#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM28	10863	hgsc.bcm.edu	37	8	24192996	24192996	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr8:24192996A>T	ENST00000265769.4	+	14	1519	c.1409A>T	c.(1408-1410)gAt>gTt	p.D470V	ADAM28_ENST00000437154.2_Missense_Mutation_p.D470V|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000540823.1_Missense_Mutation_p.D237V|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.D217V|RP11-624C23.1_ENST00000518988.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	470	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CCAGCAAAAGATGAGTGCGAC	0.433																																					NSCLC(193;488 2149 22258 34798 40734)												0													134.0	125.0	128.0					8																	24192996		2203	4300	6503	SO:0001583	missense	10863			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1409A>T	8.37:g.24192996A>T	ENSP00000265769:p.Asp470Val	Somatic		WXS	SOLID	Phase_I	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	37	CCDS34865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.82|18.82	3.705912|3.705912	0.68615|0.68615	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154|ENST00000521629	T;T;T;T|.	0.12879|.	2.64;2.64;2.64;2.64|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Blood coagulation inhibitor, Disintegrin (5);|.	.|.	.|.	.|.	.|.	D|D	0.84042|0.84042	0.5385|0.5385	M|M	0.91663|0.91663	3.23|3.23	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.63880|.	0.979;0.993;0.993;0.973|.	D;D;D;D|.	0.67548|.	0.952;0.949;0.949;0.94|.	D|D	0.87560|0.87560	0.2471|0.2471	9|5	0.87932|.	D|.	0|.	.|.	14.0996|14.0996	0.65046|0.65046	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	237;470;470;470|.	B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2|.	.;.;ADA28_HUMAN;.|.	V|S	470;217;237;470|102	ENSP00000265769:D470V;ENSP00000380770:D217V;ENSP00000443743:D237V;ENSP00000393699:D470V|.	ENSP00000265769:D470V|.	D|R	+|+	2|3	0|2	ADAM28|ADAM28	24248941|24248941	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	6.162000|6.162000	0.71874|0.71874	2.213000|2.213000	0.71641|0.71641	0.528000|0.528000	0.53228|0.53228	GAT|AGA		0.433	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2		NM_021778	
AQR	9716	hgsc.bcm.edu	37	15	35202458	35202458	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr15:35202458A>T	ENST00000156471.5	-	17	1766	c.1541T>A	c.(1540-1542)aTt>aAt	p.I514N		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	514					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GAAAGCCACAATGGGCTGGGC	0.443																																																	0													108.0	108.0	108.0					15																	35202458		1912	4127	6039	SO:0001583	missense	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1541T>A	15.37:g.35202458A>T	ENSP00000156471:p.Ile514Asn	Somatic		WXS	SOLID	Phase_I	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.208294	0.79240	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.95980	-3.87	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.98372	0.9459	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.99593	1.0976	10	0.87932	D	0	-24.1575	16.1998	0.82063	1.0:0.0:0.0:0.0	.	514	O60306	AQR_HUMAN	N	514	ENSP00000156471:I514N	ENSP00000156471:I514N	I	-	2	0	AQR	32989750	1.000000	0.71417	0.999000	0.59377	0.565000	0.35776	9.189000	0.94928	2.232000	0.73038	0.528000	0.53228	ATT		0.443	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2		NM_014691	
BMP8B	656	hgsc.bcm.edu	37	1	40229454	40229454	+	Missense_Mutation	SNP	T	T	C	rs150014470	byFrequency	TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr1:40229454T>C	ENST00000372827.3	-	5	1253	c.878A>G	c.(877-879)cAc>cGc	p.H293R	PPIE_ENST00000356511.2_3'UTR|PPIE_ENST00000372830.1_3'UTR|BMP8B_ENST00000397360.2_Missense_Mutation_p.H318R	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b	293			H -> R (in dbSNP:rs6525).		cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GTGGGAGCCGTGGACGTCATC	0.587													T|||	63	0.0125799	0.0136	0.0086	5008	,	,		19213	0.0109		0.0229	False		,,,				2504	0.0051																0								T	,ARG/HIS,	40,4334	20.2+/-43.8	4,32,2151	80.0	92.0	88.0		,878,	2.8	0.0	1	dbSNP_134	88	77,8491	29.6+/-80.5	4,69,4211	no	utr-3,missense,utr-3	BMP8B,PPIE	NM_001195007.1,NM_001720.3,NM_203456.2	,29,	8,101,6362	CC,CT,TT		0.8987,0.9145,0.904	,benign,	,293/403,	40229454	117,12825	2187	4284	6471	SO:0001583	missense	656			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.878A>G	1.37:g.40229454T>C	ENSP00000361915:p.His293Arg	Somatic		WXS	SOLID	Phase_I	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	ENST00000372827.3	37	CCDS444.1	60	0.027472527472527472	16	0.032520325203252036	12	0.03314917127071823	10	0.017482517482517484	22	0.029023746701846966	T	11.44	1.638199	0.29157	0.009145	0.008987	ENSG00000116985	ENST00000372827;ENST00000397360	D;T	0.88046	-2.33;0.24	4.02	2.83	0.33086	Transforming growth factor-beta, C-terminal (1);	0.398039	0.24841	U	0.035176	T	0.67534	0.2903	M	0.68952	2.095	0.46437	D	0.999046	B;B	0.24092	0.021;0.097	B;B	0.20577	0.03;0.025	T	0.73733	-0.3890	10	0.49607	T	0.09	.	9.7168	0.40278	0.0:0.0:0.175:0.825	.	318;293	E7EMY8;P34820	.;BMP8B_HUMAN	R	293;318	ENSP00000361915:H293R;ENSP00000380518:H318R	ENSP00000361915:H293R	H	-	2	0	BMP8B	40002041	0.724000	0.28038	0.025000	0.17156	0.186000	0.23388	0.935000	0.28924	0.662000	0.31006	0.529000	0.55759	CAC		0.587	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025641.1		NM_001720	
