#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACSL3	2181	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	223795455	223795455	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:223795455G>A	ENST00000357430.3	+	14	2188	c.1657G>A	c.(1657-1659)Gat>Aat	p.D553N	ACSL3_ENST00000392066.3_Missense_Mutation_p.D553N|AC013476.1_ENST00000582868.1_RNA	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	553					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.D553N(2)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TTTCTTTGAAGATGAAAATGG	0.388			T	ETV1	prostate																																			Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	2	Substitution - Missense(2)	kidney(2)											100.0	103.0	102.0					2																	223795455		2203	4300	6503	SO:0001583	missense	2181			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1657G>A	2.37:g.223795455G>A	ENSP00000350012:p.Asp553Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	37	CCDS2455.1	.	.	.	.	.	.	.	.	.	.	G	35	5.447121	0.96205	.	.	ENSG00000123983	ENST00000357430;ENST00000392066	T;T	0.12465	2.68;2.68	5.74	5.74	0.90152	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	M	0.83603	2.65	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.42396	-0.9454	10	0.87932	D	0	-28.8823	19.9187	0.97077	0.0:0.0:1.0:0.0	.	553	O95573	ACSL3_HUMAN	N	553	ENSP00000350012:D553N;ENSP00000375918:D553N	ENSP00000350012:D553N	D	+	1	0	ACSL3	223503699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.702000	0.92279	0.591000	0.81541	GAT		0.388	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2		NM_004457	
ADAMTS14	140766	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	72498659	72498659	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr10:72498659G>C	ENST00000373207.1	+	11	1661	c.1661G>C	c.(1660-1662)gGc>gCc	p.G554A	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G557A	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	554	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G557A(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CAGGATGGAGGCTGGAGCTCC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											76.0	69.0	71.0					10																	72498659		2203	4300	6503	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1661G>C	10.37:g.72498659G>C	ENSP00000362303:p.Gly554Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795402	0.50208	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.60424	0.19;0.19	4.89	4.89	0.63831	.	0.177748	0.49305	D	0.000142	T	0.53190	0.1781	L	0.48642	1.525	0.44531	D	0.997481	B;B;B	0.25955	0.138;0.038;0.038	B;B;B	0.27500	0.049;0.04;0.08	T	0.49570	-0.8926	10	0.30078	T	0.28	.	17.8276	0.88671	0.0:0.0:1.0:0.0	.	487;554;557	Q8WXS8-2;Q8WXS8;Q5T4G1	.;ATS14_HUMAN;.	A	557;554	ENSP00000362304:G557A;ENSP00000362303:G554A	ENSP00000362303:G554A	G	+	2	0	ADAMTS14	72168665	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	5.342000	0.65970	2.533000	0.85409	0.455000	0.32223	GGC		0.627	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1		NM_080722	
ADARB1	104	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	46642103	46642103	+	Silent	SNP	C	C	A	rs371097171		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr21:46642103C>A	ENST00000360697.3	+	10	2232	c.2217C>A	c.(2215-2217)ctC>ctA	p.L739L	ADARB1_ENST00000437626.1_3'UTR|ADARB1_ENST00000348831.4_Silent_p.L699L|ADARB1_ENST00000539173.1_Silent_p.L739L|ADARB1_ENST00000389863.4_Intron			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	739					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L739L(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		AGTTCTCACTCACGCCCTGAC	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											27.0	24.0	25.0					21																	46642103		2200	4298	6498	SO:0001819	synonymous_variant	104			U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.2217C>A	21.37:g.46642103C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Silent	SNP	ENST00000360697.3	37	CCDS33589.1																																																																																				0.647	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2		NM_015833	
ETNPPL	64850	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	109681436	109681436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr4:109681436G>T	ENST00000296486.3	-	2	237	c.83C>A	c.(82-84)tCg>tAg	p.S28*	ETNPPL_ENST00000411864.2_Nonsense_Mutation_p.S28*|ETNPPL_ENST00000512646.1_Intron|ETNPPL_ENST00000510706.1_5'UTR	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	28						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.S28*(1)									GATGGGATCCGATGCAAAGAA	0.428																																																	1	Substitution - Nonsense(1)	kidney(1)											93.0	92.0	92.0					4																	109681436		2203	4300	6503	SO:0001587	stop_gained	64850			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.83C>A	4.37:g.109681436G>T	ENSP00000296486:p.Ser28*	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1Y0|E9PBY0|Q9H174	Nonsense_Mutation	SNP	ENST00000296486.3	37	CCDS3682.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703861	0.96812	.	.	ENSG00000164089	ENST00000296486;ENST00000411864	.	.	.	5.65	0.68	0.17980	.	0.543643	0.20194	N	0.097260	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.8329	16.2984	0.82786	0.0:0.0:0.1917:0.8083	.	.	.	.	X	28	.	.	S	-	2	0	AGXT2L1	109900885	0.970000	0.33590	0.994000	0.49952	0.962000	0.63368	1.614000	0.36911	0.143000	0.18926	0.563000	0.77884	TCG		0.428	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363508.1		NM_031279	
AOX1	316	broad.mit.edu	37	2	201450857	201450857	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:201450857T>G	ENST00000374700.2	+	1	267	c.26T>G	c.(25-27)tTc>tGc	p.F9C		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	9	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.F9C(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GAGCTGCTCTTCTACGTGAAC	0.716																																																	1	Substitution - Missense(1)	kidney(1)											7.0	8.0	8.0					2																	201450857		2164	4209	6373	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.26T>G	2.37:g.201450857T>G	ENSP00000363832:p.Phe9Cys	Somatic		WXS	Illumina GAIIx	Phase_I	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	T	15.64	2.893772	0.52121	.	.	ENSG00000138356	ENST00000374700	T	0.35605	1.3	3.82	3.82	0.43975	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (2);	0.060832	0.64402	D	0.000002	T	0.59985	0.2234	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65500	-0.6153	10	0.87932	D	0	-28.933	10.4705	0.44633	0.0:0.0:0.0:1.0	.	9	Q06278	ADO_HUMAN	C	9	ENSP00000363832:F9C	ENSP00000363832:F9C	F	+	2	0	AOX1	201159102	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	3.796000	0.55507	1.723000	0.51488	0.260000	0.18958	TTC		0.716	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1		NM_001159	
APC2	10297	broad.mit.edu;hgsc.bcm.edu	37	19	1467881	1467881	+	Missense_Mutation	SNP	C	C	G	rs566223544		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr19:1467881C>G	ENST00000535453.1	+	14	6294	c.4581C>G	c.(4579-4581)caC>caG	p.H1527Q	C19orf25_ENST00000588427.1_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.H1527Q|APC2_ENST00000238483.4_Missense_Mutation_p.H1253Q			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)	p.H1527Q(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCAACCCACCGGCGCACAT	0.726													C|||	1	0.000199681	0.0008	0.0	5008	,	,		11604	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											6.0	8.0	7.0					19																	1467881		1968	3934	5902	SO:0001583	missense	10297				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.4581C>G	19.37:g.1467881C>G	ENSP00000442954:p.His1527Gln	Somatic		WXS	Illumina HiSeq	Phase_I	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	37	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	C	1.490	-0.554927	0.03967	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.91996	-2.95;-2.59;-2.95	1.92	-3.84	0.04256	.	1.783850	0.03031	N	0.152113	T	0.80665	0.4666	N	0.08118	0	0.24938	N	0.991871	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.72537	-0.4263	10	0.11485	T	0.65	-2.4695	7.9079	0.29774	0.1561:0.2394:0.6045:0.0	.	1526;1527	O95996-3;O95996	.;APC2_HUMAN	Q	1527;1253;1527	ENSP00000233607:H1527Q;ENSP00000238483:H1253Q;ENSP00000442954:H1527Q	ENSP00000233607:H1527Q	H	+	3	2	APC2	1418881	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-2.278000	0.01159	-1.258000	0.02471	0.436000	0.28706	CAC		0.726	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2		NM_005883	
ARFGAP2	84364	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	47193064	47193064	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr11:47193064C>A	ENST00000524782.1	-	10	1082	c.854G>T	c.(853-855)cGt>cTt	p.R285L	ARFGAP2_ENST00000319543.6_Missense_Mutation_p.R16L|ARFGAP2_ENST00000395449.3_5'UTR|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000426335.2_Missense_Mutation_p.R149L|ARFGAP2_ENST00000419701.2_Missense_Mutation_p.R178L	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	285	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.R285L(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTCTTTCTTACGATCAATCTG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											221.0	215.0	217.0					11																	47193064		2201	4299	6500	SO:0001583	missense	84364			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.854G>T	11.37:g.47193064C>A	ENSP00000434442:p.Arg285Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	37	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.892203	0.72524	.	.	ENSG00000149182	ENST00000426335;ENST00000524782;ENST00000319543;ENST00000419701;ENST00000527927;ENST00000525398	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.67258	0.2874	M	0.76002	2.32	0.80722	D	1	D;D;D	0.89917	1.0;0.986;1.0	D;P;D	0.91635	0.999;0.766;0.998	T	0.67872	-0.5558	10	0.56958	D	0.05	-17.9314	19.756	0.96291	0.0:1.0:0.0:0.0	.	178;149;285	B4DX29;G5E9L0;Q8N6H7	.;.;ARFG2_HUMAN	L	149;285;16;178;149;299	ENSP00000400226:R149L;ENSP00000434442:R285L;ENSP00000327309:R16L;ENSP00000389264:R178L;ENSP00000434433:R149L;ENSP00000431939:R299L	ENSP00000327309:R16L	R	-	2	0	ARFGAP2	47149640	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	5.452000	0.66638	2.665000	0.90641	0.655000	0.94253	CGT		0.547	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1		NM_032389	
ARHGAP25	9938	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	69045086	69045086	+	Silent	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:69045086C>A	ENST00000295381.3	+	8	1379	c.960C>A	c.(958-960)ctC>ctA	p.L320L	ARHGAP25_ENST00000497079.1_Silent_p.L314L|ARHGAP25_ENST00000409220.1_Silent_p.L314L|ARHGAP25_ENST00000409030.3_Silent_p.L313L|ARHGAP25_ENST00000409202.3_Silent_p.L321L|ARHGAP25_ENST00000479844.1_Silent_p.L14L|ARHGAP25_ENST00000467265.1_Silent_p.L281L	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	320	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.L314L(1)|p.L321L(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						GTGTGAATCTCATCAGGTCGA	0.473																																																	2	Substitution - coding silent(2)	kidney(2)											174.0	157.0	163.0					2																	69045086		2203	4300	6503	SO:0001819	synonymous_variant	9938			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.960C>A	2.37:g.69045086C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Silent	SNP	ENST00000295381.3	37		.	.	.	.	.	.	.	.	.	.	C	10.18	1.278787	0.23307	.	.	ENSG00000163219	ENST00000497259	.	.	.	5.32	2.55	0.30701	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.1491	0.03795	0.1385:0.5058:0.1341:0.2216	.	.	.	.	X	180	.	.	S	+	2	0	ARHGAP25	68898590	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.004000	0.29822	0.388000	0.25054	0.650000	0.86243	TCA		0.473	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_014882	
