G223E|CLCN3_ENST00000360642.3_Missense_Mutation_p.G240E|CLCN3_ENST00000347613.4_Missense_Mutation_p.G240E	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	240					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TGTGGCTCTGGAATTCCAGAG	0.368																																																	0													121.0	112.0	115.0					4																	170611793		2203	4300	6503	SO:0001583	missense	1182			X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.719G>A	4.37:g.170611793G>A	ENSP00000424603:p.Gly240Glu	Somatic		WXS	SOLID	Phase_I	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	37	CCDS34101.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569599	0.86439	.	.	ENSG00000109572	ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131;ENST00000507875	D;D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51;-4.51	5.52	4.68	0.58851	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.99342	0.9769	H	0.99454	4.575	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.997;0.997;0.997;0.994	D	0.98145	1.0438	10	0.87932	D	0	-7.9192	14.2016	0.65707	0.072:0.0:0.928:0.0	.	240;223;213;240;240	B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.;.;.;CLCN3_HUMAN;.	E	240;240;240;223;213	ENSP00000424603:G240E;ENSP00000261514:G240E;ENSP00000353857:G240E;ENSP00000424540:G223E;ENSP00000425323:G213E	ENSP00000261514:G240E	G	+	2	0	CLCN3	170848368	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.785000	0.99042	1.312000	0.45043	0.650000	0.86243	GGA		0.368	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2			
CR2	1380	hgsc.bcm.edu	37	1	207644230	207644230	+	Silent	SNP	G	G	T			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr1:207644230G>T	ENST00000367058.3	+	7	1560	c.1371G>T	c.(1369-1371)ggG>ggT	p.G457G	CR2_ENST00000458541.2_Silent_p.G457G|CR2_ENST00000367057.3_Silent_p.G457G|CR2_ENST00000367059.3_Silent_p.G457G	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	457	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.			Missing (in Ref. 2; CAA68674). {ECO:0000305}.	B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CCTCTGAGGGGGTGTGGACAC	0.458																																																	0													65.0	66.0	66.0					1																	207644230		2203	4300	6503	SO:0001819	synonymous_variant	1380			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1371G>T	1.37:g.207644230G>T		Somatic		WXS	SOLID	Phase_I	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	CCDS1478.1																																																																																				0.458	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1		NM_001877	
DNHD1	144132	hgsc.bcm.edu	37	11	6567890	6567890	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr11:6567890G>T	ENST00000527990.2	+	19	5721	c.5721G>T	c.(5719-5721)gaG>gaT	p.E1907D	DNHD1_ENST00000254579.6_Missense_Mutation_p.E1907D			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1907					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTGCCATTGAGGAGGCTGCCC	0.562																																																	0													48.0	42.0	44.0					11																	6567890		692	1591	2283	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.5721G>T	11.37:g.6567890G>T	ENSP00000436180:p.Glu1907Asp	Somatic		WXS	SOLID	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.071996	0.55646	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000533649	T;T	0.31769	1.48;1.48	4.96	0.93	0.19454	.	0.182642	0.46442	N	0.000297	T	0.26159	0.0638	M	0.61703	1.905	0.33891	D	0.637296	B	0.25390	0.125	B	0.22753	0.041	T	0.16453	-1.0402	10	0.59425	D	0.04	.	5.8679	0.18786	0.2264:0.0:0.639:0.1346	.	1907	Q96M86	DNHD1_HUMAN	D	1907;1907;198	ENSP00000254579:E1907D;ENSP00000436180:E1907D	ENSP00000254579:E1907D	E	+	3	2	DNHD1	6524466	1.000000	0.71417	0.904000	0.35570	0.836000	0.47400	0.557000	0.23454	0.017000	0.15025	-0.137000	0.14449	GAG		0.562	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2		NM_144666	