DDX41	51428	hgsc.bcm.edu;ucsc.edu	37	5	176942816	176942816	+	Silent	SNP	A	A	G			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr5:176942816A>G	ENST00000507955.1	-	6	964	c.441T>C	c.(439-441)acT>acC	p.T147T	DDX41_ENST00000506965.1_Intron	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	147					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			aacggggtggagtccagctgt	0.562																																																	0													126.0	124.0	125.0					5																	176942816		2203	4300	6503	SO:0001819	synonymous_variant	51428			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.441T>C	5.37:g.176942816A>G		Somatic		WXS	SOLID	Phase_I	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Silent	SNP	ENST00000507955.1	37	CCDS4427.1																																																																																				0.562	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2		NM_016222	
FAM179B	23116	hgsc.bcm.edu	37	14	45514043	45514043	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr14:45514043C>A	ENST00000361577.3	+	13	4338	c.4124C>A	c.(4123-4125)gCa>gAa	p.A1375E	KLHL28_ENST00000553817.1_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.A1375E|FAM179B_ENST00000382233.2_3'UTR	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1375										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CCTGCACGTGCAGTTGTTTCT	0.338																																																	0													79.0	76.0	77.0					14																	45514043		2202	4300	6502	SO:0001583	missense	23116			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4124C>A	14.37:g.45514043C>A	ENSP00000355045:p.Ala1375Glu	Somatic		WXS	SOLID	Phase_I	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277894	0.80692	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.43688	1.51;0.94	5.74	5.74	0.90152	Armadillo-type fold (1);	0.211953	0.50627	D	0.000119	T	0.65974	0.2743	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.72338	0.952;0.977	T	0.66870	-0.5814	10	0.66056	D	0.02	-17.2161	19.5147	0.95159	0.0:1.0:0.0:0.0	.	1375;1375	G3XAE9;Q9Y4F4	.;F179B_HUMAN	E	1375	ENSP00000355045:A1375E;ENSP00000354917:A1375E	ENSP00000354917:A1375E	A	+	2	0	FAM179B	44583793	1.000000	0.71417	0.967000	0.41034	0.601000	0.36947	7.027000	0.76463	2.708000	0.92522	0.650000	0.86243	GCA		0.338	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1		XM_113781	
FARP2	9855	hgsc.bcm.edu	37	2	242429386	242429386	+	Missense_Mutation	SNP	A	A	G	rs150907406		TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr2:242429386A>G	ENST00000264042.3	+	22	2601	c.2431A>G	c.(2431-2433)Agt>Ggt	p.S811G		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	811	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S811C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GGTGGAAGAAAGTGATAACGA	0.532																																																	1	Substitution - Missense(1)	skin(1)											103.0	90.0	95.0					2																	242429386		2203	4300	6503	SO:0001583	missense	9855			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2431A>G	2.37:g.242429386A>G	ENSP00000264042:p.Ser811Gly	Somatic		WXS	SOLID	Phase_I	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	CCDS33424.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.88|13.88	2.369397|2.369397	0.42003|0.42003	.|.	.|.	ENSG00000006607|ENSG00000006607	ENST00000444371|ENST00000264042	.|T	.|0.42900	.|0.96	5.51|5.51	-1.43|-1.43	0.08884|0.08884	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.312440	.|0.39274	.|N	.|0.001407	T|T	0.29976|0.29976	0.0750|0.0750	L|L	0.52126|0.52126	1.63|1.63	0.19575|0.19575	N|N	0.999965|0.999965	.|B	.|0.15719	.|0.014	.|B	.|0.16289	.|0.015	T|T	0.15838|0.15838	-1.0423|-1.0423	5|10	.|0.52906	.|T	.|0.07	.|.	5.3629|5.3629	0.16098|0.16098	0.501:0.2665:0.2324:0.0|0.501:0.2665:0.2324:0.0	.|.	.|811	.|O94887	.|FARP2_HUMAN	R|G	4|811	.|ENSP00000264042:S811G	.|ENSP00000264042:S811G	K|S	+|+	2|1	0|0	FARP2|FARP2	242078059|242078059	1.000000|1.000000	0.71417|0.71417	0.000000|0.000000	0.03702|0.03702	0.028000|0.028000	0.11728|0.11728	4.313000|4.313000	0.59160|0.59160	-0.502000|-0.502000	0.06596|0.06596	0.528000|0.528000	0.53228|0.53228	AAG|AGT		0.532	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1			