ARHGAP25	9938	hgsc.bcm.edu;ucsc.edu	37	2	69046267	69046267	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:69046267delT	ENST00000295381.3	+	9	1432	c.1013delT	c.(1012-1014)atcfs	p.I338fs	ARHGAP25_ENST00000497079.1_Frame_Shift_Del_p.I332fs|ARHGAP25_ENST00000409220.1_Frame_Shift_Del_p.I332fs|ARHGAP25_ENST00000409030.3_Frame_Shift_Del_p.I331fs|ARHGAP25_ENST00000409202.3_Frame_Shift_Del_p.I339fs|ARHGAP25_ENST00000479844.1_Frame_Shift_Del_p.I32fs|ARHGAP25_ENST00000467265.1_Frame_Shift_Del_p.I299fs	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	338	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						ACTCCTCAGATCCAAAGAGTG	0.498																																																	0													178.0	194.0	188.0					2																	69046267		2203	4300	6503	SO:0001589	frameshift_variant	9938			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1013delT	2.37:g.69046267delT	ENSP00000295381:p.Ile338fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Frame_Shift_Del	DEL	ENST00000295381.3	37																																																																																					0.498	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_014882	
PHF7	51533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52443892	52443892	+	5'Flank	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:52443892C>T	ENST00000327906.3	+	0	0				BAP1_ENST00000296288.5_Start_Codon_SNP_p.M1I|PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Start_Codon_SNP_p.M1I	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.M1I(2)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		AGCCCTTATTCATCTTCCCGC	0.766																																																	2	Substitution - Missense(2)	kidney(2)											25.0	31.0	29.0					3																	52443892		2202	4299	6501	SO:0001631	upstream_gene_variant	8314			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52443892C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044029	0.93685	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.41758	0.99;0.99	5.06	5.06	0.68205	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (2);	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	.	.	.	0.80722	D	1	P	0.34699	0.464	B	0.37692	0.256	T	0.47898	-0.9081	9	0.72032	D	0.01	-3.8616	16.2289	0.82318	0.0:1.0:0.0:0.0	.	1	Q92560	BAP1_HUMAN	I	1	ENSP00000417132:M1I;ENSP00000296288:M1I	ENSP00000296288:M1I	M	-	3	0	BAP1	52418932	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.256000	0.72473	2.359000	0.80004	0.655000	0.94253	ATG		0.766	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1		NM_016483	
BBS1	582	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	66278152	66278152	+	Missense_Mutation	SNP	G	G	A	rs113994178		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr11:66278152G>A	ENST00000318312.7	+	1	73	c.22G>A	c.(22-24)Gat>Aat	p.D8N	BBS1_ENST00000393994.2_Missense_Mutation_p.D8N|CTD-3074O7.11_ENST00000419755.3_Intron|BBS1_ENST00000529766.1_3'UTR|BBS1_ENST00000455748.2_Missense_Mutation_p.D8N|BBS1_ENST00000537537.1_5'UTR	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	8					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)	p.D8N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GTCCTCATCGGATTCCGACGC	0.662									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												1	Substitution - Missense(1)	kidney(1)											35.0	36.0	36.0					11																	66278152		2200	4295	6495	SO:0001583	missense	582	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.22G>A	11.37:g.66278152G>A	ENSP00000317469:p.Asp8Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715371	0.48622	.	.	ENSG00000174483	ENST00000318312;ENST00000525809;ENST00000455748;ENST00000393994	D;D;D;D	0.97303	-4.33;-3.48;-4.24;-4.15	4.96	4.05	0.47172	.	.	.	.	.	D	0.92648	0.7664	L	0.29908	0.895	0.80722	D	1	B;B;B	0.13594	0.0;0.008;0.004	B;B;B	0.14578	0.003;0.011;0.007	D	0.88394	0.3010	9	0.19590	T	0.45	.	9.9881	0.41854	0.096:0.0:0.904:0.0	.	8;8;8	E7EQH1;Q32MM9;Q8NFJ9	.;.;BBS1_HUMAN	N	8	ENSP00000317469:D8N;ENSP00000431187:D8N;ENSP00000405764:D8N;ENSP00000377563:D8N	ENSP00000317469:D8N	D	+	1	0	BBS1	66034728	0.994000	0.37717	0.907000	0.35723	0.136000	0.21042	4.143000	0.58051	1.431000	0.47355	0.650000	0.86243	GAT		0.662	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2			
C3orf17	25871	broad.mit.edu;hgsc.bcm.edu	37	3	112724334	112724334	+	3'UTR	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:112724334C>A	ENST00000314400.5	-	0	1944				C3orf17_ENST00000472762.1_5'Flank|C3orf17_ENST00000393857.2_3'UTR|C3orf17_ENST00000383675.2_3'UTR	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17						negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						ACTTAGAACACTGAACTAGCC	0.393																																																	0													77.0	67.0	70.0					3																	112724334		2202	4300	6502	SO:0001624	3_prime_UTR_variant	25871			AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.*49G>T	3.37:g.112724334C>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	RNA	SNP	ENST00000314400.5	37	CCDS33824.1																																																																																				0.393	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3		NM_015412	
CARS	833	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	3039892	3039892	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr11:3039892T>G	ENST00000397111.5	-	12	1479	c.1234A>C	c.(1234-1236)Aaa>Caa	p.K412Q	CARS_ENST00000380525.4_Missense_Mutation_p.K495Q|CARS_ENST00000278224.9_Missense_Mutation_p.K412Q|CARS_ENST00000401769.3_Missense_Mutation_p.K425Q|CARS_ENST00000397114.3_Missense_Mutation_p.K402Q			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	412					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.K412Q(1)|p.K495Q(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ATGAAGTTTTTTAGTGACTTT	0.478			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)			Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	2	Substitution - Missense(2)	kidney(2)											206.0	201.0	203.0					11																	3039892		2202	4298	6500	SO:0001583	missense	833			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1234A>C	11.37:g.3039892T>G	ENSP00000380300:p.Lys412Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	ENST00000397111.5	37	CCDS7742.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079960	0.76528	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.53640	0.61;0.62;0.61;0.62;0.61	4.71	4.71	0.59529	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.73560	0.3602	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.993;0.999;0.995;0.997;0.993;0.995	T	0.80400	-0.1398	10	0.87932	D	0	-13.9732	14.1952	0.65667	0.0:0.0:0.0:1.0	.	425;495;412;412;495;402	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	Q	495;412;412;402;425	ENSP00000369897:K495Q;ENSP00000380300:K412Q;ENSP00000278224:K412Q;ENSP00000380303:K402Q;ENSP00000384069:K425Q	ENSP00000278224:K412Q	K	-	1	0	CARS	2996468	1.000000	0.71417	0.446000	0.26920	0.709000	0.40893	7.550000	0.82173	1.767000	0.52121	0.482000	0.46254	AAA		0.478	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4		NM_001751	
EFCC1	79825	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	128753037	128753037	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:128753037G>T	ENST00000480450.1	+	5	1314	c.1314G>T	c.(1312-1314)atG>atT	p.M438I	EFCC1_ENST00000436022.2_Start_Codon_SNP_p.M1I			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	438							calcium ion binding (GO:0005509)	p.M1I(1)|p.M438I(1)									AGAAGCTCATGACTTACTTTG	0.622																																																	2	Substitution - Missense(2)	kidney(2)											93.0	88.0	89.0					3																	128753037		2203	4300	6503	SO:0001583	missense	0			AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1314G>T	3.37:g.128753037G>T	ENSP00000420075:p.Met438Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	.	.	.	.	.	.	.	.	.	.	G	12.03	1.815403	0.32053	.	.	ENSG00000114654	ENST00000480450;ENST00000436022	T;T	0.42900	0.96;0.99	4.47	2.65	0.31530	.	0.971917	0.08444	N	0.945043	T	0.36635	0.0974	L	0.46157	1.445	0.80722	D	1	B	0.15473	0.013	B	0.11329	0.006	T	0.13818	-1.0495	10	0.56958	D	0.05	.	7.1984	0.25866	0.2139:0.0:0.7861:0.0	.	438	Q9HA90	CCD48_HUMAN	I	438;1	ENSP00000420075:M438I;ENSP00000414597:M1I	ENSP00000414597:M1I	M	+	3	0	CCDC48	130235727	0.883000	0.30277	0.001000	0.08648	0.833000	0.47200	3.150000	0.50662	0.425000	0.26087	0.313000	0.20887	ATG		0.622	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1		NM_024768	
CCDC78	124093	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	775560	775560	+	Silent	SNP	C	C	T	rs532009000		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr16:775560C>T	ENST00000293889.6	-	4	393	c.288G>A	c.(286-288)cgG>cgA	p.R96R	HAGHL_ENST00000561546.1_5'Flank|HAGHL_ENST00000341413.4_5'Flank|HAGHL_ENST00000564537.1_5'Flank|HAGHL_ENST00000549114.1_5'Flank|HAGHL_ENST00000564545.1_5'Flank|HAGHL_ENST00000389703.3_5'Flank	NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	96					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)		p.R96R(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				GCTCCAGTACCCGGCTCTCCA	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		18034	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	kidney(1)											39.0	40.0	39.0					16																	775560		2191	4295	6486	SO:0001819	synonymous_variant	124093			BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.288G>A	16.37:g.775560C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Silent	SNP	ENST00000293889.6	37	CCDS32353.1																																																																																				0.657	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241665.3		NM_173476	
CLTCL1	8218	broad.mit.edu;hgsc.bcm.edu	37	22	19184099	19184099	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr22:19184099C>A	ENST00000263200.10	-	25	4014	c.3942G>T	c.(3940-3942)atG>atT	p.M1314I	CLTCL1_ENST00000427926.1_Missense_Mutation_p.M1314I|CLTCL1_ENST00000353891.5_Missense_Mutation_p.M1314I|CLTCL1_ENST00000442042.2_5'UTR	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1314	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.M1314I(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					TGAACATGCCCATGTGGGCCC	0.577			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	1	Substitution - Missense(1)	kidney(1)											40.0	43.0	42.0					22																	19184099		2088	4205	6293	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.3942G>T	22.37:g.19184099C>A	ENSP00000445677:p.Met1314Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.862028	0.71949	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.19938	2.11;2.11;2.11	3.5	3.5	0.40072	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.109437	0.64402	D	0.000014	T	0.50990	0.1648	M	0.86343	2.81	0.80722	D	1	P;D;D;D	0.56287	0.847;0.975;0.975;0.975	P;D;D;D	0.80764	0.842;0.994;0.994;0.994	T	0.61987	-0.6949	10	0.59425	D	0.04	-8.993	15.1691	0.72854	0.0:1.0:0.0:0.0	.	1314;137;137;1314	P53675-2;B7Z1Z7;B7Z2Y4;P53675	.;.;.;CLH2_HUMAN	I	1314	ENSP00000439662:M1314I;ENSP00000445677:M1314I;ENSP00000441158:M1314I	ENSP00000445677:M1314I	M	-	3	0	CLTCL1	17564099	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	6.947000	0.75959	1.802000	0.52723	0.491000	0.48974	ATG		0.577	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5		NM_007098	
CPS1	1373	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	211441087	211441087	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:211441087C>G	ENST00000233072.5	+	3	450	c.254C>G	c.(253-255)aCt>aGt	p.T85S	CPS1_ENST00000430249.2_Missense_Mutation_p.T91S	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	85	Anthranilate phosphoribosyltransferase homolog.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.T85S(1)|p.T91S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GAAGCTATTACTGACCCTGCC	0.408																																																	2	Substitution - Missense(2)	kidney(2)											177.0	162.0	167.0					2																	211441087		2203	4300	6503	SO:0001583	missense	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.254C>G	2.37:g.211441087C>G	ENSP00000233072:p.Thr85Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854493	0.91355	.	.	ENSG00000021826	ENST00000417946;ENST00000518043;ENST00000523702;ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84	5.96	5.96	0.96718	Carbamoyl-phosphate synthase, small subunit, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.97770	0.9268	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97340	0.9956	10	0.51188	T	0.08	0.623	20.4192	0.99033	0.0:1.0:0.0:0.0	.	95;85	Q59HF8;P31327	.;CPSM_HUMAN	S	85;85;91;91;93;85;85	ENSP00000388496:T85S;ENSP00000430697:T85S;ENSP00000430644:T91S;ENSP00000402608:T91S;ENSP00000233072:T85S	ENSP00000233072:T85S	T	+	2	0	CPS1	211149332	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	7.262000	0.78410	2.831000	0.97527	0.650000	0.86243	ACT		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			