EVPL	2125	hgsc.bcm.edu	37	17	74023229	74023229	+	Silent	SNP	G	G	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr17:74023229G>A	ENST00000301607.3	-	1	304	c.51C>T	c.(49-51)ggC>ggT	p.G17G	EVPL_ENST00000586740.1_Silent_p.G17G	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	17	4 X 4 AA tandem repeats of K-G-S-P.|Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						tggcgggggagcccttggggg	0.677																																																	0													10.0	11.0	11.0					17																	74023229		2189	4286	6475	SO:0001819	synonymous_variant	2125			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.51C>T	17.37:g.74023229G>A		Somatic		WXS	SOLID	Phase_I	A0AUV5	Silent	SNP	ENST00000301607.3	37	CCDS11737.1																																																																																				0.677	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1		NM_001988	
GAREM	64762	hgsc.bcm.edu;ucsc.edu	37	18	29868022	29868022	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr18:29868022T>G	ENST00000269209.6	-	4	541	c.538A>C	c.(538-540)Aag>Cag	p.K180Q	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000578619.1_5'UTR|GAREM_ENST00000399218.4_Missense_Mutation_p.K180Q			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	180	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TTCCCAATCTTTTTGAAGATT	0.448																																																	0													103.0	86.0	92.0					18																	29868022		2203	4300	6503	SO:0001583	missense	0			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.538A>C	18.37:g.29868022T>G	ENSP00000269209:p.Lys180Gln	Somatic		WXS	SOLID	Phase_I	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.646329	0.67358	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.16597	2.33;2.33	5.14	5.14	0.70334	.	0.181162	0.48286	D	0.000184	T	0.35451	0.0932	L	0.54323	1.7	0.47214	D	0.999357	D;D	0.55800	0.968;0.973	P;D	0.63283	0.81;0.913	T	0.05550	-1.0878	10	0.72032	D	0.01	-23.8095	15.3978	0.74812	0.0:0.0:0.0:1.0	.	180;180	Q9H706;Q9H706-3	FA59A_HUMAN;.	Q	180	ENSP00000382165:K180Q;ENSP00000269209:K180Q	ENSP00000269209:K180Q	K	-	1	0	FAM59A	28122020	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.525000	0.67110	2.283000	0.76528	0.533000	0.62120	AAG		0.448	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1		NM_022751	
FAM90A1	55138	hgsc.bcm.edu	37	12	8374782	8374783	+	In_Frame_Ins	INS	-	-	CGG			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr12:8374782_8374783insCGG	ENST00000538603.1	-	7	1588_1589	c.1030_1031insCCG	c.(1030-1032)acg>aCCGcg	p.344_345insA	FAM90A1_ENST00000307435.6_In_Frame_Ins_p.344_345insA	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	344				T -> TV (in Ref. 1; BAA91593). {ECO:0000305}.			nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		CTGGGGTGACGTACGTGGTCCA	0.678																																																	0																																										SO:0001652	inframe_insertion	55138			AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.1030_1031insCCG	12.37:g.8374782_8374783insCGG	ENSP00000445418:p.Thr344_Ser345insAla	Somatic		WXS	SOLID	Phase_I	D3DUU9|Q9NVZ6	In_Frame_Ins	INS	ENST00000538603.1	37	CCDS31738.1																																																																																				0.678	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1		NM_018088	
FAT2	2196	hgsc.bcm.edu;ucsc.edu	37	5	150897291	150897291	+	Silent	SNP	G	G	T			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr5:150897291G>T	ENST00000261800.5	-	19	11365	c.11353C>A	c.(11353-11355)Cgg>Agg	p.R3785R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3785	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCCTGTACCGCACATAGCTC	0.517																																																	0													102.0	95.0	98.0					5																	150897291		2203	4300	6503	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11353C>A	5.37:g.150897291G>T		Somatic		WXS	SOLID	Phase_I	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	7.384	0.629337	0.14257	.	.	ENSG00000086570	ENST00000520200	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	T	0.60830	0.2299	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58736	-0.7584	4	.	.	.	.	9.9272	0.41501	0.1277:0.0:0.8723:0.0	.	.	.	.	E	643	.	.	A	-	2	0	FAT2	150877484	0.497000	0.26067	0.919000	0.36401	0.664000	0.39144	1.480000	0.35464	2.436000	0.82500	0.650000	0.86243	GCG		0.517	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1		NM_001447	