HIST1H1A	3024	hgsc.bcm.edu	37	6	26017707	26017707	+	Missense_Mutation	SNP	A	A	G	rs150074424		TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr6:26017707A>G	ENST00000244573.3	-	1	333	c.254T>C	c.(253-255)cTg>cCg	p.L85P		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	85	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						CTTAATGCCCAGCTTAATGCG	0.567																																																	0								A	PRO/LEU	1,4405		0,1,2202	75.0	78.0	77.0		254	4.2	1.0	6	dbSNP_134	77	0,8600		0,0,4300	no	missense	HIST1H1A	NM_005325.3	98	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	85/216	26017707	1,13005	2203	4300	6503	SO:0001583	missense	3024			AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.254T>C	6.37:g.26017707A>G	ENSP00000244573:p.Leu85Pro	Somatic		WXS	SOLID	Phase_I	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	37	CCDS4569.1	.	.	.	.	.	.	.	.	.	.	N	18.50	3.636849	0.67130	2.27E-4	0.0	ENSG00000124610	ENST00000244573	T	0.11169	2.8	4.2	4.2	0.49525	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.434585	0.23266	N	0.050063	T	0.33323	0.0859	M	0.93808	3.46	0.80722	D	1	D	0.59357	0.985	D	0.78314	0.991	T	0.45948	-0.9226	10	0.72032	D	0.01	-13.8207	13.1659	0.59571	1.0:0.0:0.0:0.0	.	85	Q02539	H11_HUMAN	P	85	ENSP00000244573:L85P	ENSP00000244573:L85P	L	-	2	0	HIST1H1A	26125686	0.938000	0.31826	0.999000	0.59377	0.952000	0.60782	1.750000	0.38329	1.834000	0.53371	0.496000	0.49642	CTG		0.567	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1		NM_005325	
KANK4	163782	hgsc.bcm.edu	37	1	62740072	62740072	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr1:62740072G>A	ENST00000371153.4	-	3	1082	c.704C>T	c.(703-705)cCa>cTa	p.P235L	KANK4_ENST00000371150.1_5'Flank|KANK4_ENST00000354381.3_Intron	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	235	Pro-rich.					cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						CACACCCTCTGGAGGCTCAGC	0.547																																																	0													48.0	45.0	46.0					1																	62740072		2203	4300	6503	SO:0001583	missense	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.704C>T	1.37:g.62740072G>A	ENSP00000360195:p.Pro235Leu	Somatic		WXS	SOLID	Phase_I	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	.	.	.	.	.	.	.	.	.	.	G	9.583	1.124226	0.20959	.	.	ENSG00000132854	ENST00000371153	T	0.46451	0.87	4.75	-2.9	0.05648	.	1.476840	0.04596	N	0.397601	T	0.29914	0.0748	L	0.47716	1.5	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.14420	-1.0473	10	0.28530	T	0.3	1.3222	1.3702	0.02209	0.2369:0.1095:0.1884:0.4652	.	235	Q5T7N3	KANK4_HUMAN	L	235	ENSP00000360195:P235L	ENSP00000360195:P235L	P	-	2	0	KANK4	62512660	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-0.215000	0.09279	-0.328000	0.08539	-0.372000	0.07161	CCA		0.547	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1		NM_181712	
KCNJ12	3768	hgsc.bcm.edu	37	17	21318912	21318912	+	Silent	SNP	C	C	A	rs35011501	byFrequency	TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr17:21318912C>A	ENST00000583088.1	+	3	1153	c.258C>A	c.(256-258)atC>atA	p.I86I	KCNJ12_ENST00000331718.5_Silent_p.I86I	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	86					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TGCTGCTCATCTTCTCGCTGG	0.612										Prostate(3;0.18)																																							0													190.0	116.0	141.0					17																	21318912		2203	4300	6503	SO:0001819	synonymous_variant	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.258C>A	17.37:g.21318912C>A		Somatic		WXS	SOLID	Phase_I	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1																																																																																				0.612	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2		NM_021012	
MAP2K5	5607	hgsc.bcm.edu	37	15	68099075	68099075	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr15:68099075A>G	ENST00000178640.5	+	22	1961	c.1334A>G	c.(1333-1335)cAg>cGg	p.Q445R	MAP2K5_ENST00000354498.5_Missense_Mutation_p.Q409R|MAP2K5_ENST00000340972.4_Missense_Mutation_p.Q255R|MAP2K5_ENST00000395476.2_Missense_Mutation_p.Q435R	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	445					activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						CGGAGCCAGCAGGGGCCCCCG	0.662																																																	0													18.0	19.0	18.0					15																	68099075		2156	4217	6373	SO:0001583	missense	5607			U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.1334A>G	15.37:g.68099075A>G	ENSP00000178640:p.Gln445Arg	Somatic		WXS	SOLID	Phase_I	B4DE43|Q92961|Q92962	Missense_Mutation	SNP	ENST00000178640.5	37	CCDS10224.1	.	