DCDC2B	149069	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	32678141	32678141	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:32678141C>G	ENST00000409358.1	+	5	578	c.578C>G	c.(577-579)aCt>aGt	p.T193S		NM_001099434.1	NP_001092904.1	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	193	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)			p.T193S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GAGCTGGTAACTGGCCATTAC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											68.0	74.0	72.0					1																	32678141		1985	4161	6146	SO:0001583	missense	149069			BC128073	CCDS44100.1	1p35.1	2008-05-13			ENSG00000222046	ENSG00000222046			32576	protein-coding gene	gene with protein product							Standard	NM_001099434		Approved		uc001bun.2	A2VCK2	OTTHUMG00000005741	ENST00000409358.1:c.578C>G	1.37:g.32678141C>G	ENSP00000386870:p.Thr193Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBC6	Missense_Mutation	SNP	ENST00000409358.1	37	CCDS44100.1	.	.	.	.	.	.	.	.	.	.	C	1.442	-0.567344	0.03910	.	.	ENSG00000222046	ENST00000409358	D	0.85702	-2.02	5.3	-6.0	0.02206	Doublecortin domain (5);	.	.	.	.	T	0.54711	0.1875	N	0.00823	-1.155	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.52808	-0.8526	9	0.16420	T	0.52	.	9.3293	0.38012	0.586:0.1844:0.2296:0.0	.	193	A2VCK2	DCD2B_HUMAN	S	193	ENSP00000386870:T193S	ENSP00000386870:T193S	T	+	2	0	DCDC2B	32450728	0.011000	0.17503	0.063000	0.19743	0.150000	0.21749	0.151000	0.16283	-0.996000	0.03455	-0.839000	0.03059	ACT		0.587	DCDC2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328293.1		XM_940631	
DDX46	9879	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	134153324	134153324	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr5:134153324G>T	ENST00000354283.4	+	20	2884	c.2749G>T	c.(2749-2751)Gaa>Taa	p.E917*	DDX46_ENST00000452510.2_Nonsense_Mutation_p.E918*			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	917					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.E917*(2)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGAGAAACAAGAAGAAGAGAG	0.408																																					Colon(13;391 453 4901 21675 24897)												2	Substitution - Nonsense(2)	lung(1)|kidney(1)											122.0	116.0	118.0					5																	134153324		2203	4300	6503	SO:0001587	stop_gained	9879				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2749G>T	5.37:g.134153324G>T	ENSP00000346236:p.Glu917*	Somatic		WXS	Illumina HiSeq	Phase_I	O94894|Q96EI0|Q9Y658	Nonsense_Mutation	SNP	ENST00000354283.4	37	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	G	41	8.627365	0.98890	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	.	.	.	5.8	5.8	0.92144	.	0.046318	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-25.8214	20.0706	0.97721	0.0:0.0:1.0:0.0	.	.	.	.	X	918;917	.	ENSP00000346236:E917X	E	+	1	0	DDX46	134181223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.809000	0.86057	2.744000	0.94065	0.655000	0.94253	GAA		0.408	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1		NM_014829	
DENND2D	79961	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	111734927	111734927	+	Silent	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:111734927C>T	ENST00000357640.4	-	8	1036	c.807G>A	c.(805-807)caG>caA	p.Q269Q	DENND2D_ENST00000473682.1_5'Flank|DENND2D_ENST00000369752.5_Silent_p.Q266Q	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	269	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q269Q(1)		breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CATGGATGCACTGAGACAAGG	0.622																																																	1	Substitution - coding silent(1)	kidney(1)											62.0	53.0	56.0					1																	111734927		2203	4300	6503	SO:0001819	synonymous_variant	79961				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.807G>A	1.37:g.111734927C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T5V6|Q9BSU0	Silent	SNP	ENST00000357640.4	37	CCDS831.1																																																																																				0.622	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1		NM_024901	
DNAJB1	3337	hgsc.bcm.edu;ucsc.edu	37	19	14627721	14627722	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr19:14627721_14627722insA	ENST00000254322.2	-	2	418_419	c.348_349insT	c.(346-351)tttgggfs	p.G117fs	DNAJB1_ENST00000396969.4_Frame_Shift_Ins_p.G17fs	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	117					chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		TTCCGCTGCCCAAAAAAGGTGT	0.54																																																	0																																										SO:0001589	frameshift_variant	3337			D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.349dupT	19.37:g.14627727_14627727dupA	ENSP00000254322:p.Gly117fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DX52	Frame_Shift_Ins	INS	ENST00000254322.2	37	CCDS12312.1																																																																																				0.540	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465987.1		NM_006145	
DST	667	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	56471874	56471874	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr6:56471874G>T	ENST00000361203.3	-	36	6926	c.6919C>A	c.(6919-6921)Caa>Aaa	p.Q2307K	DST_ENST00000312431.6_Missense_Mutation_p.Q2307K|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.Q2485K|DST_ENST00000370769.4_Missense_Mutation_p.Q2307K|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Missense_Mutation_p.Q1981K|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	2307					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TATTGTACTTGAGGATTACTA	0.348																																																	0													82.0	74.0	76.0					6																	56471874		1834	4089	5923	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.6919C>A	6.37:g.56471874G>T	ENSP00000354508:p.Gln2307Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Intron	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	15.82	2.944845	0.53079	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;D;T;T	0.86297	-0.48;-0.53;0.37;-2.1;-0.6;-1.02	5.7	4.83	0.62350	.	0.147274	0.31268	N	0.007949	T	0.71204	0.3312	.	.	.	0.26734	N	0.970534	B	0.33238	0.403	B	0.33890	0.172	T	0.69796	-0.5048	8	0.37606	T	0.19	.	9.6079	0.39645	0.0768:0.1414:0.7818:0.0	.	1981	Q03001-9	.	K	2485;2307;1981;2307;2307;1981	ENSP00000359790:Q2485K;ENSP00000359805:Q2307K;ENSP00000393645:Q1981K;ENSP00000307959:Q2307K;ENSP00000354508:Q2307K;ENSP00000404924:Q1981K	ENSP00000307959:Q2307K	Q	-	1	0	DST	56579833	0.007000	0.16637	0.022000	0.16811	0.572000	0.35998	1.588000	0.36633	1.412000	0.46977	0.462000	0.41574	CAA		0.348	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3		NM_001723	
EIF1	10209	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	39846142	39846142	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr17:39846142A>T	ENST00000469257.1	+	2	290	c.144A>T	c.(142-144)caA>caT	p.Q48H	JUP_ENST00000540235.1_Intron|EIF1_ENST00000310837.4_Intron|EIF1_ENST00000591776.1_Missense_Mutation_p.Q48H			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1	48					dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.Q48H(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CTACTGTCCAAGGGATCGCTG	0.413											OREG0024409	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(176;1692 2837 16734 17588)												1	Substitution - Missense(1)	kidney(1)											70.0	70.0	70.0					17																	39846142		2203	4299	6502	SO:0001583	missense	10209			AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.144A>T	17.37:g.39846142A>T	ENSP00000419449:p.Gln48His	Somatic	13	WXS	Illumina HiSeq	Phase_I	Q9UNQ9	Missense_Mutation	SNP	ENST00000469257.1	37	CCDS11403.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293804	0.80914	.	.	ENSG00000173812	ENST00000469257	T	0.33654	1.4	5.18	1.67	0.24075	Translation initiation factor SUI1 (3);	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	M	0.93462	3.42	0.51012	D	0.999906	P	0.39862	0.692	P	0.48598	0.583	T	0.58261	-0.7667	10	0.87932	D	0	3.6052	7.3761	0.26829	0.585:0.0:0.415:0.0	.	48	P41567	EIF1_HUMAN	H	48	ENSP00000419449:Q48H	ENSP00000419449:Q48H	Q	+	3	2	EIF1	37099668	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.850000	0.55918	0.439000	0.26476	0.379000	0.24179	CAA		0.413	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257390.1		NM_005801	
ENPP6	133121	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	185138820	185138820	+	Silent	SNP	T	T	C	rs148715663	byFrequency	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr4:185138820T>C	ENST00000296741.2	-	1	294	c.153A>G	c.(151-153)aaA>aaG	p.K51K		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	51					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)	p.K51K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		TCACAATCTCTTTGAAACCAG	0.498																																																	1	Substitution - coding silent(1)	kidney(1)						T		0,4406		0,0,2203	81.0	76.0	78.0		153	0.1	0.6	4	dbSNP_134	78	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	ENPP6	NM_153343.3		0,3,6500	CC,CT,TT		0.0349,0.0,0.0231		51/441	185138820	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	133121			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.153A>G	4.37:g.185138820T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5Q1|Q96M57	Silent	SNP	ENST00000296741.2	37	CCDS3834.1																																																																																				0.498	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1		NM_153343	
EXPH5	23086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	108383516	108383516	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr11:108383516G>T	ENST00000265843.4	-	6	2828	c.2718C>A	c.(2716-2718)ttC>ttA	p.F906L	EXPH5_ENST00000525344.1_Missense_Mutation_p.F899L|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Missense_Mutation_p.F718L|EXPH5_ENST00000428840.1_Missense_Mutation_p.F830L	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	906					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.F906L(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTCTCCTGGAGAACACTGTAG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											172.0	158.0	162.0					11																	108383516		2201	4298	6499	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2718C>A	11.37:g.108383516G>T	ENSP00000265843:p.Phe906Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900882	0.92035	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.10573	3.45;3.35;3.22;3.45;3.2;2.86	5.68	5.68	0.88126	.	0.385037	0.25555	N	0.029868	T	0.16981	0.0408	M	0.69823	2.125	0.37094	D	0.89956	B	0.23249	0.082	B	0.22386	0.039	T	0.02844	-1.1103	10	0.40728	T	0.16	-0.755	16.5316	0.84362	0.0:0.0:1.0:0.0	.	906	Q8NEV8	EXPH5_HUMAN	L	906;830;718;899;830;718	ENSP00000265843:F906L;ENSP00000391966:F830L;ENSP00000411390:F718L;ENSP00000432546:F899L;ENSP00000432683:F830L;ENSP00000446434:F718L	ENSP00000265843:F906L	F	-	3	2	EXPH5	107888726	0.343000	0.24818	0.641000	0.29422	0.812000	0.45895	1.011000	0.29911	2.687000	0.91594	0.563000	0.77884	TTC		0.428	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1		NM_015065	
FEZ1	9638	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	125324081	125324081	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr11:125324081T>G	ENST00000278919.3	-	7	1199	c.965A>C	c.(964-966)aAc>aCc	p.N322T	FEZ1_ENST00000527350.1_5'UTR	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	322					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.N322T(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CTGCAGAATGTTGGAGATGCC	0.552																																					Melanoma(180;509 2033 10762 15939 24711)												1	Substitution - Missense(1)	kidney(1)											119.0	96.0	104.0					11																	125324081		2201	4299	6500	SO:0001583	missense	9638			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.965A>C	11.37:g.125324081T>G	ENSP00000278919:p.Asn322Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O00679|O00728|Q6IBI7	Missense_Mutation	SNP	ENST00000278919.3	37	CCDS31716.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.656532	0.47467	.	.	ENSG00000149557	ENST00000278919	T	0.33438	1.41	5.63	0.215	0.15253	.	0.275955	0.45606	D	0.000358	T	0.22126	0.0533	L	0.47716	1.5	0.80722	D	1	B	0.30793	0.295	B	0.25759	0.063	T	0.04811	-1.0925	10	0.35671	T	0.21	-31.0359	9.6421	0.39846	0.0:0.3073:0.0:0.6927	.	322	Q99689	FEZ1_HUMAN	T	322	ENSP00000278919:N322T	ENSP00000278919:N322T	N	-	2	0	FEZ1	124829291	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.657000	0.24963	0.044000	0.15775	0.460000	0.39030	AAC		0.552	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1		NM_005103	
