#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA8	10351	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	66881449	66881449	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr17:66881449A>G	ENST00000269080.2	-	25	3454	c.3317T>C	c.(3316-3318)gTa>gCa	p.V1106A	ABCA8_ENST00000586539.1_Missense_Mutation_p.V1146A|ABCA8_ENST00000430352.2_Missense_Mutation_p.V1146A	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1106					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.V1106A(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CACAGAGAATACAGTGACCTA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											73.0	68.0	70.0					17																	66881449		2203	4300	6503	SO:0001583	missense	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3317T>C	17.37:g.66881449A>G	ENSP00000269080:p.Val1106Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	A	8.494	0.862704	0.17178	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.83250	-1.7;-1.7	4.43	2.21	0.28008	.	1.892740	0.02715	N	0.113266	T	0.72724	0.3496	N	0.17082	0.46	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.12837	0.005;0.001;0.008	T	0.59231	-0.7493	10	0.51188	T	0.08	.	6.0925	0.20003	0.7969:0.0:0.2031:0.0	.	1146;1146;1106	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	A	1106;1146	ENSP00000269080:V1106A;ENSP00000402814:V1146A	ENSP00000269080:V1106A	V	-	2	0	ABCA8	64393044	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.654000	0.24918	0.464000	0.27142	0.533000	0.62120	GTA		0.353	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1		NM_007168	
ADPRHL1	113622	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	114107552	114107552	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr13:114107552C>G	ENST00000375418.3	-	1	287	c.201G>C	c.(199-201)gaG>gaC	p.E67D		NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	67					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)	p.E67D(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			TGGTGAGGGCCTCGGCGGTTG	0.642																																																	1	Substitution - Missense(1)	kidney(1)											102.0	85.0	90.0					13																	114107552		2203	4300	6503	SO:0001583	missense	113622			AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.201G>C	13.37:g.114107552C>G	ENSP00000364567:p.Glu67Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JUG2|Q96GD1	Missense_Mutation	SNP	ENST00000375418.3	37	CCDS9535.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030951	0.54790	.	.	ENSG00000153531	ENST00000375418	T	0.34667	1.35	5.73	3.99	0.46301	.	0.302391	0.34700	N	0.003745	T	0.27594	0.0678	L	0.47716	1.5	0.33353	D	0.571372	P	0.36354	0.549	B	0.34536	0.185	T	0.34976	-0.9807	10	0.23302	T	0.38	-14.1943	8.6898	0.34260	0.0:0.7116:0.0:0.2884	.	67	Q8NDY3	ARHL1_HUMAN	D	67	ENSP00000364567:E67D	ENSP00000364567:E67D	E	-	3	2	ADPRHL1	113155553	1.000000	0.71417	0.616000	0.29078	0.649000	0.38597	1.577000	0.36515	0.753000	0.32945	0.655000	0.94253	GAG		0.642	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045915.2		NM_138430	
AIM1	202	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	106968602	106968602	+	Silent	SNP	G	G	A	rs200098719	byFrequency	TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr6:106968602G>A	ENST00000369066.3	+	2	2782	c.2295G>A	c.(2293-2295)ccG>ccA	p.P765P		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.P765P(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AAATGTCACCGGCTTTACATT	0.453													G|||	2	0.000399361	0.0	0.0	5008	,	,		20845	0.0		0.0	False		,,,				2504	0.002																1	Substitution - coding silent(1)	kidney(1)											75.0	75.0	75.0					6																	106968602		2203	4300	6503	SO:0001819	synonymous_variant	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2295G>A	6.37:g.106968602G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	37	CCDS34506.1																																																																																				0.453	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			
ANKRD13C	81573	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	70766485	70766485	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:70766485C>A	ENST00000370944.4	-	7	1196	c.883G>T	c.(883-885)Gac>Tac	p.D295Y	ANKRD13C_ENST00000262346.6_Missense_Mutation_p.D260Y	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	295					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)	p.D295Y(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						TGTTCATTGTCTAATACTACA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											62.0	58.0	60.0					1																	70766485		2203	4300	6503	SO:0001583	missense	81573				CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.883G>T	1.37:g.70766485C>A	ENSP00000359982:p.Asp295Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Missense_Mutation	SNP	ENST00000370944.4	37	CCDS648.2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746961	0.89663	.	.	ENSG00000118454	ENST00000370944;ENST00000262346	T;T	0.55052	0.54;0.54	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.73281	0.3567	M	0.91038	3.17	0.80722	D	1	D;P	0.57899	0.981;0.762	P;P	0.60682	0.878;0.869	T	0.80476	-0.1366	10	0.87932	D	0	.	18.9114	0.92487	0.0:1.0:0.0:0.0	.	260;295	Q8N6S4-2;Q8N6S4	.;AN13C_HUMAN	Y	295;260	ENSP00000359982:D295Y;ENSP00000262346:D260Y	ENSP00000262346:D260Y	D	-	1	0	ANKRD13C	70539073	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.656000	0.83736	2.479000	0.83701	0.557000	0.71058	GAC		0.363	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025903.1		NM_030816	
BMS1	9790	hgsc.bcm.edu	37	10	43315792	43315792	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr10:43315792delT	ENST00000374518.5	+	16	2752	c.2689delT	c.(2689-2691)tttfs	p.F897fs		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	897					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TCCCTGTGAATTTGTGCAGAA	0.478																																																	0													106.0	104.0	105.0					10																	43315792		2203	4300	6503	SO:0001589	frameshift_variant	9790			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2689delT	10.37:g.43315792delT	ENSP00000363642:p.Phe897fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5QPT5|Q86XJ9	Frame_Shift_Del	DEL	ENST00000374518.5	37	CCDS7199.1																																																																																				0.478	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2		NM_014753	
CABLES1	91768	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	20716478	20716478	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr18:20716478C>T	ENST00000256925.7	+	1	752	c.752C>T	c.(751-753)gCc>gTc	p.A251V	CABLES1_ENST00000400473.2_Intron|AC105247.1_ENST00000411067.1_RNA	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	251	Interacts with CDK3. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)	p.A251V(1)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTGCCCATCGCCTTCTCCAGG	0.682																																																	1	Substitution - Missense(1)	kidney(1)											17.0	20.0	19.0					18																	20716478		2001	4168	6169	SO:0001583	missense	91768			BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.752C>T	18.37:g.20716478C>T	ENSP00000256925:p.Ala251Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	37	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483455	0.44147	.	.	ENSG00000134508	ENST00000256925	T	0.50813	0.73	3.66	1.72	0.24424	.	0.214853	0.39146	N	0.001446	T	0.30696	0.0773	N	0.22421	0.69	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.06075	-1.0847	10	0.54805	T	0.06	-17.0022	8.7308	0.34498	0.0:0.7491:0.1529:0.098	.	251	Q8TDN4	CABL1_HUMAN	V	251	ENSP00000256925:A251V	ENSP00000256925:A251V	A	+	2	0	CABLES1	18970476	0.996000	0.38824	0.992000	0.48379	0.727000	0.41649	1.845000	0.39279	0.006000	0.14734	-1.598000	0.00824	GCC		0.682	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2		NM_138375	