FBXW5	54461	hgsc.bcm.edu	37	9	139837902	139837902	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr9:139837902C>A	ENST00000325285.3	-	3	329	c.250G>T	c.(250-252)Gag>Tag	p.E84*	FBXW5_ENST00000483559.1_5'UTR|C8G_ENST00000224181.3_5'Flank	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	84					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GTCTGCACCTCCACGCAGGGC	0.642																																																	0													78.0	53.0	62.0					9																	139837902		2200	4299	6499	SO:0001587	stop_gained	54461			BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.250G>T	9.37:g.139837902C>A	ENSP00000313034:p.Glu84*	Somatic		WXS	SOLID	Phase_I	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Nonsense_Mutation	SNP	ENST00000325285.3	37	CCDS7014.1	.	.	.	.	.	.	.	.	.	.	c	41	9.143748	0.99080	.	.	ENSG00000159069	ENST00000325285;ENST00000428398;ENST00000443788	.	.	.	4.85	4.85	0.62838	.	0.050490	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-12.7364	17.9754	0.89126	0.0:1.0:0.0:0.0	.	.	.	.	X	84	.	ENSP00000313034:E84X	E	-	1	0	FBXW5	138957723	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	7.227000	0.78070	2.224000	0.72417	0.556000	0.70494	GAG		0.642	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1		NM_018998	
GDF3	9573	hgsc.bcm.edu	37	12	7843115	7843115	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr12:7843115C>A	ENST00000329913.3	-	2	501	c.454G>T	c.(454-456)Gag>Tag	p.E152*		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	152					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						ACATGAGGCTCCTGAACCAGG	0.552																																																	0													56.0	59.0	58.0					12																	7843115		2203	4300	6503	SO:0001587	stop_gained	9573			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.454G>T	12.37:g.7843115C>A	ENSP00000331745:p.Glu152*	Somatic		WXS	SOLID	Phase_I	Q8NEJ4	Nonsense_Mutation	SNP	ENST00000329913.3	37	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938267	0.34189	.	.	ENSG00000184344	ENST00000329913	.	.	.	4.41	2.49	0.30216	.	1.377680	0.04077	N	0.308924	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	4.5858	0.12282	0.0:0.6043:0.179:0.2167	.	.	.	.	X	152	.	ENSP00000331745:E152X	E	-	1	0	GDF3	7734382	0.001000	0.12720	0.050000	0.19076	0.208000	0.24298	0.953000	0.29162	0.382000	0.24878	-0.258000	0.10820	GAG		0.552	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1			
HK1	3098	hgsc.bcm.edu	37	10	71048514	71048514	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr10:71048514C>A	ENST00000448642.2	+	4	404	c.15C>A	c.(13-15)tgC>tgA	p.C5*	HK1_ENST00000404387.2_Nonsense_Mutation_p.C5*|HK1_ENST00000360289.2_5'UTR			P19367	HXK1_HUMAN	hexokinase 1	0	Hydrophobic.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GGCAGATCTGCCAGCGAGAAT	0.522																																																	0													92.0	81.0	85.0					10																	71048514		2203	4300	6503	SO:0001587	stop_gained	3098			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000448642.2:c.15C>A	10.37:g.71048514C>A	ENSP00000402103:p.Cys5*	Somatic		WXS	SOLID	Phase_I	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Nonsense_Mutation	SNP	ENST00000448642.2	37		.	.	.	.	.	.	.	.	.	.	C	38	7.138440	0.98088	.	.	ENSG00000156515	ENST00000450646;ENST00000448642;ENST00000404387	.	.	.	4.09	3.19	0.36642	.	0.953555	0.08797	N	0.892322	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	7.9966	0.30271	0.0:0.8897:0.0:0.1103	.	.	.	.	X	5	.	ENSP00000384774:C5X	C	+	3	2	HK1	70718520	1.000000	0.71417	1.000000	0.80357	0.453000	0.32348	1.566000	0.36396	1.313000	0.45069	0.655000	0.94253	TGC		0.522	HK1-204	KNOWN	basic	protein_coding	protein_coding			NM_000188	
HVCN1	84329	hgsc.bcm.edu	37	12	111099084	111099084	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr12:111099084C>T	ENST00000356742.5	-	3	944	c.191G>A	c.(190-192)gGc>gAc	p.G64D	HVCN1_ENST00000242607.8_Missense_Mutation_p.G64D|HVCN1_ENST00000439744.2_Missense_Mutation_p.G44D|HVCN1_ENST00000548312.1_Missense_Mutation_p.G64D			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	64					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						GCCTTCCTCGCCTGAGACTGG	0.612																																																	0													62.0	66.0	64.0					12																	111099084		2203	4300	6503	SO:0001583	missense	84329			BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.191G>A	12.37:g.111099084C>T	ENSP00000349181:p.Gly64Asp	Somatic		WXS	SOLID	Phase_I	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	ENST00000356742.5	37	CCDS31900.1	.	