FLNC	2318	hgsc.bcm.edu;ucsc.edu	37	7	128483008	128483008	+	Splice_Site	DEL	G	G	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr7:128483008delG	ENST00000325888.8	+	16	2811	c.2550delG	c.(2548-2550)cag>ca	p.Q850fs	FLNC_ENST00000346177.6_Splice_Site_p.Q850fs	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	850					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TTGCCAACCAGGTACCTAAGC	0.562																																																	0													48.0	52.0	51.0					7																	128483008		2104	4224	6328	SO:0001630	splice_region_variant	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2550+1G>-	7.37:g.128483008delG		Somatic		WXS	Illumina HiSeq	Phase_I	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Frame_Shift_Del	DEL	ENST00000325888.8	37	CCDS43644.1																																																																																				0.562	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			Frame_Shift_Del
FNTB	2342	broad.mit.edu;ucsc.edu	37	14	65482387	65482387	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr14:65482387C>G	ENST00000246166.2	+	4	561	c.327C>G	c.(325-327)caC>caG	p.H109Q	FNTB_ENST00000447296.2_Missense_Mutation_p.H143Q|MAX_ENST00000341653.2_Intron|CHURC1-FNTB_ENST00000549987.1_Missense_Mutation_p.H144Q|AL139022.1_ENST00000577601.1_RNA|FNTB_ENST00000555742.1_3'UTR|FNTB_ENST00000542227.1_Missense_Mutation_p.H63Q	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	109					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)	p.H109Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GGATCCTGCACAGCTTGGAAC	0.488																																																	1	Substitution - Missense(1)	kidney(1)											124.0	108.0	114.0					14																	65482387		2203	4300	6503	SO:0001583	missense	2342				CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.327C>G	14.37:g.65482387C>G	ENSP00000246166:p.His109Gln	Somatic		WXS	Illumina GAIIx	Phase_I	B2RDX6|B4E1A0	Missense_Mutation	SNP	ENST00000246166.2	37	CCDS9769.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289009	0.59976	.	.	ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000257365;ENSG00000257365	ENST00000542227;ENST00000549987;ENST00000447296;ENST00000553743;ENST00000246166;ENST00000555372	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.97	4.17	0.49024	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	L	0.54908	1.71	0.80722	D	1	P;D;D;D	0.65815	0.921;0.995;0.99;0.966	B;P;B;B	0.52386	0.258;0.697;0.402;0.361	T	0.29274	-1.0017	10	0.32370	T	0.25	-27.9278	7.9125	0.29800	0.0:0.6971:0.0:0.3029	.	112;63;143;109	Q86TX8;B4E1A0;B4DL54;P49356	.;.;.;FNTB_HUMAN	Q	63;144;143;67;109;109	ENSP00000443140:H63Q;ENSP00000447121:H144Q;ENSP00000406393:H143Q;ENSP00000246166:H109Q	ENSP00000246166:H109Q	H	+	3	2	FNTB;AL139022.1	64552140	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.928000	0.40104	0.877000	0.35895	0.655000	0.94253	CAC		0.488	FNTB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000286392.1		NM_002028	
GPR179	440435	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	36486397	36486397	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr17:36486397G>T	ENST00000342292.4	-	11	3075	c.3055C>A	c.(3055-3057)Cac>Aac	p.H1019N	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1019					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.H1019N(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GGGGAGTGGTGGCCTCGCTCT	0.617																																																	1	Substitution - Missense(1)	kidney(1)											47.0	50.0	49.0					17																	36486397		1938	4139	6077	SO:0001583	missense	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3055C>A	17.37:g.36486397G>T	ENSP00000345060:p.His1019Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.331103	0.00227	.	.	ENSG00000188888	ENST00000342292	T	0.48522	0.81	5.06	-8.35	0.00984	.	2.028210	0.01566	N	0.020368	T	0.23926	0.0579	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12630	-1.0540	10	0.18710	T	0.47	1.3496	9.9307	0.41521	0.0:0.2803:0.5362:0.1835	.	1019	Q6PRD1	GP179_HUMAN	N	1019	ENSP00000345060:H1019N	ENSP00000345060:H1019N	H	-	1	0	GPR179	33739923	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.966000	0.03825	-1.653000	0.01500	-0.521000	0.04368	CAC		0.617	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2			
H1F0	3005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	38201647	38201647	+	Silent	SNP	C	C	T	rs151035348		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr22:38201647C>T	ENST00000340857.2	+	1	534	c.96C>T	c.(94-96)atC>atT	p.I32I	GCAT_ENST00000248924.6_5'Flank|GCAT_ENST00000323205.6_5'Flank	NM_005318.3	NP_005309.1	P07305	H10_HUMAN	H1 histone family, member 0	32	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|nucleosome assembly (GO:0006334)	actin cytoskeleton (GO:0015629)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.I32I(1)		cervix(1)|endometrium(1)|kidney(2)|prostate(2)|urinary_tract(1)	7	Melanoma(58;0.045)					CAGACATGATCGTGGCTGCCA	0.592																																					NSCLC(191;1872 2984 30230 41544)|Esophageal Squamous(4;11 371 39444 52196)												1	Substitution - coding silent(1)	kidney(1)						C		0,4406		0,0,2203	79.0	78.0	79.0		96	4.2	1.0	22	dbSNP_134	79	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	H1F0	NM_005318.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		32/195	38201647	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	3005			X03473	CCDS13956.1	22q13.1	2011-01-27			ENSG00000189060	ENSG00000189060		"""Histones / Replication-independent"""	4714	protein-coding gene	gene with protein product	"""H1.0, H1(0), H1-0"""	142708		H1FV		3084796	Standard	NM_005318		Approved	H10	uc003aty.3	P07305	OTTHUMG00000150659	ENST00000340857.2:c.96C>T	22.37:g.38201647C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6I0|B4DRD6|Q6FG88|Q8N6R3	Silent	SNP	ENST00000340857.2	37	CCDS13956.1																																																																																				0.592	H1F0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319453.1		NM_005318	
HAS3	3038	broad.mit.edu;hgsc.bcm.edu	37	16	69149149	69149149	+	Silent	SNP	T	T	C	rs375357316		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr16:69149149T>C	ENST00000306560.1	+	4	1798	c.1642T>C	c.(1642-1644)Ttg>Ctg	p.L548L	HAS3_ENST00000569188.1_Silent_p.L548L|HAS3_ENST00000219322.3_Intron	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	548					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.L548L(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GCAGTACAGCTTGGCTTTTGC	0.572																																																	1	Substitution - coding silent(1)	kidney(1)						T	,,	0,4396		0,0,2198	45.0	48.0	47.0		1642,1642,	2.3	1.0	16		47	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous,intron	HAS3	NM_001199280.1,NM_005329.2,NM_138612.2	,,	0,1,6497	CC,CT,TT		0.0116,0.0,0.0077	,,	548/554,548/554,	69149149	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	3038			BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1642T>C	16.37:g.69149149T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5T5|Q8WTZ0|Q9NYP0	Silent	SNP	ENST00000306560.1	37	CCDS10871.1																																																																																				0.572	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2		NM_138612	
JAK3	3718	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17945490	17945490	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr19:17945490G>T	ENST00000527670.1	-	16	2269	c.2240C>A	c.(2239-2241)cCc>cAc	p.P747H	JAK3_ENST00000534444.1_Missense_Mutation_p.P747H|JAK3_ENST00000458235.1_Missense_Mutation_p.P747H			P52333	JAK3_HUMAN	Janus kinase 3	747	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.P747H(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	TGTCCACTTGGGGGCCGGCAG	0.587		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	2	Substitution - Missense(2)	kidney(2)											51.0	61.0	57.0					19																	17945490		2203	4300	6503	SO:0001583	missense	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2240C>A	19.37:g.17945490G>T	ENSP00000432511:p.Pro747His	Somatic		WXS	Illumina HiSeq	Phase_I	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372305	0.61624	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.86627	-2.15;-2.15;-2.15	4.8	2.24	0.28232	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.294463	0.33161	N	0.005218	D	0.92371	0.7579	M	0.84683	2.71	0.36150	D	0.847383	D;D	0.89917	1.0;0.97	D;P	0.72982	0.979;0.866	D	0.93468	0.6816	10	0.87932	D	0	-22.8649	9.0831	0.36565	0.2304:0.0:0.7696:0.0	.	747;747	P52333-2;P52333	.;JAK3_HUMAN	H	747	ENSP00000391676:P747H;ENSP00000432511:P747H;ENSP00000436421:P747H	ENSP00000391676:P747H	P	-	2	0	JAK3	17806490	1.000000	0.71417	0.957000	0.39632	0.972000	0.66771	5.150000	0.64869	0.981000	0.38548	0.484000	0.47621	CCC		0.587	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1		NM_000215	
KIF14	9928	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	200562851	200562851	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:200562851C>T	ENST00000367350.4	-	15	3034	c.2596G>A	c.(2596-2598)Gaa>Aaa	p.E866K		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	866	FHA.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)	p.E866K(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						GTCTTTGCTTCCCCAACTGGG	0.328																																																	1	Substitution - Missense(1)	kidney(1)											183.0	163.0	170.0					1																	200562851		2203	4300	6503	SO:0001583	missense	9928			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.2596G>A	1.37:g.200562851C>T	ENSP00000356319:p.Glu866Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223010	0.58668	.	.	ENSG00000118193	ENST00000367350	D	0.85258	-1.96	5.15	5.15	0.70609	Forkhead-associated (FHA) domain (3);SMAD/FHA domain (1);	0.182120	0.47852	D	0.000219	D	0.83889	0.5352	L	0.52011	1.625	0.39754	D	0.971924	B	0.24618	0.107	B	0.29077	0.098	T	0.82242	-0.0554	10	0.51188	T	0.08	.	18.6098	0.91281	0.0:1.0:0.0:0.0	.	866	Q15058	KIF14_HUMAN	K	866	ENSP00000356319:E866K	ENSP00000356319:E866K	E	-	1	0	KIF14	198829474	1.000000	0.71417	0.942000	0.38095	0.754000	0.42855	4.812000	0.62613	2.374000	0.81015	0.563000	0.77884	GAA		0.328	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1		NM_014875	
KIF21B	23046	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	200959172	200959172	+	Splice_Site	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:200959172C>T	ENST00000422435.2	-	21	3347		c.e21-1		KIF21B_ENST00000332129.2_Splice_Site|KIF21B_ENST00000360529.5_Splice_Site|KIF21B_ENST00000461742.2_Splice_Site	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.?(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CCAGCTCCTCCTAGGACCGGG	0.647																																																	1	Unknown(1)	kidney(1)											55.0	54.0	55.0					1																	200959172		2203	4300	6503	SO:0001630	splice_region_variant	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3031-1G>A	1.37:g.200959172C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP62|B7ZMI0|Q5T4J3	Splice_Site	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458377	0.84317	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1472	0.89661	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF21B	199225795	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	7.688000	0.84153	2.280000	0.76307	0.655000	0.94253	.		0.647	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1		XM_371332	Intron