.	.	.	.	.	.	.	.	.	A	7.831	0.719854	0.15372	.	.	ENSG00000137764	ENST00000395476;ENST00000178640;ENST00000354498;ENST00000340972	T;T;T;T	0.74002	-0.4;-0.59;-0.57;-0.8	5.48	5.48	0.80851	Protein kinase-like domain (1);	2.036920	0.02219	N	0.063894	T	0.62380	0.2423	N	0.22421	0.69	0.35708	D	0.81614	B;B;B	0.32160	0.037;0.358;0.244	B;B;B	0.29785	0.013;0.107;0.05	T	0.53961	-0.8364	10	0.15499	T	0.54	29.6023	7.2944	0.26385	0.7802:0.146:0.0737:0.0	.	255;435;445	A6NK28;Q13163-2;Q13163	.;.;MP2K5_HUMAN	R	435;445;409;255	ENSP00000378859:Q435R;ENSP00000178640:Q445R;ENSP00000346493:Q409R;ENSP00000342101:Q255R	ENSP00000178640:Q445R	Q	+	2	0	MAP2K5	65886129	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	2.435000	0.44811	2.089000	0.63090	0.459000	0.35465	CAG		0.662	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257041.1		NM_145162	
LARP6	55323	hgsc.bcm.edu	37	15	71124525	71124525	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr15:71124525G>T	ENST00000299213.8	-	3	1412	c.1342C>A	c.(1342-1344)Ccc>Acc	p.P448T	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	448					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						CTCGTACCGGGGCTTTTCTCC	0.617																																																	0													67.0	71.0	70.0					15																	71124525		2199	4297	6496	SO:0001583	missense	55323			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.1342C>A	15.37:g.71124525G>T	ENSP00000299213:p.Pro448Thr	Somatic		WXS	SOLID	Phase_I	Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	ENST00000299213.8	37	CCDS32281.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389355	0.61956	.	.	ENSG00000166173	ENST00000299213	T	0.57436	0.4	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.62368	0.2422	L	0.56769	1.78	0.80722	D	1	D	0.60575	0.988	P	0.54815	0.761	T	0.60321	-0.7286	10	0.34782	T	0.22	-12.9051	16.4568	0.84021	0.0:0.0:1.0:0.0	.	448	Q9BRS8	LARP6_HUMAN	T	448	ENSP00000299213:P448T	ENSP00000299213:P448T	P	-	1	0	LARP6	68911579	1.000000	0.71417	0.890000	0.34922	0.418000	0.31294	9.069000	0.93967	2.471000	0.83476	0.555000	0.69702	CCC		0.617	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2		NM_018357	
MGAT3	4248	hgsc.bcm.edu	37	22	39883403	39883403	+	Silent	SNP	G	G	C			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr22:39883403G>C	ENST00000341184.6	+	2	266	c.51G>C	c.(49-51)ctG>ctC	p.L17L		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	17					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					TGGCCGGCCTGTGCCTCATCT	0.557																																																	0													210.0	202.0	205.0					22																	39883403		2203	4300	6503	SO:0001819	synonymous_variant	4248			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.51G>C	22.37:g.39883403G>C		Somatic		WXS	SOLID	Phase_I	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Silent	SNP	ENST00000341184.6	37	CCDS13994.2																																																																																				0.557	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2		NM_002409	
MUC4	4585	hgsc.bcm.edu	37	3	195512287	195512287	+	Missense_Mutation	SNP	G	G	A	rs113602668	byFrequency	TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr3:195512287G>A	ENST00000463781.3	-	2	6623	c.6164C>T	c.(6163-6165)tCc>tTc	p.S2055F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2055F|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATACTGAGGAAAGGCTGGT	0.572																																																	0													18.0	18.0	18.0					3																	195512287		686	1573	2259	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6164C>T	3.37:g.195512287G>A	ENSP00000417498:p.Ser2055Phe	Somatic		WXS	SOLID	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	5.081	0.200645	0.09652	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.43;1.43	.	.	.	.	.	.	.	.	T	0.14056	0.0340	N	0.19112	0.55	0.09310	N	1	P	0.35139	0.486	B	0.22601	0.04	T	0.15752	-1.0426	6	.	.	.	.	.	.	.	.	2055	E7ESK3	.	F	2055	ENSP00000417498:S2055F;ENSP00000420243:S2055F	.	S	-	2	0	MUC4	196996682	.	.	0.002000	0.10522	0.014000	0.08584	.	.	0.488000	0.27723	0.064000	0.15345	TCC		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