.	.	.	.	.	.	.	.	.	c	10.17	1.277455	0.23307	.	.	ENSG00000122986	ENST00000548312;ENST00000242607;ENST00000356742;ENST00000439744;ENST00000546713	T;T;T;T	0.44881	0.92;0.91;0.91;0.94	5.01	2.03	0.26663	.	0.746229	0.12303	N	0.480979	T	0.43478	0.1249	M	0.65975	2.015	0.09310	N	1	B;P	0.38827	0.376;0.649	B;B	0.44044	0.122;0.439	T	0.37686	-0.9695	10	0.56958	D	0.05	-13.3976	4.661	0.12643	0.0:0.441:0.344:0.2149	.	64;64	Q96D96;Q96D96-3	HVCN1_HUMAN;.	D	64;64;64;44;64	ENSP00000449601:G64D;ENSP00000242607:G64D;ENSP00000349181:G64D;ENSP00000412052:G44D	ENSP00000242607:G64D	G	-	2	0	HVCN1	109583467	0.000000	0.05858	0.015000	0.15790	0.069000	0.16628	0.017000	0.13399	0.696000	0.31696	0.457000	0.33378	GGC		0.612	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1		NM_032369	
KRT10	3858	hgsc.bcm.edu;ucsc.edu	37	17	38977371	38977371	+	Splice_Site	SNP	T	T	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr17:38977371T>A	ENST00000269576.5	-	2	637		c.e2-2		TMEM99_ENST00000496847.1_Intron|TMEM99_ENST00000301665.3_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10						cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				GTTGAGAATCTGGAGGGAGAG	0.433																																																	0													95.0	72.0	80.0					17																	38977371		2203	4300	6503	SO:0001630	splice_region_variant	3858			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.628-2A>T	17.37:g.38977371T>A		Somatic		WXS	SOLID	Phase_I	Q14664|Q8N175	Splice_Site	SNP	ENST00000269576.5	37	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.824996	0.90955	.	.	ENSG00000186395	ENST00000269576	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9715	0.80025	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT10	36230897	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.975000	0.76128	2.158000	0.67659	0.533000	0.62120	.		0.433	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1		NM_000421	Intron
LRP1B	53353	hgsc.bcm.edu	37	2	141665553	141665553	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr2:141665553G>A	ENST00000389484.3	-	22	4384	c.3413C>T	c.(3412-3414)cCa>cTa	p.P1138L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1138	LDL-receptor class A 10. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.P1138L(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGCTTGGGTGGTCCACACAA	0.463										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	lung(1)											195.0	162.0	173.0					2																	141665553		2203	4300	6503	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3413C>T	2.37:g.141665553G>A	ENSP00000374135:p.Pro1138Leu	Somatic		WXS	SOLID	Phase_I	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821703	0.90873	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.99051	-5.37;-3.85	5.58	5.58	0.84498	.	0.070853	0.56097	D	0.000022	D	0.98773	0.9587	L	0.44542	1.39	0.80722	D	1	B;D	0.89917	0.006;1.0	B;D	0.85130	0.05;0.997	D	0.98821	1.0747	10	0.16420	T	0.52	.	19.5654	0.95390	0.0:0.0:1.0:0.0	.	321;1138	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	L	1138;1076;283	ENSP00000374135:P1138L;ENSP00000413239:P283L	ENSP00000374135:P1138L	P	-	2	0	LRP1B	141382023	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.894000	0.87336	2.641000	0.89580	0.585000	0.79938	CCA		0.463	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557	
MUC4	4585	hgsc.bcm.edu	37	3	195512343	195512343	+	Silent	SNP	G	G	A	rs113457754		TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr3:195512343G>A	ENST00000463781.3	-	2	6567	c.6108C>T	c.(6106-6108)acC>acT	p.T2036T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2036T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2036T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTATCGGTGACAGGAA	0.567																																																	2	Substitution - coding silent(2)	stomach(2)											29.0	25.0	26.0					3																	195512343		688	1575	2263	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6108C>T	3.37:g.195512343G>A		Somatic		WXS	SOLID	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MYO3A	53904	hgsc.bcm.edu	37	10	26385322	26385322	+	Silent	SNP	T	T	C			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr10:26385322T>C	ENST00000265944.5	+	16	1741	c.1575T>C	c.(1573-1575)aaT>aaC	p.N525N	MYO3A_ENST00000543632.1_Silent_p.N525N	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	525	Myosin motor.		