#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ARHGAP33	115703	hgsc.bcm.edu;ucsc.edu	37	19	36275074	36275074	+	Splice_Site	SNP	G	G	A	rs62112163	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:36275074G>A	ENST00000007510.4	+	16	1566	c.1422G>A	c.(1420-1422)cgG>cgA	p.R474R	ARHGAP33_ENST00000378944.5_Splice_Site_p.R338R|ARHGAP33_ENST00000314737.5_Splice_Site_p.R474R			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	474	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.R474R(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TCCCACCCAGGTCCATGGAGC	0.652													G|||	918	0.183307	0.0862	0.1715	5008	,	,		12087	0.1518		0.1829	False		,,,				2504	0.3558																1	Substitution - coding silent(1)	stomach(1)						G	,	443,3963	211.8+/-231.9	13,417,1773	122.0	113.0	116.0		1014,1422	3.8	1.0	19	dbSNP_129	116	1631,6967	300.1+/-304.8	146,1339,2814	no	coding-synonymous-near-splice,coding-synonymous-near-splice	ARHGAP33	NM_001172630.1,NM_052948.3	,	159,1756,4587	AA,AG,GG		18.9695,10.0545,15.9489	,	338/1124,474/1127	36275074	2074,10930	2203	4299	6502	SO:0001630	splice_region_variant	115703			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1422-1G>A	19.37:g.36275074G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Silent	SNP	ENST00000007510.4	37																																																																																					0.652	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding			NM_052948	Silent
ATM	472	hgsc.bcm.edu	37	11	108206572	108206572	+	Splice_Site	SNP	G	G	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr11:108206572G>C	ENST00000452508.2	+	57	8341	c.8152G>C	c.(8152-8154)Ggc>Cgc	p.G2718R	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Splice_Site_p.G2718R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2718	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.G2718R(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TATTCTGAAGGGCCGTGATGA	0.383			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	2	Substitution - Missense(2)	kidney(2)											84.0	78.0	80.0					11																	108206572		2201	4298	6499	SO:0001630	splice_region_variant	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8152-1G>C	11.37:g.108206572G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005966	0.93287	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.94330	-3.4;-3.4	5.47	5.47	0.80525	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.97427	0.9158	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97771	1.0226	9	.	.	.	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	2718	Q13315	ATM_HUMAN	R	2718	ENSP00000278616:G2718R;ENSP00000388058:G2718R	.	G	+	1	0	ATM	107711782	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.262000	0.95591	2.583000	0.87209	0.591000	0.81541	GGC		0.383	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	Missense_Mutation
ATP10D	57205	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	47527622	47527622	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:47527622A>T	ENST00000273859.3	+	5	1008	c.739A>T	c.(739-741)Agc>Tgc	p.S247C	ATP10D_ENST00000504445.1_Missense_Mutation_p.S247C	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	247					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S247C(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						AGAATGTGAAAGCCCAAACAA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											101.0	101.0	101.0					4																	47527622		2203	4300	6503	SO:0001583	missense	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.739A>T	4.37:g.47527622A>T	ENSP00000273859:p.Ser247Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598033	0.87055	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.76578	-1.03;-1.03	5.66	5.66	0.87406	ATPase, P-type, ATPase-associated domain (1);	0.203558	0.51477	D	0.000089	D	0.85431	0.5695	M	0.67397	2.05	0.30399	N	0.780207	P;P	0.44659	0.84;0.711	P;P	0.58520	0.84;0.704	D	0.84982	0.0889	10	0.62326	D	0.03	-9.5839	15.3685	0.74541	1.0:0.0:0.0:0.0	.	247;247	Q9P241;Q6PEW3	AT10D_HUMAN;.	C	247	ENSP00000273859:S247C;ENSP00000420909:S247C	ENSP00000273859:S247C	S	+	1	0	ATP10D	47222379	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.426000	0.80270	2.270000	0.75569	0.533000	0.62120	AGC		0.363	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1		NM_020453	
B3GALT2	8707	hgsc.bcm.edu;ucsc.edu	37	1	193149452	193149452	+	Frame_Shift_Del	DEL	C	C	-	rs373501556		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:193149452delC	ENST00000367434.4	-	2	1996	c.1241delG	c.(1240-1242)ggcfs	p.G414fs	CDC73_ENST00000367435.3_Intron	NM_003783.3	NP_003774.1	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2	414					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	16						GCGATACCTGCCTGCCTTTTC	0.363																																																	0													122.0	117.0	119.0					1																	193149452		2203	4300	6503	SO:0001589	frameshift_variant	8707			Y15060	CCDS1383.1	1q31	2013-02-19			ENSG00000162630	ENSG00000162630		"""Beta 3-glycosyltransferases"""	917	protein-coding gene	gene with protein product		603018				9582303, 9417100	Standard	NM_003783		Approved	beta3Gal-T2	uc001gtc.4	O43825	OTTHUMG00000035687	ENST00000367434.4:c.1241delG	1.37:g.193149452delC	ENSP00000356404:p.Gly414fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAB1|Q9BZQ9	Frame_Shift_Del	DEL	ENST00000367434.4	37	CCDS1383.1																																																																																				0.363	B3GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086759.1		NM_003783	
BRD8	10902	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137503709	137503709	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr5:137503709A>T	ENST00000254900.5	-	9	1072	c.701T>A	c.(700-702)cTg>cAg	p.L234Q	BRD8_ENST00000455658.2_Missense_Mutation_p.L193Q|BRD8_ENST00000411594.2_Missense_Mutation_p.L307Q|BRD8_ENST00000402931.1_Missense_Mutation_p.L234Q|BRD8_ENST00000230901.5_Missense_Mutation_p.L307Q	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	234					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)	p.L234Q(1)|p.L307Q(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCCTACCTCCAGGAGGACACC	0.522																																																	2	Substitution - Missense(2)	kidney(2)											104.0	96.0	99.0					5																	137503709		2203	4300	6503	SO:0001583	missense	10902			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.701T>A	5.37:g.137503709A>T	ENSP00000254900:p.Leu234Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.27|12.27	1.888876|1.888876	0.33348|0.33348	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000453824|ENST00000441656	T;T;T;T;T;T;T|.	0.36157|.	1.8;1.51;1.27;1.61;1.59;1.28;1.57|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.305616|.	0.31554|.	N|.	0.007452|.	T|T	0.50343|0.50343	0.1610|0.1610	N|N	0.19112|0.19112	0.55|0.55	0.49051|0.49051	D|D	0.999741|0.999741	D;D;D;P;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.952;0.99;0.985;0.971;1.0|.	D;D;D;P;P;P;P;D|.	0.76575|.	0.988;0.972;0.972;0.694;0.775;0.878;0.839;0.981|.	T|T	0.46871|0.46871	-0.9160|-0.9160	10|5	0.30078|.	T|.	0.28|.	-6.1165|-6.1165	14.7615|14.7615	0.69610|0.69610	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	193;218;193;307;307;167;307;234|.	F8W820;B4DN43;B4DEG9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9|.	.;.;.;.;.;.;.;BRD8_HUMAN|.	Q|R	234;302;302;307;234;307;167;193;122|298	ENSP00000254900:L234Q;ENSP00000398067:L302Q;ENSP00000398873:L302Q;ENSP00000230901:L307Q;ENSP00000384845:L234Q;ENSP00000394330:L307Q;ENSP00000408396:L193Q|.	ENSP00000230901:L307Q|.	L|W	-|-	2|1	0|0	BRD8|BRD8	137531608|137531608	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.208000|6.208000	0.72165|0.72165	2.273000|2.273000	0.75805|0.75805	0.482000|0.482000	0.46254|0.46254	CTG|TGG		0.522	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3		NM_006696	
C17orf98	388381	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	36997521	36997521	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr17:36997521G>A	ENST00000398575.4	-	1	187	c.122C>T	c.(121-123)cCg>cTg	p.P41L		NM_001080465.2	NP_001073934.1	A8MV24	CQ098_HUMAN	chromosome 17 open reading frame 98	41								p.P41L(2)		endometrium(5)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(3)	14						GTTGTAGGGCGGAATCGCCGA	0.617																																																	2	Substitution - Missense(2)	prostate(1)|kidney(1)											54.0	55.0	55.0					17																	36997521		1998	4178	6176	SO:0001583	missense	388381			AC006449, DY654789	CCDS42310.1	17q12	2014-05-06			ENSG00000214556	ENSG00000275489			34492	protein-coding gene	gene with protein product						16625196	Standard	NM_001080465		Approved	LOC388381	uc002hqv.2	A8MV24	OTTHUMG00000188506	ENST00000398575.4:c.122C>T	17.37:g.36997521G>A	ENSP00000381580:p.Pro41Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000398575.4	37	CCDS42310.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108975	0.77096	.	.	ENSG00000214556	ENST00000398575	T	0.51574	0.7	5.16	5.16	0.70880	.	0.000000	0.39020	U	0.001482	T	0.68192	0.2974	M	0.71036	2.16	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.71080	-0.4696	10	0.87932	D	0	-17.5062	16.1916	0.81992	0.0:0.0:1.0:0.0	.	41	A8MV24	CQ098_HUMAN	L	41	ENSP00000381580:P41L	ENSP00000381580:P41L	P	-	2	0	C17orf98	34251047	1.000000	0.71417	0.984000	0.44739	0.484000	0.33280	6.015000	0.70791	2.687000	0.91594	0.462000	0.41574	CCG		0.617	C17orf98-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255469.2		NM_001080465	
C17orf53	78995	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	42232723	42232723	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr17:42232723T>A	ENST00000319977.4	+	8	1954	c.1717T>A	c.(1717-1719)Tac>Aac	p.Y573N	C17orf53_ENST00000245382.6_Missense_Mutation_p.Y497N|C17orf53_ENST00000585683.1_Missense_Mutation_p.Y572N	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	573								p.Y573N(1)		NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GGTCCATATTTACAGCCCGGA	0.522																																																	1	Substitution - Missense(1)	kidney(1)											119.0	104.0	109.0					17																	42232723		2203	4300	6503	SO:0001583	missense	78995			AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.1717T>A	17.37:g.42232723T>A	ENSP00000313500:p.Tyr573Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.968011	0.92855	.	.	ENSG00000125319	ENST00000319977;ENST00000245382	T;T	0.59772	0.24;0.49	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.76140	0.3946	M	0.76328	2.33	0.51767	D	0.99993	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.992;0.999	T	0.78974	-0.1992	10	0.87932	D	0	-13.2721	15.4388	0.75168	0.0:0.0:0.0:1.0	.	572;497;573	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	N	573;497	ENSP00000313500:Y573N;ENSP00000245382:Y497N	ENSP00000245382:Y497N	Y	+	1	0	C17orf53	39588249	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	7.483000	0.81158	2.289000	0.77006	0.459000	0.35465	TAC		0.522	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1		NM_024032	
BZRAP1	9256	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	56395795	56395796	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr17:56395795_56395796CC>TT	ENST00000343736.4	-	14	1880_1881	c.1717_1718GG>AA	c.(1717-1719)GGc>AAc	p.G573N	BZRAP1_ENST00000355701.3_Missense_Mutation_p.G573N|BZRAP1_ENST00000268893.6_Missense_Mutation_p.G513N			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	573						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)	p.G573D(2)|p.G573S(2)|p.G573>?(2)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCAGGGGAGCCCGGCGGGAGG	0.624																																																	6	Substitution - Missense(4)|Complex(2)	kidney(6)																																								SO:0001583	missense	9256			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1717_1718delinsTT	17.37:g.56395795_56395796delinsTT	ENSP00000345824:p.Gly573Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	CCDS11605.1																																																																																				0.624	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1		NM_004758	
C1orf112	55732	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	169811586	169811586	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:169811586T>A	ENST00000286031.6	+	18	2454	c.1754T>A	c.(1753-1755)gTa>gAa	p.V585E	C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Missense_Mutation_p.V585E	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	585								p.V585E(1)		breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGCTTGCAGTATGTAATTCT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											161.0	153.0	156.0					1																	169811586		2203	4300	6503	SO:0001583	missense	55732			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1754T>A	1.37:g.169811586T>A	ENSP00000286031:p.Val585Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.536811	0.45176	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.47869	0.83;0.83	5.18	5.18	0.71444	.	0.226336	0.45361	D	0.000379	T	0.45296	0.1335	M	0.75447	2.3	0.28209	N	0.927003	P;P	0.42584	0.784;0.784	P;P	0.51615	0.675;0.675	T	0.50890	-0.8774	10	0.72032	D	0.01	-5.6691	8.0737	0.30704	0.0:0.0911:0.0:0.9089	.	527;585	B4DGF2;Q9NSG2	.;CA112_HUMAN	E	585	ENSP00000352276:V585E;ENSP00000286031:V585E	ENSP00000286031:V585E	V	+	2	0	C1orf112	168078210	0.931000	0.31567	0.044000	0.18714	0.402000	0.30811	3.606000	0.54095	2.081000	0.62600	0.533000	0.62120	GTA		0.408	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3		NM_018186	
CCDC173	129881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	170506866	170506866	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:170506866T>G	ENST00000447353.1	-	7	1230	c.1125A>C	c.(1123-1125)aaA>aaC	p.K375N		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	375								p.K369N(1)									CTGCAATTGTTTTTAATTCTG	0.318																																																	1	Substitution - Missense(1)	kidney(1)											104.0	89.0	94.0					2																	170506866		1809	4068	5877	SO:0001583	missense	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1125A>C	2.37:g.170506866T>G	ENSP00000391504:p.Lys375Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	T	11.87	1.767586	0.31320	.	.	ENSG00000154479	ENST00000447353	T	0.09538	2.97	5.42	3.01	0.34805	.	.	.	.	.	T	0.10637	0.0260	L	0.54323	1.7	0.28917	N	0.892378	B	0.10296	0.003	B	0.12837	0.008	T	0.20739	-1.0266	9	0.40728	T	0.16	.	4.9924	0.14220	0.1758:0.0873:0.0:0.7369	.	375	Q0VFZ6	CB077_HUMAN	N	375	ENSP00000391504:K375N	ENSP00000391504:K375N	K	-	3	2	C2orf77	170215112	0.974000	0.33945	0.897000	0.35233	0.936000	0.57629	0.439000	0.21575	0.358000	0.24211	0.456000	0.33151	AAA		0.318	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2		NM_001085447	
C3orf58	205428	broad.mit.edu	37	3	143691724	143691724	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr3:143691724G>T	ENST00000315691.3	+	1	1085	c.550G>T	c.(550-552)Gcg>Tcg	p.A184S	C3orf58_ENST00000441925.2_5'Flank|C3orf58_ENST00000495414.1_5'Flank|C3orf58_ENST00000493396.1_3'UTR	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	184					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)		p.A184S(1)|p.A184>?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCGCCGCTACGCGGAGACCAA	0.697																																																	2	Substitution - Missense(1)|Complex(1)	kidney(2)											8.0	8.0	8.0					3																	143691724		2144	4198	6342	SO:0001583	missense	205428			AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.550G>T	3.37:g.143691724G>T	ENSP00000320081:p.Ala184Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B2RCF2|B7Z1W3	Missense_Mutation	SNP	ENST00000315691.3	37	CCDS3130.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448247	0.84101	.	.	ENSG00000181744	ENST00000315691	T	0.33438	1.41	3.41	3.41	0.39046	.	0.000000	0.85682	U	0.000000	T	0.42245	0.1194	L	0.61387	1.9	0.80722	D	1	D	0.60575	0.988	P	0.53450	0.726	T	0.35176	-0.9799	10	0.28530	T	0.3	.	15.0174	0.71597	0.0:0.0:1.0:0.0	.	184	Q8NDZ4	CC058_HUMAN	S	184	ENSP00000320081:A184S	ENSP00000320081:A184S	A	+	1	0	C3orf58	145174414	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.701000	0.91331	1.752000	0.51891	0.561000	0.74099	GCG		0.697	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355038.1		NM_173552	
STPG2	285555	hgsc.bcm.edu	37	4	99064290	99064290	+	Silent	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:99064290C>A	ENST00000295268.3	-	1	101	c.12G>T	c.(10-12)cgG>cgT	p.R4R		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	4																	GGCGGGGAGCCCGATCATACA	0.572											OREG0016268	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													33.0	28.0	30.0					4																	99064290		2203	4300	6503	SO:0001819	synonymous_variant	0			BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.12G>T	4.37:g.99064290C>A		Somatic	1340	WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000295268.3	37	CCDS3645.1																																																																																				0.572	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1		NM_174952	