ODC1	4953	hgsc.bcm.edu	37	2	10583632	10583632	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr2:10583632C>A	ENST00000234111.4	-	7	1160	c.650G>T	c.(649-651)tGt>tTt	p.C217F	ODC1_ENST00000446285.1_5'Flank|ODC1_ENST00000405333.1_Missense_Mutation_p.C217F	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	217					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	GTCAAAAACACAGCGGGCATC	0.473																																																	0													87.0	91.0	90.0					2																	10583632		2203	4300	6503	SO:0001583	missense	4953				CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.650G>T	2.37:g.10583632C>A	ENSP00000234111:p.Cys217Phe	Somatic		WXS	SOLID	Phase_I	Q53TU3|Q6LDS9	Missense_Mutation	SNP	ENST00000234111.4	37	CCDS1672.1	.	.	.	.	.	.	.	.	.	.	C	6.796	0.515872	0.12944	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.40756	1.02;1.02	5.79	3.99	0.46301	Orn/DAP/Arg decarboxylase 2, N-terminal (1);	0.087604	0.85682	D	0.000000	T	0.30230	0.0758	L	0.28274	0.84	0.58432	D	0.999997	B	0.20887	0.049	B	0.25759	0.063	T	0.04440	-1.0951	10	0.22109	T	0.4	.	12.4714	0.55790	0.0:0.8646:0.0:0.1354	.	217	P11926	DCOR_HUMAN	F	217;217;88	ENSP00000234111:C217F;ENSP00000385333:C217F	ENSP00000234111:C217F	C	-	2	0	ODC1	10501083	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.985000	0.49362	0.798000	0.33994	-0.150000	0.13652	TGT		0.473	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2			
OSGIN1	29948	hgsc.bcm.edu	37	16	83984776	83984776	+	Missense_Mutation	SNP	A	A	C	rs28555129|rs561380669	byFrequency	TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr16:83984776A>C	ENST00000343939.2	+	2	484	c.101A>C	c.(100-102)aAc>aCc	p.N34T	OSGIN1_ENST00000565123.1_5'Flank|RP11-505K9.4_ENST00000561562.1_3'UTR|OSGIN1_ENST00000361711.3_Intron|OSGIN1_ENST00000393306.1_5'Flank			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	34			N -> T (in dbSNP:rs28555129). {ECO:0000269|PubMed:14570898}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						TCTACCAGGAAccagccccag	0.597													C|||	3785	0.755791	0.7368	0.8156	5008	,	,		14824	0.8958		0.6839	False		,,,				2504	0.6687																0								C	,THR/ASN	2976,1018		1106,764,127	46.0	41.0	43.0		,101	0.8	0.0	16	dbSNP_125	43	5481,2487		1890,1701,393	yes	intron,missense	OSGIN1	NM_182980.2,NM_013370.3	,65	2996,2465,520	CC,CA,AA		31.2123,25.4882,29.3011	,benign	,34/561	83984776	8457,3505	1997	3984	5981	SO:0001583	missense	29948			AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.101A>C	16.37:g.83984776A>C	ENSP00000343376:p.Asn34Thr	Somatic		WXS	SOLID	Phase_I	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	37		1663	0.7614468864468864	359	0.7296747967479674	288	0.7955801104972375	497	0.8688811188811189	519	0.6846965699208444	C	3.933	-0.015772	0.07681	0.745118	0.687877	ENSG00000140961	ENST00000343939	T	0.10573	2.86	0.772	0.772	0.18510	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.32824	-0.9892	8	0.02654	T	1	.	3.908	0.09191	0.4182:0.5818:0.0:0.0	rs28555129	34	Q9UJX0	OSGI1_HUMAN	T	34	ENSP00000343376:N34T	ENSP00000343376:N34T	N	+	2	0	OSGIN1	82542277	0.015000	0.18098	0.002000	0.10522	0.002000	0.02628	-0.244000	0.08903	-0.076000	0.12775	-0.225000	0.12378	AAC		0.597	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1		NM_013370	
OSMR	9180	hgsc.bcm.edu;ucsc.edu	37	5	38886147	38886147	+	Silent	SNP	T	T	G			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr5:38886147T>G	ENST00000274276.3	+	7	1248	c.846T>G	c.(844-846)tcT>tcG	p.S282S	OSMR_ENST00000502536.1_Silent_p.S282S	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	282					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					AAAGATTTTCTGGGGAAAAGA	0.343																																																	0													54.0	56.0	55.0					5																	38886147		2203	4300	6503	SO:0001819	synonymous_variant	9180			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.846T>G	5.37:g.38886147T>G		Somatic		WXS	SOLID	Phase_I	Q6P4E8|Q96QJ6	Silent	SNP	ENST00000274276.3	37	CCDS3928.1																																																																																				0.343	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2		NM_003999	
PDIA5	10954	hgsc.bcm.edu	37	3	122849455	122849455	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr3:122849455A>C	ENST00000316218.7	+	11	997	c.902A>C	c.(901-903)cAc>cCc	p.H301P		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	301	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		GTCATGTTCCACGCCCCATGT	0.557																																																	0													140.0	115.0	123.0					3																	122849455		2203	4300	6503	SO:0001583	missense	10954			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.902A>C	3.37:g.122849455A>C	ENSP00000323313:p.His301Pro	Somatic		WXS	SOLID	Phase_I	D3DN95|Q9BV43	Missense_Mutation	SNP	ENST00000316218.7	37	CCDS3020.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.489422	0.84962	.	.	ENSG00000065485	ENST00000316218	T	0.38887	1.11	5.76	5.76	0.90799	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);	0.052848	0.85682	D	0.000000	T	0.54303	0.1850	L	0.48362	1.52	0.53688	D	0.999971	D	0.58970	0.984	P	0.59643	0.861	T	0.56950	-0.7894	10	0.87932	D	0	.	14.6496	0.68786	1.0:0.0:0.0:0.0	.	301	Q14554	PDIA5_HUMAN	P	301	ENSP00000323313:H301P	ENSP00000323313:H301P	H	+	2	0	PDIA5	124332145	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.320000	0.89995	2.200000	0.70718	0.379000	0.24179	CAC		0.557	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1		NM_006810	