KLHDC8B	200942	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	49212294	49212294	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:49212294G>A	ENST00000332780.2	+	4	870	c.661G>A	c.(661-663)Gaa>Aaa	p.E221K	C3orf84_ENST00000443990.1_5'Flank|KLHDC8B_ENST00000476495.2_3'UTR	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	221						cytoplasm (GO:0005737)		p.E221K(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CGCCATGGCTGAAGGCAGCGT	0.602																																																	1	Substitution - Missense(1)	kidney(1)											44.0	46.0	45.0					3																	49212294		2203	4300	6503	SO:0001583	missense	200942				CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.661G>A	3.37:g.49212294G>A	ENSP00000327468:p.Glu221Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000332780.2	37	CCDS2791.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010869	0.93346	.	.	ENSG00000185909	ENST00000332780	T	0.77620	-1.11	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.109565	0.64402	D	0.000013	T	0.76212	0.3956	L	0.34521	1.04	0.52501	D	0.999952	P;P	0.45634	0.839;0.863	B;P	0.46685	0.218;0.524	T	0.76369	-0.2984	10	0.49607	T	0.09	-25.9536	19.4161	0.94700	0.0:0.0:1.0:0.0	.	175;221	B4DFM2;Q8IXV7	.;KLD8B_HUMAN	K	221	ENSP00000327468:E221K	ENSP00000327468:E221K	E	+	1	0	KLHDC8B	49187298	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	6.702000	0.74628	2.837000	0.97791	0.655000	0.94253	GAA		0.602	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345974.1		NM_173546	
KLHL36	79786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	84691436	84691436	+	Frame_Shift_Del	DEL	G	G	-	rs367668625		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr16:84691436delG	ENST00000564996.1	+	3	1164	c.1023delG	c.(1021-1023)gcgfs	p.A341fs	KLHL36_ENST00000258157.5_Frame_Shift_Del_p.A341fs	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	341					protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						ACTGTGTCGCGGTGCTGGGGG	0.637																																																	0													15.0	16.0	16.0					16																	84691436		2192	4285	6477	SO:0001589	frameshift_variant	79786			AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.1023delG	16.37:g.84691436delG	ENSP00000456743:p.Ala341fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N5G6|Q9H9U6	Frame_Shift_Del	DEL	ENST00000564996.1	37	CCDS10948.1																																																																																				0.637	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269084.2			
L3MBTL4	91133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	6311557	6311557	+	Missense_Mutation	SNP	C	C	T	rs199766253	byFrequency	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr18:6311557C>T	ENST00000284898.6	-	3	268	c.68G>A	c.(67-69)cGc>cAc	p.R23H	L3MBTL4_ENST00000400104.3_Missense_Mutation_p.R23H|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.R23H|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.R23H	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	23					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R23H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TCTTACCAAGCGTCCGTCCTG	0.498													C|||	4	0.000798722	0.0	0.0	5008	,	,		16439	0.004		0.0	False		,,,				2504	0.0				Esophageal Squamous(41;748 902 17366 28959 43175)												1	Substitution - Missense(1)	kidney(1)											316.0	284.0	295.0					18																	6311557		2203	4300	6503	SO:0001583	missense	91133			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.68G>A	18.37:g.6311557C>T	ENSP00000284898:p.Arg23His	Somatic		WXS	Illumina HiSeq	Phase_I	A8MTL8|Q8IXS3	Missense_Mutation	SNP	ENST00000284898.6	37	CCDS11839.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	10.09	1.254862	0.22965	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	T;T;T;T	0.15017	2.46;2.46;2.46;2.68	4.8	3.92	0.45320	.	1.266020	0.05310	N	0.524614	T	0.09686	0.0238	N	0.08118	0	0.52099	D	0.999942	P	0.38370	0.628	B	0.28139	0.086	T	0.08411	-1.0723	10	0.46703	T	0.11	.	10.9859	0.47523	0.0:0.8118:0.1881:0.0	.	23	Q8NA19	LMBL4_HUMAN	H	23	ENSP00000382976:R23H;ENSP00000318543:R23H;ENSP00000284898:R23H;ENSP00000382975:R23H	ENSP00000284898:R23H	R	-	2	0	L3MBTL4	6301557	0.318000	0.24598	0.720000	0.30636	0.162000	0.22319	1.666000	0.37460	1.244000	0.43870	0.555000	0.69702	CGC		0.498	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2		NM_173464	
LIMK2	3985	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	31674310	31674310	+	Silent	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr22:31674310C>A	ENST00000331728.4	+	16	1914	c.1800C>A	c.(1798-1800)tcC>tcA	p.S600S	LIMK2_ENST00000333611.4_Silent_p.S579S|LIMK2_ENST00000467301.1_3'UTR|LIMK2_ENST00000444929.2_Silent_p.S354S	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.S600S(1)		endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TGGAGGACTCCTTTGAGGCCC	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											221.0	233.0	229.0					22																	31674310		2203	4300	6503	SO:0001819	synonymous_variant	3985			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1800C>A	22.37:g.31674310C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Silent	SNP	ENST00000331728.4	37	CCDS13891.1																																																																																				0.577	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1		NM_016733	
LRRC4	64101	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	127670481	127670481	+	Silent	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr7:127670481C>T	ENST00000249363.3	-	2	470	c.213G>A	c.(211-213)caG>caA	p.Q71Q	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	71	LRRNT.				postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.Q71Q(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		AGGGAATACCCTGCGGGACCT	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											158.0	161.0	160.0					7																	127670481		2203	4300	6503	SO:0001819	synonymous_variant	64101			AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.213G>A	7.37:g.127670481C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Silent	SNP	ENST00000249363.3	37	CCDS5799.1																																																																																				0.647	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1		NM_022143	
MACF1	23499	hgsc.bcm.edu	37	1	39799059	39799060	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:39799059_39799060insG	ENST00000372915.3	+	36	6901_6902	c.6814_6815insG	c.(6814-6816)aggfs	p.R2272fs	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000564288.1_Frame_Shift_Ins_p.R2267fs|MACF1_ENST00000289893.4_Frame_Shift_Ins_p.R707fs|MACF1_ENST00000567887.1_Frame_Shift_Ins_p.R2304fs			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2272					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGATAGTGGCAGGGAAATTTTT	0.391																																																	0																																										SO:0001589	frameshift_variant	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.6817dupG	1.37:g.39799062_39799062dupG	ENSP00000362006:p.Arg2272fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Ins	INS	ENST00000372915.3	37																																																																																					0.391	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1		NM_033044	
MZB1	51237	broad.mit.edu	37	5	138724269	138724269	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr5:138724269C>T	ENST00000302125.8	-	2	240	c.183G>A	c.(181-183)tgG>tgA	p.W61*	MZB1_ENST00000412103.2_Intron	NM_016459.3	NP_057543.2	Q8WU39	MZB1_HUMAN	marginal zone B and B1 cell-specific protein	61					apoptotic process (GO:0006915)|integrin activation (GO:0033622)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin biosynthetic process (GO:0002642)|regulation of B cell proliferation (GO:0030888)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)		p.W61*(2)									CCAGATTTTGCCACATCTGGA	0.577																																																	2	Substitution - Nonsense(2)	kidney(2)											33.0	35.0	34.0					5																	138724269		1909	4121	6030	SO:0001587	stop_gained	0			AF151024	CCDS47273.1	5q31.2	2012-09-27	2012-09-19		ENSG00000170476	ENSG00000170476			30125	protein-coding gene	gene with protein product	"""plasma cell-induced ER protein 1"", ""proapoptotic caspase adaptor protein"", ""mesenteric oestrogen-dependent adipose gene- 7"""	609447				22573353, 12573802, 11350957, 21093319, 21688198	Standard	NM_016459		Approved	PACAP, MGC29506, HSPC190, pERp1, MEDA-7	uc003lei.3	Q8WU39	OTTHUMG00000163390	ENST00000302125.8:c.183G>A	5.37:g.138724269C>T	ENSP00000303920:p.Trp61*	Somatic		WXS	Illumina GAIIx	Phase_I	D2IYS0|Q7Z6N2|Q96RL5|Q9P0T3	Nonsense_Mutation	SNP	ENST00000302125.8	37	CCDS47273.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450797	0.43531	.	.	ENSG00000170476	ENST00000302125	.	.	.	4.69	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-2.454	11.1644	0.48535	0.0:0.8148:0.1852:0.0	.	.	.	.	X	61	.	ENSP00000303920:W61X	W	-	3	0	RP11-1280I22.1	138752168	0.849000	0.29639	0.997000	0.53966	0.427000	0.31564	1.074000	0.30703	1.325000	0.45301	0.462000	0.41574	TGG		0.577	MZB1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373055.1		NM_016459	
KMT2A	4297	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118375278	118375278	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr11:118375278G>T	ENST00000389506.5	+	27	8662	c.8662G>T	c.(8662-8664)Gaa>Taa	p.E2888*	KMT2A_ENST00000534358.1_Nonsense_Mutation_p.E2891*|KMT2A_ENST00000354520.4_Nonsense_Mutation_p.E2850*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2888					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.E2891*(1)|p.E2888*(1)									CAGTAATCGTGAAAAAGACAT	0.443																																																	2	Substitution - Nonsense(2)	kidney(2)											175.0	166.0	169.0					11																	118375278		2200	4295	6495	SO:0001587	stop_gained	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8662G>T	11.37:g.118375278G>T	ENSP00000374157:p.Glu2888*	Somatic		WXS	Illumina HiSeq	Phase_I	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	48	14.766935	0.99809	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	.	.	.	6.06	6.06	0.98353	.	0.320511	0.33691	N	0.004652	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	20.6282	0.99521	0.0:0.0:1.0:0.0	.	.	.	.	X	2891;2888;2850;1798	.	ENSP00000346516:E2850X	E	+	1	0	MLL	117880488	1.000000	0.71417	0.955000	0.39395	0.995000	0.86356	5.643000	0.67895	2.871000	0.98454	0.655000	0.94253	GAA		0.443	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2		NM_005933	
NAF1	92345	broad.mit.edu;hgsc.bcm.edu	37	4	164087855	164087855	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr4:164087855C>A	ENST00000274054.2	-	1	218	c.25G>T	c.(25-27)Gct>Tct	p.A9S	NAF1_ENST00000422287.2_Missense_Mutation_p.A9S	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	9					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A9S(2)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				TCCAGCTGAGCGGCGGCGGCC	0.637																																																	2	Substitution - Missense(2)	kidney(2)											17.0	23.0	21.0					4																	164087855		2083	4239	6322	SO:0001583	missense	92345				CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.25G>T	4.37:g.164087855C>A	ENSP00000274054:p.Ala9Ser	Somatic		WXS	Illumina HiSeq	Phase_I	D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	CCDS3803.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351057	0.61183	.	.	ENSG00000145414	ENST00000422287;ENST00000274054	T;T	0.51071	0.74;0.72	2.81	2.81	0.32909	.	0.467249	0.19148	N	0.121532	T	0.49830	0.1580	L	0.32530	0.975	0.23795	N	0.996827	D;D	0.69078	0.997;0.992	D;D	0.74023	0.982;0.982	T	0.31779	-0.9931	10	0.15499	T	0.54	-20.5479	9.2868	0.37762	0.0:1.0:0.0:0.0	.	9;9	E9PAZ2;Q96HR8	.;NAF1_HUMAN	S	9	ENSP00000408963:A9S;ENSP00000274054:A9S	ENSP00000274054:A9S	A	-	1	0	NAF1	164307305	1.000000	0.71417	0.953000	0.39169	0.337000	0.28794	2.575000	0.46025	1.884000	0.54569	0.305000	0.20034	GCT		0.637	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2		NM_138386	
