#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACO1	48	broad.mit.edu	37	9	32434667	32434667	+	Silent	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr9:32434667C>T	ENST00000309951.6	+	17	2205	c.2067C>T	c.(2065-2067)aaC>aaT	p.N689N	ACO1_ENST00000379923.1_Silent_p.N689N|ACO1_ENST00000541043.1_Silent_p.N590N	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	689					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.N689N(2)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TTGCAAGAAACAGTCCTGCTG	0.448																																																	2	Substitution - coding silent(2)	kidney(2)											135.0	128.0	130.0					9																	32434667		2203	4300	6503	SO:0001819	synonymous_variant	48			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.2067C>T	9.37:g.32434667C>T		Somatic		WXS	Illumina GAIIx	Phase_I	D3DRK7|Q14652|Q5VZA7	Silent	SNP	ENST00000309951.6	37	CCDS6525.1																																																																																				0.448	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3		NM_002197	
ADAMTS20	80070	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	43862444	43862444	+	Silent	SNP	T	T	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr12:43862444T>G	ENST00000389420.3	-	8	1181	c.1182A>C	c.(1180-1182)ggA>ggC	p.G394G	ADAMTS20_ENST00000553158.1_Silent_p.G394G	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	394	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G394G(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAGAAATGAGTCCTTTTTCTT	0.348																																																	2	Substitution - coding silent(2)	kidney(2)											125.0	132.0	130.0					12																	43862444		2203	4300	6503	SO:0001819	synonymous_variant	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1182A>C	12.37:g.43862444T>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	CCDS31778.2																																																																																				0.348	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1		NM_025003	
ALPL	249	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	21903878	21903878	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr1:21903878C>T	ENST00000374840.3	+	12	1562	c.1312C>T	c.(1312-1314)Cac>Tac	p.H438Y	ALPL_ENST00000540617.1_Missense_Mutation_p.H383Y|ALPL_ENST00000374829.1_Missense_Mutation_p.H84Y|ALPL_ENST00000425315.2_Missense_Mutation_p.H438Y|ALPL_ENST00000374830.1_Missense_Mutation_p.H84Y|ALPL_ENST00000374832.1_Missense_Mutation_p.H438Y|ALPL_ENST00000539907.1_Missense_Mutation_p.H361Y	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	438					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.H438Y(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	GCCCACAGCTCACAACAACTA	0.667																																																	1	Substitution - Missense(1)	kidney(1)											43.0	45.0	45.0					1																	21903878		2201	4292	6493	SO:0001583	missense	249			BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.1312C>T	1.37:g.21903878C>T	ENSP00000363973:p.His438Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	ENST00000374840.3	37	CCDS217.1	.	.	.	.	.	.	.	.	.	.	c	15.56	2.870584	0.51588	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315;ENST00000374830;ENST00000374829	D;D;D;D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83;-3.83;-3.83;-3.83	4.59	4.59	0.56863	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.109644	0.64402	D	0.000007	D	0.94522	0.8236	L	0.49126	1.545	0.41849	D	0.990168	B;P;P	0.47962	0.014;0.829;0.903	B;P;P	0.47346	0.038;0.53;0.544	D	0.95234	0.8345	10	0.72032	D	0.01	-7.952	14.9591	0.71141	0.0:1.0:0.0:0.0	.	361;386;438	B7Z387;B7Z1D1;P05186	.;.;PPBT_HUMAN	Y	361;383;438;438;438;84;84	ENSP00000437674:H361Y;ENSP00000442672:H383Y;ENSP00000363973:H438Y;ENSP00000363965:H438Y;ENSP00000394765:H438Y;ENSP00000363963:H84Y;ENSP00000363962:H84Y	ENSP00000363962:H84Y	H	+	1	0	ALPL	21776465	0.584000	0.26766	1.000000	0.80357	0.982000	0.71751	0.584000	0.23864	2.392000	0.81423	0.556000	0.70494	CAC		0.667	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1		NM_000478	
ATG7	10533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	11348441	11348441	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr3:11348441C>A	ENST00000354449.3	+	4	265	c.240C>A	c.(238-240)tgC>tgA	p.C80*	ATG7_ENST00000354956.5_Nonsense_Mutation_p.C80*|ATG7_ENST00000446450.2_Nonsense_Mutation_p.C80*	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	80					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)	p.C80*(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CAGCCCGTTGCTGCCCAGCTA	0.502																																																	1	Substitution - Nonsense(1)	kidney(1)											148.0	139.0	142.0					3																	11348441		2203	4300	6503	SO:0001587	stop_gained	10533			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.240C>A	3.37:g.11348441C>A	ENSP00000346437:p.Cys80*	Somatic		WXS	Illumina HiSeq	Phase_I	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Nonsense_Mutation	SNP	ENST00000354449.3	37	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	c	23.7	4.444851	0.83993	.	.	ENSG00000197548	ENST00000451513;ENST00000451830;ENST00000444619;ENST00000446450;ENST00000354956;ENST00000354449;ENST00000419112;ENST00000423116	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-17.4693	19.8591	0.96777	0.0:1.0:0.0:0.0	.	.	.	.	X	80	.	ENSP00000346437:C80X	C	+	3	2	ATG7	11323441	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.519000	0.45546	2.785000	0.95823	0.645000	0.84053	TGC		0.502	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3		NM_006395	