SEMA6C	10500	hgsc.bcm.edu	37	1	151112489	151112489	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr1:151112489A>G	ENST00000341697.3	-	4	1887	c.196T>C	c.(196-198)Ttc>Ctc	p.F66L				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	66	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AAGGTCAGGAATCTCTGAAAG	0.567																																																	0													89.0	63.0	72.0					1																	151112489		2203	4300	6503	SO:0001583	missense	10500			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.196T>C	1.37:g.151112489A>G	ENSP00000344148:p.Phe66Leu	Somatic		WXS	SOLID	Phase_I	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	CCDS984.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.085406	0.76642	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697;ENST00000392792	T;T;T;T	0.16196	2.36;2.57;2.37;2.36	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (3);	0.162902	0.52532	N	0.000072	T	0.10337	0.0253	N	0.11427	0.14	0.33556	D	0.596708	B;D;B;D	0.59357	0.018;0.982;0.04;0.985	B;D;B;D	0.72338	0.055;0.961;0.032;0.977	T	0.17837	-1.0356	10	0.23302	T	0.38	.	10.595	0.45331	1.0:0.0:0.0:0.0	.	66;66;66;66	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	L	66	ENSP00000357910:F66L;ENSP00000357908:F66L;ENSP00000357909:F66L;ENSP00000344148:F66L	ENSP00000344148:F66L	F	-	1	0	SEMA6C	149379113	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.149000	0.58091	2.016000	0.59253	0.459000	0.35465	TTC		0.567	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1		NM_030913	
SERPINB4	6318	hgsc.bcm.edu	37	18	61306561	61306561	+	Missense_Mutation	SNP	G	G	C	rs541302733		TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr18:61306561G>C	ENST00000341074.5	-	7	741	c.626C>G	c.(625-627)tCt>tGt	p.S209C	SERPINB4_ENST00000356424.6_Intron	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	209					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S209Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						CATCTGTACAGATTTGTATGT	0.358																																																	1	Substitution - Missense(1)	ovary(1)											89.0	77.0	81.0					18																	61306561		2203	4300	6503	SO:0001583	missense	6318			X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.626C>G	18.37:g.61306561G>C	ENSP00000343445:p.Ser209Cys	Somatic		WXS	SOLID	Phase_I	A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	CCDS11986.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.040205	0.55003	.	.	ENSG00000206073	ENST00000341074;ENST00000436264	D;D	0.84873	-1.91;-1.91	4.17	3.29	0.37713	Serpin domain (3);	0.543479	0.15483	N	0.259999	D	0.90113	0.6911	M	0.88241	2.94	0.80722	D	1	P	0.49307	0.922	P	0.51355	0.667	D	0.91460	0.5188	10	0.72032	D	0.01	.	11.8533	0.52423	0.0914:0.0:0.9086:0.0	.	209	P48594	SPB4_HUMAN	C	209;166	ENSP00000343445:S209C;ENSP00000399796:S166C	ENSP00000343445:S209C	S	-	2	0	SERPINB4	59457541	0.042000	0.20092	0.019000	0.16419	0.002000	0.02628	2.202000	0.42743	2.300000	0.77407	0.603000	0.83216	TCT		0.358	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2		NM_175041	
STAT1	6772	hgsc.bcm.edu	37	2	191862646	191862646	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr2:191862646G>A	ENST00000361099.3	-	9	1108	c.721C>T	c.(721-723)Cgg>Tgg	p.R241W	STAT1_ENST00000392322.3_Missense_Mutation_p.R241W|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.R241W|STAT1_ENST00000392323.2_Missense_Mutation_p.R243W	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	241					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)	p.R241W(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			TGCTGTCTCCGCTTCCACTCC	0.473																																																	1	Substitution - Missense(1)	endometrium(1)											79.0	75.0	76.0					2																	191862646		2203	4300	6503	SO:0001583	missense	6772				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.721C>T	2.37:g.191862646G>A	ENSP00000354394:p.Arg241Trp	Somatic		WXS	SOLID	Phase_I	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802663	0.70682	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323;ENST00000544783	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.28	5.28	0.74379	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.310953	0.36778	N	0.002401	T	0.77308	0.4111	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.63597	0.663;0.916	T	0.78874	-0.2032	10	0.56958	D	0.05	-18.7476	14.8073	0.69968	0.0:0.0:0.8556:0.1444	.	241;241	P42224-2;P42224	.;STAT1_HUMAN	W	241;241;241;243;149	ENSP00000354394:R241W;ENSP00000386244:R241W;ENSP00000376136:R241W;ENSP00000376137:R243W	ENSP00000354394:R241W	R	-	1	2	STAT1	191570891	1.000000	0.71417	0.968000	0.41197	0.522000	0.34438	4.231000	0.58639	2.746000	0.94184	0.655000	0.94253	CGG		0.473	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3		NM_007315	