CLCA2	9635	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	86913358	86913358	+	Silent	SNP	T	T	C			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:86913358T>C	ENST00000370565.4	+	11	2043	c.1881T>C	c.(1879-1881)aaT>aaC	p.N627N		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	627					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.N627N(1)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TTTATGCCAATGTGAAACAGG	0.507																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)												1	Substitution - coding silent(1)	kidney(1)											134.0	127.0	130.0					1																	86913358		2203	4300	6503	SO:0001819	synonymous_variant	9635				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1881T>C	1.37:g.86913358T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K2T3|Q9Y6N2	Silent	SNP	ENST00000370565.4	37	CCDS708.1																																																																																				0.507	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1		NM_006536	
PBDC1	51260	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	75397644	75397644	+	Silent	SNP	A	A	G			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chrX:75397644A>G	ENST00000373358.3	+	6	806	c.603A>G	c.(601-603)aaA>aaG	p.K201K	PBDC1_ENST00000373357.3_Missense_Mutation_p.K164R	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	201								p.K201K(1)									gagaagaaaaagaggaaggaa	0.403																																																	1	Substitution - coding silent(1)	kidney(1)											114.0	109.0	111.0					X																	75397644		2203	4296	6499	SO:0001819	synonymous_variant	0			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.603A>G	X.37:g.75397644A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000373358.3	37	CCDS14432.1	.	.	.	.	.	.	.	.	.	.	A	1.406	-0.576790	0.03854	.	.	ENSG00000102390	ENST00000373357	.	.	.	2.72	-1.98	0.07480	.	6.044570	0.00639	N	0.000504	T	0.35248	0.0925	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25187	-1.0139	6	0.66056	D	0.02	.	3.3976	0.07311	0.3652:0.2348:0.4:0.0	.	.	.	.	R	164	.	ENSP00000362455:K164R	K	+	2	0	CXorf26	75314047	1.000000	0.71417	0.261000	0.24466	0.188000	0.23474	1.497000	0.35649	-0.552000	0.06167	0.483000	0.47432	AAG		0.403	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1		NM_016500	
LOC101927755	101927755	broad.mit.edu	37	17	58066651	58066651	+	lincRNA	SNP	C	C	T	rs376360537		TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr17:58066651C>T	ENST00000586209.1	+	0	158																											ACTGGTAAAGCTGTTTAAGAG	0.333																																																	0																																												0																															17.37:g.58066651C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000586209.1	37																																																																																					0.333	RP11-178C3.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449162.1			
DNAH11	8701	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	21639591	21639591	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr7:21639591C>T	ENST00000409508.3	+	15	2885	c.2854C>T	c.(2854-2856)Cct>Tct	p.P952S	DNAH11_ENST00000328843.6_Missense_Mutation_p.P952S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	952	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P952S(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GATCTTGTTGCCTCCTGAGAT	0.393									Kartagener syndrome																																								1	Substitution - Missense(1)	kidney(1)											82.0	78.0	79.0					7																	21639591		1846	4091	5937	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2854C>T	7.37:g.21639591C>T	ENSP00000475939:p.Pro952Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	4.360	0.066314	0.08388	.	.	ENSG00000105877	ENST00000328843	T	0.21031	2.03	5.72	4.79	0.61399	.	0.336972	0.30930	N	0.008599	T	0.08179	0.0204	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.39272	-0.9622	9	0.09590	T	0.72	.	4.2519	0.10698	0.1321:0.5497:0.2321:0.0861	.	952	Q96DT5	DYH11_HUMAN	S	952	ENSP00000330671:P952S	ENSP00000330671:P952S	P	+	1	0	DNAH11	21606116	0.000000	0.05858	0.998000	0.56505	0.807000	0.45602	0.594000	0.24014	2.865000	0.98341	0.655000	0.94253	CCT		0.393	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6		NM_003777	
EPS8L2	64787	broad.mit.edu	37	11	726936	726936	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr11:726936G>C	ENST00000533256.1	+	22	2478	c.2103G>C	c.(2101-2103)atG>atC	p.M701I	EPS8L2_ENST00000534449.1_Intron|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Missense_Mutation_p.M701I|EPS8L2_ENST00000530636.1_Missense_Mutation_p.M701I|EPS8L2_ENST00000526198.1_Missense_Mutation_p.M717I			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	701					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)	p.M701I(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGAACTCATGAACAAGTTTC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											40.0	38.0	39.0					11																	726936		2202	4300	6502	SO:0001583	missense	64787			AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.2103G>C	11.37:g.726936G>C	ENSP00000435585:p.Met701Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985410	0.53934	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	4.14	4.14	0.48551	.	0.138296	0.42821	U	0.000657	T	0.13927	0.0337	L	0.46819	1.47	0.40909	D	0.984215	B;B	0.10296	0.003;0.002	B;B	0.08055	0.002;0.003	T	0.04294	-1.0962	10	0.62326	D	0.03	-43.5183	12.3108	0.54927	0.0:0.0:1.0:0.0	.	717;701	B7ZKL3;Q9H6S3	.;ES8L2_HUMAN	I	701;701;701;717	ENSP00000320828:M701I;ENSP00000435585:M701I;ENSP00000436035:M701I;ENSP00000436230:M717I	ENSP00000320828:M701I	M	+	3	0	EPS8L2	716936	0.993000	0.37304	0.989000	0.46669	0.978000	0.69477	1.230000	0.32612	2.034000	0.60081	0.561000	0.74099	ATG		0.627	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1		NM_022772	
GALNT1	2589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	33272259	33272259	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr18:33272259C>A	ENST00000269195.5	+	8	1377	c.1274C>A	c.(1273-1275)cCa>cAa	p.P425Q	GALNT1_ENST00000537549.1_Missense_Mutation_p.P365Q	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	425					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P425Q(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						TCTCAAATTCCACGTCACTAT	0.299																																																	1	Substitution - Missense(1)	kidney(1)											108.0	105.0	106.0					18																	33272259		2203	4298	6501	SO:0001583	missense	2589				CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.1274C>A	18.37:g.33272259C>A	ENSP00000269195:p.Pro425Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.795892	0.90453	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.65732	-0.17;-0.17	5.6	5.6	0.85130	Ricin B-related lectin (1);	0.000000	0.85682	D	0.000000	D	0.84474	0.5480	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.88117	0.2829	10	0.72032	D	0.01	.	17.1142	0.86684	0.0:1.0:0.0:0.0	.	425	Q10472	GALT1_HUMAN	Q	425;425;365	ENSP00000269195:P425Q;ENSP00000440910:P365Q	ENSP00000269195:P425Q	P	+	2	0	GALNT1	31526257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.636000	0.89361	0.655000	0.94253	CCA		0.299	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2		NM_020474	
GNG3	2785	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62475843	62475843	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr11:62475843G>T	ENST00000294117.5	+	2	335	c.76G>T	c.(76-78)Gaa>Taa	p.E26*	BSCL2_ENST00000421906.1_5'Flank|BSCL2_ENST00000403550.1_5'Flank|HNRNPUL2-BSCL2_ENST00000403734.2_Intron|BSCL2_ENST00000433053.1_Intron|BSCL2_ENST00000407022.3_5'Flank|BSCL2_ENST00000360796.5_5'Flank|BSCL2_ENST00000405837.1_Intron|BSCL2_ENST00000278893.7_5'Flank|BSCL2_ENST00000537604.1_5'Flank	NM_012202.4	NP_036334.1	P63215	GBG3_HUMAN	guanine nucleotide binding protein (G protein), gamma 3	26					activation of MAPK activity (GO:0000187)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)	p.E26*(1)		kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	5						GCTTAAGATTGAAGCCAGCTT	0.522																																																	1	Substitution - Nonsense(1)	kidney(1)											148.0	137.0	141.0					11																	62475843		2202	4299	6501	SO:0001587	stop_gained	2785			AF075042	CCDS8032.1	11p11	2008-07-18				ENSG00000162188			4405	protein-coding gene	gene with protein product	"""guanine nucleotide-binding protein gamma-3 subunit"", ""NBP gamma-3"""	608941				10644457	Standard	NM_012202		Approved		uc001nuv.4	P63215		ENST00000294117.5:c.76G>T	11.37:g.62475843G>T	ENSP00000294117:p.Glu26*	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4S7|P29798|Q61014	Nonsense_Mutation	SNP	ENST00000294117.5	37	CCDS8032.1	.	.	.	.	.	.	.	.	.	.	G	37	6.163708	0.97338	.	.	ENSG00000162188	ENST00000294117	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.4826	16.5279	0.84336	0.0:0.0:1.0:0.0	.	.	.	.	X	26	.	ENSP00000294117:E26X	E	+	1	0	GNG3	62232419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.200000	0.95010	2.559000	0.86315	0.558000	0.71614	GAA		0.522	GNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395020.1		NM_012202	