CAMSAP1	157922	broad.mit.edu	37	9	138715799	138715800	+	Frame_Shift_Ins	INS	-	-	T	rs148250832|rs201838505	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr9:138715799_138715800insT	ENST00000389532.4	-	10	1460_1461	c.1396_1397insA	c.(1396-1398)accfs	p.T466fs	CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000409386.3_Frame_Shift_Ins_p.T477fs|CAMSAP1_ENST00000312405.6_Frame_Shift_Ins_p.T188fs	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	466					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GACTCACCTGGTTTTTTTTTCT	0.46																																																	0																																										SO:0001589	frameshift_variant	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1397dupA	9.37:g.138715808_138715808dupT	ENSP00000374183:p.Thr466fs	Somatic		WXS	Illumina GAIIx	Phase_I	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Frame_Shift_Ins	INS	ENST00000389532.4	37	CCDS35176.2																																																																																				0.460	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2		XM_351857	
CDC14C	168448	broad.mit.edu	37	7	48964801	48964801	+	IGR	SNP	A	A	G	rs541886983		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr7:48964801A>G								AC004899.1 (73580 upstream) : AC010971.1 (304931 downstream)																							TATGAACACTATGAAAAAGCA	0.368													A|||	1	0.000199681	0.0	0.0	5008	,	,		20764	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	168448																															7.37:g.48964801A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.368									
CHST4	10164	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	71570904	71570904	+	Silent	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr16:71570904C>A	ENST00000338482.5	+	3	667	c.324C>A	c.(322-324)gtC>gtA	p.V108V	CHST4_ENST00000539698.3_Silent_p.V108V|RP11-510M2.5_ENST00000568523.1_RNA|CHST4_ENST00000572450.1_Silent_p.V108V|ZNF19_ENST00000568446.1_Intron			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	108					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.V108V(1)		cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						ACATGAGCGTCTTTGATGCCT	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											86.0	89.0	88.0					16																	71570904		2198	4300	6498	SO:0001819	synonymous_variant	10164			AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.324C>A	16.37:g.71570904C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IV46|Q9Y5R3	Silent	SNP	ENST00000338482.5	37	CCDS10902.1																																																																																				0.592	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4		NM_005769	
CHST5	23563	hgsc.bcm.edu	37	16	75564068	75564068	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr16:75564068C>T	ENST00000336257.3	-	3	1609	c.215G>A	c.(214-216)cGc>cAc	p.R72H	CHST5_ENST00000541075.1_Missense_Mutation_p.R78H|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	72					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						TGAGCCCGAGCGCCACGAGGA	0.667																																																	0													43.0	38.0	40.0					16																	75564068		2198	4300	6498	SO:0001583	missense	23563			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.215G>A	16.37:g.75564068C>T	ENSP00000338783:p.Arg72His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986655	0.53934	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	T;T	0.39406	1.08;1.08	2.73	2.73	0.32206	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.68796	0.3040	M	0.90870	3.155	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77094	-0.2715	10	0.87932	D	0	.	12.3965	0.55389	0.0:1.0:0.0:0.0	.	78;72	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	H	72;78	ENSP00000338783:R72H;ENSP00000441220:R78H	ENSP00000338783:R72H	R	-	2	0	CHST5	74121569	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	5.644000	0.67902	1.514000	0.48869	0.313000	0.20887	CGC		0.667	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2		NM_012126	
CHSY3	337876	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	129520380	129520380	+	Silent	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr5:129520380G>T	ENST00000305031.4	+	3	1903	c.1545G>T	c.(1543-1545)cgG>cgT	p.R515R		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	515					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.R515R(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GCAGAGGACGGCTCATTGACT	0.463																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	65.0	66.0					5																	129520380		2203	4300	6503	SO:0001819	synonymous_variant	337876			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1545G>T	5.37:g.129520380G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																				0.463	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1		NM_175856	
COBL	23242	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	51094361	51094361	+	Splice_Site	SNP	G	G	A	rs375317019		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr7:51094361G>A	ENST00000265136.7	-	11	3551	c.3386C>T	c.(3385-3387)aCg>aTg	p.T1129M	COBL_ENST00000395542.2_Splice_Site_p.T1211M	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1129	WH2 1. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.T1129M(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GTGTTCTGCCGTCTAGAATAT	0.557																																					NSCLC(189;2119 2138 12223 30818 34679)												1	Substitution - Missense(1)	kidney(1)						G	MET/THR	0,4406		0,0,2203	127.0	113.0	118.0		3386	2.3	0.2	7		118	2,8598	2.2+/-6.3	0,2,4298	no	missense-near-splice	COBL	NM_015198.3	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	1129/1262	51094361	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	23242			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3385-1C>T	7.37:g.51094361G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	G	4.368	0.067849	0.08436	0.0	2.33E-4	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.16	2.29	0.28610	Actin-binding WH2 (3);	0.494861	0.17127	N	0.185980	T	0.58623	0.2135	L	0.50333	1.59	0.22435	N	0.999104	D;B;B;B;B	0.76494	0.999;0.246;0.101;0.246;0.294	P;B;B;B;B	0.61397	0.888;0.043;0.04;0.043;0.094	T	0.47812	-0.9088	10	0.51188	T	0.08	.	7.2793	0.26302	0.3767:0.0:0.6233:0.0	.	1129;1186;1129;1211;671	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	M	1129;1021;1014;1211	ENSP00000265136:T1129M;ENSP00000401204:T1021M;ENSP00000413498:T1014M;ENSP00000378912:T1211M	ENSP00000265136:T1129M	T	-	2	0	COBL	51061855	0.035000	0.19736	0.214000	0.23707	0.008000	0.06430	0.117000	0.15583	0.157000	0.19338	-0.251000	0.11542	ACG		0.557	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1		NM_015198	Missense_Mutation
CNTNAP2	26047	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	146829477	146829477	+	Silent	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr7:146829477T>C	ENST00000361727.3	+	8	1740	c.1224T>C	c.(1222-1224)ggT>ggC	p.G408G		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	408	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.G408G(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACCCCAATGGTCTCCTGGTCT	0.483										HNSCC(39;0.1)																																							1	Substitution - coding silent(1)	kidney(1)											130.0	117.0	121.0					7																	146829477		2203	4300	6503	SO:0001819	synonymous_variant	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1224T>C	7.37:g.146829477T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	37	CCDS5889.1																																																																																				0.483	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			
COG1	9382	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	71197742	71197742	+	Silent	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr17:71197742T>C	ENST00000299886.4	+	7	1856	c.1776T>C	c.(1774-1776)atT>atC	p.I592I		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	592					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.I592I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			TACAGAGCATTGAAGAGGGTG	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											81.0	65.0	70.0					17																	71197742		2203	4300	6503	SO:0001819	synonymous_variant	9382				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1776T>C	17.37:g.71197742T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NPV9|Q9P2G6	Silent	SNP	ENST00000299886.4	37	CCDS11692.1																																																																																				0.587	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1			
CREBZF	58487	broad.mit.edu;ucsc.edu	37	11	85374911	85374911	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr11:85374911A>C	ENST00000527447.1	-	1	1235	c.1009T>G	c.(1009-1011)Tcg>Gcg	p.S337A	CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000531515.1_Intron|CREBZF_ENST00000398294.2_Missense_Mutation_p.S255A	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	337					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S337A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				AACTCCACCGACACCTTATCC	0.562											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(172;674 2044 9050 18334 41735)												1	Substitution - Missense(1)	kidney(1)											89.0	98.0	95.0					11																	85374911		1995	4155	6150	SO:0001583	missense	58487			AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.1009T>G	11.37:g.85374911A>C	ENSP00000433459:p.Ser337Ala	Somatic	1236	WXS	Illumina GAIIx	Phase_I	B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	ENST00000527447.1	37	CCDS41697.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.094571	0.76870	.	.	ENSG00000137504	ENST00000398294;ENST00000527447	.	.	.	5.43	5.43	0.79202	.	0.314863	0.21915	N	0.067260	T	0.75042	0.3796	L	0.59436	1.845	0.49798	D	0.999826	D	0.64830	0.994	D	0.70716	0.97	T	0.74153	-0.3757	8	.	.	.	-19.0833	15.3001	0.73940	1.0:0.0:0.0:0.0	.	337	Q9NS37	ZHANG_HUMAN	A	255;337	.	.	S	-	1	0	CREBZF	85052559	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.310000	0.89971	2.279000	0.76181	0.533000	0.62120	TCG		0.562	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2		NM_001039618	
CXCL11	6373	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	76956490	76956490	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:76956490G>T	ENST00000503860.1	-	3	445	c.67C>A	c.(67-69)Ccc>Acc	p.P23T	ART3_ENST00000341029.5_Intron|CXCL11_ENST00000306621.3_Missense_Mutation_p.P23T			O14625	CXL11_HUMAN	chemokine (C-X-C motif) ligand 11	23					cell-cell signaling (GO:0007267)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|regulation of cell proliferation (GO:0042127)|signal transduction (GO:0007165)|T cell chemotaxis (GO:0010818)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)	p.P23T(1)		kidney(1)|large_intestine(3)|lung(1)|skin(1)	6			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTGAACATGGGGAAGCCTAGA	0.423																																					Pancreas(31;57 931 1690 18027 37686)												1	Substitution - Missense(1)	kidney(1)											70.0	66.0	67.0					4																	76956490		2203	4300	6503	SO:0001583	missense	6373			U66096	CCDS3574.1	4q21	2013-02-25	2002-08-22	2002-08-23	ENSG00000169248	ENSG00000169248		"""Endogenous ligands"""	10638	protein-coding gene	gene with protein product		604852	"""small inducible cytokine subfamily B (Cys-X-Cys), member 11"""	SCYB9B, SCYB11		9730616	Standard	NM_005409		Approved	H174, b-R1, I-TAC, IP-9	uc003hjm.3	O14625	OTTHUMG00000130101	ENST00000503860.1:c.67C>A	4.37:g.76956490G>T	ENSP00000425819:p.Pro23Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q53YA3|Q92840	Missense_Mutation	SNP	ENST00000503860.1	37	CCDS3574.1	.	.	.	.	.	.	.	.	.	.	G	7.502	0.652924	0.14580	.	.	ENSG00000169248	ENST00000306621;ENST00000503860	T;T	0.42900	0.96;0.96	5.37	3.59	0.41128	Chemokine interleukin-8-like domain (1);	0.322125	0.24438	N	0.038527	T	0.25121	0.0610	.	.	.	0.21719	N	0.999573	P	0.46987	0.888	B	0.37601	0.254	T	0.08785	-1.0705	9	0.27785	T	0.31	-1.5064	8.1616	0.31202	0.0894:0.162:0.7486:0.0	.	23	O14625	CXL11_HUMAN	T	23	ENSP00000306884:P23T;ENSP00000425819:P23T	ENSP00000306884:P23T	P	-	1	0	CXCL11	77175514	0.995000	0.38212	0.538000	0.28064	0.178000	0.23041	0.944000	0.29043	1.364000	0.46038	0.557000	0.71058	CCC		0.423	CXCL11-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362816.1			
DAPK1	1612	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	90321652	90321652	+	Silent	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr9:90321652C>T	ENST00000408954.3	+	26	4001	c.3666C>T	c.(3664-3666)gtC>gtT	p.V1222V	DAPK1_ENST00000469640.2_Silent_p.V1247V|DAPK1_ENST00000358077.5_Silent_p.V1222V|DAPK1_ENST00000491893.1_Silent_p.V1156V|DAPK1_ENST00000472284.1_Silent_p.V1222V	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1222					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V1222V(1)|p.V1223V(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TTGAGAACGTCATGGCCACCA	0.637									Chronic Lymphocytic Leukemia, Familial Clustering of																																								2	Substitution - coding silent(2)	kidney(2)											34.0	39.0	37.0					9																	90321652		2176	4281	6457	SO:0001819	synonymous_variant	1612	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3666C>T	9.37:g.90321652C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	CCDS43842.1																																																																																				0.637	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1		NM_004938	
DBH	1621	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	136522203	136522203	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr9:136522203A>G	ENST00000393056.2	+	11	1586	c.1574A>G	c.(1573-1575)gAg>gGg	p.E525G	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	525					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.E525G(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	TTCAACAACGAGGATGTCTGC	0.612																																																	1	Substitution - Missense(1)	kidney(1)											135.0	100.0	112.0					9																	136522203		2203	4300	6503	SO:0001583	missense	1621			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1574A>G	9.37:g.136522203A>G	ENSP00000376776:p.Glu525Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	CCDS6977.2	.	.	.	.	.	.	.	.	.	.	A	6.736	0.504652	0.12822	.	.	ENSG00000123454	ENST00000393056	T	0.51071	0.72	5.07	2.71	0.32032	PHM/PNGase F domain (1);	0.481200	0.25280	N	0.031813	T	0.38983	0.1061	L	0.51422	1.61	0.36972	D	0.893867	B	0.11235	0.004	B	0.06405	0.002	T	0.28618	-1.0038	10	0.36615	T	0.2	-7.4821	9.2405	0.37493	0.8515:0.0:0.1485:0.0	.	525	P09172	DOPO_HUMAN	G	525	ENSP00000376776:E525G	ENSP00000376776:E525G	E	+	2	0	DBH	135512024	1.000000	0.71417	0.284000	0.24805	0.010000	0.07245	2.203000	0.42752	0.282000	0.22254	-0.415000	0.06103	GAG		0.612	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2		NM_000787	
DDR2	4921	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	162749936	162749936	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:162749936C>T	ENST00000367922.3	+	19	2906	c.2468C>T	c.(2467-2469)tCt>tTt	p.S823F	DDR2_ENST00000367921.3_Missense_Mutation_p.S823F|RN7SL861P_ENST00000473793.2_RNA	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	823	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S823F(1)		central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TGTCCTGACTCTGTGTATAAG	0.453																																					NSCLC(161;314 2006 8283 19651 23192)												1	Substitution - Missense(1)	kidney(1)											209.0	202.0	205.0					1																	162749936		2203	4300	6503	SO:0001583	missense	4921			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.2468C>T	1.37:g.162749936C>T	ENSP00000356899:p.Ser823Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469834	0.63625	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	D;D	0.83250	-1.7;-1.7	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.259980	0.41500	D	0.000861	T	0.63534	0.2519	N	0.21545	0.675	0.42680	D	0.993548	P	0.37636	0.603	B	0.34873	0.191	T	0.73512	-0.3959	9	0.66056	D	0.02	.	13.9968	0.64407	0.0:0.8485:0.1515:0.0	.	823	Q16832	DDR2_HUMAN	F	823	ENSP00000356899:S823F;ENSP00000356898:S823F	ENSP00000356898:S823F	S	+	2	0	DDR2	161016560	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.529000	0.53532	2.671000	0.90904	0.650000	0.86243	TCT		0.453	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2		NM_006182	