N -> K (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N525K(2)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GAGAAAAAAATTTTCATATTT	0.318																																																	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)											31.0	34.0	33.0					10																	26385322		2195	4288	6483	SO:0001819	synonymous_variant	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1575T>C	10.37:g.26385322T>C		Somatic		WXS	SOLID	Phase_I	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	37	CCDS7148.1																																																																																				0.318	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1		NM_017433	
NMUR1	10316	hgsc.bcm.edu	37	2	232393300	232393300	+	Silent	SNP	G	G	C			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr2:232393300G>C	ENST00000305141.4	-	2	565	c.432C>G	c.(430-432)gtC>gtG	p.V144V		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	144					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)	p.V144V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		AGGCCAGGCAGACCATCTCAA	0.622																																																	1	Substitution - coding silent(1)	lung(1)											70.0	62.0	65.0					2																	232393300		2203	4300	6503	SO:0001819	synonymous_variant	10316			AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.432C>G	2.37:g.232393300G>C		Somatic		WXS	SOLID	Phase_I	O43664|Q7LDP6|Q8NE20	Silent	SNP	ENST00000305141.4	37	CCDS2486.1																																																																																				0.622	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1		NM_006056	
PTGFR	5737	hgsc.bcm.edu	37	1	78958515	78958515	+	Silent	SNP	C	C	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr1:78958515C>A	ENST00000370757.3	+	2	324	c.87C>A	c.(85-87)tcC>tcA	p.S29S	PTGFR_ENST00000370756.3_Silent_p.S29S|PTGFR_ENST00000370758.1_Silent_p.S29S	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	29					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	ACCGGCTTTCCGTATTTTTTT	0.438																																																	0													80.0	83.0	82.0					1																	78958515		2203	4300	6503	SO:0001819	synonymous_variant	5737			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.87C>A	1.37:g.78958515C>A		Somatic		WXS	SOLID	Phase_I	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Silent	SNP	ENST00000370757.3	37	CCDS686.1																																																																																				0.438	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1		NM_000959	
PTK6	5753	hgsc.bcm.edu;ucsc.edu	37	20	62164915	62164915	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr20:62164915A>T	ENST00000217185.2	-	4	686	c.659T>A	c.(658-660)gTg>gAg	p.V220E	PTK6_ENST00000542869.1_Missense_Mutation_p.V119E	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	TCGAGAAATCACCTTAATGGC	0.662																																																	0													69.0	73.0	72.0					20																	62164915		2203	4300	6503	SO:0001583	missense	5753			U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.659T>A	20.37:g.62164915A>T	ENSP00000217185:p.Val220Glu	Somatic		WXS	SOLID	Phase_I	B2RCR3|B4DW46|Q58F01	Missense_Mutation	SNP	ENST00000217185.2	37	CCDS13524.1	.	.	.	.	.	.	.	.	.	.	a	13.02	2.112536	0.37242	.	.	ENSG00000101213	ENST00000217185;ENST00000542869	D;D	0.89810	-2.57;-2.57	4.32	4.32	0.51571	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.37857	U	0.001908	D	0.85349	0.5676	L	0.47016	1.485	0.31131	N	0.7077	P	0.35714	0.517	B	0.37451	0.25	D	0.86553	0.1836	10	0.87932	D	0	.	11.0227	0.47728	1.0:0.0:0.0:0.0	.	220	Q13882	PTK6_HUMAN	E	220;119	ENSP00000217185:V220E;ENSP00000442460:V119E	ENSP00000217185:V220E	V	-	2	0	PTK6	61635359	0.361000	0.24972	0.941000	0.38009	0.179000	0.23085	1.177000	0.31969	1.599000	0.50093	0.398000	0.26397	GTG		0.662	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080313.1			