NEB	4703	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	152551064	152551064	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:152551064G>T	ENST00000172853.10	-	19	1901	c.1754C>A	c.(1753-1755)gCc>gAc	p.A585D	NEB_ENST00000427231.2_Missense_Mutation_p.A585D|NEB_ENST00000603639.1_Missense_Mutation_p.A585D|NEB_ENST00000409198.1_Missense_Mutation_p.A585D|NEB_ENST00000397345.3_Missense_Mutation_p.A585D|NEB_ENST00000604864.1_Missense_Mutation_p.A585D			P20929	NEBU_HUMAN	nebulin	585					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.A585D(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTTGGCTTTGGCTGCCAGCAG	0.488																																																	2	Substitution - Missense(2)	kidney(2)											100.0	95.0	97.0					2																	152551064		1931	4126	6057	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1754C>A	2.37:g.152551064G>T	ENSP00000172853:p.Ala585Asp	Somatic		WXS	Illumina HiSeq	Phase_I	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	33	5.264928	0.95399	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000536533	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.84938	0.5583	M	0.88512	2.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86877	0.2039	10	0.72032	D	0.01	.	17.1936	0.86887	0.0:0.0:1.0:0.0	.	218;585	Q86TG3;P20929	.;NEBU_HUMAN	D	585;585;585;585;311	ENSP00000386259:A585D;ENSP00000380505:A585D;ENSP00000416578:A585D;ENSP00000172853:A585D	ENSP00000172853:A585D	A	-	2	0	NEB	152259310	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.064000	0.93933	2.797000	0.96272	0.655000	0.94253	GCC		0.488	NEB-201	KNOWN	basic	protein_coding	protein_coding			NM_004543	
NUP88	4927	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	5322749	5322749	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr17:5322749T>A	ENST00000573584.1	-	1	731	c.222A>T	c.(220-222)gaA>gaT	p.E74D	RPAIN_ENST00000381209.3_5'Flank|RPAIN_ENST00000327154.6_5'Flank|RPAIN_ENST00000574003.1_5'Flank|RPAIN_ENST00000536255.2_5'Flank|RPAIN_ENST00000381208.5_5'Flank|RPAIN_ENST00000405578.4_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	74					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.E74D(1)		endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						AGGAGCTGTCTTCTCCGTCCC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											59.0	62.0	61.0					17																	5322749		2203	4300	6503	SO:0001583	missense	4927			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.222A>T	17.37:g.5322749T>A	ENSP00000458954:p.Glu74Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTM2|Q9BWE5	Silent	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.208844	0.58343	.	.	ENSG00000108559	ENST00000225696	T	0.70282	-0.47	5.19	-1.04	0.10068	.	0.520122	0.21089	N	0.080358	T	0.44498	0.1296	N	0.22421	0.69	0.23936	N	0.996419	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.09952	-1.0651	10	0.20046	T	0.44	-11.143	1.5119	0.02497	0.1503:0.3636:0.2014:0.2847	.	74;74	B7Z5I6;Q99567	.;NUP88_HUMAN	D	74	ENSP00000225696:E74D	ENSP00000225696:E74D	E	-	3	2	NUP88	5263473	0.000000	0.05858	0.666000	0.29783	0.950000	0.60333	-0.673000	0.05239	-0.093000	0.12396	0.533000	0.62120	GAA		0.627	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3		NM_002532	
OR7A10	390892	broad.mit.edu;hgsc.bcm.edu	37	19	14952548	14952548	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr19:14952548C>T	ENST00000248058.1	-	1	141	c.142G>A	c.(142-144)Gcc>Acc	p.A48T		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A48T(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					GAGATTGTGGCCAGGATGATG	0.527																																																	1	Substitution - Missense(1)	kidney(1)											73.0	68.0	70.0					19																	14952548		2203	4297	6500	SO:0001583	missense	390892				CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.142G>A	19.37:g.14952548C>T	ENSP00000248058:p.Ala48Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	c	7.491	0.650652	0.14516	.	.	ENSG00000127515	ENST00000248058	T	0.10288	2.89	2.79	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37393	U	0.002110	T	0.12220	0.0297	L	0.39085	1.19	0.09310	N	1	P	0.41947	0.766	P	0.47744	0.556	T	0.07271	-1.0781	10	0.54805	T	0.06	.	8.7414	0.34560	0.0:0.874:0.0:0.126	.	48	O76100	OR7AA_HUMAN	T	48	ENSP00000248058:A48T	ENSP00000248058:A48T	A	-	1	0	OR7A10	14813548	0.000000	0.05858	0.887000	0.34795	0.261000	0.26267	-1.816000	0.01720	0.435000	0.26365	-1.085000	0.02201	GCC		0.527	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1		NM_001005190	
POLR1A	25885	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	86325787	86325787	+	Silent	SNP	G	G	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr2:86325787G>A	ENST00000263857.6	-	3	757	c.379C>T	c.(379-381)Ctg>Ttg	p.L127L	POLR1A_ENST00000409681.1_Silent_p.L127L			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	127					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.L127L(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CCGACTTCCAGAACCCTCAGC	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											163.0	164.0	164.0					2																	86325787		1913	4124	6037	SO:0001819	synonymous_variant	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.379C>T	2.37:g.86325787G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	ENST00000263857.6	37	CCDS42706.1																																																																																				0.532	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2		NM_015425	
PRIM1	5557	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57139904	57139904	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr12:57139904C>T	ENST00000338193.6	-	5	540	c.504G>A	c.(502-504)tgG>tgA	p.W168*	PRIM1_ENST00000552408.1_5'Flank	NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	168					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.W168*(1)		kidney(1)|lung(6)|prostate(1)	8						CATCACAGACCCAACAATGAA	0.373																																																	1	Substitution - Nonsense(1)	kidney(1)											117.0	106.0	110.0					12																	57139904		1860	4103	5963	SO:0001587	stop_gained	5557			BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.504G>A	12.37:g.57139904C>T	ENSP00000350491:p.Trp168*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000338193.6	37	CCDS44926.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938946	0.73557	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000550770	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7557	17.5123	0.87763	0.0:1.0:0.0:0.0	.	.	.	.	X	169;168;171	.	ENSP00000350491:W168X	W	-	3	0	PRIM1	55426171	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.534000	0.82004	2.493000	0.84123	0.456000	0.33151	TGG		0.373	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406956.1		NM_000946	
PSMB11	122706	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	23511526	23511526	+	Missense_Mutation	SNP	G	G	A	rs372195981		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr14:23511526G>A	ENST00000408907.2	+	1	151	c.92G>A	c.(91-93)cGg>cAg	p.R31Q		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	31					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.R31Q(3)		endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GCTGTGCCCCGGGGTTGTGAC	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17841	0.0		0.0	False		,,,				2504	0.001																3	Substitution - Missense(3)	kidney(3)											58.0	69.0	65.0					14																	23511526		2100	4220	6320	SO:0001583	missense	122706				CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.92G>A	14.37:g.23511526G>A	ENSP00000386212:p.Arg31Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000408907.2	37	CCDS41923.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466849	0.26335	.	.	ENSG00000222028	ENST00000408907	T	0.35048	1.33	5.53	0.283	0.15696	.	0.617780	0.14141	N	0.338696	T	0.27027	0.0662	L	0.52573	1.65	0.20926	N	0.999823	B	0.16396	0.017	B	0.09377	0.004	T	0.18587	-1.0332	10	0.33141	T	0.24	-1.8886	5.8511	0.18694	0.073:0.3777:0.4197:0.1296	.	31	A5LHX3	PSB11_HUMAN	Q	31	ENSP00000386212:R31Q	ENSP00000386212:R31Q	R	+	2	0	PSMB11	22581366	0.000000	0.05858	0.652000	0.29579	0.930000	0.56654	-0.321000	0.08018	0.044000	0.15775	0.655000	0.94253	CGG		0.652	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408294.1		NM_001099780	
PTPRB	5787	broad.mit.edu;ucsc.edu	37	12	70970258	70970258	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr12:70970258delA	ENST00000261266.5	-	9	2121	c.2092delT	c.(2092-2094)tccfs	p.S698fs	PTPRB_ENST00000550358.1_Intron|PTPRB_ENST00000334414.6_Frame_Shift_Del_p.S916fs|PTPRB_ENST00000550857.1_Frame_Shift_Del_p.S608fs|PTPRB_ENST00000551525.1_Frame_Shift_Del_p.S915fs|PTPRB_ENST00000538708.1_Frame_Shift_Del_p.S698fs|PTPRB_ENST00000451516.2_Frame_Shift_Del_p.S608fs	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	698	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GAGCTGAAGGAACATTCTCTG	0.522																																																	0													59.0	64.0	62.0					12																	70970258		2075	4215	6290	SO:0001589	frameshift_variant	5787			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2092delT	12.37:g.70970258delA	ENSP00000261266:p.Ser698fs	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Frame_Shift_Del	DEL	ENST00000261266.5	37	CCDS44944.1																																																																																				0.522	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1			
PYDC1	260434	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	31228342	31228342	+	Missense_Mutation	SNP	G	G	C	rs546281460	byFrequency	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr16:31228342G>C	ENST00000302964.3	-	1	338	c.8C>G	c.(7-9)aCg>aGg	p.T3R	TRIM72_ENST00000322122.3_Intron|PYDC1_ENST00000568383.1_5'Flank	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1	3	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)		p.T3M(1)|p.T3R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						CTCGCGCTTCGTTCCCATGGC	0.647																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											45.0	38.0	40.0					16																	31228342		2197	4300	6497	SO:0001583	missense	260434				CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407	ENST00000302964.3:c.8C>G	16.37:g.31228342G>C	ENSP00000304336:p.Thr3Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8L4|Q8NFP8	Missense_Mutation	SNP	ENST00000302964.3	37	CCDS10710.1	.	.	.	.	.	.	.	.	.	.	G	0.246	-1.010034	0.02095	.	.	ENSG00000169900	ENST00000302964	T	0.40756	1.02	3.63	-3.22	0.05125	Pyrin (1);DEATH-like (2);	2.334450	0.02566	N	0.097247	T	0.25306	0.0615	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09975	-1.0650	9	0.30078	T	0.28	.	4.4689	0.11703	0.0:0.3093:0.3388:0.3519	.	3	Q8WXC3	PYDC1_HUMAN	R	3	ENSP00000304336:T3R	ENSP00000304336:T3R	T	-	2	0	PYDC1	31135843	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.836000	0.01690	-0.510000	0.06523	-1.048000	0.02349	ACG		0.647	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255543.2		NM_152901	
RERE	473	broad.mit.edu	37	1	8420609	8420609	+	Silent	SNP	T	T	G	rs578199349		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:8420609T>G	ENST00000337907.3	-	19	3592	c.2958A>C	c.(2956-2958)ccA>ccC	p.P986P	RERE_ENST00000476556.1_Silent_p.P432P|RERE_ENST00000400907.2_Intron|RERE_ENST00000377464.1_Silent_p.P718P|RERE_ENST00000400908.2_Silent_p.P986P	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	986	Pro-rich.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P986P(4)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTTGCAGGGGTGGGGGGTGAG	0.706																																																	4	Substitution - coding silent(4)	kidney(2)|prostate(1)|lung(1)											11.0	14.0	13.0					1																	8420609		1946	3883	5829	SO:0001819	synonymous_variant	473			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2958A>C	1.37:g.8420609T>G		Somatic		WXS	Illumina GAIIx	Phase_I	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Silent	SNP	ENST00000337907.3	37	CCDS95.1																																																																																				0.706	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1			