DIP2C	22982	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	445051	445051	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:445051T>A	ENST00000280886.6	-	10	1345	c.1258A>T	c.(1258-1260)Aag>Tag	p.K420*	DIP2C_ENST00000381496.3_Nonsense_Mutation_p.K313*	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	420						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.K420*(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTCCTTACCTTCCTGGTGAGC	0.622																																																	1	Substitution - Nonsense(1)	kidney(1)											68.0	58.0	62.0					10																	445051		2203	4300	6503	SO:0001587	stop_gained	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1258A>T	10.37:g.445051T>A	ENSP00000280886:p.Lys420*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPI5|Q5SS78	Nonsense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	t	41	8.972987	0.99021	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.3845	15.4178	0.74983	0.0:0.0:0.0:1.0	.	.	.	.	X	420;313	.	ENSP00000280886:K420X	K	-	1	0	DIP2C	435051	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	7.785000	0.85724	2.119000	0.64992	0.456000	0.33151	AAG		0.622	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1		NM_014974	
DNASE2B	58511	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	84864297	84864297	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:84864297T>C	ENST00000370665.3	+	1	83	c.50T>C	c.(49-51)cTc>cCc	p.L17P		NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	17					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)	p.L17P(1)		endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		TTTGCTTTGCTCTTCCTTGGC	0.453																																					Pancreas(54;788 1175 11852 16034 30034)												1	Substitution - Missense(1)	kidney(1)											227.0	233.0	231.0					1																	84864297		1998	4176	6174	SO:0001583	missense	58511			AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.50T>C	1.37:g.84864297T>C	ENSP00000359699:p.Leu17Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Missense_Mutation	SNP	ENST00000370665.3	37	CCDS44167.1	.	.	.	.	.	.	.	.	.	.	T	8.112	0.779071	0.16120	.	.	ENSG00000137976	ENST00000370665	T	0.17854	2.25	5.23	5.23	0.72850	.	0.332317	0.28098	N	0.016616	T	0.17280	0.0415	M	0.72894	2.215	0.80722	D	1	P	0.46395	0.877	P	0.46718	0.525	T	0.01235	-1.1410	10	0.87932	D	0	-1.2509	11.6871	0.51492	0.0:0.0:0.0:1.0	.	17	Q8WZ79	DNS2B_HUMAN	P	17	ENSP00000359699:L17P	ENSP00000359699:L17P	L	+	2	0	DNASE2B	84636885	0.947000	0.32204	0.128000	0.21923	0.008000	0.06430	2.811000	0.47986	2.324000	0.78689	0.533000	0.62120	CTC		0.453	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027248.1		NM_021233	
DPY19L3	147991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	32968514	32968514	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:32968514A>G	ENST00000342179.5	+	17	1999	c.1784A>G	c.(1783-1785)aAc>aGc	p.N595S	DPY19L3_ENST00000392250.2_Missense_Mutation_p.N595S|DPY19L3_ENST00000586987.1_Missense_Mutation_p.N595S	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	595						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.N595S(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					ACCCTAACCAACCACCCGCAC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											125.0	107.0	113.0					19																	32968514		2203	4300	6503	SO:0001583	missense	147991				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1784A>G	19.37:g.32968514A>G	ENSP00000344937:p.Asn595Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.741810	0.69304	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.58506	0.33;0.33	5.4	5.4	0.78164	.	0.112895	0.64402	D	0.000016	T	0.72220	0.3433	M	0.62209	1.925	0.53688	D	0.999978	D	0.89917	1.0	D	0.87578	0.998	T	0.69702	-0.5074	10	0.27785	T	0.31	-16.2025	15.4079	0.74893	1.0:0.0:0.0:0.0	.	595	Q6ZPD9	D19L3_HUMAN	S	595	ENSP00000376081:N595S;ENSP00000344937:N595S	ENSP00000344937:N595S	N	+	2	0	DPY19L3	37660354	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.310000	0.72830	2.046000	0.60703	0.460000	0.39030	AAC		0.582	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1		NM_207325	
DUSP10	11221	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	221912420	221912420	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:221912420C>T	ENST00000366899.3	-	2	905	c.667G>A	c.(667-669)Gac>Aac	p.D223N	DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000544095.1_5'Flank|DUSP10_ENST00000323825.3_Intron	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	223	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.D223N(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		TTGAAAGAGTCCTTGCCTTCC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											68.0	73.0	71.0					1																	221912420		2203	4300	6503	SO:0001583	missense	11221			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.667G>A	1.37:g.221912420C>T	ENSP00000355866:p.Asp223Asn	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	ENST00000366899.3	37	CCDS1528.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934207	0.73442	.	.	ENSG00000143507	ENST00000366899;ENST00000418487	T	0.43688	0.94	5.44	5.44	0.79542	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.46870	0.1415	L	0.46157	1.445	0.80722	D	1	B	0.33964	0.434	B	0.41036	0.346	T	0.37033	-0.9723	10	0.40728	T	0.16	.	19.2863	0.94072	0.0:1.0:0.0:0.0	.	223	Q9Y6W6	DUS10_HUMAN	N	223;168	ENSP00000355866:D223N	ENSP00000355866:D223N	D	-	1	0	DUSP10	219979043	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.999000	0.70665	2.558000	0.86282	0.591000	0.81541	GAC		0.473	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1		NM_007207	
EBF3	253738	broad.mit.edu;hgsc.bcm.edu	37	10	131761928	131761928	+	Silent	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:131761928G>A	ENST00000355311.5	-	1	177	c.105C>T	c.(103-105)ggC>ggT	p.G35G	EBF3_ENST00000368648.3_Silent_p.G35G			Q9H4W6	COE3_HUMAN	early B-cell factor 3	35					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G35G(2)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CGTCCACCACGCCCGCCGTGT	0.761																																																	2	Substitution - coding silent(2)	kidney(2)											22.0	26.0	25.0					10																	131761928		2187	4283	6470	SO:0001819	synonymous_variant	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.105C>T	10.37:g.131761928G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	37																																																																																					0.761	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2		NM_001005463	
F8	2157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	154157680	154157680	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chrX:154157680A>T	ENST00000360256.4	-	14	4585	c.4385T>A	c.(4384-4386)cTt>cAt	p.L1462H		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1462	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.L1462H(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGCTAAAGAAAGGTTATTTTT	0.418																																																	2	Substitution - Missense(2)	kidney(2)											85.0	82.0	83.0					X																	154157680		2203	4300	6503	SO:0001583	missense	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4385T>A	X.37:g.154157680A>T	ENSP00000353393:p.Leu1462His	Somatic		WXS	Illumina HiSeq	Phase_I	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	a	10.11	1.261110	0.23051	.	.	ENSG00000185010	ENST00000360256	D	0.99259	-5.64	5.03	-4.28	0.03732	.	1.107720	0.06756	N	0.780974	D	0.98419	0.9474	M	0.72118	2.19	0.09310	N	1	D	0.63880	0.993	P	0.53185	0.72	D	0.96969	0.9707	10	0.27785	T	0.31	-0.0219	5.6814	0.17778	0.3008:0.4283:0.2709:0.0	.	1462	P00451	FA8_HUMAN	H	1462	ENSP00000353393:L1462H	ENSP00000353393:L1462H	L	-	2	0	F8	153810874	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.081000	0.14823	-0.660000	0.05352	-0.318000	0.08688	CTT		0.418	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			
FAM178A	55719	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	102719193	102719193	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:102719193C>A	ENST00000238961.4	+	19	3968	c.3426C>A	c.(3424-3426)gaC>gaA	p.D1142E	FAM178A_ENST00000370269.3_Missense_Mutation_p.D1142E	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	1142						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.D1142E(1)									AGGTGAAAGACTTGGTCGCCA	0.358																																																	1	Substitution - Missense(1)	kidney(1)											188.0	196.0	193.0					10																	102719193		2203	4300	6503	SO:0001583	missense	55719			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.3426C>A	10.37:g.102719193C>A	ENSP00000238961:p.Asp1142Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	ENST00000238961.4	37	CCDS7500.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445987	0.84101	.	.	ENSG00000119906	ENST00000238961;ENST00000370269	T;T	0.40756	1.03;1.02	5.98	4.99	0.66335	.	0.245484	0.40064	N	0.001183	T	0.50137	0.1598	M	0.62723	1.935	0.44880	D	0.997897	D;D	0.65815	0.991;0.995	P;P	0.55713	0.782;0.782	T	0.52449	-0.8574	10	0.72032	D	0.01	-12.5499	7.0266	0.24944	0.0:0.8615:0.0:0.1385	.	1142;1142	Q8IX21;B1AL17	F178A_HUMAN;.	E	1142	ENSP00000238961:D1142E;ENSP00000359292:D1142E	ENSP00000238961:D1142E	D	+	3	2	FAM178A	102709183	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	0.744000	0.26245	2.838000	0.97847	0.591000	0.81541	GAC		0.358	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3			
FBLN1	2192	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	45938163	45938163	+	Splice_Site	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr22:45938163G>A	ENST00000327858.6	+	10	1290	c.1195G>A	c.(1195-1197)Gat>Aat	p.D399N	FBLN1_ENST00000442170.2_Splice_Site_p.D399N|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000340923.5_Splice_Site_p.D399N|FBLN1_ENST00000348697.2_Splice_Site_p.D399N|FBLN1_ENST00000262722.7_Splice_Site_p.D399N|FBLN1_ENST00000402984.3_Splice_Site_p.D437N	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	399	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Self-association and FN1-binding; calcium is necessary for homotypic binding, but not for heterotypic binding.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.D399N(3)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GATGTGTGTCGGTGCGTGGGG	0.612																																																	3	Substitution - Missense(3)	kidney(3)											52.0	56.0	55.0					22																	45938163		2203	4300	6503	SO:0001630	splice_region_variant	2192				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1195+1G>A	22.37:g.45938163G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	33	5.204492	0.95033	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923	D;D;D;D;D;D	0.88975	-2.25;-2.45;-2.45;-2.3;-2.45;-2.45	5.33	5.33	0.75918	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.95695	0.8600	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;1.0;0.999	D	0.96234	0.9170	10	0.87932	D	0	.	18.9792	0.92748	0.0:0.0:1.0:0.0	.	437;399;399;399	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	N	399;437;399;399;399;399	ENSP00000262723:D399N;ENSP00000385521:D437N;ENSP00000262722:D399N;ENSP00000331544:D399N;ENSP00000393812:D399N;ENSP00000342212:D399N	ENSP00000262722:D399N	D	+	1	0	FBLN1	44316827	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	9.294000	0.96088	2.644000	0.89710	0.655000	0.94253	GAT		0.612	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1		NM_006486	Missense_Mutation
FBN2	2201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	127782277	127782277	+	Silent	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr5:127782277G>A	ENST00000508053.1	-	13	1823	c.849C>T	c.(847-849)atC>atT	p.I283I	FBN2_ENST00000508989.1_Silent_p.I250I|FBN2_ENST00000262464.4_Silent_p.I283I			P35556	FBN2_HUMAN	fibrillin 2	283	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.I283I(4)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATATCCCTGGGATAGCCTGGC	0.383																																																	4	Substitution - coding silent(4)	prostate(2)|kidney(2)											120.0	111.0	114.0					5																	127782277		2203	4300	6503	SO:0001819	synonymous_variant	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.849C>T	5.37:g.127782277G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																				0.383	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
FLNA	2316	broad.mit.edu	37	X	153599613	153599613	+	Start_Codon_Del	DEL	T	T	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chrX:153599613delT	ENST00000369850.3	-	0	237				FLNA_ENST00000422373.1_Start_Codon_Del|FLNA_ENST00000344736.4_Start_Codon_Del|FLNA_ENST00000360319.4_Start_Codon_Del	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha						actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GAGCTACTCATTTTGAGGCGC	0.716											OREG0003594	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													5.0	7.0	6.0					X																	153599613		1749	3748	5497	SO:0001582	initiator_codon_variant	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712		X.37:g.153599613delT		Somatic	1756	WXS	Illumina GAIIx	Phase_I	E9KL45|Q5HY53|Q5HY55|Q8NF52	Frame_Shift_Del	DEL	ENST00000369850.3	37	CCDS48194.1																																																																																				0.716	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			
FOLH1B	219595	broad.mit.edu;hgsc.bcm.edu	37	11	89429850	89429850	+	RNA	SNP	G	G	C	rs141697840		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr11:89429850G>C	ENST00000532352.1	+	0	1859							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.A366P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TCTGGAAAGAGCATTTATTGA	0.308																																																	1	Substitution - Missense(1)	kidney(1)											102.0	97.0	98.0					11																	89429850		2201	4298	6499			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89429850G>C		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000532352.1	37																																																																																					0.308	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1		NM_153696	
GALNT7	51809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	174219381	174219381	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:174219381C>A	ENST00000265000.4	+	6	1164	c.1081C>A	c.(1081-1083)Ctc>Atc	p.L361I	GALNT7_ENST00000512285.1_3'UTR	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	361					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L361I(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTGGAGTATGCTCTGGAAACG	0.438																																																	1	Substitution - Missense(1)	kidney(1)											85.0	85.0	85.0					4																	174219381		2203	4300	6503	SO:0001583	missense	51809			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1081C>A	4.37:g.174219381C>A	ENSP00000265000:p.Leu361Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	ENST00000265000.4	37	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893909	0.91889	.	.	ENSG00000109586	ENST00000265000	T	0.60040	0.22	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	L	0.54863	1.705	0.80722	D	1	D	0.59357	0.985	D	0.63283	0.913	T	0.64927	-0.6292	10	0.28530	T	0.3	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	361	Q86SF2	GALT7_HUMAN	I	361	ENSP00000265000:L361I	ENSP00000265000:L361I	L	+	1	0	GALNT7	174455956	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.680000	0.91292	0.655000	0.94253	CTC		0.438	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2		NM_017423	
GJA10	84694	hgsc.bcm.edu	37	6	90604514	90604514	+	Silent	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr6:90604514G>A	ENST00000369352.1	+	1	327	c.327G>A	c.(325-327)agG>agA	p.R109R		NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	109					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		ACAGGCAGAGGAAAAAGTCAC	0.463																																																	0													76.0	72.0	74.0					6																	90604514		2203	4300	6503	SO:0001819	synonymous_variant	84694			AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.327G>A	6.37:g.90604514G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	ENST00000369352.1	37	CCDS5025.1																																																																																				0.463	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1		NM_032602	
GLCE	26035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	69561171	69561171	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr15:69561171C>G	ENST00000261858.2	+	5	1670	c.1442C>G	c.(1441-1443)tCt>tGt	p.S481C	GLCE_ENST00000559420.2_Missense_Mutation_p.S417C	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	481					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)	p.S481C(1)		NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AAGTTTCTATCTGAGCAGCAT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											57.0	64.0	62.0					15																	69561171		2200	4298	6498	SO:0001583	missense	26035			AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1442C>G	15.37:g.69561171C>G	ENSP00000261858:p.Ser481Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	37	CCDS32277.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278551	0.40294	.	.	ENSG00000138604	ENST00000261858	T	0.48201	0.82	5.01	5.01	0.66863	.	0.061993	0.64402	D	0.000002	T	0.67571	0.2907	M	0.75777	2.31	0.80722	D	1	D	0.65815	0.995	D	0.64321	0.924	T	0.71842	-0.4470	10	0.72032	D	0.01	-16.3884	17.2305	0.86983	0.0:1.0:0.0:0.0	.	481	O94923	GLCE_HUMAN	C	481	ENSP00000261858:S481C	ENSP00000261858:S481C	S	+	2	0	GLCE	67348225	1.000000	0.71417	0.277000	0.24703	0.125000	0.20455	7.663000	0.83820	2.479000	0.83701	0.557000	0.71058	TCT		0.378	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_015554	