SETDB1	9869	hgsc.bcm.edu	37	1	150923431	150923431	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr1:150923431G>A	ENST00000271640.5	+	13	2268	c.2078G>A	c.(2077-2079)tGt>tAt	p.C693Y	SETDB1_ENST00000368969.4_Missense_Mutation_p.C693Y|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	693					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCCCTATCCTGTGTCAATGAG	0.463																																																	0													96.0	97.0	97.0					1																	150923431		2203	4300	6503	SO:0001583	missense	9869			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2078G>A	1.37:g.150923431G>A	ENSP00000271640:p.Cys693Tyr	Somatic		WXS	SOLID	Phase_I	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315114	0.81358	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	T;T;T	0.76578	-1.03;-1.03;-1.03	5.66	5.66	0.87406	Pre-SET zinc-binding sub-group (1);Pre-SET domain (1);	0.087163	0.85682	D	0.000000	D	0.88833	0.6544	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.997	D;D;D	0.91635	0.999;0.994;0.996	D	0.88483	0.3070	10	0.45353	T	0.12	.	18.744	0.91785	0.0:0.0:1.0:0.0	.	693;693;693	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	Y	693	ENSP00000271640:C693Y;ENSP00000357965:C693Y;ENSP00000432348:C693Y	ENSP00000271640:C693Y	C	+	2	0	SETDB1	149190055	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.621000	0.74228	2.656000	0.90262	0.655000	0.94253	TGT		0.463	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2			
PEAK1	79834	hgsc.bcm.edu;ucsc.edu	37	15	77407253	77407253	+	Silent	SNP	G	G	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr15:77407253G>A	ENST00000560626.2	-	7	4961	c.4486C>T	c.(4486-4488)Ctg>Ttg	p.L1496L	PEAK1_ENST00000312493.4_Silent_p.L1496L			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1496	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TGTAAGAGCAGCAGACACACC	0.527																																																	0													62.0	65.0	64.0					15																	77407253		2075	4199	6274	SO:0001819	synonymous_variant	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4486C>T	15.37:g.77407253G>A		Somatic		WXS	SOLID	Phase_I	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	ENST00000560626.2	37	CCDS42062.1																																																																																				0.527	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3			
SRPX2	27286	hgsc.bcm.edu;ucsc.edu	37	X	99922295	99922295	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chrX:99922295A>G	ENST00000373004.3	+	9	1414	c.986A>G	c.(985-987)aAc>aGc	p.N329S		NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	329					angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						GTCAACGTCAACTCAGCTGCT	0.463																																																	0													179.0	142.0	154.0					X																	99922295		2203	4300	6503	SO:0001583	missense	27286			AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.986A>G	X.37:g.99922295A>G	ENSP00000362095:p.Asn329Ser	Somatic		WXS	SOLID	Phase_I	B3KQT3|Q8WW85	Missense_Mutation	SNP	ENST00000373004.3	37	CCDS14471.1	.	.	.	.	.	.	.	.	.	.	A	13.59	2.281309	0.40394	.	.	ENSG00000102359	ENST00000373004	T	0.28666	1.6	5.49	5.49	0.81192	.	0.181237	0.64402	D	0.000014	T	0.29620	0.0739	L	0.59436	1.845	0.40485	D	0.980483	P	0.39480	0.675	B	0.33960	0.173	T	0.10613	-1.0622	9	.	.	.	-21.2699	14.8149	0.70028	1.0:0.0:0.0:0.0	.	329	O60687	SRPX2_HUMAN	S	329	ENSP00000362095:N329S	.	N	+	2	0	SRPX2	99808951	0.997000	0.39634	1.000000	0.80357	0.717000	0.41224	1.527000	0.35975	1.948000	0.56530	0.486000	0.48141	AAC		0.463	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057486.1		NM_014467	
TRIB1	10221	hgsc.bcm.edu	37	8	126448323	126448323	+	Silent	SNP	T	T	C			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr8:126448323T>C	ENST00000519576.1	+	2	299	c.36T>C	c.(34-36)caT>caC	p.H12H	TRIB1_ENST00000520847.1_Silent_p.H77H|TRIB1_ENST00000311922.3_Silent_p.H243H					tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CAGACAAACATGGCTGCCCAG	0.532																																																	0													76.0	69.0	71.0					8																	126448323		2203	4300	6503	SO:0001819	synonymous_variant	10221			AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000519576.1:c.36T>C	8.37:g.126448323T>C		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000519576.1	37																																																																																					0.532	TRIB1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000381433.1		NM_025195	