SEC31B	25956	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	102249094	102249094	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr10:102249094T>A	ENST00000370345.3	-	23	3183	c.3086A>T	c.(3085-3087)gAg>gTg	p.E1029V		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	1029	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.E1029V(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CCCTTGTAGCTCAGGGGTGAG	0.527																																																	1	Substitution - Missense(1)	kidney(1)											80.0	86.0	84.0					10																	102249094		2203	4300	6503	SO:0001583	missense	25956			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.3086A>T	10.37:g.102249094T>A	ENSP00000359370:p.Glu1029Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.067363	0.55539	.	.	ENSG00000075826	ENST00000370345	T	0.53206	0.63	4.68	4.68	0.58851	.	0.241861	0.40222	N	0.001151	T	0.60919	0.2306	M	0.70275	2.135	0.80722	D	1	P;P	0.52463	0.953;0.922	P;P	0.55713	0.782;0.611	T	0.65138	-0.6241	10	0.56958	D	0.05	-6.9087	13.4654	0.61251	0.0:0.0:0.0:1.0	.	1028;1029	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	V	1029	ENSP00000359370:E1029V	ENSP00000359370:E1029V	E	-	2	0	SEC31B	102239084	1.000000	0.71417	0.689000	0.30133	0.189000	0.23516	6.744000	0.74854	1.980000	0.57719	0.459000	0.35465	GAG		0.527	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1		NM_015490	
SKIV2L	6499	broad.mit.edu;hgsc.bcm.edu	37	6	31930533	31930533	+	Silent	SNP	G	G	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr6:31930533G>A	ENST00000375394.2	+	12	1367	c.1254G>A	c.(1252-1254)gaG>gaA	p.E418E	SKIV2L_ENST00000544581.1_Silent_p.E225E	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	418	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.E418E(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GGGACCTGGAGTGGGTCATCT	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											142.0	132.0	135.0					6																	31930533		1510	2709	4219	SO:0001819	synonymous_variant	6499				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1254G>A	6.37:g.31930533G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O15005|Q12902|Q15476|Q5ST66	Silent	SNP	ENST00000375394.2	37	CCDS4731.1																																																																																				0.572	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3			
SNRK	54861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	43389698	43389698	+	Silent	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:43389698C>T	ENST00000296088.7	+	7	2251	c.1947C>T	c.(1945-1947)ctC>ctT	p.L649L	RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000429705.2_Silent_p.L649L|SNRK_ENST00000437827.1_Silent_p.L443L|SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000454177.1_Silent_p.L649L	NM_017719.4	NP_060189.3			SNF related kinase									p.L649L(2)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		GCCTCAAACTCATGAGCCTCT	0.552																																																	2	Substitution - coding silent(2)	kidney(2)											31.0	33.0	33.0					3																	43389698		1943	4142	6085	SO:0001819	synonymous_variant	54861			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1947C>T	3.37:g.43389698C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000296088.7	37	CCDS43075.1																																																																																				0.552	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1		NM_017719	
SPSB1	80176	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	9416147	9416147	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:9416147T>C	ENST00000328089.6	+	2	538	c.197T>C	c.(196-198)tTt>tCt	p.F66S	SPSB1_ENST00000377399.2_Missense_Mutation_p.F66S|SPSB1_ENST00000357898.3_Missense_Mutation_p.F66S	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	66	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.F66S(1)		breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CTCAATGTCTTTGTGAAGGAG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											174.0	168.0	170.0					1																	9416147		2203	4300	6503	SO:0001583	missense	80176				CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.197T>C	1.37:g.9416147T>C	ENSP00000330221:p.Phe66Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Missense_Mutation	SNP	ENST00000328089.6	37	CCDS102.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056308	0.55325	.	.	ENSG00000171621	ENST00000328089;ENST00000450402;ENST00000357898;ENST00000377399	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.32	5.32	0.75619	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	T	0.65375	0.2685	M	0.90650	3.135	0.80722	D	1	D	0.71674	0.998	P	0.60345	0.873	T	0.68812	-0.5310	10	0.23302	T	0.38	-12.0094	14.473	0.67529	0.0:0.0:0.0:1.0	.	66	Q96BD6	SPSB1_HUMAN	S	66	ENSP00000330221:F66S;ENSP00000409235:F66S;ENSP00000350573:F66S;ENSP00000366616:F66S	ENSP00000330221:F66S	F	+	2	0	SPSB1	9338734	1.000000	0.71417	0.979000	0.43373	0.497000	0.33675	6.237000	0.72345	2.011000	0.59026	0.533000	0.62120	TTT		0.577	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2		NM_025106	
SPEN	23013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	16199600	16199600	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:16199600C>T	ENST00000375759.3	+	2	577	c.373C>T	c.(373-375)Cga>Tga	p.R125*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	125	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.R125*(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACTTCATGCACGAGAAGGACG	0.463																																																	1	Substitution - Nonsense(1)	kidney(1)											93.0	80.0	84.0					1																	16199600		2203	4300	6503	SO:0001587	stop_gained	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.373C>T	1.37:g.16199600C>T	ENSP00000364912:p.Arg125*	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	C	36	5.726429	0.96847	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1083	19.3121	0.94192	0.0:1.0:0.0:0.0	.	.	.	.	X	125	.	ENSP00000364912:R125X	R	+	1	2	SPEN	16072187	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.983000	0.70540	2.578000	0.87016	0.555000	0.69702	CGA		0.463	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1		NM_015001	
SRCAP	10847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	30735820	30735820	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr16:30735820G>C	ENST00000262518.4	+	25	5460	c.5075G>C	c.(5074-5076)gGa>gCa	p.G1692A	SRCAP_ENST00000395059.2_Missense_Mutation_p.G1630A|SRCAP_ENST00000344771.4_Missense_Mutation_p.G1534A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1692	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.G1692A(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCCACTCTTGGAGGCTCATCT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											120.0	129.0	126.0					16																	30735820		2197	4300	6497	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5075G>C	16.37:g.30735820G>C	ENSP00000262518:p.Gly1692Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	6.628	0.484389	0.12641	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.90004	-2.54;-2.59;-2.6	5.81	4.85	0.62838	.	0.126462	0.36778	N	0.002409	T	0.75339	0.3836	N	0.19112	0.55	0.22940	N	0.998531	B;B;B	0.18741	0.03;0.03;0.018	B;B;B	0.21151	0.033;0.033;0.015	T	0.59252	-0.7489	10	0.02654	T	1	-3.7491	6.8326	0.23919	0.0862:0.0:0.7381:0.1757	.	1534;1630;1692	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	A	1692;1630;1534	ENSP00000262518:G1692A;ENSP00000378499:G1630A;ENSP00000343042:G1534A	ENSP00000262518:G1692A	G	+	2	0	SRCAP	30643321	1.000000	0.71417	0.948000	0.38648	0.615000	0.37417	4.812000	0.62613	2.741000	0.93983	0.650000	0.86243	GGA		0.562	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1		NM_006662	
TAF5	6877	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	105133273	105133273	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr10:105133273T>G	ENST00000369839.3	+	2	741	c.718T>G	c.(718-720)Ttt>Gtt	p.F240V	TAF5_ENST00000351396.4_Missense_Mutation_p.F240V	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	240					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.F240V(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GTCCCAACTTTTTTATCCTCT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											130.0	121.0	124.0					10																	105133273		2203	4300	6503	SO:0001583	missense	6877			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.718T>G	10.37:g.105133273T>G	ENSP00000358854:p.Phe240Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	.	.	.	.	.	.	.	.	.	.	T	19.24	3.788892	0.70337	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55588	0.77;0.51	5.13	5.13	0.70059	TFIID subunit, WD40-associated region (1);	0.000000	0.85682	D	0.000000	T	0.54191	0.1843	L	0.36672	1.1	0.80722	D	1	P;D	0.56521	0.925;0.976	B;P	0.51355	0.439;0.667	T	0.59327	-0.7475	10	0.72032	D	0.01	-10.9706	14.9325	0.70926	0.0:0.0:0.0:1.0	.	240;240	Q15542-2;Q15542	.;TAF5_HUMAN	V	240	ENSP00000358854:F240V;ENSP00000311024:F240V	ENSP00000311024:F240V	F	+	1	0	TAF5	105123263	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.698000	0.84413	1.936000	0.56123	0.454000	0.30748	TTT		0.383	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1			
TAS1R1	80835	hgsc.bcm.edu	37	1	6638984	6638985	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:6638984_6638985insT	ENST00000333172.6	+	6	2059_2060	c.1866_1867insT	c.(1867-1869)tttfs	p.F623fs	TAS1R1_ENST00000328191.4_3'UTR|TAS1R1_ENST00000351136.3_Frame_Shift_Ins_p.F369fs|ZBTB48_ENST00000377674.4_5'Flank	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	623					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TCTATGGCTTCTTTGGGGAACC	0.599																																																	0																																										SO:0001589	frameshift_variant	80835				CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1869dupT	1.37:g.6638987_6638987dupT	ENSP00000331867:p.Phe623fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Frame_Shift_Ins	INS	ENST00000333172.6	37	CCDS81.1																																																																																				0.599	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1			
TLL2	7093	broad.mit.edu;ucsc.edu	37	10	98182331	98182331	+	Silent	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr10:98182331G>T	ENST00000357947.3	-	6	1017	c.792C>A	c.(790-792)acC>acA	p.T264T	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	264	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T264T(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CCCTGATGATGGTGACATGTT	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											185.0	144.0	158.0					10																	98182331		2203	4300	6503	SO:0001819	synonymous_variant	7093			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.792C>A	10.37:g.98182331G>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	CCDS7449.1																																																																																				0.567	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			
TLR1	7096	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	38799865	38799865	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr4:38799865G>T	ENST00000502213.2	-	3	817	c.588C>A	c.(586-588)ttC>ttA	p.F196L	TLR1_ENST00000308979.2_Missense_Mutation_p.F196L			Q15399	TLR1_HUMAN	toll-like receptor 1	196					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.F196L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TGTTTGTGGGGAACACAATGT	0.393																																					GBM(5;216 373 40795 46382)												1	Substitution - Missense(1)	kidney(1)											63.0	63.0	63.0					4																	38799865		2203	4300	6503	SO:0001583	missense	7096			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.588C>A	4.37:g.38799865G>T	ENSP00000421259:p.Phe196Leu	Somatic		WXS	Illumina HiSeq	Phase_I	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.252776	0.01469	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.01629	4.72;4.72	4.59	1.76	0.24704	.	0.085568	0.49916	D	0.000122	T	0.01627	0.0052	L	0.46670	1.46	0.21652	N	0.999607	B	0.06786	0.001	B	0.10450	0.005	T	0.49808	-0.8900	10	0.09084	T	0.74	.	5.3574	0.16069	0.3317:0.1355:0.5328:0.0	.	196	Q15399	TLR1_HUMAN	L	196	ENSP00000354932:F196L;ENSP00000421259:F196L	ENSP00000354932:F196L	F	-	3	2	TLR1	38476260	0.008000	0.16893	0.982000	0.44146	0.010000	0.07245	-0.850000	0.04317	0.210000	0.20664	-0.345000	0.07892	TTC		0.393	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3			