GLIPR1L1	256710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	75737689	75737689	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr12:75737689T>G	ENST00000378695.4	+	2	481	c.391T>G	c.(391-393)Tgc>Ggc	p.C131G	CAPS2_ENST00000442339.2_Intron|GLIPR1L1_ENST00000312442.2_Missense_Mutation_p.C131G			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	131	SCP.				binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)		p.C131G(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						TAGTCTATCATGCTCCAGAGT	0.328																																																	1	Substitution - Missense(1)	kidney(1)											87.0	86.0	86.0					12																	75737689		2203	4300	6503	SO:0001583	missense	256710			BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.391T>G	12.37:g.75737689T>G	ENSP00000367967:p.Cys131Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q96L06	Missense_Mutation	SNP	ENST00000378695.4	37		.	.	.	.	.	.	.	.	.	.	T	18.19	3.568958	0.65765	.	.	ENSG00000173401	ENST00000378695;ENST00000312442	T;T	0.06687	3.27;3.27	4.69	4.69	0.59074	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.28466	0.0704	M	0.81179	2.53	0.52501	D	0.999951	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.01935	-1.1244	10	0.40728	T	0.16	.	11.96	0.53003	0.0:0.0:0.0:1.0	.	131;131	Q6UWM5;Q6UWM5-2	GPRL1_HUMAN;.	G	131	ENSP00000367967:C131G;ENSP00000310770:C131G	ENSP00000310770:C131G	C	+	1	0	GLIPR1L1	74023956	1.000000	0.71417	0.367000	0.25926	0.270000	0.26580	5.165000	0.64959	1.876000	0.54355	0.459000	0.35465	TGC		0.328	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405714.1		NM_152779	
GPR98	84059	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	89971958	89971958	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr5:89971958T>A	ENST00000405460.2	+	25	5471	c.5375T>A	c.(5374-5376)aTc>aAc	p.I1792N	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1792	Calx-beta 12. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.I1792N(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTCATAAACATCACTGATAAT	0.299																																																	1	Substitution - Missense(1)	kidney(1)											40.0	39.0	39.0					5																	89971958		1804	4058	5862	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5375T>A	5.37:g.89971958T>A	ENSP00000384582:p.Ile1792Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337936	0.81911	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.41400	1.0	5.78	5.78	0.91487	Na-Ca exchanger/integrin-beta4 (2);	0.046152	0.85682	D	0.000000	T	0.75191	0.3816	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83396	0.0020	10	0.87932	D	0	.	15.7732	0.78187	0.0:0.0:0.0:1.0	.	1792	Q8WXG9	GPR98_HUMAN	N	1792	ENSP00000384582:I1792N	ENSP00000296619:I1792N	I	+	2	0	GPR98	90007714	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	7.875000	0.87205	2.199000	0.70637	0.533000	0.62120	ATC		0.299	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2		NM_032119	
HDAC6	10013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	48674583	48674583	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chrX:48674583T>C	ENST00000334136.5	+	18	1707	c.1529T>C	c.(1528-1530)aTc>aCc	p.I510T	HDAC6_ENST00000444343.2_Missense_Mutation_p.I524T|HDAC6_ENST00000376619.2_Missense_Mutation_p.I510T			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	510	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.I510T(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	ATCTTGCGGATCATGTGCCGT	0.647																																					Pancreas(112;205 1675 2305 8976 15959)												1	Substitution - Missense(1)	kidney(1)											90.0	72.0	78.0					X																	48674583		2203	4300	6503	SO:0001583	missense	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1529T>C	X.37:g.48674583T>C	ENSP00000334061:p.Ile510Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.368102	0.61513	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	T;T;T	0.72282	-0.64;-0.64;-0.64	5.85	5.85	0.93711	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.83571	0.5283	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.85701	0.1313	10	0.87932	D	0	-26.025	12.8912	0.58071	0.0:0.0:0.0:1.0	.	500;158;510	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	T	524;510;510;510	ENSP00000398566:I524T;ENSP00000334061:I510T;ENSP00000365804:I510T	ENSP00000334061:I510T	I	+	2	0	HDAC6	48559527	1.000000	0.71417	0.135000	0.22099	0.323000	0.28346	5.194000	0.65125	1.952000	0.56665	0.481000	0.45027	ATC		0.647	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2		NM_006044	
HIPK1	204851	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	114483183	114483183	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:114483183C>A	ENST00000369558.1	+	2	410	c.178C>A	c.(178-180)Cac>Aac	p.H60N	HIPK1_ENST00000369561.4_Missense_Mutation_p.H60N|HIPK1_ENST00000369559.4_Missense_Mutation_p.H60N|HIPK1_ENST00000369554.2_Missense_Mutation_p.H60N|HIPK1_ENST00000426820.2_Missense_Mutation_p.H60N|HIPK1_ENST00000369555.2_Missense_Mutation_p.H60N			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	60					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.H60N(2)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAACTCCTCTCACCAGGTAGC	0.537																																																	2	Substitution - Missense(2)	kidney(2)											207.0	209.0	208.0					1																	114483183		2203	4300	6503	SO:0001583	missense	204851			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.178C>A	1.37:g.114483183C>A	ENSP00000358571:p.His60Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.030038	0.35797	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.85;0.88;0.86;0.86;0.88;0.86;0.96;0.95	5.22	4.29	0.51040	.	0.083034	0.50627	D	0.000114	T	0.15003	0.0362	N	0.08118	0	0.80722	D	1	B;B	0.31817	0.231;0.341	B;B	0.32762	0.034;0.152	T	0.06445	-1.0826	10	0.27785	T	0.31	.	14.9969	0.71439	0.1435:0.8565:0.0:0.0	.	60;60	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	N	131;60;60;60;60;60;60;60;60	ENSP00000407442:H131N;ENSP00000358572:H60N;ENSP00000409673:H60N;ENSP00000358567:H60N;ENSP00000358568:H60N;ENSP00000358571:H60N;ENSP00000358574:H60N;ENSP00000422322:H60N;ENSP00000426695:H60N	ENSP00000358567:H60N	H	+	1	0	HIPK1	114284706	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.882000	0.63121	1.151000	0.42436	0.650000	0.86243	CAC		0.537	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1		NM_198268	
HIPK2	28996	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	139415959	139415959	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr7:139415959T>C	ENST00000406875.3	-	2	969	c.875A>G	c.(874-876)aAg>aGg	p.K292R	HIPK2_ENST00000342645.6_Missense_Mutation_p.K292R|HIPK2_ENST00000428878.2_Missense_Mutation_p.K292R	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	292	Interaction with DAXX.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.K292R(2)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					GGGGCTAAACTTGTTTTGCTT	0.507																																																	2	Substitution - Missense(2)	kidney(2)											149.0	134.0	138.0					7																	139415959		1568	3582	5150	SO:0001583	missense	28996			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.875A>G	7.37:g.139415959T>C	ENSP00000385571:p.Lys292Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	T	22.2	4.255474	0.80135	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.65549	-0.16;-0.16;-0.16	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.79799	0.4508	.	.	.	0.53688	D	0.999972	D;D	0.76494	0.999;0.982	D;P	0.81914	0.995;0.831	T	0.82782	-0.0287	8	0.66056	D	0.02	.	15.211	0.73225	0.0:0.0:0.0:1.0	.	292;292	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	R	292	ENSP00000385571:K292R;ENSP00000413724:K292R;ENSP00000343108:K292R	ENSP00000343108:K292R	K	-	2	0	HIPK2	139062445	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.040000	0.89188	1.986000	0.57962	0.482000	0.46254	AAG		0.507	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3		NM_022740	
HMCN1	83872	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	186147782	186147782	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:186147782A>T	ENST00000271588.4	+	104	16407	c.16178A>T	c.(16177-16179)cAt>cTt	p.H5393L	HMCN1_ENST00000367492.2_Intron|GS1-174L6.4_ENST00000428391.1_RNA	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5393					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.H5393L(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGTACTCACATCTCTACAGC	0.453																																																	1	Substitution - Missense(1)	kidney(1)											199.0	192.0	194.0					1																	186147782		2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16178A>T	1.37:g.186147782A>T	ENSP00000271588:p.His5393Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845303	0.32606	.	.	ENSG00000143341	ENST00000271588	T	0.63255	-0.03	5.56	4.44	0.53790	Growth factor, receptor (1);	0.606540	0.18885	N	0.128474	T	0.40171	0.1106	N	0.08118	0	0.80722	D	1	B	0.21520	0.057	B	0.14023	0.01	T	0.19516	-1.0303	10	0.39692	T	0.17	.	10.1308	0.42678	0.9243:0.0:0.0757:0.0	.	5393	Q96RW7	HMCN1_HUMAN	L	5393	ENSP00000271588:H5393L	ENSP00000271588:H5393L	H	+	2	0	HMCN1	184414405	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.425000	0.66470	1.052000	0.40392	0.533000	0.62120	CAT		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
HMOX1	3162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	35783139	35783139	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr22:35783139G>T	ENST00000216117.8	+	3	945	c.606G>T	c.(604-606)gaG>gaT	p.E202D		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	202					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.E202D(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	TGATAGAAGAGGCCAAGACTG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											51.0	48.0	49.0					22																	35783139		2203	4300	6503	SO:0001583	missense	3162				CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.606G>T	22.37:g.35783139G>T	ENSP00000216117:p.Glu202Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000216117.8	37	CCDS13914.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014498	0.54468	.	.	ENSG00000100292	ENST00000216117	T	0.34859	1.34	5.71	3.6	0.41247	Haem oxygenase-like, multi-helical (2);	0.000000	0.85682	D	0.000000	T	0.68650	0.3024	H	0.96547	3.84	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.76487	-0.2941	10	0.87932	D	0	-39.4503	10.1113	0.42563	0.2652:0.0:0.7348:0.0	.	202	P09601	HMOX1_HUMAN	D	202	ENSP00000216117:E202D	ENSP00000216117:E202D	E	+	3	2	HMOX1	34113139	1.000000	0.71417	0.999000	0.59377	0.046000	0.14306	1.900000	0.39828	1.417000	0.47077	0.655000	0.94253	GAG		0.602	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320657.1			
IL2RA	3559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	6067802	6067802	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:6067802C>T	ENST00000379959.3	-	2	424	c.251G>A	c.(250-252)aGc>aAc	p.S84N	IL2RA_ENST00000256876.6_Missense_Mutation_p.S84N|IL2RA_ENST00000379954.1_Missense_Mutation_p.S84N|RP11-536K7.5_ENST00000440436.1_RNA	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	84	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)	p.S84N(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CTTACCAGAGCTTGTGCATTG	0.468																																																	1	Substitution - Missense(1)	kidney(1)											108.0	102.0	104.0					10																	6067802		2203	4300	6503	SO:0001583	missense	3559			X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.251G>A	10.37:g.6067802C>T	ENSP00000369293:p.Ser84Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	CCDS7076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.74|13.74	2.326183|2.326183	0.41197|0.41197	.|.	.|.	ENSG00000134460|ENSG00000134460	ENST00000447847|ENST00000379959;ENST00000397240;ENST00000379954;ENST00000256876	.|T;T;T	.|0.46451	.|1.48;0.87;1.47	4.61|4.61	1.46|1.46	0.22682|0.22682	.|Complement control module (1);Sushi/SCR/CCP (1);	.|0.778944	.|0.12201	.|N	.|0.490268	T|T	0.37945|0.37945	0.1022|0.1022	L|L	0.58101|0.58101	1.795|1.795	0.09310|0.09310	N|N	1|1	.|B;P;P	.|0.50066	.|0.172;0.905;0.931	.|B;P;B	.|0.44359	.|0.015;0.447;0.398	T|T	0.22730|0.22730	-1.0208|-1.0208	5|10	.|0.49607	.|T	.|0.09	-38.0083|-38.0083	4.8998|4.8998	0.13769|0.13769	0.3762:0.5224:0.0:0.1014|0.3762:0.5224:0.0:0.1014	.|.	.|84;70;84	.|Q5W005;E9PF94;P01589	.|.;.;IL2RA_HUMAN	T|N	55|84;70;84;84	.|ENSP00000369293:S84N;ENSP00000369287:S84N;ENSP00000256876:S84N	.|ENSP00000256876:S84N	A|S	-|-	1|2	0|0	IL2RA|IL2RA	6107808|6107808	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.007000|0.007000	0.05969|0.05969	0.152000|0.152000	0.16302|0.16302	0.635000|0.635000	0.30488|0.30488	0.585000|0.585000	0.79938|0.79938	GCT|AGC		0.468	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1		NM_000417	
HNRNPA3P1	10151	broad.mit.edu	37	10	44285777	44285777	+	IGR	SNP	T	T	C	rs3750724	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:44285777T>C								RP11-272J7.4 (11504 upstream) : LINC00619 (54976 downstream)																							CTCCCCCCAGTGGCGACGGCG	0.527													c|||	2268	0.452875	0.5567	0.415	5008	,	,		16074	0.627		0.327	False		,,,				2504	0.2894																0																																										SO:0001628	intergenic_variant	10151																															10.37:g.44285777T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.527									
KIAA1683	80726	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	18376414	18376414	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:18376414G>C	ENST00000600328.3	-	3	2129	c.1936C>G	c.(1936-1938)Cac>Gac	p.H646D	KIAA1683_ENST00000600359.3_Missense_Mutation_p.H600D|KIAA1683_ENST00000392413.4_Missense_Mutation_p.H646D			Q9H0B3	K1683_HUMAN	KIAA1683	646						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.H646D(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ACATACACGTGAGGTGGCTTG	0.577																																																	2	Substitution - Missense(2)	kidney(2)											74.0	66.0	69.0					19																	18376414		2203	4300	6503	SO:0001583	missense	80726			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.1936C>G	19.37:g.18376414G>C	ENSP00000470780:p.His646Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	G	8.230	0.804509	0.16467	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634	T;T;T	0.03689	3.92;3.92;3.84	4.36	0.919	0.19392	.	1.105830	0.07154	N	0.849612	T	0.03095	0.0091	L	0.36672	1.1	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.12837	0.008;0.008	T	0.49762	-0.8905	10	0.12766	T	0.61	-2.006	3.265	0.06861	0.2263:0.0:0.556:0.2177	.	646;646	E9PDE0;Q9H0B3	.;K1683_HUMAN	D	646;646;600	ENSP00000376213:H646D;ENSP00000352774:H646D;ENSP00000404501:H600D	ENSP00000352774:H646D	H	-	1	0	KIAA1683	18237414	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	0.948000	0.29096	0.359000	0.24239	-0.136000	0.14681	CAC		0.577	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3			
CERS3	204219	broad.mit.edu;hgsc.bcm.edu	37	15	100943022	100943022	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr15:100943022C>G	ENST00000394113.1	-	14	1738	c.1048G>C	c.(1048-1050)Gaa>Caa	p.E350Q	CERS3_ENST00000560944.1_5'UTR|RP11-168G16.2_ENST00000560643.1_RNA|CERS3_ENST00000538112.2_Missense_Mutation_p.E350Q|CERS3_ENST00000284382.4_Missense_Mutation_p.E350Q|RP11-168G16.2_ENST00000560718.1_RNA			Q8IU89	CERS3_HUMAN	ceramide synthase 3	350	Poly-Glu.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.E350Q(1)									tcttcctcttcctcttcctct	0.483																																																	1	Substitution - Missense(1)	kidney(1)											115.0	86.0	96.0					15																	100943022		2203	4300	6503	SO:0001583	missense	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.1048G>C	15.37:g.100943022C>G	ENSP00000377672:p.Glu350Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	.	.	.	.	.	.	.	.	.	.	C	1.860	-0.462969	0.04476	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	T;T	0.08193	3.12;3.12	3.29	2.36	0.29203	.	0.560003	0.16831	N	0.197775	T	0.14874	0.0359	M	0.83483	2.645	0.09310	N	1	P	0.51933	0.949	P	0.46825	0.528	T	0.10064	-1.0646	10	0.37606	T	0.19	.	6.6584	0.23000	0.0:0.8624:0.0:0.1376	.	350	Q8IU89	CERS3_HUMAN	Q	350;361;350	ENSP00000284382:E350Q;ENSP00000437640:E350Q	ENSP00000284382:E350Q	E	-	1	0	CERS3	98760545	0.032000	0.19561	0.235000	0.24058	0.001000	0.01503	1.263000	0.33004	0.696000	0.31696	-0.157000	0.13467	GAA		0.483	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4		NM_178842	