SYNE2	23224	hgsc.bcm.edu	37	14	64450489	64450489	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr14:64450489A>G	ENST00000344113.4	+	18	2248	c.2036A>G	c.(2035-2037)gAt>gGt	p.D679G	SYNE2_ENST00000358025.3_Missense_Mutation_p.D679G|SYNE2_ENST00000554584.1_Missense_Mutation_p.D679G|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	679					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAAAACAGGATCAGCCCACT	0.284																																																	0													41.0	40.0	40.0					14																	64450489		1797	4066	5863	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2036A>G	14.37:g.64450489A>G	ENSP00000341781:p.Asp679Gly	Somatic		WXS	SOLID	Phase_I	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.963463	0.34659	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.57107	0.79;0.79;0.42	4.97	3.82	0.43975	.	0.946035	0.08814	N	0.889775	T	0.43656	0.1257	L	0.44542	1.39	0.28012	N	0.934873	B;P	0.36909	0.437;0.573	B;B	0.33690	0.081;0.168	T	0.34850	-0.9812	10	0.46703	T	0.11	.	7.9606	0.30068	0.9006:0.0:0.0994:0.0	.	679;679	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	G	679	ENSP00000350719:D679G;ENSP00000341781:D679G;ENSP00000452570:D679G	ENSP00000261678:D679G	D	+	2	0	SYNE2	63520242	0.069000	0.21087	0.360000	0.25837	0.925000	0.55904	0.913000	0.28611	1.031000	0.39867	0.528000	0.53228	GAT		0.284	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2		NM_182914	
TLR4	7099	hgsc.bcm.edu	37	9	120475463	120475463	+	Missense_Mutation	SNP	C	C	T	rs148638298		TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr9:120475463C>T	ENST00000355622.6	+	3	1158	c.1057C>T	c.(1057-1059)Ctc>Ttc	p.L353F	TLR4_ENST00000394487.4_Missense_Mutation_p.L313F|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	353					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L353F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACTCAAATCTCTCAAAAGGCT	0.353																																																	1	Substitution - Missense(1)	skin(1)											56.0	61.0	59.0					9																	120475463		2202	4300	6502	SO:0001583	missense	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1057C>T	9.37:g.120475463C>T	ENSP00000363089:p.Leu353Phe	Somatic		WXS	SOLID	Phase_I	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366985	0.41902	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.66995	-0.24;-0.24	5.56	5.56	0.83823	.	0.000000	0.56097	D	0.000035	T	0.69584	0.3127	L	0.33485	1.01	0.43673	D	0.9961	D	0.89917	1.0	D	0.97110	1.0	T	0.72077	-0.4399	10	0.87932	D	0	.	5.7761	0.18279	0.1892:0.6948:0.0:0.1161	.	353	O00206	TLR4_HUMAN	F	313;353	ENSP00000377997:L313F;ENSP00000363089:L353F	ENSP00000363089:L353F	L	+	1	0	TLR4	119515284	0.978000	0.34361	0.992000	0.48379	0.075000	0.17131	0.711000	0.25764	2.621000	0.88768	0.655000	0.94253	CTC		0.353	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3		NM_138554	
UBAP2L	9898	hgsc.bcm.edu	37	1	154218831	154218831	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr1:154218831A>C	ENST00000361546.2	+	10	1036	c.994A>C	c.(994-996)Aca>Cca	p.T332P	UBAP2L_ENST00000428931.1_Missense_Mutation_p.T332P|UBAP2L_ENST00000343815.6_Missense_Mutation_p.T332P|UBAP2L_ENST00000271877.7_Missense_Mutation_p.T343P			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	332					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTCAGGGAACACATTTTCTCA	0.463																																																	0													116.0	116.0	116.0					1																	154218831		2203	4300	6503	SO:0001583	missense	9898			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.994A>C	1.37:g.154218831A>C	ENSP00000355343:p.Thr332Pro	Somatic		WXS	SOLID	Phase_I	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.818250	0.50633	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000368504;ENST00000361546	T;T;T;T;T	0.46451	2.74;2.74;2.74;0.87;2.74	5.29	4.15	0.48705	.	0.166846	0.53938	D	0.000042	T	0.11196	0.0273	N	0.12182	0.205	0.32078	N	0.59357	B;B;B;B;B	0.22414	0.0;0.069;0.0;0.0;0.0	B;B;B;B;B	0.20384	0.0;0.029;0.0;0.0;0.0	T	0.07424	-1.0773	10	0.59425	D	0.04	-2.358	9.5653	0.39394	0.704:0.0:0.0:0.296	.	246;343;325;332;332	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	P	332;332;343;343;332	ENSP00000345308:T332P;ENSP00000389445:T332P;ENSP00000271877:T343P;ENSP00000357490:T343P;ENSP00000355343:T332P	ENSP00000271877:T343P	T	+	1	0	UBAP2L	152485455	0.996000	0.38824	0.992000	0.48379	0.999000	0.98932	1.769000	0.38522	1.007000	0.39238	0.533000	0.62120	ACA		0.463	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1		NM_014847	