TMEM87A	25963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42512318	42512318	+	Silent	SNP	T	T	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr15:42512318T>A	ENST00000389834.4	-	16	1683	c.1419A>T	c.(1417-1419)ccA>ccT	p.P473P	RP11-546B15.1_ENST00000563846.1_RNA|TMEM87A_ENST00000448392.1_Silent_p.P412P	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	473						integral component of membrane (GO:0016021)		p.P473P(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		CCTCAGACAATGGTGAAAAGG	0.318																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	103.0	101.0					15																	42512318		2203	4299	6502	SO:0001819	synonymous_variant	25963			AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.1419A>T	15.37:g.42512318T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Silent	SNP	ENST00000389834.4	37	CCDS32205.1																																																																																				0.318	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2		NM_015497	
TRAF5	7188	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	211545849	211545849	+	Silent	SNP	G	G	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:211545849G>A	ENST00000261464.5	+	11	1533	c.1479G>A	c.(1477-1479)aaG>aaA	p.K493K	TRAF5_ENST00000367004.3_Silent_p.K493K|TRAF5_ENST00000427925.2_Silent_p.K387K|TRAF5_ENST00000336184.2_Silent_p.K493K	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	493	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K493K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		GTGGCAAAAAGAACATTATGG	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											97.0	87.0	90.0					1																	211545849		2203	4300	6503	SO:0001819	synonymous_variant	7188			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1479G>A	1.37:g.211545849G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DIS9|B4E0A2|Q6FHY1	Silent	SNP	ENST00000261464.5	37	CCDS1497.1																																																																																				0.507	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1		NM_004619	
TRANK1	9881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	36872739	36872739	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:36872739C>A	ENST00000429976.2	-	21	8450	c.8203G>T	c.(8203-8205)Ggc>Tgc	p.G2735C	TRANK1_ENST00000301807.6_Missense_Mutation_p.G2185C|TRANK1_ENST00000428977.2_Missense_Mutation_p.G2185C	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2735							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)	p.G2185S(2)|p.G2178S(2)|p.G2735S(2)|p.G2735C(1)|p.G2185C(1)|p.G2178C(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TTCTCTGGGCCACGGGTAAAC	0.592																																																	9	Substitution - Missense(9)	lung(6)|kidney(3)											63.0	65.0	64.0					3																	36872739		2012	4168	6180	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.8203G>T	3.37:g.36872739C>A	ENSP00000416168:p.Gly2735Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	5.740	0.321053	0.10845	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.32515	1.45;1.87;1.45	5.25	-2.72	0.05968	.	0.760679	0.12318	N	0.479586	T	0.14657	0.0354	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.15037	-1.0451	10	0.38643	T	0.18	.	5.3267	0.15910	0.3262:0.1566:0.0:0.5172	.	2735	O15050	TRNK1_HUMAN	C	2185;2735;2185	ENSP00000416826:G2185C;ENSP00000416168:G2735C;ENSP00000301807:G2185C	ENSP00000301807:G2185C	G	-	1	0	TRANK1	36847743	0.001000	0.12720	0.000000	0.03702	0.370000	0.29829	-0.152000	0.10159	-0.827000	0.04278	-0.367000	0.07326	GGC		0.592	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_014831	
TSC22D1	8848	broad.mit.edu	37	13	45008837	45008837	+	Silent	SNP	A	A	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr13:45008837A>G	ENST00000458659.2	-	3	3637	c.3147T>C	c.(3145-3147)ccT>ccC	p.P1049P	RP11-71C5.2_ENST00000426579.2_RNA|TSC22D1_ENST00000261489.2_Silent_p.P120P|TSC22D1_ENST00000501704.2_Intron	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	1049					negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P1049P(2)|p.P120P(2)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		GGGTGGTGGCAGGGGGGGAGC	0.642																																																	4	Substitution - coding silent(4)	prostate(2)|kidney(2)											21.0	25.0	24.0					13																	45008837		2194	4297	6491	SO:0001819	synonymous_variant	8848			AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.3147T>C	13.37:g.45008837A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Silent	SNP	ENST00000458659.2	37	CCDS31966.1																																																																																				0.642	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2		NM_006022	
UBE4B	10277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	10166557	10166557	+	Missense_Mutation	SNP	G	G	A	rs375249164		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:10166557G>A	ENST00000343090.6	+	7	1187	c.1112G>A	c.(1111-1113)aGg>aAg	p.R371K	UBE4B_ENST00000377157.3_Intron|UBE4B_ENST00000253251.8_Intron	NM_001105562.2	NP_001099032.1			ubiquitination factor E4B									p.R371K(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TCCAGACAGAGGCCCAGCAGC	0.657																																																	1	Substitution - Missense(1)	kidney(1)						G	,LYS/ARG	0,4192		0,0,2096	51.0	61.0	58.0		,1112	4.5	1.0	1		58	1,8423		0,1,4211	no	intron,missense	UBE4B	NM_006048.4,NM_001105562.2	,26	0,1,6307	AA,AG,GG		0.0119,0.0,0.0079	,benign	,371/1303	10166557	1,12615	2096	4212	6308	SO:0001583	missense	10277			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000343090.6:c.1112G>A	1.37:g.10166557G>A	ENSP00000343001:p.Arg371Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000343090.6	37	CCDS41245.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516653	0.64634	0.0	1.19E-4	ENSG00000130939	ENST00000343090	T	0.46451	0.87	5.47	4.5	0.54988	.	0.132353	0.49305	D	0.000145	T	0.26521	0.0648	N	0.22421	0.69	0.80722	D	1	B	0.19200	0.034	B	0.14578	0.011	T	0.07635	-1.0762	10	0.02654	T	1	-17.1849	16.0805	0.81003	0.0:0.1338:0.8662:0.0	.	371	O95155	UBE4B_HUMAN	K	371	ENSP00000343001:R371K	ENSP00000343001:R371K	R	+	2	0	UBE4B	10089144	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	3.900000	0.56295	2.735000	0.93741	0.655000	0.94253	AGG		0.657	UBE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005016.1		NM_006048	
USP48	84196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	22032286	22032286	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr1:22032286G>A	ENST00000308271.9	-	19	2966	c.2318C>T	c.(2317-2319)gCt>gTt	p.A773V	USP48_ENST00000374732.3_Missense_Mutation_p.A311V|USP48_ENST00000529637.1_Missense_Mutation_p.A785V|USP48_ENST00000400301.1_Missense_Mutation_p.A773V	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	773	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.A773V(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ACACAAAAGAGCACTGTTCCC	0.418																																																	1	Substitution - Missense(1)	kidney(1)											71.0	74.0	73.0					1																	22032286		2203	4300	6503	SO:0001583	missense	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2318C>T	1.37:g.22032286G>A	ENSP00000309262:p.Ala773Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682154	0.29872	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T	0.04758	3.56;3.56;3.56	5.7	5.7	0.88788	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.206931	0.46758	D	0.000268	T	0.04724	0.0128	L	0.44542	1.39	0.35103	D	0.765385	B;B;B;B;B	0.28933	0.177;0.012;0.228;0.146;0.225	B;B;B;B;B	0.26969	0.032;0.003;0.075;0.023;0.047	T	0.32375	-0.9909	10	0.11182	T	0.66	.	10.3321	0.43829	0.1493:0.0:0.8507:0.0	.	785;773;773;773;311	B7ZKS7;B7ZKS3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;UBP48_HUMAN;.	V	773;773;311;785	ENSP00000383157:A773V;ENSP00000309262:A773V;ENSP00000431949:A785V	ENSP00000309262:A773V	A	-	2	0	USP48	21904873	1.000000	0.71417	0.985000	0.45067	0.664000	0.39144	4.779000	0.62375	2.697000	0.92050	0.557000	0.71058	GCT		0.418	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1		NM_032236	
ZBTB20	26137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	114058081	114058081	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr3:114058081A>G	ENST00000474710.1	-	5	2175	c.1997T>C	c.(1996-1998)aTc>aCc	p.I666T	ZBTB20_ENST00000462705.1_Missense_Mutation_p.I593T|ZBTB20_ENST00000471418.1_Missense_Mutation_p.I593T|ZBTB20_ENST00000464560.1_Missense_Mutation_p.I593T|ZBTB20_ENST00000393785.2_Missense_Mutation_p.I593T|ZBTB20_ENST00000481632.1_Missense_Mutation_p.I593T|ZBTB20_ENST00000357258.3_Missense_Mutation_p.I593T	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	666						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.I593T(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CTTTTTGCAGATGTAGCACTC	0.592																																					NSCLC(69;748 1344 9802 11203 30933)												1	Substitution - Missense(1)	kidney(1)											170.0	154.0	159.0					3																	114058081		2203	4300	6503	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1997T>C	3.37:g.114058081A>G	ENSP00000419153:p.Ile666Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	A	17.06	3.292109	0.59976	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19;3.19;3.19	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.053160	0.85682	D	0.000000	T	0.11495	0.0280	L	0.35593	1.075	0.80722	D	1	P	0.48089	0.905	P	0.47118	0.538	T	0.12426	-1.0548	10	0.30854	T	0.27	.	16.4608	0.84044	1.0:0.0:0.0:0.0	.	666	Q9HC78	ZBT20_HUMAN	T	593;593;593;593;666;593;593	ENSP00000420324:I593T;ENSP00000377375:I593T;ENSP00000418092:I593T;ENSP00000419902:I593T;ENSP00000419153:I666T;ENSP00000349803:I593T;ENSP00000417307:I593T	ENSP00000349803:I593T	I	-	2	0	ZBTB20	115540771	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.288000	0.76882	0.533000	0.62120	ATC		0.592	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1		NM_015642	
ZMYND11	10771	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	298337	298337	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	00523547-da1c-4bb1-a627-c0946849b376	24dc7a15-3446-419c-b2be-75107c669f93	g.chr10:298337C>A	ENST00000397962.3	+	15	2164	c.1736C>A	c.(1735-1737)tCc>tAc	p.S579Y	ZMYND11_ENST00000402736.1_Missense_Mutation_p.S548Y|ZMYND11_ENST00000381604.4_Missense_Mutation_p.S539Y|ZMYND11_ENST00000381591.1_Missense_Mutation_p.S579Y|ZMYND11_ENST00000545619.1_Missense_Mutation_p.S459Y|ZMYND11_ENST00000381607.4_Missense_Mutation_p.S485Y|ZMYND11_ENST00000602682.1_Missense_Mutation_p.S494Y|ZMYND11_ENST00000535374.1_Missense_Mutation_p.S374Y|ZMYND11_ENST00000397959.3_Missense_Mutation_p.S494Y|ZMYND11_ENST00000403354.1_Missense_Mutation_p.S499Y|ZMYND11_ENST00000309776.4_Missense_Mutation_p.S539Y|ZMYND11_ENST00000381584.1_Missense_Mutation_p.S562Y			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	579					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.S539Y(1)|p.S579Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGGAACACATCCTACTGCTCC	0.577																																																	2	Substitution - Missense(2)	kidney(2)											146.0	141.0	142.0					10																	298337		2203	4300	6503	SO:0001583	missense	10771			X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.1736C>A	10.37:g.298337C>A	ENSP00000381053:p.Ser579Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Missense_Mutation	SNP	ENST00000397962.3	37	CCDS7052.2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451090	0.84209	.	.	ENSG00000015171	ENST00000397962;ENST00000309776;ENST00000397959;ENST00000381591;ENST00000403354;ENST00000381607;ENST00000402736;ENST00000381604;ENST00000381584;ENST00000545619;ENST00000535374	.	.	.	5.29	4.38	0.52667	Zinc finger, MYND-type (2);	0.000000	0.85682	D	0.000000	T	0.80166	0.4573	M	0.79805	2.47	0.48632	D	0.999682	D;D;D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.99;0.999;0.999	D;D;D;D;D;D;D	0.85130	0.997;0.994;0.956;0.997;0.974;0.997;0.996	D	0.84592	0.0667	8	0.72032	D	0.01	-14.1553	16.332	0.83039	0.0:0.8677:0.1323:0.0	.	539;494;524;579;499;508;525	Q15326;B7Z293;B7Z2J6;Q2LD48;B0QZE2;B0QZE3;Q2LD47	ZMY11_HUMAN;.;.;.;.;.;.	Y	579;539;494;579;499;485;548;539;562;459;374	.	ENSP00000309992:S539Y	S	+	2	0	ZMYND11	288337	1.000000	0.71417	0.427000	0.26684	0.986000	0.74619	7.760000	0.85248	1.341000	0.45600	0.561000	0.74099	TCC		0.577	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046382.4		NM_006624	