LCOR	84458	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	98715214	98715214	+	Silent	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:98715214A>G	ENST00000371097.4	+	8	1383	c.837A>G	c.(835-837)gtA>gtG	p.V279V	LCOR_ENST00000540664.1_Silent_p.V279V|LCOR_ENST00000498444.1_Intron|LCOR_ENST00000356016.3_Silent_p.V279V|LCOR_ENST00000371103.3_Silent_p.V279V			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	279					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V279V(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GCTCTTTGGTAATGGGTTCAC	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											73.0	76.0	75.0					10																	98715214		2203	4300	6503	SO:0001819	synonymous_variant	84458				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.837A>G	10.37:g.98715214A>G		Somatic		WXS	Illumina HiSeq	Phase_I	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Silent	SNP	ENST00000371097.4	37	CCDS7451.1																																																																																				0.428	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2			
LILRB3	11025	hgsc.bcm.edu	37	19	54726241	54726241	+	Missense_Mutation	SNP	C	C	T	rs77279742	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:54726241C>T	ENST00000391750.1	-	4	400	c.264G>A	c.(262-264)atG>atA	p.M88I	LILRA6_ENST00000391735.3_Intron|LILRB3_ENST00000346401.6_Missense_Mutation_p.M88I|LILRB3_ENST00000245620.9_Missense_Mutation_p.M88I|LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000407860.2_Intron|LILRB3_ENST00000424807.1_Missense_Mutation_p.M88I|LILRA6_ENST00000270464.5_Intron|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRB3_ENST00000469273.1_5'Flank			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	88	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGTGCTCTGTCATGGATGGGA	0.562													.|||	2272	0.453674	0.5325	0.4265	5008	,	,		12679	0.4871		0.4046	False		,,,				2504	0.3824																0								C	ILE/MET,ILE/MET	2307,1735		841,625,555	85.0	121.0	109.0		264,264	0.8	0.0	19	dbSNP_131	109	3530,4528		697,2136,1196	no	missense,missense	LILRB3	NM_001081450.1,NM_006864.2	10,10	1538,2761,1751	TT,TC,CC		43.8074,42.9243,48.2397	benign,benign	88/633,88/632	54726241	5837,6263	2021	4029	6050	SO:0001583	missense	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.264G>A	19.37:g.54726241C>T	ENSP00000375630:p.Met88Ile	Somatic		WXS	Illumina HiSeq	Phase_I	C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	ENST00000391750.1	37	CCDS33105.1	930	0.4258241758241758	254	0.516260162601626	141	0.38950276243093923	263	0.4597902097902098	272	0.35883905013192613	C	4.046	0.006136	0.07866	0.570757	0.438074	ENSG00000204577	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000445347	T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88	3.08	0.77	0.18497	Immunoglobulin-like fold (1);	0.442058	0.21614	N	0.071749	T	0.00012	0.0000	M	0.75884	2.315	0.80722	P	0.0	P;B	0.43352	0.804;0.06	B;B	0.35655	0.087;0.207	T	0.38993	-0.9635	9	0.23891	T	0.37	.	8.9029	0.35505	0.0:0.5451:0.4549:0.0	.	88;88	O75022;O75022-3	LIRB3_HUMAN;.	I	88	ENSP00000375630:M88I;ENSP00000412771:M88I;ENSP00000345184:M88I;ENSP00000245620:M88I;ENSP00000388199:M88I	ENSP00000245620:M88I	M	-	3	0	LILRB3	59418053	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.092000	0.15066	0.300000	0.22699	0.573000	0.79308	ATG		0.562	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5		NM_006864	
MAF	4094	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	79633710	79633710	+	Silent	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr16:79633710A>G	ENST00000393350.1	-	1	901	c.90T>C	c.(88-90)ttT>ttC	p.F30F	MAF_ENST00000569649.1_Silent_p.F30F|MAF_ENST00000326043.4_Silent_p.F30F	NM_001031804.2	NP_001026974.1	O75444	MAF_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog	30					cell development (GO:0048468)|cytokine production (GO:0001816)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of chondrocyte differentiation (GO:0032330)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F30F(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)	10		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		TTTTCACTTCAAACTTCATCA	0.582			T	IGH@	MM																																			Dom	yes		16	16q22-q23	4094	v-maf musculoaponeurotic fibrosarcoma oncogene homolog		L	1	Substitution - coding silent(1)	kidney(1)											36.0	43.0	41.0					16																	79633710		2198	4299	6497	SO:0001819	synonymous_variant	4094				CCDS10928.1, CCDS42198.1	16q22-q23	2013-07-09	2013-07-09		ENSG00000178573	ENSG00000178573			6776	protein-coding gene	gene with protein product		177075				14998484	Standard	NM_005360		Approved	c-MAF	uc002ffm.3	O75444	OTTHUMG00000137621	ENST00000393350.1:c.90T>C	16.37:g.79633710A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q66I47|Q9UP93	Silent	SNP	ENST00000393350.1	37	CCDS42198.1																																																																																				0.582	MAF-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317037.1			
MAGEA12	4111	broad.mit.edu	37	X	151896334	151896334	+	IGR	SNP	G	G	A	rs2515828	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chrX:151896334G>A	ENST00000357916.4	-	0	1664				CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12									p.P26P(2)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GTTCCCTTCCGGGTTGTCTTG	0.527													.|||	1768	0.468344	0.4735	0.5231	3775	,	,		11227	0.245		0.2793	False		,,,				2504	0.2566																2	Substitution - coding silent(2)	kidney(1)|endometrium(1)																																								SO:0001628	intergenic_variant	4111				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650		X.37:g.151896334G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q9NSD3	RNA	SNP	ENST00000357916.4	37	CCDS14710.1																																																																																				0.527	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1		NM_005367	
MAP1S	55201	broad.mit.edu	37	19	17836823	17836823	+	Silent	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:17836823C>T	ENST00000324096.4	+	5	781	c.630C>T	c.(628-630)ttC>ttT	p.F210F	MAP1S_ENST00000544059.2_Silent_p.F184F|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	210	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.F210F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						TGTGCGAATTCCTGGAGTACG	0.711																																																	1	Substitution - coding silent(1)	kidney(1)											24.0	25.0	25.0					19																	17836823		2201	4299	6500	SO:0001819	synonymous_variant	55201			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.630C>T	19.37:g.17836823C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	37	CCDS32954.1																																																																																				0.711	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1		NM_018174	
MGAT4C	25834	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	86373140	86373140	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr12:86373140C>T	ENST00000604798.1	-	8	2568	c.1364G>A	c.(1363-1365)tGt>tAt	p.C455Y	MGAT4C_ENST00000552808.2_Missense_Mutation_p.C455Y|MGAT4C_ENST00000549405.2_Missense_Mutation_p.C455Y|MGAT4C_ENST00000332156.1_Missense_Mutation_p.C455Y|MGAT4C_ENST00000548651.1_Missense_Mutation_p.C455Y|MGAT4C_ENST00000393205.2_Missense_Mutation_p.C484Y			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	455					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.C455Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TATCCTCATACAATGTATATC	0.308																																																	1	Substitution - Missense(1)	kidney(1)											78.0	78.0	78.0					12																	86373140		2203	4300	6503	SO:0001583	missense	25834				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.1364G>A	12.37:g.86373140C>T	ENSP00000474896:p.Cys455Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764773	0.69878	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651	T;T;T;T;T	0.36340	1.3;1.26;1.3;1.3;1.3	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69495	-0.5130	10	0.72032	D	0.01	-10.3016	19.9607	0.97248	0.0:1.0:0.0:0.0	.	484;455	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	Y	455;484;455;455;455;455	ENSP00000331664:C455Y;ENSP00000376900:C484Y;ENSP00000449022:C455Y;ENSP00000446647:C455Y;ENSP00000447253:C455Y	ENSP00000331664:C455Y	C	-	2	0	MGAT4C	84897271	1.000000	0.71417	0.993000	0.49108	0.932000	0.56968	7.814000	0.86154	2.713000	0.92767	0.585000	0.79938	TGT		0.308	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2		NM_013244	
MUC17	140453	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	100680818	100680818	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr7:100680818G>A	ENST00000306151.4	+	3	6185	c.6121G>A	c.(6121-6123)Gaa>Aaa	p.E2041K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2041	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.E2041K(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTCCTAGTGAACGGACCAC	0.498																																																	1	Substitution - Missense(1)	kidney(1)											179.0	170.0	173.0					7																	100680818		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6121G>A	7.37:g.100680818G>A	ENSP00000302716:p.Glu2041Lys	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	3.840	-0.034066	0.07543	.	.	ENSG00000169876	ENST00000306151	T	0.02631	4.22	0.512	0.512	0.16994	.	.	.	.	.	T	0.01287	0.0042	N	0.14661	0.345	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.41197	-0.9522	9	0.07482	T	0.82	.	6.9006	0.24281	2.0E-4:0.0:0.9998:0.0	.	2041	Q685J3	MUC17_HUMAN	K	2041	ENSP00000302716:E2041K	ENSP00000302716:E2041K	E	+	1	0	MUC17	100467538	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.230000	0.09083	0.551000	0.29008	0.134000	0.15878	GAA		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1		NM_001040105	
MYO5B	4645	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	47463681	47463681	+	Silent	SNP	G	G	A	rs577718838		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr18:47463681G>A	ENST00000285039.7	-	15	2138	c.1839C>T	c.(1837-1839)agC>agT	p.S613S		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	613	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.S613S(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CAGAACGGACGCTGATCTTCG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		18484	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	kidney(1)											97.0	97.0	97.0					18																	47463681		1984	4172	6156	SO:0001819	synonymous_variant	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1839C>T	18.37:g.47463681G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	37	CCDS42436.1																																																																																				0.547	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			
NABP1	64859	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	192550402	192550402	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:192550402A>C	ENST00000425611.2	+	6	606	c.523A>C	c.(523-525)Ata>Cta	p.I175L	NABP1_ENST00000410026.2_Missense_Mutation_p.I95L|NABP1_ENST00000409510.1_Missense_Mutation_p.I95L	NM_001031716.2	NP_001026886.1	Q96AH0	SOSB2_HUMAN	nucleic acid binding protein 1	175					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SOSS complex (GO:0070876)	RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.I175L(1)									CCGGGGACTTATAAATCCACA	0.428																																																	1	Substitution - Missense(1)	kidney(1)											98.0	91.0	93.0					2																	192550402		2203	4300	6503	SO:0001583	missense	0			BC017114	CCDS33352.1, CCDS58745.1	2q32.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000173559	ENSG00000173559			26232	protein-coding gene	gene with protein product	"""single-stranded DNA-binding protein 2"", ""sensor of single-strand DNA complex subunit B2"""	612103	"""oligonucleotide/oligosaccharide-binding fold containing 2A"""	OBFC2A			Standard	NM_001031716		Approved	FLJ22833, DKFZp667M1322, FLJ13624, MGC111163, SSB2, hSSB2, SOSS-B2	uc002usx.3	Q96AH0	OTTHUMG00000132720	ENST00000425611.2:c.523A>C	2.37:g.192550402A>C	ENSP00000403683:p.Ile175Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q658Y8|Q9H5X6	Missense_Mutation	SNP	ENST00000425611.2	37	CCDS33352.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.391|0.391	-0.923321|-0.923321	0.02377|0.02377	.|.	.|.	ENSG00000173559|ENSG00000173559	ENST00000410026;ENST00000409510;ENST00000425611|ENST00000435931	T;T;T|T	0.40476|0.43688	1.03;1.03;1.03|0.94	5.35|5.35	-4.17|-4.17	0.03857|0.03857	.|.	0.568928|.	0.18897|.	N|.	0.128137|.	T|T	0.29389|0.29389	0.0732|0.0732	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.37934|0.37934	-0.9684|-0.9684	10|7	0.08381|0.15499	T|T	0.77|0.54	.|.	8.8305|8.8305	0.35080|0.35080	0.2292:0.2602:0.5107:0.0|0.2292:0.2602:0.5107:0.0	.|.	95;175|.	Q96AH0-2;Q96AH0|.	.;SOSB2_HUMAN|.	L|F	95;95;175|138	ENSP00000387243:I95L;ENSP00000386605:I95L;ENSP00000403683:I175L|ENSP00000397041:L138F	ENSP00000386605:I95L|ENSP00000397041:L138F	I|L	+|+	1|3	0|2	OBFC2A|OBFC2A	192258647|192258647	0.985000|0.985000	0.35326|0.35326	0.005000|0.005000	0.12908|0.12908	0.125000|0.125000	0.20455|0.20455	0.278000|0.278000	0.18753|0.18753	-0.567000|-0.567000	0.06046|0.06046	0.533000|0.533000	0.62120|0.62120	ATA|TTA		0.428	NABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256060.1		NM_022837	
NBEAL1	65065	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	204002984	204002984	+	Silent	SNP	A	A	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:204002984A>T	ENST00000449802.1	+	29	4911	c.4578A>T	c.(4576-4578)atA>atT	p.I1526I		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1526								p.I1526I(1)|p.I236I(1)		NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TGCTGATCATACAGGACTTTC	0.378																																																	2	Substitution - coding silent(2)	kidney(2)											92.0	85.0	87.0					2																	204002984		1858	4090	5948	SO:0001819	synonymous_variant	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.4578A>T	2.37:g.204002984A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	ENST00000449802.1	37	CCDS46495.1																																																																																				0.378	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4			
OGDHL	55753	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	50947858	50947858	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr10:50947858C>T	ENST00000374103.4	-	17	2253	c.2168G>A	c.(2167-2169)aGc>aAc	p.S723N	OGDHL_ENST00000432695.1_Missense_Mutation_p.S514N|OGDHL_ENST00000419399.1_Missense_Mutation_p.S666N|OGDHL_ENST00000490844.1_5'Flank	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	723					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.S723N(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GGCATTGGGGCTGGCCATGGC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											66.0	60.0	62.0					10																	50947858		2203	4300	6503	SO:0001583	missense	55753			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2168G>A	10.37:g.50947858C>T	ENSP00000363216:p.Ser723Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	C	9.664	1.144942	0.21288	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.91124	-2.79;-2.79;-2.79	4.61	4.61	0.57282	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.78691	0.4323	N	0.02736	-0.51	0.54753	D	0.999982	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.003;0.001;0.006	T	0.73480	-0.3969	10	0.15952	T	0.53	.	17.4702	0.87643	0.0:1.0:0.0:0.0	.	666;514;723	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	N	723;666;514	ENSP00000363216:S723N;ENSP00000401356:S666N;ENSP00000390240:S514N	ENSP00000363216:S723N	S	-	2	0	OGDHL	50617864	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.689000	0.61723	2.127000	0.65507	0.446000	0.29264	AGC		0.567	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1		NM_018245	
OGT	8473	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	70756094	70756094	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chrX:70756094G>T	ENST00000373719.3	+	2	321	c.104G>T	c.(103-105)gGa>gTa	p.G35V	OGT_ENST00000373701.3_Missense_Mutation_p.G25V|OGT_ENST00000498566.1_3'UTR	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	35					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.G35V(1)|p.G25V(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					TATCAGGCAGGAGATTTTGAG	0.453																																																	2	Substitution - Missense(2)	kidney(2)											104.0	87.0	93.0					X																	70756094		2203	4300	6503	SO:0001583	missense	8473			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.104G>T	X.37:g.70756094G>T	ENSP00000362824:p.Gly35Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.156000	0.57259	.	.	ENSG00000147162	ENST00000373719;ENST00000373701;ENST00000444774	T;T;T	0.73469	0.56;-0.75;0.67	5.35	5.35	0.76521	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.83064	0.5173	L	0.47190	1.495	0.80722	D	1	D;D;P	0.89917	0.999;1.0;0.646	D;D;B	0.91635	0.974;0.999;0.227	D	0.84169	0.0433	10	0.62326	D	0.03	-6.7002	18.1204	0.89569	0.0:0.0:1.0:0.0	.	35;25;35	B4DTL6;O15294-3;O15294	.;.;OGT1_HUMAN	V	35;25;18	ENSP00000362824:G35V;ENSP00000362805:G25V;ENSP00000399729:G18V	ENSP00000362805:G25V	G	+	2	0	OGT	70672819	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.551000	0.98112	2.471000	0.83476	0.600000	0.82982	GGA		0.453	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3		NM_003605, NM_181672	