UBP1	7342	hgsc.bcm.edu	37	3	33450220	33450220	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr3:33450220G>A	ENST00000283629.3	-	8	1418	c.889C>T	c.(889-891)Cca>Tca	p.P297S	UBP1_ENST00000283628.5_Missense_Mutation_p.P297S|UBP1_ENST00000486388.1_5'Flank|UBP1_ENST00000447368.2_Intron	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	297				SSKRTLP -> VQQADFA (in Ref. 1). {ECO:0000305}.	angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P297S(2)		breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TAGTCTGCTGGCAAAGTCCGC	0.448																																																	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)											121.0	115.0	117.0					3																	33450220		2203	4300	6503	SO:0001583	missense	7342			AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.889C>T	3.37:g.33450220G>A	ENSP00000283629:p.Pro297Ser	Somatic		WXS	SOLID	Phase_I	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011871	0.75046	.	.	ENSG00000153560	ENST00000283629;ENST00000283628	T;T	0.16897	2.31;2.31	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.33933	0.0880	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00376	-1.1779	10	0.31617	T	0.26	-11.0023	18.833	0.92148	0.0:0.0:1.0:0.0	.	297	Q9NZI7	UBIP1_HUMAN	S	297	ENSP00000283629:P297S;ENSP00000283628:P297S	ENSP00000283628:P297S	P	-	1	0	UBP1	33425224	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.855000	0.92236	2.890000	0.99128	0.585000	0.79938	CCA		0.448	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2		NM_014517	
ZAN	7455	hgsc.bcm.edu	37	7	100371474	100371474	+	RNA	SNP	G	G	A	rs78193191	byFrequency	TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr7:100371474G>A	ENST00000348028.3	+	0	5930				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGGCTGCTCCGTTTCGGGCCT	0.622													G|||	2231	0.445487	0.2141	0.5418	5008	,	,		18070	0.7867		0.3419	False		,,,				2504	0.4448																0													32.0	34.0	33.0					7																	100371474		2009	4154	6163			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100371474G>A		Somatic		WXS	SOLID	Phase_I	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	G	17.72	3.459247	0.63401	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.80994	2.44;2.44;2.41;-1.44	4.56	2.73	0.32206	von Willebrand factor, type C (1);von Willebrand factor, type D domain (1);	0.756330	0.11382	N	0.569707	T	0.73845	0.3639	M	0.76574	2.34	0.21064	N	0.999795	P;P	0.42908	0.754;0.793	B;B	0.33750	0.105;0.169	T	0.64106	-0.6485	10	0.34782	T	0.22	.	6.1384	0.20247	0.226:0.0:0.774:0.0	.	1922;1922	F5H0T8;Q9Y493	.;ZAN_HUMAN	H	1922;1922;1922;433	ENSP00000445943:R1922H;ENSP00000445091:R1922H;ENSP00000444427:R1922H;ENSP00000441117:R433H	ENSP00000423579:R1922H	R	+	2	0	ZAN	100209410	0.922000	0.31269	0.754000	0.31244	0.137000	0.21094	1.873000	0.39558	1.222000	0.43521	0.448000	0.29417	CGT		0.622	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1		NM_003386	
ZNF30	90075	hgsc.bcm.edu;ucsc.edu	37	19	35434174	35434174	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4804-01A-02D-1373-10	TCGA-BP-4804-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d310a284-76e2-41e0-8641-11c3e206c3f4	cc9fe2bf-0a9d-49fa-a4a5-4fc6016b1257	g.chr19:35434174T>C	ENST00000601142.1	+	5	541	c.304T>C	c.(304-306)Tct>Cct	p.S102P	ZNF30_ENST00000426813.2_Missense_Mutation_p.S21P|ZNF30_ENST00000439785.1_Missense_Mutation_p.S103P|ZNF30_ENST00000303586.7_Missense_Mutation_p.S103P|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000595818.1_3'UTR			P17039	ZNF30_HUMAN	zinc finger protein 30	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		AATGCCCACCTCTGAAAACTG	0.338																																																	0													45.0	43.0	44.0					19																	35434174		1829	4074	5903	SO:0001583	missense	90075			X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.304T>C	19.37:g.35434174T>C	ENSP00000469954:p.Ser102Pro	Somatic		WXS	SOLID	Phase_I	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	T	4.245	0.044522	0.08196	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813	T;T	0.09445	3.17;2.98	1.35	0.225	0.15325	.	.	.	.	.	T	0.06325	0.0163	N	0.08118	0	0.09310	N	1	P;B	0.39624	0.681;0.043	P;B	0.45343	0.477;0.012	T	0.32851	-0.9891	9	0.33940	T	0.23	.	3.3202	0.07048	0.369:0.0:0.0:0.631	.	103;102	P17039-2;P17039	.;ZNF30_HUMAN	P	103;102;21	ENSP00000403441:S103P;ENSP00000416457:S21P	ENSP00000303889:S102P	S	+	1	0	ZNF30	40126014	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-1.506000	0.02271	0.001000	0.14605	0.416000	0.27883	TCT		0.338	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1		NM_194325	