USP43	124739	hgsc.bcm.edu	37	17	9604523	9604523	+	Silent	SNP	C	C	A			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr17:9604523C>A	ENST00000285199.7	+	11	1719	c.1623C>A	c.(1621-1623)acC>acA	p.T541T	USP43_ENST00000570475.1_Silent_p.T541T|USP43_ENST00000570827.2_3'UTR	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	541	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.T542T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						ACAGCTGTACCTTGGATGAAT	0.647																																																	1	Substitution - coding silent(1)	breast(1)											23.0	29.0	27.0					17																	9604523		2159	4265	6424	SO:0001819	synonymous_variant	124739			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.1623C>A	17.37:g.9604523C>A		Somatic		WXS	SOLID	Phase_I	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Silent	SNP	ENST00000285199.7	37	CCDS45610.1																																																																																				0.647	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3		NM_153210	
VHL	7428	hgsc.bcm.edu;ucsc.edu	37	3	10191558	10191558	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr3:10191558T>C	ENST00000256474.2	+	3	1391	c.551T>C	c.(550-552)cTc>cCc	p.L184P	VHL_ENST00000345392.2_Missense_Mutation_p.L143P|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	184			L -> P (in VHLD; type I). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829911}.|L -> R (in VHLD; type I). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L184P(6)|p.L184R(1)|p.Y185fs*14(1)|p.S183*(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCAGGTCGCTCTACGAAGAT	0.517		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	9	Substitution - Missense(7)|Deletion - Frameshift(2)	kidney(9)	GRCh37	CM042503|CM941389|CM961440	VHL	M							83.0	75.0	78.0					3																	10191558		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.551T>C	3.37:g.10191558T>C	ENSP00000256474:p.Leu184Pro	Somatic		WXS	SOLID	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.039597	0.55003	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99879	-7.44;-7.44	4.97	4.97	0.65823	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96159	0.9114	10	0.87932	D	0	0.329	12.9354	0.58311	0.0:0.0:0.0:1.0	.	143;184	P40337-2;P40337	.;VHL_HUMAN	P	184;143;102	ENSP00000256474:L184P;ENSP00000344757:L143P	ENSP00000256474:L184P	L	+	2	0	VHL	10166558	0.992000	0.36948	0.737000	0.30932	0.208000	0.24298	5.765000	0.68834	2.209000	0.71365	0.533000	0.62120	CTC		0.517	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VSTM1	284415	hgsc.bcm.edu	37	19	54561641	54561641	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4771-01A-01D-1366-10	TCGA-BP-4771-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c00898-84ed-4fcb-b167-be6464a960e3	319a361d-cb17-4a06-89dc-421b28936aa7	g.chr19:54561641C>G	ENST00000338372.2	-	3	449	c.274G>C	c.(274-276)Ggg>Cgg	p.G92R	VSTM1_ENST00000425006.2_Missense_Mutation_p.G92R|VSTM1_ENST00000376626.1_Missense_Mutation_p.G92R|VSTM1_ENST00000366170.2_Intron	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	92	Ig-like V-type.				immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		AAGTACCTCCCAGCATCCTTA	0.532																																																	0													123.0	104.0	110.0					19																	54561641		2203	4300	6503	SO:0001583	missense	284415			AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.274G>C	19.37:g.54561641C>G	ENSP00000343366:p.Gly92Arg	Somatic		WXS	SOLID	Phase_I	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Missense_Mutation	SNP	ENST00000338372.2	37	CCDS12872.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.139784	0.37728	.	.	ENSG00000189068	ENST00000419106;ENST00000338372;ENST00000376626;ENST00000425006	T;T;T;T	0.01599	4.74;4.74;4.74;4.74	3.63	2.56	0.30785	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.484707	0.15375	N	0.265647	T	0.12008	0.0292	M	0.92649	3.33	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.03608	-1.1020	10	0.48119	T	0.1	-7.6861	8.9571	0.35825	0.0:0.7713:0.2287:0.0	.	92;92	D2DJS4;Q6UX27	.;VSTM1_HUMAN	R	13;92;92;92	ENSP00000409412:G13R;ENSP00000343366:G92R;ENSP00000365813:G92R;ENSP00000413006:G92R	ENSP00000343366:G92R	G	-	1	0	VSTM1	59253453	0.339000	0.24784	0.003000	0.11579	0.000000	0.00434	3.189000	0.50965	0.850000	0.35239	-0.282000	0.10007	GGG		0.532	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3		NM_198481	