OR10G9	219870	broad.mit.edu;hgsc.bcm.edu	37	11	123894277	123894277	+	Silent	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr11:123894277G>A	ENST00000375024.1	+	1	558	c.558G>A	c.(556-558)ctG>ctA	p.L186L		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L186L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCCTGAAACTGGCCTGTGCAG	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											254.0	221.0	232.0					11																	123894277		2201	4297	6498	SO:0001819	synonymous_variant	219870			AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.558G>A	11.37:g.123894277G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000375024.1	37	CCDS31703.1																																																																																				0.522	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1		NM_001001953	
OR1D2	4991	broad.mit.edu;hgsc.bcm.edu	37	17	2996190	2996190	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr17:2996190A>G	ENST00000331459.1	-	1	100	c.101T>C	c.(100-102)aTg>aCg	p.M34T		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	34					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M34T(1)		kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						GACCAGGTACATGGACAGGAA	0.557																																																	1	Substitution - Missense(1)	kidney(1)											116.0	109.0	111.0					17																	2996190		2203	4300	6503	SO:0001583	missense	4991			U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.101T>C	17.37:g.2996190A>G	ENSP00000327585:p.Met34Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFL8|Q96RA4|Q9UM78	Missense_Mutation	SNP	ENST00000331459.1	37	CCDS11019.1	.	.	.	.	.	.	.	.	.	.	A	10.46	1.356050	0.24598	.	.	ENSG00000184166	ENST00000331459	T	0.00433	7.43	3.42	3.42	0.39159	.	.	.	.	.	T	0.00356	0.0011	L	0.49350	1.555	0.25155	N	0.990397	B	0.33103	0.397	B	0.28011	0.085	T	0.46020	-0.9221	9	0.62326	D	0.03	.	10.8068	0.46522	1.0:0.0:0.0:0.0	.	34	P34982	OR1D2_HUMAN	T	34	ENSP00000327585:M34T	ENSP00000327585:M34T	M	-	2	0	OR1D2	2942940	0.251000	0.23961	0.996000	0.52242	0.539000	0.34962	3.790000	0.55461	1.407000	0.46875	0.443000	0.29094	ATG		0.557	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207207.1		NM_002548	
OR4K13	390433	broad.mit.edu;ucsc.edu	37	14	20502565	20502565	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr14:20502565A>G	ENST00000315693.2	-	1	354	c.353T>C	c.(352-354)aTg>aCg	p.M118T	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M118T(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GTCTATTGCCATGGCTACAAG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											102.0	99.0	100.0					14																	20502565		2203	4300	6503	SO:0001583	missense	390433				CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.353T>C	14.37:g.20502565A>G	ENSP00000319322:p.Met118Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IF13	Missense_Mutation	SNP	ENST00000315693.2	37	CCDS32028.1	.	.	.	.	.	.	.	.	.	.	.	10.87	1.471762	0.26423	.	.	ENSG00000176253	ENST00000315693	T	0.01145	5.27	3.6	2.44	0.29823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	U	0.000235	T	0.04048	0.0113	H	0.97186	3.955	0.30516	N	0.768964	P	0.39883	0.693	B	0.38500	0.275	T	0.02596	-1.1136	10	0.72032	D	0.01	.	7.789	0.29108	0.8937:0.0:0.1063:0.0	.	118	Q8NH42	OR4KD_HUMAN	T	118	ENSP00000319322:M118T	ENSP00000319322:M118T	M	-	2	0	OR4K13	19572405	1.000000	0.71417	0.968000	0.41197	0.031000	0.12232	7.843000	0.86859	0.462000	0.27095	0.416000	0.27883	ATG		0.493	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410344.1			
PCDHB8	56128	broad.mit.edu;hgsc.bcm.edu	37	5	140559268	140559268	+	Silent	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr5:140559268G>T	ENST00000239444.2	+	1	1898	c.1653G>T	c.(1651-1653)ctG>ctT	p.L551L	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	551	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L551L(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCGCGTGCTGGTGCTGGACG	0.716																																																	1	Substitution - coding silent(1)	kidney(1)											29.0	51.0	44.0					5																	140559268		2194	4290	6484	SO:0001819	synonymous_variant	56128			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1653G>T	5.37:g.140559268G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																				0.716	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2		NM_019120	
PDIA3	2923	broad.mit.edu;hgsc.bcm.edu	37	15	44060741	44060741	+	Silent	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr15:44060741G>A	ENST00000300289.5	+	9	1231	c.1083G>A	c.(1081-1083)ctG>ctA	p.L361L	PDIA3_ENST00000538521.1_Silent_p.L341L	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3	361	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.L361L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		ATGGCAATCTGAAGAGATACC	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											118.0	118.0	118.0					15																	44060741		2198	4296	6494	SO:0001819	synonymous_variant	2923				CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444	ENST00000300289.5:c.1083G>A	15.37:g.44060741G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q13453|Q14255|Q8IYF8|Q9UMU7	Silent	SNP	ENST00000300289.5	37	CCDS10101.1																																																																																				0.488	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103532.3		NM_005313	
PGM5P2	595135	broad.mit.edu	37	9	69113733	69113733	+	RNA	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr9:69113733G>T	ENST00000591037.1	-	0	912					NR_002836.2				phosphoglucomutase 5 pseudogene 2																		AATTGGCTGGGGCCCCCAGCT	0.443																																																	0																																												595135			BC007887, BC025351		9q12	2014-01-23			ENSG00000227558	ENSG00000277778			18965	pseudogene	pseudogene						12421752, 15233989	Standard	NR_002836		Approved		uc004aff.4		OTTHUMG00000013322		9.37:g.69113733G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000591037.1	37																																																																																					0.443	PGM5P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000460890.1		NR_002836	
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7986847	7986847	+	Intron	SNP	G	G	A	rs197129	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr6:7986847G>A	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)									p.A26A(1)									CCTGTACCGCGTCCTCAGCAT	0.607													G|||	1710	0.341454	0.0734	0.3746	5008	,	,		17219	0.7163		0.3052	False		,,,				2504	0.3313																1	Substitution - coding silent(1)	kidney(1)																																								SO:0001627	intron_variant	206426					6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+39752C>T	6.37:g.7986847G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000439343.2	37																																																																																					0.607	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1		NR_037616.1	
PLG	5340	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	161152841	161152841	+	Silent	SNP	A	A	G	rs150227219		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr6:161152841A>G	ENST00000308192.9	+	12	1566	c.1503A>G	c.(1501-1503)ccA>ccG	p.P501P		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	501	Kringle 5. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P501P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTGGGACGCCATGCCAGGACT	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											99.0	104.0	102.0					6																	161152841		2203	4300	6503	SO:0001819	synonymous_variant	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1503A>G	6.37:g.161152841A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	CCDS5279.1																																																																																				0.502	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2		NM_000301	
PLVAP	83483	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17487791	17487791	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:17487791G>T	ENST00000252590.4	-	1	368	c.307C>A	c.(307-309)Ctg>Atg	p.L103M		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	103					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.L103M(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CGAGCATTCAGCCACATCTGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											115.0	99.0	105.0					19																	17487791		2203	4300	6503	SO:0001583	missense	83483			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.307C>A	19.37:g.17487791G>T	ENSP00000252590:p.Leu103Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	ENST00000252590.4	37	CCDS32952.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078539	0.36662	.	.	ENSG00000130300	ENST00000252590	T	0.31510	1.49	4.77	-9.02	0.00741	.	2.797130	0.01103	N	0.005439	T	0.17916	0.0430	N	0.19112	0.55	0.09310	N	1	P	0.41710	0.76	B	0.41440	0.357	T	0.39820	-0.9595	10	0.45353	T	0.12	-9.4517	5.8504	0.18689	0.0809:0.5311:0.1759:0.2121	.	103	Q9BX97	PLVAP_HUMAN	M	103	ENSP00000252590:L103M	ENSP00000252590:L103M	L	-	1	2	PLVAP	17348791	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.638000	0.24674	-0.802000	0.04421	-0.311000	0.09066	CTG		0.627	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1		NM_031310	
POLH	5429	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43571729	43571729	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr6:43571729C>A	ENST00000372236.4	+	7	1160	c.865C>A	c.(865-867)Cat>Aat	p.H289N	POLH_ENST00000372226.1_Missense_Mutation_p.H289N|POLH_ENST00000535400.1_Missense_Mutation_p.H227N	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.H289N(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GCTCCAGAGTCATTTTGGGGA	0.398								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																																								1	Substitution - Missense(1)	kidney(1)											100.0	99.0	99.0					6																	43571729		2203	4300	6503	SO:0001583	missense	5429	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.865C>A	6.37:g.43571729C>A	ENSP00000361310:p.His289Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000372236.4	37	CCDS4902.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860468	0.91433	.	.	ENSG00000170734	ENST00000372236;ENST00000535400;ENST00000372226	T;T;T	0.70869	-0.52;-0.52;-0.52	5.62	5.62	0.85841	DNA polymerase, Y-family, little finger domain (1);	0.000000	0.85682	D	0.000000	T	0.78065	0.4225	M	0.63843	1.955	0.80722	D	1	D;D	0.60160	0.987;0.972	D;D	0.68943	0.961;0.943	T	0.73097	-0.4090	10	0.28530	T	0.3	-16.4276	19.2537	0.93935	0.0:1.0:0.0:0.0	.	227;289	B4DG64;Q9Y253	.;POLH_HUMAN	N	289;227;289	ENSP00000361310:H289N;ENSP00000442102:H227N;ENSP00000361300:H289N	ENSP00000361300:H289N	H	+	1	0	POLH	43679707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.135000	0.77276	2.638000	0.89438	0.591000	0.81541	CAT		0.398	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040666.1		NM_006502	
PRTG	283659	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	56032778	56032778	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr15:56032778G>A	ENST00000561292.1	-	2	357	c.199C>T	c.(199-201)Cct>Tct	p.P67S	PRTG_ENST00000389286.4_Missense_Mutation_p.P67S					protogenin									p.P67S(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ACCTTAATAGGAACTTCTCCG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											141.0	137.0	138.0					15																	56032778		1845	4093	5938	SO:0001583	missense	283659			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000561292.1:c.199C>T	15.37:g.56032778G>A	ENSP00000453335:p.Pro67Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000561292.1	37		.	.	.	.	.	.	.	.	.	.	G	24.2	4.503011	0.85176	.	.	ENSG00000166450	ENST00000389286	T	0.66638	-0.22	5.82	5.82	0.92795	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000003	T	0.76793	0.4037	L	0.41961	1.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71919	-0.4447	10	0.29301	T	0.29	-14.6247	18.6661	0.91491	0.0:0.0:1.0:0.0	.	67	Q2VWP7	PRTG_HUMAN	S	67	ENSP00000373937:P67S	ENSP00000373937:P67S	P	-	1	0	PRTG	53820070	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.238000	0.95380	2.739000	0.93911	0.655000	0.94253	CCT		0.423	PRTG-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000419360.1		NM_173814	
SAT1	6303	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	23803813	23803814	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chrX:23803813_23803814GG>AA	ENST00000379270.4	+	6	535_536	c.356_357GG>AA	c.(355-357)aGG>aAA	p.R119K	SAT1_ENST00000489394.1_3'UTR|RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000379254.1_Missense_Mutation_p.R91K	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.R119R(1)|p.R119K(1)|p.R119>?(1)		breast(1)|endometrium(3)|kidney(3)|lung(3)	10						GTTGCAATGAGGTGTCGCTGCA	0.411																																																	3	Substitution - Missense(1)|Complex(1)|Substitution - coding silent(1)	kidney(3)																																								SO:0001583	missense	6303			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	Exception_encountered	X.37:g.23803813_23803814delinsAA	ENSP00000368572:p.Arg119Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation|Silent	SNP	ENST00000379270.4	37	CCDS14207.1																																																																																				0.411	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056056.1		NM_002970	
SDHD	6392	broad.mit.edu;hgsc.bcm.edu	37	11	111959648	111959648	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr11:111959648T>A	ENST00000375549.3	+	3	362	c.227T>A	c.(226-228)cTc>cAc	p.L76H	SDHD_ENST00000528182.1_Missense_Mutation_p.L76H|SDHD_ENST00000526592.1_Missense_Mutation_p.L76H|SDHD_ENST00000528021.1_Missense_Mutation_p.L76H|TIMM8B_ENST00000507614.1_5'Flank|TIMM8B_ENST00000541231.1_5'Flank|SDHD_ENST00000532699.1_Missense_Mutation_p.L76H|TIMM8B_ENST00000504148.2_5'Flank|SDHD_ENST00000528048.1_Intron|SDHD_ENST00000525291.1_Missense_Mutation_p.L37H	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	76					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)	p.L76H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	AGTGTTTTGCTCCTGGGTCTG	0.498			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																														yes	Rec		Familial paraganglioma	11	11q23	6392	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""		O	1	Substitution - Missense(1)	kidney(1)											79.0	77.0	77.0					11																	111959648		2201	4294	6495	SO:0001583	missense	6392	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.227T>A	11.37:g.111959648T>A	ENSP00000364699:p.Leu76His	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Missense_Mutation	SNP	ENST00000375549.3	37	CCDS31678.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546346	0.86022	.	.	ENSG00000204370	ENST00000375549;ENST00000528182;ENST00000528021;ENST00000526592;ENST00000525291	D;D;D;D;D	0.99304	-5.72;-5.72;-5.72;-5.72;-5.72	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000001	D	0.99521	0.9829	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98162	1.0447	10	0.87932	D	0	-3.599	14.7676	0.69651	0.0:0.0:0.0:1.0	.	76	O14521	DHSD_HUMAN	H	76;76;76;76;37	ENSP00000364699:L76H;ENSP00000435475:L76H;ENSP00000432465:L76H;ENSP00000432005:L76H;ENSP00000436669:L37H	ENSP00000436395:L76H	L	+	2	0	SDHD	111464858	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.504000	0.81646	1.893000	0.54813	0.477000	0.44152	CTC		0.498	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392351.1		NM_003002	