HOXD4	3233	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	177016412	177016412	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr2:177016412C>G	ENST00000306324.3	+	1	463	c.51C>G	c.(49-51)ttC>ttG	p.F17L	HOXD3_ENST00000468418.3_5'UTR|MIR10B_ENST00000385011.1_RNA	NM_014621.2	NP_055436.2	P09016	HXD4_HUMAN	homeobox D4	17					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F17L(1)		kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		ACCCCAAGTTCCCTCCGTGCG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											48.0	52.0	50.0					2																	177016412		2187	4235	6422	SO:0001583	missense	3233				CCDS2269.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170166	ENSG00000170166		"""Homeoboxes / ANTP class : HOXL subclass"""	5138	protein-coding gene	gene with protein product		142981	"""homeo box D4"""	HOX4B, HOX4		1973146, 1358459	Standard	NM_014621		Approved		uc002uks.3	P09016	OTTHUMG00000132515	ENST00000306324.3:c.51C>G	2.37:g.177016412C>G	ENSP00000302548:p.Phe17Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9R3|Q96AU0	Missense_Mutation	SNP	ENST00000306324.3	37	CCDS2269.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447955	0.63178	.	.	ENSG00000170166	ENST00000306324	T	0.59772	0.24	5.12	-1.86	0.07760	.	0.249724	0.40728	N	0.001026	T	0.76364	0.3977	M	0.91717	3.235	0.53005	D	0.999968	D	0.89917	1.0	D	0.83275	0.996	T	0.78540	-0.2165	10	0.87932	D	0	.	11.2747	0.49159	0.0:0.3812:0.0:0.6188	.	17	P09016	HXD4_HUMAN	L	17	ENSP00000302548:F17L	ENSP00000302548:F17L	F	+	3	2	HOXD4	176724658	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	2.070000	0.41491	-0.223000	0.09943	0.655000	0.94253	TTC		0.542	HOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255697.2			
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	TCGCTGTCGCCA	TCGCTGTCGCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374																2	Deletion - In frame(2)	large_intestine(1)|breast(1)								958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				SO:0001651	inframe_deletion	256949			AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic		WXS	Illumina GAIIx	Phase_I	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	ENST00000593649.1	37																																																																																					0.717	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1		NM_198471	
KCNN3	3782	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	154705482	154705482	+	Silent	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:154705482G>A	ENST00000271915.4	-	4	1902	c.1587C>T	c.(1585-1587)atC>atT	p.I529I	KCNN3_ENST00000361147.4_Silent_p.I224I|KCNN3_ENST00000358505.2_Silent_p.I216I	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	534					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.I224I(1)|p.I529I(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	TACTCACCATGATGCCAGTGA	0.532																																																	2	Substitution - coding silent(2)	kidney(2)											122.0	95.0	104.0					1																	154705482		2203	4300	6503	SO:0001819	synonymous_variant	3782			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1587C>T	1.37:g.154705482G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																				0.532	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3		NM_002249	
KCTD7	154881	hgsc.bcm.edu;ucsc.edu	37	7	66103415	66103415	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr7:66103415A>G	ENST00000275532.3	+	3	674	c.490A>G	c.(490-492)Aaa>Gaa	p.K164E	KCTD7_ENST00000443322.1_Missense_Mutation_p.K164E	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	164					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCCTATTACAAAGGTGAGGG	0.577																																																	0													77.0	64.0	69.0					7																	66103415		2203	4300	6503	SO:0001583	missense	154881			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.490A>G	7.37:g.66103415A>G	ENSP00000275532:p.Lys164Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	37	CCDS5534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	19.16|19.16	3.773324|3.773324	0.69992|0.69992	.|.	.|.	ENSG00000243335|ENSG00000243335	ENST00000275532;ENST00000443322|ENST00000449064	T;T|.	0.77877|.	-1.13;-1.13|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.38058	.|N	.|0.001839	T|T	0.62672|0.62672	0.2447|0.2447	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	B|.	0.16802|.	0.019|.	B|.	0.11329|.	0.006|.	T|T	0.66440|0.66440	-0.5923|-0.5923	9|7	0.11485|0.87932	T|D	0.65|0	.|.	14.3083|14.3083	0.66397|0.66397	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	164|.	Q96MP8|.	KCTD7_HUMAN|.	E|R	164|107	ENSP00000275532:K164E;ENSP00000411624:K164E|.	ENSP00000275532:K164E|ENSP00000388463:Q107R	K|Q	+|+	1|2	0|0	KCTD7|KCTD7	65740850|65740850	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	6.684000|6.684000	0.74538|0.74538	2.164000|2.164000	0.68074|0.68074	0.533000|0.533000	0.62120|0.62120	AAA|CAA		0.577	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2		NM_153033	
KCTD7	154881	hgsc.bcm.edu;ucsc.edu	37	7	66103415	66103415	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr7:66103415delA	ENST00000275532.3	+	3	674	c.490delA	c.(490-492)aaafs	p.K164fs	KCTD7_ENST00000443322.1_Frame_Shift_Del_p.K164fs	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	164					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCCTATTACAAAGGTGAGGG	0.577																																																	0													77.0	64.0	69.0					7																	66103415		2203	4300	6503	SO:0001589	frameshift_variant	154881			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.490delA	7.37:g.66103415delA	ENSP00000275532:p.Lys164fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2M4|Q8IVR0	Frame_Shift_Del	DEL	ENST00000275532.3	37	CCDS5534.1																																																																																				0.577	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2		NM_153033	
KIAA1244	57221	hgsc.bcm.edu;ucsc.edu	37	6	138601236	138601236	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr6:138601236delT	ENST00000251691.4	+	14	2562	c.2396delT	c.(2395-2397)cttfs	p.L799fs		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGGAACATGCTTGGAGAGGCT	0.572																																																	0													103.0	89.0	94.0					6																	138601236		2203	4300	6503	SO:0001589	frameshift_variant	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.2396delT	6.37:g.138601236delT	ENSP00000251691:p.Leu799fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000251691.4	37	CCDS5189.2																																																																																				0.572	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4		NM_020340	