SEC16A	9919	broad.mit.edu;hgsc.bcm.edu	37	9	139370322	139370322	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr9:139370322C>A	ENST00000371706.3	-	1	1245	c.1212G>T	c.(1210-1212)caG>caT	p.Q404H	SEC16A_ENST00000290037.6_Missense_Mutation_p.Q404H|SEC16A_ENST00000431893.2_Missense_Mutation_p.Q404H|SEC16A_ENST00000313050.7_Missense_Mutation_p.Q582H			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	404					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.Q582H(2)		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CACGGTAATTCTGGCTCACAG	0.478																																																	2	Substitution - Missense(2)	kidney(2)											29.0	33.0	31.0					9																	139370322		2101	4241	6342	SO:0001583	missense	9919			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.1212G>T	9.37:g.139370322C>A	ENSP00000360771:p.Gln404His	Somatic		WXS	Illumina HiSeq	Phase_I	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	C	12.96	2.094173	0.36952	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T	0.26373	1.75;1.75;1.74;1.74	5.42	0.0998	0.14504	.	0.278543	0.35555	N	0.003140	T	0.33294	0.0858	M	0.67953	2.075	0.19575	N	0.999962	D;D;D;D	0.62365	0.991;0.986;0.986;0.976	P;P;P;P	0.59288	0.72;0.855;0.855;0.556	T	0.11941	-1.0567	10	0.41790	T	0.15	-5.1675	2.4359	0.04483	0.1329:0.5153:0.1289:0.2229	.	582;404;404;209	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	H	582;404;404;404;209	ENSP00000325827:Q582H;ENSP00000360771:Q404H;ENSP00000290037:Q404H;ENSP00000387583:Q404H	ENSP00000290037:Q404H	Q	-	3	2	SEC16A	138490143	0.284000	0.24287	0.130000	0.21974	0.356000	0.29392	0.426000	0.21363	0.040000	0.15660	0.655000	0.94253	CAG		0.478	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1		XM_088459	
SERPINB5	5268	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	61154236	61154236	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr18:61154236G>A	ENST00000382771.4	+	3	518	c.226G>A	c.(226-228)Gat>Aat	p.D76N	RP11-635N19.3_ENST00000602456.1_RNA|SERPINB5_ENST00000489441.1_Missense_Mutation_p.D76N	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	76					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D76N(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						AGTAACATCGGATGTAAACAA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											108.0	107.0	107.0					18																	61154236		2203	4299	6502	SO:0001583	missense	5268			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.226G>A	18.37:g.61154236G>A	ENSP00000372221:p.Asp76Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	CCDS32839.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523709	0.85600	.	.	ENSG00000206075	ENST00000382771;ENST00000424602	D;D	0.84223	-1.82;-1.82	5.32	5.32	0.75619	Serpin domain (3);	0.000000	0.64402	D	0.000001	D	0.88808	0.6537	L	0.51422	1.61	0.54753	D	0.999984	D;B	0.60160	0.987;0.072	P;B	0.58210	0.835;0.037	D	0.88718	0.3227	10	0.51188	T	0.08	.	18.1356	0.89618	0.0:0.0:1.0:0.0	.	76;76	P36952;P36952-2	SPB5_HUMAN;.	N	76	ENSP00000372221:D76N;ENSP00000408821:D76N	ENSP00000372221:D76N	D	+	1	0	SERPINB5	59305216	1.000000	0.71417	0.908000	0.35775	0.820000	0.46376	5.984000	0.70548	2.659000	0.90383	0.650000	0.86243	GAT		0.353	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1		NM_002639	
SLC13A1	6561	hgsc.bcm.edu;ucsc.edu	37	7	122757654	122757654	+	Silent	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr7:122757654G>A	ENST00000194130.2	-	14	1560	c.1521C>T	c.(1519-1521)gcC>gcT	p.A507A	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	507					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)	p.A507A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TCACATGAATGGCTTCGGCCT	0.358																																																	1	Substitution - coding silent(1)	kidney(1)											84.0	81.0	82.0					7																	122757654		2203	4300	6503	SO:0001819	synonymous_variant	6561				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1521C>T	7.37:g.122757654G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H5Z0	Silent	SNP	ENST00000194130.2	37	CCDS5786.1																																																																																				0.358	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1		NM_022444	
SNX27	81609	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151665946	151665946	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:151665946A>G	ENST00000458013.2	+	11	1685	c.1565A>G	c.(1564-1566)aAg>aGg	p.K522R	SNX27_ENST00000368843.3_Missense_Mutation_p.K522R|SNX27_ENST00000368838.1_Missense_Mutation_p.K429R			Q96L92	SNX27_HUMAN	sorting nexin family member 27	522	FERM-like region F3.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.K522R(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGCGAGCTCAAGTGGAGAAAA	0.423																																					Colon(46;291 966 40145 41237 41888)												1	Substitution - Missense(1)	kidney(1)											187.0	173.0	178.0					1																	151665946		2203	4300	6503	SO:0001583	missense	81609			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1565A>G	1.37:g.151665946A>G	ENSP00000400333:p.Lys522Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	37		.	.	.	.	.	.	.	.	.	.	A	20.6	4.021988	0.75275	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.54675	0.61;0.56;0.77	5.93	5.93	0.95920	.	0.049039	0.85682	D	0.000000	T	0.35128	0.0921	M	0.68952	2.095	0.58432	D	0.999993	B;B	0.27853	0.072;0.191	B;B	0.29942	0.075;0.109	T	0.25984	-1.0116	10	0.16896	T	0.51	.	12.7735	0.57434	1.0:0.0:0.0:0.0	.	522;522	Q96L92;Q96L92-3	SNX27_HUMAN;.	R	522;522;429	ENSP00000400333:K522R;ENSP00000357836:K522R;ENSP00000357831:K429R	ENSP00000357831:K429R	K	+	2	0	SNX27	149932570	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.686000	0.74548	2.261000	0.74972	0.460000	0.39030	AAG		0.423	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3		NM_030918	
SPATA5L1	79029	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	45706846	45706846	+	Silent	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr15:45706846T>C	ENST00000305560.6	+	4	1611	c.1512T>C	c.(1510-1512)taT>taC	p.Y504Y	SPATA5L1_ENST00000559860.1_Silent_p.Y504Y	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	504						cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.Y504Y(1)		kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		TTCTCCTCTATGGGCCCCCTG	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											80.0	75.0	77.0					15																	45706846		2198	4298	6496	SO:0001819	synonymous_variant	79029			AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.1512T>C	15.37:g.45706846T>C		Somatic		WXS	Illumina HiSeq	Phase_I	C9JHR5|Q9H8W7|Q9HA41	Silent	SNP	ENST00000305560.6	37	CCDS10123.1																																																																																				0.498	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1		NM_024063	
SPHKAP	80309	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	228886626	228886626	+	Missense_Mutation	SNP	G	G	T	rs546485834		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:228886626G>T	ENST00000392056.3	-	6	544	c.498C>A	c.(496-498)aaC>aaA	p.N166K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.N166K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	166						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.N166K(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGTTGGTACTGTTTGGTCTGT	0.438																																																	2	Substitution - Missense(2)	kidney(2)											120.0	106.0	111.0					2																	228886626		2203	4300	6503	SO:0001583	missense	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.498C>A	2.37:g.228886626G>T	ENSP00000375909:p.Asn166Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514301	0.64522	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11821	2.75;2.74	5.79	1.01	0.19927	.	0.198535	0.51477	D	0.000081	T	0.19248	0.0462	L	0.27053	0.805	0.35614	D	0.808894	D;D	0.62365	0.976;0.991	P;D	0.66847	0.622;0.947	T	0.06679	-1.0813	10	0.48119	T	0.1	.	9.7469	0.40453	0.3294:0.0:0.6706:0.0	.	166;166	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	K	166	ENSP00000375909:N166K;ENSP00000339886:N166K	ENSP00000339886:N166K	N	-	3	2	SPHKAP	228594870	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	1.859000	0.39418	-0.082000	0.12640	-0.140000	0.14226	AAC		0.438	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1		NM_030623	
SVEP1	79987	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	113276281	113276281	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr9:113276281G>A	ENST00000401783.2	-	4	1406	c.1070C>T	c.(1069-1071)cCt>cTt	p.P357L	SVEP1_ENST00000302728.8_Missense_Mutation_p.P357L|SVEP1_ENST00000374461.1_Missense_Mutation_p.P334L|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.P334L	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	357					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.P357L(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ACAGTCTTCAGGGGATGTGCT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											67.0	67.0	67.0					9																	113276281		1991	4177	6168	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1070C>T	9.37:g.113276281G>A	ENSP00000384917:p.Pro357Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	6.713	0.500293	0.12762	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37	5.88	4.98	0.66077	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.558812	0.18076	N	0.152450	D	0.93197	0.7833	L	0.40543	1.245	0.18873	N	0.999988	B;B;B;B	0.09022	0.002;0.001;0.002;0.002	B;B;B;B	0.08055	0.003;0.003;0.003;0.002	D	0.83909	0.0294	10	0.23891	T	0.37	.	6.9233	0.24401	0.2879:0.0:0.7121:0.0	.	357;357;357;357	E9PBN8;Q4LDE5;B3KV07;Q4LDE5-2	.;SVEP1_HUMAN;.;.	L	357;334;357;334	ENSP00000384917:P357L;ENSP00000363593:P334L;ENSP00000304118:P357L;ENSP00000363585:P334L	ENSP00000304118:P357L	P	-	2	0	SVEP1	112316102	0.028000	0.19301	0.366000	0.25914	0.932000	0.56968	2.033000	0.41136	1.481000	0.48307	0.650000	0.86243	CCT		0.498	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
SYNPO2	171024	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	119947951	119947951	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:119947951G>C	ENST00000429713.2	+	3	609	c.427G>C	c.(427-429)Gct>Cct	p.A143P	SYNPO2_ENST00000307142.4_Missense_Mutation_p.A143P|SYNPO2_ENST00000434046.2_Missense_Mutation_p.A143P|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	143						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.A143P(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGTTCCCCTAGCTGAGAACCA	0.547																																																	2	Substitution - Missense(2)	kidney(2)											45.0	47.0	46.0					4																	119947951		2203	4300	6503	SO:0001583	missense	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.427G>C	4.37:g.119947951G>C	ENSP00000395143:p.Ala143Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.611|9.611	1.131176|1.131176	0.21041|0.21041	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|.	0.08720|.	3.07;3.06;3.06|.	5.29|5.29	2.47|2.47	0.30058|0.30058	.|.	0.554792|.	0.16194|.	N|.	0.225231|.	T|T	0.38321|0.38321	0.1036|0.1036	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	0.999991|0.999991	B;B;B;B|.	0.09022|.	0.0;0.001;0.002;0.002|.	B;B;B;B|.	0.08055|.	0.0;0.002;0.003;0.002|.	T|T	0.23655|0.23655	-1.0182|-1.0182	10|5	0.36615|.	T|.	0.2|.	-4.2263|-4.2263	6.7595|6.7595	0.23532|0.23532	0.1598:0.1439:0.6963:0.0|0.1598:0.1439:0.6963:0.0	.|.	143;143;143;143|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	P|T	143|94	ENSP00000306015:A143P;ENSP00000395143:A143P;ENSP00000390965:A143P|.	ENSP00000306015:A143P|.	A|S	+|+	1|2	0|0	SYNPO2|SYNPO2	120167399|120167399	0.941000|0.941000	0.31946|0.31946	0.453000|0.453000	0.27007|0.27007	0.517000|0.517000	0.34286|0.34286	1.397000|1.397000	0.34543|0.34543	0.590000|0.590000	0.29694|0.29694	0.557000|0.557000	0.71058|0.71058	GCT|AGC		0.547	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			
SYNPO2	171024	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	119947953	119947953	+	Silent	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:119947953T>A	ENST00000429713.2	+	3	611	c.429T>A	c.(427-429)gcT>gcA	p.A143A	SYNPO2_ENST00000307142.4_Silent_p.A143A|SYNPO2_ENST00000434046.2_Silent_p.A143A|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	143						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.A143A(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TTCCCCTAGCTGAGAACCAAA	0.547																																																	2	Substitution - coding silent(2)	kidney(2)											44.0	46.0	46.0					4																	119947953		2203	4300	6503	SO:0001819	synonymous_variant	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.429T>A	4.37:g.119947953T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	T	6.091	0.385118	0.11524	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.29	-0.0133	0.13985	.	.	.	.	.	.	.	.	.	.	.	0.32797	N	0.500358	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.2263	1.353	0.02177	0.1456:0.2677:0.133:0.4538	.	.	.	.	R	95	.	.	X	+	1	0	SYNPO2	120167401	0.933000	0.31639	0.792000	0.32020	0.495000	0.33615	0.117000	0.15583	0.355000	0.24131	0.455000	0.32223	TGA		0.547	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			
TARBP1	6894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	234565028	234565028	+	Missense_Mutation	SNP	T	T	A	rs576184554		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:234565028T>A	ENST00000040877.1	-	17	2913	c.2914A>T	c.(2914-2916)Atg>Ttg	p.M972L		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	972					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.M972L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TTCCACGCCATGTCAAAAGAC	0.338																																																	1	Substitution - Missense(1)	kidney(1)											61.0	64.0	63.0					1																	234565028		2203	4300	6503	SO:0001583	missense	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.2914A>T	1.37:g.234565028T>A	ENSP00000040877:p.Met972Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	T	2.655	-0.281178	0.05642	.	.	ENSG00000059588	ENST00000040877	T	0.04454	3.62	5.58	-2.81	0.05805	Armadillo-type fold (1);	0.693428	0.15678	N	0.250071	T	0.02610	0.0079	L	0.35414	1.06	0.20403	N	0.999904	B	0.02656	0.0	B	0.01281	0.0	T	0.44620	-0.9316	10	0.18276	T	0.48	-26.7065	1.2904	0.02059	0.1341:0.2775:0.1956:0.3928	.	972	Q13395	TARB1_HUMAN	L	972	ENSP00000040877:M972L	ENSP00000040877:M972L	M	-	1	0	TARBP1	232631651	0.001000	0.12720	0.792000	0.32020	0.911000	0.54048	-1.413000	0.02473	-0.412000	0.07519	-0.316000	0.08728	ATG		0.338	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1		NM_005646	
THOC1	9984	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	214641	214641	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr18:214641A>C	ENST00000261600.6	-	21	1966	c.1959T>G	c.(1957-1959)aaT>aaG	p.N653K		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	653	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.N653K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TATTTGTCTCATTGTCATTAG	0.348																																																	1	Substitution - Missense(1)	kidney(1)											81.0	76.0	78.0					18																	214641		1844	4086	5930	SO:0001583	missense	9984			AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.1959T>G	18.37:g.214641A>C	ENSP00000261600:p.Asn653Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	37	CCDS45820.1	.	.	.	.	.	.	.	.	.	.	A	4.028	0.002698	0.07866	.	.	ENSG00000079134	ENST00000261600	.	.	.	6.03	3.7	0.42460	Death (2);	0.377447	0.29307	N	0.012524	T	0.14743	0.0356	N	0.02539	-0.55	0.27466	N	0.953008	B	0.12013	0.005	B	0.19391	0.025	T	0.16335	-1.0406	9	0.27785	T	0.31	-12.9865	8.9537	0.35805	0.7922:0.0:0.2078:0.0	.	653	Q96FV9	THOC1_HUMAN	K	653	.	ENSP00000261600:N653K	N	-	3	2	THOC1	204641	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	0.461000	0.21940	1.102000	0.41551	0.533000	0.62120	AAT		0.348	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5		NM_005131	
CATSPERD	257062	hgsc.bcm.edu;ucsc.edu	37	19	5749189	5749191	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:5749189_5749191delATC	ENST00000381624.3	+	11	1043_1045	c.982_984delATC	c.(982-984)atcdel	p.I328del	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	328					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											AAGTTCCATAATCAAAGTAGGTA	0.468																																																	0																																										SO:0001651	inframe_deletion	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.982_984delATC	19.37:g.5749189_5749191delATC	ENSP00000371037:p.Ile328del	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZRP1	In_Frame_Del	DEL	ENST00000381624.3	37	CCDS12149.2																																																																																				0.468	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2		NM_152784	
TMEM184C	55751	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	148555356	148555356	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:148555356T>G	ENST00000296582.3	+	10	1662	c.1088T>G	c.(1087-1089)tTt>tGt	p.F363C	TMEM184C_ENST00000508208.1_Intron	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	363						integral component of membrane (GO:0016021)		p.F363C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						AAAAAATTGTTTCCCGAGGAT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											56.0	55.0	55.0					4																	148555356		2203	4300	6503	SO:0001583	missense	55751			AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.1088T>G	4.37:g.148555356T>G	ENSP00000296582:p.Phe363Cys	Somatic		WXS	Illumina HiSeq	Phase_I	D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	ENST00000296582.3	37	CCDS3770.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.074953	0.76415	.	.	ENSG00000164168	ENST00000296582	.	.	.	5.74	5.74	0.90152	.	0.048414	0.85682	D	0.000000	T	0.75265	0.3826	M	0.69823	2.125	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	T	0.74922	-0.3499	9	0.38643	T	0.18	-25.9685	16.3305	0.83010	0.0:0.0:0.0:1.0	.	363	Q9NVA4	T184C_HUMAN	C	363	.	ENSP00000296582:F363C	F	+	2	0	TMEM184C	148774806	1.000000	0.71417	0.805000	0.32314	0.710000	0.40934	4.225000	0.58600	2.317000	0.78254	0.459000	0.35465	TTT		0.348	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1		NM_018241	