MAPKBP1	23005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42108803	42108803	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr15:42108803C>A	ENST00000456763.2	+	14	1754	c.1558C>A	c.(1558-1560)Cat>Aat	p.H520N	MAPKBP1_ENST00000514566.1_Missense_Mutation_p.H514N|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.H514N|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.H397N|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.H353N	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	520								p.H514N(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GGTGGAGGCCCATGACTCTGA	0.577																																																	1	Substitution - Missense(1)	kidney(1)											90.0	74.0	80.0					15																	42108803		2203	4300	6503	SO:0001583	missense	23005			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1558C>A	15.37:g.42108803C>A	ENSP00000393099:p.His520Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	c	35	5.505908	0.96371	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.72394	0.77;0.77;0.51;-0.65;0.51	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90397	0.6994	H	0.96861	3.895	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	0.995;0.999;0.998;1.0;1.0	D	0.92745	0.6211	10	0.87932	D	0	-12.4383	20.2985	0.98592	0.0:1.0:0.0:0.0	.	353;397;514;520;514	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	N	514;397;353;520;514	ENSP00000397570:H514N;ENSP00000221214:H397N;ENSP00000260357:H353N;ENSP00000393099:H520N;ENSP00000426154:H514N	ENSP00000221214:H397N	H	+	1	0	MAPKBP1	39896095	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.623000	0.83113	2.793000	0.96121	0.655000	0.94253	CAT		0.577	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1		NM_014994	
NAV1	89796	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	201751584	201751584	+	Silent	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:201751584C>T	ENST00000367296.4	+	6	2364	c.1944C>T	c.(1942-1944)agC>agT	p.S648S	NAV1_ENST00000295624.6_Silent_p.S648S|NAV1_ENST00000367300.3_Silent_p.S648S|NAV1_ENST00000367297.4_Silent_p.S648S|NAV1_ENST00000367295.1_Silent_p.S257S|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Silent_p.S661S	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	648					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.S648S(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GCAAGACTAGCTTAGATGTTT	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											84.0	87.0	86.0					1																	201751584		2203	4300	6503	SO:0001819	synonymous_variant	89796			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1944C>T	1.37:g.201751584C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	C	8.504	0.864856	0.17250	.	.	ENSG00000134369	ENST00000430015	.	.	.	5.8	2.93	0.34026	.	.	.	.	.	T	0.59500	0.2198	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52917	-0.8511	4	.	.	.	-31.1504	10.3196	0.43758	0.0:0.7898:0.0:0.2102	.	.	.	.	F	206	.	.	L	+	1	0	NAV1	200018207	0.994000	0.37717	0.089000	0.20774	0.990000	0.78478	1.484000	0.35508	0.373000	0.24621	0.655000	0.94253	CTT		0.552	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1		NM_020443	
NCAN	1463	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19329874	19329874	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:19329874G>T	ENST00000252575.6	+	3	323	c.224G>T	c.(223-225)cGg>cTg	p.R75L		NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	75	Ig-like V-type.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.R89L(1)|p.R75L(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GATGCCCCTCGGATAAAGTGG	0.657																																																	2	Substitution - Missense(2)	kidney(2)											49.0	45.0	46.0					19																	19329874		2203	4300	6503	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.224G>T	19.37:g.19329874G>T	ENSP00000252575:p.Arg75Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369316	0.82463	.	.	ENSG00000130287	ENST00000539499;ENST00000252575	T	0.66280	-0.2	4.55	4.55	0.56014	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34750	N	0.003709	T	0.81235	0.4780	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85254	0.1046	10	0.87932	D	0	-26.0897	14.8061	0.69956	0.0:0.0:1.0:0.0	.	75	O14594	NCAN_HUMAN	L	89;75	ENSP00000252575:R75L	ENSP00000252575:R75L	R	+	2	0	NCAN	19190874	1.000000	0.71417	0.991000	0.47740	0.671000	0.39405	9.198000	0.94994	2.060000	0.61445	0.491000	0.48974	CGG		0.657	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2		NM_004386	
NCKAP5	344148	broad.mit.edu;ucsc.edu	37	2	133540492	133540492	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr2:133540492G>A	ENST00000409261.1	-	14	4265	c.3892C>T	c.(3892-3894)Cgc>Tgc	p.R1298C	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R1298C	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1298								p.R1298C(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATCTGAGTGCGGACTTTGCCT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											85.0	86.0	85.0					2																	133540492		1963	4160	6123	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3892C>T	2.37:g.133540492G>A	ENSP00000387128:p.Arg1298Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539279	0.65085	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.29917	1.55;1.55	5.5	5.5	0.81552	.	0.000000	0.33075	U	0.005314	T	0.47021	0.1423	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.41360	-0.9513	10	0.87932	D	0	.	17.7704	0.88490	0.0:0.0:1.0:0.0	.	1298	O14513	NCKP5_HUMAN	C	1298	ENSP00000387128:R1298C;ENSP00000380603:R1298C	ENSP00000380603:R1298C	R	-	1	0	NCKAP5	133256962	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.549000	0.53681	2.854000	0.98071	0.655000	0.94253	CGC		0.562	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1		NM_207481	
NOL8	55035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	95077535	95077535	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr9:95077535C>T	ENST00000535387.1	-	6	1371	c.1372G>A	c.(1372-1374)Gat>Aat	p.D458N	NOL8_ENST00000545558.1_Missense_Mutation_p.D458N|NOL8_ENST00000542053.1_Missense_Mutation_p.D390N|NOL8_ENST00000358855.4_Missense_Mutation_p.D390N|NOL8_ENST00000442668.2_Missense_Mutation_p.D458N					nucleolar protein 8									p.D460N(1)|p.D458N(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						GAATCAGCATCTTCACTGCTA	0.393																																																	2	Substitution - Missense(2)	kidney(2)											62.0	59.0	60.0					9																	95077535		1912	4133	6045	SO:0001583	missense	55035			AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.1372G>A	9.37:g.95077535C>T	ENSP00000441300:p.Asp458Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000535387.1	37	CCDS47993.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257743	0.39896	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670	T;T;T;T;T;T	0.19669	2.39;2.39;2.39;2.62;2.39;2.13	5.25	1.3	0.21679	.	0.837401	0.10918	N	0.619806	T	0.13543	0.0328	L	0.27053	0.805	0.09310	N	1	B	0.20780	0.048	B	0.18561	0.022	T	0.29518	-1.0009	10	0.33940	T	0.23	-5.6827	7.1807	0.25770	0.0:0.4071:0.0:0.5929	.	458	Q76FK4	NOL8_HUMAN	N	458;460;390;458;458;390;458	ENSP00000401177:D458N;ENSP00000351723:D390N;ENSP00000441140:D458N;ENSP00000441300:D458N;ENSP00000440709:D390N;ENSP00000414112:D458N	ENSP00000351723:D390N	D	-	1	0	NOL8	94117356	0.008000	0.16893	0.035000	0.18076	0.955000	0.61496	1.292000	0.33342	0.303000	0.22785	0.655000	0.94253	GAT		0.393	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2		NM_017948	
NXPH4	11247	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57619419	57619419	+	Silent	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr12:57619419G>A	ENST00000349394.5	+	2	991	c.816G>A	c.(814-816)aaG>aaA	p.K272K	Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	272	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.K272K(2)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						TCTGTGCCAAGCCCTTCAAAG	0.577																																																	2	Substitution - coding silent(2)	kidney(2)											58.0	64.0	62.0					12																	57619419		2203	4300	6503	SO:0001819	synonymous_variant	11247			AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.816G>A	12.37:g.57619419G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4I4|Q7Z6L3|Q8N462	Silent	SNP	ENST00000349394.5	37	CCDS8933.1																																																																																				0.577	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1		NM_007224	