TTC32	130502	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	20101521	20101521	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:20101521G>A	ENST00000333610.3	-	1	226	c.95C>T	c.(94-96)tCc>tTc	p.S32F	RP11-79O8.1_ENST00000607190.1_lincRNA|TTC32_ENST00000402414.1_Missense_Mutation_p.S32F	NM_001008237.1	NP_001008238.1	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32	32								p.S32F(1)		kidney(2)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATGTAAGCGGAGTACAGTGC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											107.0	99.0	102.0					2																	20101521		2203	4300	6503	SO:0001583	missense	130502			BC057850	CCDS33151.1	2p24.1	2013-01-10			ENSG00000183891	ENSG00000183891		"""Tetratricopeptide (TTC) repeat domain containing"""	32954	protein-coding gene	gene with protein product							Standard	NM_001008237		Approved		uc002rdg.3	Q5I0X7	OTTHUMG00000151776	ENST00000333610.3:c.95C>T	2.37:g.20101521G>A	ENSP00000333018:p.Ser32Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000333610.3	37	CCDS33151.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404457	0.42613	.	.	ENSG00000183891	ENST00000402414;ENST00000333610	T;T	0.74947	-0.09;-0.89	5.09	5.09	0.68999	Tetratricopeptide-like helical (1);	0.352957	0.28641	N	0.014628	T	0.81847	0.4909	M	0.64997	1.995	0.42547	D	0.993099	D	0.53151	0.958	P	0.59546	0.859	D	0.83562	0.0107	10	0.72032	D	0.01	-8.4125	13.8614	0.63561	0.0:0.0:1.0:0.0	.	32	Q5I0X7	TTC32_HUMAN	F	32	ENSP00000385708:S32F;ENSP00000333018:S32F	ENSP00000333018:S32F	S	-	2	0	TTC32	19965002	0.993000	0.37304	0.995000	0.50966	0.051000	0.14879	2.606000	0.46291	2.638000	0.89438	0.655000	0.94253	TCC		0.647	TTC32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323868.1		NM_001008237	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179485254	179485254	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:179485254G>T	ENST00000591111.1	-	198	41295	c.41071C>A	c.(41071-41073)Ctg>Atg	p.L13691M	TTN_ENST00000589042.1_Missense_Mutation_p.L15332M|TTN_ENST00000342992.6_Missense_Mutation_p.L12764M|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L6459M|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L6392M|TTN_ENST00000460472.2_Missense_Mutation_p.L6267M|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13691	Ig-like 93.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L12764M(2)|p.L6392M(1)|p.L6267M(1)|p.L6459M(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCACTTCAGTGTTACATTG	0.398																																																	5	Substitution - Missense(5)	kidney(5)											132.0	124.0	127.0					2																	179485254		1928	4127	6055	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41071C>A	2.37:g.179485254G>T	ENSP00000465570:p.Leu13691Met	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	8.346	0.829697	0.16749	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.7	2.96	0.34315	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70386	0.3218	L	0.41824	1.3	0.29971	N	0.818511	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.68039	0.939;0.939;0.939;0.955	T	0.64736	-0.6337	9	0.87932	D	0	.	6.6887	0.23160	0.2064:0.1275:0.666:0.0	.	6267;6392;6459;13691	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	12764;6267;6459;6392;6267	ENSP00000343764:L12764M;ENSP00000434586:L6267M;ENSP00000340554:L6459M;ENSP00000352154:L6392M	ENSP00000340554:L6459M	L	-	1	2	TTN	179193499	0.931000	0.31567	0.973000	0.42090	0.914000	0.54420	1.385000	0.34408	0.355000	0.24131	-0.244000	0.11960	CTG		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
TRIP12	9320	broad.mit.edu;ucsc.edu	37	2	230650536	230650536	+	Silent	SNP	C	C	A	rs189366062	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:230650536C>A	ENST00000283943.5	-	33	4984	c.4806G>T	c.(4804-4806)gcG>gcT	p.A1602A	TRIP12_ENST00000389044.4_Silent_p.A1650A|TRIP12_ENST00000389045.3_Silent_p.A1332A	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1602					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.A1602A(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCACAGACTCCGCCTGTTTCA	0.463																																																	1	Substitution - coding silent(1)	kidney(1)											111.0	112.0	111.0					2																	230650536		2203	4300	6503	SO:0001819	synonymous_variant	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4806G>T	2.37:g.230650536C>A		Somatic		WXS	Illumina GAIIx	Phase_I	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	37	CCDS33391.1																																																																																				0.463	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3		NM_004238	
UBE3B	89910	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	109967774	109967774	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr12:109967774T>A	ENST00000342494.3	+	25	3302	c.2707T>A	c.(2707-2709)Ttc>Atc	p.F903I	UBE3B_ENST00000434735.2_Missense_Mutation_p.F903I|UBE3B_ENST00000535089.1_5'UTR	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	903	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.F903I(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CATTAGCGGATTCCGTTCCAT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											182.0	157.0	165.0					12																	109967774		2203	4300	6503	SO:0001583	missense	89910			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2707T>A	12.37:g.109967774T>A	ENSP00000340596:p.Phe903Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	T	34	5.387734	0.95988	.	.	ENSG00000151148	ENST00000434735;ENST00000342494;ENST00000538070	T;T	0.60548	0.18;0.18	5.95	5.95	0.96441	HECT (4);	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	0.97;1.0	P;D	0.81914	0.851;0.995	T	0.81758	-0.0786	10	0.45353	T	0.12	-2.5936	15.5904	0.76523	0.0:0.0:0.0:1.0	.	198;903	F5H2J2;Q7Z3V4	.;UBE3B_HUMAN	I	903;903;198	ENSP00000391529:F903I;ENSP00000340596:F903I	ENSP00000340596:F903I	F	+	1	0	UBE3B	108452157	1.000000	0.71417	0.934000	0.37439	0.988000	0.76386	7.614000	0.82996	2.276000	0.75962	0.460000	0.39030	TTC		0.443	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1		NM_183415	
LINC01347	731275	broad.mit.edu	37	1	243251423	243251423	+	lincRNA	DEL	A	A	-	rs200578702	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr1:243251423delA	ENST00000417964.1	-	0	1346																											actccatctcaaaaaaaaaaa	0.458													|||unknown(NO_COVERAGE)	1468	0.293131	0.3033	0.3098	5008	,	,		13610	0.3333		0.2396	False		,,,				2504	0.2812																0																																												0																															1.37:g.243251423delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000417964.1	37																																																																																					0.458	RP11-261C10.3-006	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000096168.1			
USP53	54532	broad.mit.edu;ucsc.edu	37	4	120182905	120182905	+	Silent	SNP	T	T	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr4:120182905T>C	ENST00000274030.6	+	12	2037	c.858T>C	c.(856-858)aaT>aaC	p.N286N	USP53_ENST00000450251.1_Silent_p.N286N	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53									p.N285N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						ATGCCAAAAATAGTGAACTTA	0.313																																																	1	Substitution - coding silent(1)	kidney(1)											102.0	94.0	97.0					4																	120182905		1828	4082	5910	SO:0001819	synonymous_variant	54532			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.858T>C	4.37:g.120182905T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000274030.6	37	CCDS43265.1																																																																																				0.313	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2		XM_052597	
VHL	7428	broad.mit.edu	37	3	10183739	10183739	+	Nonsense_Mutation	SNP	G	G	T	rs5030802		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina Miseq			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr3:10183739G>T	ENST00000256474.2	+	1	1048	c.208G>T	c.(208-210)Gag>Tag	p.E70*	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Nonsense_Mutation_p.E70*	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	70			E -> K (in VHLD; type I). {ECO:0000269|PubMed:9829912}.|Missing (in VHLD; type I).		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.E70*(8)|p.R69_E70>Q(2)|p.E70fs*85(1)|p.N67fs*59(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.P61fs*61(1)|p.E70fs*90(1)|p.R69fs*89(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GAACTCGCGCGAGCCCTCCCA	0.721		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	17	Substitution - Nonsense(8)|Deletion - Frameshift(5)|Complex - deletion inframe(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	kidney(17)	GRCh37	CM951268|CM984688	VHL	M	rs5030802						9.0	12.0	11.0					3																	10183739		2147	4221	6368	SO:0001587	stop_gained	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.208G>T	3.37:g.10183739G>T	ENSP00000256474:p.Glu70*	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	36	5.756512	0.96898	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	.	.	.	5.43	4.56	0.56223	.	0.306262	0.36002	N	0.002852	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-6.2728	7.9439	0.29974	0.0857:0.1607:0.7536:0.0	rs5030802	.	.	.	X	70	.	ENSP00000256474:E70X	E	+	1	0	VHL	10158739	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	2.129000	0.42055	1.304000	0.44892	0.550000	0.68814	GAG		0.721	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VWA5A	4013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	123988558	123988558	+	Silent	SNP	A	A	G	rs150034934	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr11:123988558A>G	ENST00000456829.2	+	4	473	c.222A>G	c.(220-222)gtA>gtG	p.V74V	VWA5A_ENST00000361352.5_Silent_p.V74V|VWA5A_ENST00000449321.1_Silent_p.V74V|VWA5A_ENST00000360334.4_Silent_p.V74V|VWA5A_ENST00000392748.1_Silent_p.V74V|VWA5A_ENST00000392744.4_Silent_p.V90V	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	74	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.							p.V74V(1)		autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						AGAAAATTGTAGCAGAATTAC	0.413																																																	1	Substitution - coding silent(1)	kidney(1)						A	,,	5,4397	9.9+/-24.2	0,5,2196	99.0	103.0	102.0		222,222,222	1.1	1.0	11	dbSNP_134	102	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	VWA5A	NM_001130142.1,NM_014622.4,NM_198315.2	,,	0,5,6495	GG,GA,AA		0.0,0.1136,0.0385	,,	74/787,74/787,74/416	123988558	5,12995	2201	4299	6500	SO:0001819	synonymous_variant	4013			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.222A>G	11.37:g.123988558A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UN19|Q6UN20|Q9BVF8	Silent	SNP	ENST00000456829.2	37	CCDS8444.1																																																																																				0.413	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1		NM_014622	
ZNF560	147741	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9578114	9578114	+	Silent	SNP	A	A	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:9578114A>C	ENST00000301480.4	-	10	1722	c.1509T>G	c.(1507-1509)ctT>ctG	p.L503L		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L503L(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						AATGAGCAAAAAGAGATGAGA	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											123.0	130.0	128.0					19																	9578114		2203	4300	6503	SO:0001819	synonymous_variant	147741			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1509T>G	19.37:g.9578114A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q495S9|Q495T1	Silent	SNP	ENST00000301480.4	37	CCDS12214.1																																																																																				0.408	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1		NM_152476	
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	G	A	rs113700997	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:52942411G>A	ENST00000332323.6	+	4	1798	c.1737G>A	c.(1735-1737)gcG>gcA	p.A579A	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Silent_p.A566A|ZNF534_ENST00000432303.2_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	579					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A579A(4)		central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CACACCTTGCGCGACATAGGA	0.443																																																	4	Substitution - coding silent(4)	kidney(4)											63.0	62.0	62.0					19																	52942411		692	1591	2283	SO:0001819	synonymous_variant	147658			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1737G>A	19.37:g.52942411G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q76KX9	Silent	SNP	ENST00000332323.6	37	CCDS46165.1																																																																																				0.443	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1		NM_182512	
ZNF652	22834	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	47388778	47388778	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr17:47388778G>T	ENST00000362063.2	-	5	1523	c.1205C>A	c.(1204-1206)tCc>tAc	p.S402Y	ZNF652_ENST00000430262.2_Missense_Mutation_p.S402Y	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S402Y(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			GCTCATGTGGGAGCGTAGCTG	0.453																																																	1	Substitution - Missense(1)	kidney(1)											278.0	241.0	253.0					17																	47388778		2203	4300	6503	SO:0001583	missense	22834			AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1205C>A	17.37:g.47388778G>T	ENSP00000354686:p.Ser402Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPD9|Q5H9Q0	Missense_Mutation	SNP	ENST00000362063.2	37	CCDS32677.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756447	0.89843	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	T;T	0.08008	3.14;3.14	5.61	5.61	0.85477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.22742	0.0549	L	0.43923	1.385	0.58432	D	0.999999	D	0.69078	0.997	D	0.65573	0.936	T	0.00093	-1.2081	10	0.54805	T	0.06	-15.9998	19.2339	0.93850	0.0:0.0:1.0:0.0	.	402	Q9Y2D9	ZN652_HUMAN	Y	402	ENSP00000354686:S402Y;ENSP00000416305:S402Y	ENSP00000354686:S402Y	S	-	2	0	ZNF652	44743777	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.696000	0.84270	2.642000	0.89623	0.650000	0.86243	TCC		0.453	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364524.1		NM_014897	
ZNF761	388561	broad.mit.edu;hgsc.bcm.edu	37	19	53958116	53958116	+	RNA	SNP	T	T	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr19:53958116T>A	ENST00000454407.1	+	0	808							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L65M(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AATCAAAAAGTTGACAGGTAT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											88.0	88.0	88.0					19																	53958116		2203	4300	6503			388561			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958116T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																					0.368	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript			NM_001008401	
ZNF804A	91752	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	185801482	185801482	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ce0a5fc-09ae-412a-8a5b-56d9a44433aa	e8cec496-e3ba-4927-8c01-cb8ad45b56b6	g.chr2:185801482T>G	ENST00000302277.6	+	4	1953	c.1359T>G	c.(1357-1359)atT>atG	p.I453M		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	453							metal ion binding (GO:0046872)	p.I453M(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AACCATCAATTTCCTATAGCT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											92.0	93.0	93.0					2																	185801482		2203	4300	6503	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1359T>G	2.37:g.185801482T>G	ENSP00000303252:p.Ile453Met	Somatic		WXS	Illumina HiSeq	Phase_I	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087817	0.55968	.	.	ENSG00000170396	ENST00000302277	T	0.14893	2.47	5.6	0.173	0.15036	.	0.225703	0.31347	N	0.007802	T	0.21347	0.0514	M	0.65975	2.015	0.31989	N	0.604832	D	0.54047	0.964	P	0.52031	0.688	T	0.25984	-1.0116	10	0.87932	D	0	-9.3222	1.3791	0.02227	0.1343:0.2164:0.1319:0.5174	.	453	Q7Z570	Z804A_HUMAN	M	453	ENSP00000303252:I453M	ENSP00000303252:I453M	I	+	3	3	ZNF804A	185509727	0.999000	0.42202	0.992000	0.48379	0.989000	0.77384	0.435000	0.21510	-0.190000	0.10465	0.482000	0.46254	ATT		0.348	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1		NM_194250	