OGFR	11054	hgsc.bcm.edu	37	20	61444720	61444720	+	Missense_Mutation	SNP	A	A	C	rs79127826	byFrequency	TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr20:61444720A>C	ENST00000290291.6	+	7	1778	c.1753A>C	c.(1753-1755)Agc>Cgc	p.S585R	OGFR_ENST00000370461.1_Missense_Mutation_p.S533R	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	585	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCCAGGCCCCAGCCCGGCAGG	0.746													A|||	22	0.00439297	0.0091	0.0029	5008	,	,		8761	0.005		0.001	False		,,,				2504	0.002																0								A	ARG/SER	6,3976		0,6,1985	6.0	13.0	11.0		1753	1.6	0.0	20	dbSNP_131	11	7,8255		0,7,4124	no	missense	OGFR	NM_007346.2	110	0,13,6109	CC,CA,AA		0.0847,0.1507,0.1062	benign	585/678	61444720	13,12231	1991	4131	6122	SO:0001583	missense	11054			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1753A>C	20.37:g.61444720A>C	ENSP00000290291:p.Ser585Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	N	5.084	0.201077	0.09652	0.001507	8.47E-4	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.13089	2.62;2.62	1.58	1.58	0.23477	.	.	.	.	.	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	B;B;B	0.17465	0.022;0.022;0.022	B;B;B	0.11329	0.004;0.004;0.006	T	0.39057	-0.9632	9	0.28530	T	0.3	.	8.2141	0.31501	1.0:0.0:0.0:0.0	.	585;568;585	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	R	585;565;420;533	ENSP00000290291:S585R;ENSP00000359491:S533R	ENSP00000290291:S585R	S	+	1	0	OGFR	60915165	0.000000	0.05858	0.005000	0.12908	0.068000	0.16541	-2.717000	0.00813	0.680000	0.31366	0.076000	0.15429	AGC		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1			
OGFR	11054	hgsc.bcm.edu	37	20	61444725	61444725	+	Silent	SNP	G	G	A	rs74520364		TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr20:61444725G>A	ENST00000290291.6	+	7	1783	c.1758G>A	c.(1756-1758)ccG>ccA	p.P586P	OGFR_ENST00000370461.1_Silent_p.P534P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	586	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GCCCCAGCCCGGCAGGACCTA	0.741																																																	0								A		0,4046		0,0,2023	7.0	14.0	12.0		1758	-3.2	0.0	20	dbSNP_131	12	9,8325		0,9,4158	no	coding-synonymous	OGFR	NM_007346.2		0,9,6181	AA,AG,GG		0.108,0.0,0.0727		586/678	61444725	9,12371	2023	4167	6190	SO:0001819	synonymous_variant	11054			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1758G>A	20.37:g.61444725G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																				0.741	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1			
SNHG14	104472715	broad.mit.edu;hgsc.bcm.edu	37	15	25456944	25456944	+	RNA	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr15:25456944G>A	ENST00000424208.1	+	0	2516				SNHG14_ENST00000450809.1_RNA|SNORD115-23_ENST00000364461.1_RNA|SNHG14_ENST00000424333.1_RNA|SNORD115-24_ENST00000363528.1_RNA|SNORD115-22_ENST00000364456.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		CCCTGGGTTGGGTCAATGATG	0.532																																																	0													263.0	274.0	270.0					15																	25456944		876	1991	2867			347745					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25456944G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000424208.1	37																																																																																					0.532	SNHG14-002	KNOWN	basic	antisense	processed_transcript	OTTHUMT00000126729.2			
PLA2G4F	255189	broad.mit.edu;hgsc.bcm.edu	37	15	42446347	42446347	+	Silent	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr15:42446347G>A	ENST00000382396.4	-	4	479	c.393C>T	c.(391-393)gaC>gaT	p.D131D	PLA2G4F_ENST00000397272.3_Silent_p.D131D			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	131	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)	p.D131D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GGCTTCTCAGGTCAAACAGGA	0.612																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	88.0	91.0					15																	42446347		2203	4299	6502	SO:0001819	synonymous_variant	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.393C>T	15.37:g.42446347G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZMC8	Silent	SNP	ENST00000382396.4	37	CCDS32204.1																																																																																				0.612	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1		NM_213600	
PPBPP2	10895	broad.mit.edu	37	4	74919821	74919821	+	RNA	SNP	G	G	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr4:74919821G>T	ENST00000513150.1	-	0	1295					NR_026769.1				pro-platelet basic protein pseudogene 2																		GGTCCAGGCAGATTTTTTCTC	0.403																																																	0																																												0			L10403		4q13.3	2012-04-20	2012-04-20	2012-04-20	ENSG00000248848	ENSG00000248848			16981	pseudogene	pseudogene		611591	"""pro-platelet basic protein-like 2"""	PPBPL2		7887923	Standard	NR_026769		Approved	SPBPBP	uc010iim.1		OTTHUMG00000160862		4.37:g.74919821G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000513150.1	37																																																																																					0.403	PPBPP2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362726.1			
PTCHD2	57540	broad.mit.edu;ucsc.edu	37	1	11579432	11579432	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:11579432G>A	ENST00000294484.6	+	8	2048	c.1910G>A	c.(1909-1911)cGg>cAg	p.R637Q	PTCHD2_ENST00000389575.3_Missense_Mutation_p.R637Q	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	637					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.R854Q(2)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		AATTGCAGCCGGAAGACCTCC	0.647																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											110.0	122.0	118.0					1																	11579432		1992	4165	6157	SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1910G>A	1.37:g.11579432G>A	ENSP00000294484:p.Arg637Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	g	12.95	2.091474	0.36952	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.85702	-2.02;-2.02	5.42	-0.844	0.10741	.	0.696678	0.13806	N	0.361480	T	0.76256	0.3962	L	0.43152	1.355	0.09310	N	0.999998	B	0.16166	0.016	B	0.15870	0.014	T	0.59910	-0.7365	10	0.27082	T	0.32	-8.9728	9.2024	0.37268	0.5809:0.0:0.4191:0.0	.	637	Q9P2K9	PTHD2_HUMAN	Q	637	ENSP00000294484:R637Q;ENSP00000374226:R637Q	ENSP00000294484:R637Q	R	+	2	0	PTCHD2	11502019	0.010000	0.17322	0.685000	0.30070	0.374000	0.29953	0.712000	0.25779	-0.185000	0.10550	-0.130000	0.14895	CGG		0.647	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2		XM_052561	
RBM8A	9939	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	145508564	145508564	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:145508564A>C	ENST00000330165.8	+	4	364	c.295A>C	c.(295-297)Att>Ctt	p.I99L	RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RBM8A_ENST00000369307.3_Missense_Mutation_p.I98L|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A	99	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.I99L(1)		kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATATGGGGAAATTAAAAACAT	0.438																																																	1	Substitution - Missense(1)	kidney(1)											115.0	108.0	111.0					1																	145508564		2203	4300	6503	SO:0001583	missense	9939			AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.295A>C	1.37:g.145508564A>C	ENSP00000333001:p.Ile99Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Missense_Mutation	SNP	ENST00000330165.8	37	CCDS916.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638114	0.87760	.	.	ENSG00000131795	ENST00000330165;ENST00000369307	T;T	0.78246	-1.16;-1.16	4.32	4.32	0.51571	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.74007	0.3660	M	0.69823	2.125	0.58432	D	0.999998	P;P	0.36974	0.521;0.576	P;P	0.46419	0.479;0.516	T	0.78237	-0.2282	10	0.59425	D	0.04	-14.3008	9.7896	0.40697	1.0:0.0:0.0:0.0	.	98;99	Q9Y5S9-2;Q9Y5S9	.;RBM8A_HUMAN	L	99;98	ENSP00000333001:I99L;ENSP00000358313:I98L	ENSP00000333001:I99L	I	+	1	0	RBM8A	144219921	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.028000	0.88798	1.835000	0.53391	0.459000	0.35465	ATT		0.438	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038503.2		NM_005105	
RFWD2	64326	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	176055007	176055007	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr1:176055007T>C	ENST00000367669.3	-	10	1560	c.1046A>G	c.(1045-1047)tAt>tGt	p.Y349C	RFWD2_ENST00000308769.8_Missense_Mutation_p.Y325C	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	349					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)	p.Y349C(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CGTGCTATTATACCAAGGCTG	0.338																																					Ovarian(134;1413 1765 5706 35534 51541)												1	Substitution - Missense(1)	kidney(1)											106.0	98.0	101.0					1																	176055007		2203	4300	6503	SO:0001583	missense	64326			AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1046A>G	1.37:g.176055007T>C	ENSP00000356641:p.Tyr349Cys	Somatic		WXS	Illumina HiSeq	Phase_I	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	37	CCDS30944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.3|23.3	4.401069|4.401069	0.83120|0.83120	.|.	.|.	ENSG00000143207|ENSG00000143207	ENST00000459744|ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769;ENST00000498306	.|T;T;T	.|0.12361	.|2.69;2.69;2.69	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.26376|0.26376	0.0644|0.0644	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D;D;P;D;D	.|0.76494	.|0.987;0.997;0.95;0.999;0.997	.|P;P;P;D;P	.|0.66602	.|0.857;0.712;0.722;0.945;0.844	T|T	0.00790|0.00790	-1.1565|-1.1565	5|10	.|0.38643	.|T	.|0.18	-15.2247|-15.2247	15.1669|15.1669	0.72837|0.72837	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|124;109;325;349;349	.|Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.|.;.;.;RFWD2_HUMAN;.	V|C	69|124;349;184;325;188	.|ENSP00000356641:Y349C;ENSP00000356638:Y184C;ENSP00000310943:Y325C	.|ENSP00000310943:Y325C	I|Y	-|-	1|2	0|0	RFWD2|RFWD2	174321630|174321630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.486000|7.486000	0.81215|0.81215	2.226000|2.226000	0.72624|0.72624	0.528000|0.528000	0.53228|0.53228	ATA|TAT		0.338	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2		NM_022457	
SKIV2L	6499	broad.mit.edu;hgsc.bcm.edu	37	6	31928014	31928014	+	Missense_Mutation	SNP	C	C	T	rs146717555	byFrequency	TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr6:31928014C>T	ENST00000375394.2	+	4	367	c.254C>T	c.(253-255)aCg>aTg	p.T85M	SKIV2L_ENST00000544581.1_Intron|NELFE_ENST00000375429.3_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|NELFE_ENST00000375425.5_5'Flank|NELFE_ENST00000444811.2_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	85					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.T85M(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CAGAGGAAGACGGATCCCTGG	0.517													C|||	6	0.00119808	0.0015	0.0	5008	,	,		19617	0.004		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						C	MET/THR	1,3021		0,1,1510	135.0	167.0	155.0		254	2.7	1.0	6	dbSNP_134	155	0,5418		0,0,2709	yes	missense	SKIV2L	NM_006929.4	81	0,1,4219	TT,TC,CC		0.0,0.0331,0.0118	probably-damaging	85/1247	31928014	1,8439	1511	2709	4220	SO:0001583	missense	6499				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.254C>T	6.37:g.31928014C>T	ENSP00000364543:p.Thr85Met	Somatic		WXS	Illumina HiSeq	Phase_I	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	7.870	0.727989	0.15507	3.31E-4	0.0	ENSG00000204351	ENST00000375394	T	0.47177	0.85	4.61	2.73	0.32206	.	0.536612	0.18871	N	0.128829	T	0.16769	0.0403	L	0.43152	1.355	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06162	-1.0842	10	0.32370	T	0.25	-3.7804	4.2799	0.10827	0.2668:0.5125:0.0:0.2207	.	85	Q15477	SKIV2_HUMAN	M	85	ENSP00000364543:T85M	ENSP00000364543:T85M	T	+	2	0	SKIV2L	32035993	0.001000	0.12720	0.967000	0.41034	0.928000	0.56348	-0.272000	0.08560	0.156000	0.19299	-0.797000	0.03246	ACG		0.517	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3			
SMOC1	64093	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	70459140	70459140	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr14:70459140G>A	ENST00000381280.4	+	6	786	c.533G>A	c.(532-534)gGg>gAg	p.G178E	SMOC1_ENST00000361956.3_Missense_Mutation_p.G178E	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	178					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)	p.G178E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		TCAGATGACGGGTCTAAGCCG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											152.0	150.0	151.0					14																	70459140		2203	4300	6503	SO:0001583	missense	64093			AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.533G>A	14.37:g.70459140G>A	ENSP00000370680:p.Gly178Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	ENST00000381280.4	37	CCDS9798.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565983	0.86439	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	T;T	0.57595	0.39;0.4	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	L	0.29908	0.895	0.80722	D	1	B;D	0.89917	0.176;1.0	B;D	0.87578	0.122;0.998	T	0.58352	-0.7651	10	0.27785	T	0.31	-20.4292	18.9222	0.92529	0.0:0.0:1.0:0.0	.	178;178	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	E	178	ENSP00000355110:G178E;ENSP00000370680:G178E	ENSP00000355110:G178E	G	+	2	0	SMOC1	69528893	1.000000	0.71417	0.936000	0.37596	0.900000	0.52787	9.714000	0.98744	2.483000	0.83821	0.561000	0.74099	GGG		0.443	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1			
SPIB	6689	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	50926877	50926877	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:50926877G>A	ENST00000595883.1	+	5	380	c.355G>A	c.(355-357)Gca>Aca	p.A119T	SPIB_ENST00000439922.2_Missense_Mutation_p.A28T|SPIB_ENST00000597855.1_Intron|SPIB_ENST00000596074.1_Missense_Mutation_p.G47D|SPIB_ENST00000270632.7_Missense_Mutation_p.A119T|CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.G253D	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	119					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A119T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		GGTTCCCCCGGCATATGCCCC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											60.0	51.0	54.0					19																	50926877		2203	4300	6503	SO:0001583	missense	6689				CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.355G>A	19.37:g.50926877G>A	ENSP00000471921:p.Ala119Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9C9|B4DUG6|Q15359	Missense_Mutation	SNP	ENST00000595883.1	37	CCDS33080.1	.	.	.	.	.	.	.	.	.	.	.	8.542	0.873459	0.17322	.	.	ENSG00000142539	ENST00000270632;ENST00000439922	T;T	0.59502	0.26;1.9	3.99	2.95	0.34219	.	1.017170	0.07897	N	0.972034	T	0.65647	0.2711	L	0.51422	1.61	0.09310	N	1	B;P;D	0.63880	0.079;0.827;0.993	B;B;D	0.68192	0.025;0.342;0.956	T	0.51872	-0.8650	10	0.14656	T	0.56	-0.2949	7.6497	0.28342	0.1187:0.0:0.8813:0.0	.	28;119;119	B4DUG6;Q01892-2;Q01892	.;.;SPIB_HUMAN	T	119;28	ENSP00000270632:A119T;ENSP00000391877:A28T	ENSP00000270632:A119T	A	+	1	0	SPIB	55618689	0.498000	0.26075	0.024000	0.17045	0.198000	0.23893	2.489000	0.45285	1.015000	0.39444	0.462000	0.41574	GCA		0.647	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464744.1		NM_003121	
SRGAP1	57522	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	64377783	64377783	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr12:64377783C>T	ENST00000355086.3	+	2	648	c.124C>T	c.(124-126)Cga>Tga	p.R42*	SRGAP1_ENST00000357825.3_Nonsense_Mutation_p.R42*|SRGAP1_ENST00000543397.1_Nonsense_Mutation_p.R2*	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	42	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.R42*(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		AACGGAGATGCGAGTTCAGCT	0.408																																																	1	Substitution - Nonsense(1)	kidney(1)											100.0	105.0	103.0					12																	64377783		2203	4300	6503	SO:0001587	stop_gained	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.124C>T	12.37:g.64377783C>T	ENSP00000347198:p.Arg42*	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H8A3|Q9P2P2	Nonsense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	C	50	16.112195	0.99854	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	.	.	.	4.89	1.77	0.24775	.	0.000000	0.31323	U	0.007858	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.134	0.59399	0.6616:0.3384:0.0:0.0	.	.	.	.	X	42;42;2	.	.	R	+	1	2	SRGAP1	62664050	0.996000	0.38824	1.000000	0.80357	0.974000	0.67602	0.482000	0.22276	0.566000	0.29273	0.585000	0.79938	CGA		0.408	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1			
TBC1D24	57465	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	2546654	2546654	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr16:2546654A>G	ENST00000293970.5	+	2	638	c.505A>G	c.(505-507)Atc>Gtc	p.I169V	TBC1D24_ENST00000567020.1_Missense_Mutation_p.I169V|RP11-20I23.1_ENST00000564543.1_Missense_Mutation_p.I169V|TBC1D24_ENST00000434757.2_Missense_Mutation_p.I169V	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	169	Rab-GAP TBC.				neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)	p.I169V(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						CAGGAGGCTGATCGACCAGAG	0.637																																																	1	Substitution - Missense(1)	kidney(1)											29.0	33.0	32.0					16																	2546654		2172	4271	6443	SO:0001583	missense	57465			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.505A>G	16.37:g.2546654A>G	ENSP00000293970:p.Ile169Val	Somatic		WXS	Illumina HiSeq	Phase_I	A0JNW3|B9A6M6|Q2KJ08	Missense_Mutation	SNP	ENST00000293970.5	37	CCDS55980.1	.	.	.	.	.	.	.	.	.	.	A	4.276	0.050325	0.08243	.	.	ENSG00000162065	ENST00000293970;ENST00000434757	T;T	0.10860	2.83;2.83	5.41	-1.19	0.09585	Rab-GAP/TBC domain (2);	0.531595	0.21026	N	0.081438	T	0.05135	0.0137	N	0.20685	0.6	0.09310	N	0.999998	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.15052	0.009;0.012;0.007	T	0.42599	-0.9442	10	0.15499	T	0.54	-14.3859	6.4451	0.21871	0.4478:0.1417:0.4106:0.0	.	169;169;169	B9A6M6;Q9ULP9;Q9ULP9-2	.;TBC24_HUMAN;.	V	169	ENSP00000293970:I169V;ENSP00000390106:I169V	ENSP00000293970:I169V	I	+	1	0	TBC1D24	2486655	0.001000	0.12720	0.001000	0.08648	0.356000	0.29392	0.022000	0.13511	-0.178000	0.10672	-0.304000	0.09214	ATC		0.637	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000435637.1		NM_020705	
TBXA2R	6915	broad.mit.edu	37	19	3600380	3600380	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:3600380C>T	ENST00000375190.4	-	2	646	c.253G>A	c.(253-255)Gtg>Atg	p.V85M	TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000589966.1_Missense_Mutation_p.V85M|TBXA2R_ENST00000411851.3_Missense_Mutation_p.V85M	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	85					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)	p.V85M(1)		kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	TGGGACACCACGATGGTACCG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											37.0	50.0	45.0					19																	3600380		2160	4241	6401	SO:0001583	missense	6915				CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.253G>A	19.37:g.3600380C>T	ENSP00000364336:p.Val85Met	Somatic		WXS	Illumina GAIIx	Phase_I	O75228|Q6DK52|Q9UCY1|Q9UCY2	Missense_Mutation	SNP	ENST00000375190.4	37	CCDS42467.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395871	0.62177	.	.	ENSG00000006638	ENST00000411851;ENST00000375190	T;T	0.36157	1.27;1.27	4.67	4.67	0.58626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.62380	0.2423	M	0.86864	2.845	0.46336	D	0.998993	D;D	0.89917	1.0;1.0	D;D	0.81914	0.971;0.995	T	0.68330	-0.5437	10	0.72032	D	0.01	-40.3503	11.1733	0.48584	0.0:0.9071:0.0:0.0929	.	85;85	P21731;E2QRJ2	TA2R_HUMAN;.	M	85	ENSP00000393333:V85M;ENSP00000364336:V85M	ENSP00000364336:V85M	V	-	1	0	TBXA2R	3551380	1.000000	0.71417	0.934000	0.37439	0.275000	0.26752	3.809000	0.55606	2.296000	0.77279	0.313000	0.20887	GTG		0.672	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453081.2			
TECPR2	9895	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	102901086	102901086	+	Silent	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr14:102901086C>T	ENST00000359520.7	+	9	2158	c.1932C>T	c.(1930-1932)ctC>ctT	p.L644L	TECPR2_ENST00000558678.1_Silent_p.L644L	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	644					autophagy (GO:0006914)|cell death (GO:0008219)			p.L644L(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						AAGTCCCCCTCCTGAACTCAC	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											41.0	37.0	39.0					14																	102901086		2203	4300	6503	SO:0001819	synonymous_variant	9895			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1932C>T	14.37:g.102901086C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Silent	SNP	ENST00000359520.7	37	CCDS32162.1																																																																																				0.592	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2		NM_014844	
TIMM44	10469	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	7999040	7999040	+	Silent	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:7999040C>T	ENST00000270538.3	-	5	745	c.477G>A	c.(475-477)tcG>tcA	p.S159S	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	159					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)	p.S159S(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						CCGACTCGGCCGACTGCTTGG	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											83.0	90.0	88.0					19																	7999040		2203	4300	6503	SO:0001819	synonymous_variant	10469			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.477G>A	19.37:g.7999040C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0R9|D6W664|Q8N193	Silent	SNP	ENST00000270538.3	37	CCDS12192.1																																																																																				0.607	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3			
TOB1	10140	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	48941286	48941286	+	Silent	SNP	T	T	C			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr17:48941286T>C	ENST00000268957.3	-	3	521	c.93A>G	c.(91-93)gaA>gaG	p.E31E	TOB1_ENST00000499247.2_Silent_p.E31E|TOB1-AS1_ENST00000416263.3_RNA|TOB1_ENST00000509385.1_5'UTR|TOB1-AS1_ENST00000523470.1_RNA	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	31					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)	p.E31E(1)|p.R22fs*5(1)		breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GTCTTTCAAGTTCTTCACCAA	0.383																																					NSCLC(144;643 1919 24513 29423 40686)												2	Deletion - Frameshift(1)|Substitution - coding silent(1)	liver(1)|kidney(1)											102.0	105.0	104.0					17																	48941286		2203	4300	6503	SO:0001819	synonymous_variant	10140			D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.93A>G	17.37:g.48941286T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9T0|D3DTY3|Q4KMQ0	Silent	SNP	ENST00000268957.3	37	CCDS11576.1																																																																																				0.383	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1			
NDUFA13	51079	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19625999	19625999	+	5'Flank	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:19625999C>T	ENST00000507754.4	+	0	0				NDUFA13_ENST00000512771.3_5'Flank|YJEFN3_ENST00000608404.1_5'Flank|NDUFA13_ENST00000252576.5_5'Flank|NDUFA13_ENST00000428459.2_5'Flank|CTC-260F20.3_ENST00000555938.1_5'Flank|TSSK6_ENST00000585580.3_Missense_Mutation_p.E80K|TSSK6_ENST00000360913.3_Missense_Mutation_p.E80K|NDUFA13_ENST00000503283.1_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)	p.E80K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						TTGCACACCTCGATGAACTCG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											58.0	53.0	55.0					19																	19625999		2203	4300	6503	SO:0001631	upstream_gene_variant	83983			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211		19.37:g.19625999C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	ENST00000507754.4	37	CCDS12404.2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728939	0.89390	.	.	ENSG00000178093	ENST00000360913	T	0.66460	-0.21	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41938	U	0.000788	T	0.71031	0.3292	M	0.65498	2.005	0.54753	D	0.999989	D	0.56968	0.978	P	0.49451	0.611	T	0.76189	-0.3050	10	0.87932	D	0	.	13.4981	0.61438	0.0:1.0:0.0:0.0	.	80	Q9BXA6	TSSK6_HUMAN	K	80	ENSP00000354168:E80K	ENSP00000354168:E80K	E	-	1	0	TSSK6	19486999	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	3.679000	0.54634	2.252000	0.74401	0.306000	0.20318	GAG		0.657	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6		NM_015965	
UBR7	55148	hgsc.bcm.edu;ucsc.edu	37	14	93686659	93686659	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr14:93686659delA	ENST00000013070.6	+	9	1261	c.1025delA	c.(1024-1026)gaafs	p.E342fs	UBR7_ENST00000416753.1_Frame_Shift_Del_p.E266fs	NM_175748.3	NP_786924.2	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin 7 (putative)	342							ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(2)|lung(12)|urinary_tract(1)	19						CTGGCTTATGAAAACAAAGGG	0.408																																																	0													134.0	135.0	135.0					14																	93686659		2203	4300	6503	SO:0001589	frameshift_variant	55148			AK001345	CCDS9909.1	14q32.12	2008-06-23	2008-06-23	2008-06-23		ENSG00000012963		"""Ubiquitin protein ligase E3 component n-recognins"""	20344	protein-coding gene	gene with protein product		613816	"""chromosome 14 open reading frame 130"""	C14orf130		18162545	Standard	NM_175748		Approved		uc001ybm.4	Q8N806		ENST00000013070.6:c.1025delA	14.37:g.93686659delA	ENSP00000013070:p.Glu342fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q86U21|Q86UA9|Q96BY0|Q9NVV6	Frame_Shift_Del	DEL	ENST00000013070.6	37	CCDS9909.1																																																																																				0.408	UBR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412693.1		NM_175748	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10188246	10188246	+	Missense_Mutation	SNP	T	T	A	rs200131013		TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr3:10188246T>A	ENST00000256474.2	+	2	1229	c.389T>A	c.(388-390)gTt>gAt	p.V130D	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Intron	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	130	Involved in binding to CCT complex.		V -> L (in ECYT2 and VHLD; type I). {ECO:0000269|PubMed:12393546, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.V130D(2)|p.V130fs*28(1)|p.V130G(1)|p.V130fs*29(1)|p.H125fs*27(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GGGCTTCTGGTTAACCAAACT	0.468		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	6	Substitution - Missense(3)|Deletion - Frameshift(3)	kidney(5)|adrenal_gland(1)											206.0	190.0	195.0					3																	10188246		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.389T>A	3.37:g.10188246T>A	ENSP00000256474:p.Val130Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867600	0.72065	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	D	0.99859	-7.24	5.07	5.07	0.68467	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96589	0.9436	10	0.87932	D	0	-11.5971	13.0887	0.59156	0.0:0.0:0.0:1.0	.	130	P40337	VHL_HUMAN	D	130;48	ENSP00000256474:V130D	ENSP00000256474:V130D	V	+	2	0	VHL	10163246	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	4.319000	0.59197	2.047000	0.60756	0.460000	0.39030	GTT		0.468	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	RNA	SNP	C	C	G	rs17857355	byFrequency	TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr2:114355998C>G	ENST00000538033.2	+	0	2178							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCAAGGTGGGCACTTGATGTC	0.612																																																	0																																												375260					2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355998C>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000538033.2	37																																																																																					0.612	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene	OTTHUMT00000467782.1		NM_198943	
WNT7B	7477	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	46319160	46319160	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr22:46319160C>T	ENST00000339464.4	-	4	1000	c.626G>A	c.(625-627)tGc>tAc	p.C209Y	WNT7B_ENST00000409496.3_Missense_Mutation_p.C213Y|WNT7B_ENST00000410089.1_Missense_Mutation_p.C193Y	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	209					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.C209Y(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TTTGGTGGTGCAGGAGCCAGA	0.647																																																	1	Substitution - Missense(1)	kidney(1)											40.0	39.0	39.0					22																	46319160		2203	4300	6503	SO:0001583	missense	7477			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.626G>A	22.37:g.46319160C>T	ENSP00000341032:p.Cys209Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	37	CCDS33667.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635106	0.67130	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496	D;D;D	0.86865	-2.18;-2.18;-2.18	3.18	3.18	0.36537	Secreted growth factor Wnt protein, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.96005	0.8699	H	0.98951	4.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97274	0.9913	10	0.87932	D	0	.	13.6682	0.62409	0.0:1.0:0.0:0.0	.	213;209	A8K0G1;P56706	.;WNT7B_HUMAN	Y	209;193;213	ENSP00000341032:C209Y;ENSP00000386781:C193Y;ENSP00000386546:C213Y	ENSP00000341032:C209Y	C	-	2	0	WNT7B	44697824	1.000000	0.71417	0.994000	0.49952	0.877000	0.50540	7.529000	0.81952	1.493000	0.48517	0.305000	0.20034	TGC		0.647	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1		NM_058238	
ZNF304	57343	hgsc.bcm.edu;ucsc.edu	37	19	57865095	57865095	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:57865095delT	ENST00000282286.5	+	2	209	c.36delT	c.(34-36)agtfs	p.S12fs	ZNF304_ENST00000391705.3_Frame_Shift_Del_p.S12fs|ZNF304_ENST00000598744.1_5'UTR|CTC-444N24.13_ENST00000597973.1_RNA|ZNF304_ENST00000443917.2_Frame_Shift_Del_p.S12fs			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	12					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		CATGGCAGAGTTGTGTGACCT	0.542																																																	0													211.0	158.0	176.0					19																	57865095		2203	4300	6503	SO:0001589	frameshift_variant	57343			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.36delT	19.37:g.57865095delT	ENSP00000282286:p.Ser12fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000282286.5	37	CCDS12950.1																																																																																				0.542	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			
ZNF480	147657	broad.mit.edu;hgsc.bcm.edu	37	19	52825621	52825621	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5177-01A-01D-1429-08	TCGA-BP-5177-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad4cc7e3-c4d1-4cc0-9c93-33b47dadaaae	5b505dca-8443-4884-90a8-4514479783f8	g.chr19:52825621G>A	ENST00000595962.1	+	5	1184	c.1118G>A	c.(1117-1119)tGt>tAt	p.C373Y	ZNF480_ENST00000490272.1_3'UTR|ZNF480_ENST00000335090.6_Missense_Mutation_p.C296Y|ZNF480_ENST00000334564.7_Missense_Mutation_p.C330Y|CTD-2525I3.6_ENST00000594379.1_RNA	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.C373Y(1)|p.C354Y(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		CCTTACAAATGTAATGAATGT	0.378																																																	2	Substitution - Missense(2)	kidney(2)											55.0	60.0	58.0					19																	52825621		2203	4300	6503	SO:0001583	missense	147657			AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.1118G>A	19.37:g.52825621G>A	ENSP00000471754:p.Cys373Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	37	CCDS12850.2	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690571	0.29962	.	.	ENSG00000198464	ENST00000468240;ENST00000334564;ENST00000335090	D;D;D	0.85088	-1.94;-1.94;-1.94	2.21	2.21	0.28008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92711	0.7683	M	0.90814	3.15	0.32937	D	0.517922	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93572	0.6905	9	0.87932	D	0	.	11.5389	0.50655	0.0:0.0:1.0:0.0	.	330;373	F8WEZ9;Q8WV37	.;ZN480_HUMAN	Y	373;330;296	ENSP00000417424:C373Y;ENSP00000334164:C330Y;ENSP00000335670:C296Y	ENSP00000334164:C330Y	C	+	2	0	ZNF480	57517433	1.000000	0.71417	0.112000	0.21494	0.042000	0.13812	4.726000	0.61986	1.225000	0.43566	0.461000	0.40582	TGT		0.378	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3		NM_144684	