BBS10	79738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	76741471	76741471	+	Silent	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr12:76741471A>G	ENST00000393262.3	-	2	377	c.294T>C	c.(292-294)caT>caC	p.H98H		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	98					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.H98H(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						CTGTGATTGCATGAAGTCCTC	0.383									Bardet-Biedl syndrome																																								1	Substitution - coding silent(1)	kidney(1)											86.0	84.0	85.0					12																	76741471		2203	4300	6503	SO:0001819	synonymous_variant	79738	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.294T>C	12.37:g.76741471A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q96CW2|Q9H5D2	Silent	SNP	ENST00000393262.3	37	CCDS9014.2																																																																																				0.383	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303983.2		NM_024685	
BSND	7809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55474113	55474113	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr1:55474113T>A	ENST00000371265.4	+	4	1029	c.775T>A	c.(775-777)Tgg>Agg	p.W259R		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	259					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)	p.W259R(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						GGGGCAGCAGTGGGAAATAGC	0.597																																					Ovarian(191;1657 2078 22894 42033 48899)												1	Substitution - Missense(1)	kidney(1)											59.0	59.0	59.0					1																	55474113		2203	4300	6503	SO:0001583	missense	7809			AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.775T>A	1.37:g.55474113T>A	ENSP00000360312:p.Trp259Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NT28	Missense_Mutation	SNP	ENST00000371265.4	37	CCDS602.1	.	.	.	.	.	.	.	.	.	.	T	1.291	-0.607633	0.03717	.	.	ENSG00000162399	ENST00000371265	D	0.85955	-2.05	4.72	-0.886	0.10590	.	2.086490	0.01992	N	0.045607	T	0.61825	0.2378	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.62220	-0.6900	10	0.06494	T	0.89	0.1806	5.5173	0.16914	0.0:0.4708:0.1332:0.3961	.	259	Q8WZ55	BSND_HUMAN	R	259	ENSP00000360312:W259R	ENSP00000360312:W259R	W	+	1	0	BSND	55246701	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-0.618000	0.05578	-0.187000	0.10516	-0.355000	0.07637	TGG		0.597	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022213.4		NM_057176	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45716018	45716019	+	Frame_Shift_Ins	INS	-	-	T	rs546807245	byFrequency	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr14:45716018_45716019insT	ENST00000310806.4	-	2	929_930	c.471_472insA	c.(469-474)aaattgfs	p.L158fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	158					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.K157fs*24(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						GTATGCTGCAATTTTTTTTTTT	0.356													|||unknown(HR)	178	0.0355431	0.0628	0.0101	5008	,	,		17954	0.0169		0.0139	False		,,,				2504	0.0583																1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.472dupA	14.37:g.45716029_45716029dupT	ENSP00000309790:p.Leu158fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Ins	INS	ENST00000310806.4	37	CCDS9684.1																																																																																				0.356	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2			
FAM222B	55731	hgsc.bcm.edu;ucsc.edu	37	17	27086257	27086258	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr17:27086257_27086258insG	ENST00000341217.5	-	3	934_935	c.719_720insC	c.(718-720)ccgfs	p.P240fs	FAM222B_ENST00000452648.3_Frame_Shift_Ins_p.P240fs|FAM222B_ENST00000581407.1_Frame_Shift_Ins_p.P240fs|FAM222B_ENST00000582266.1_3'UTR	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	240																	CGGTCACATTCGGGGGGGCATC	0.619																																																	0																																										SO:0001589	frameshift_variant	0			AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.720dupC	17.37:g.27086264_27086264dupG	ENSP00000343115:p.Pro240fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H6F3|Q9NVJ4|Q9NXN6	Frame_Shift_Ins	INS	ENST00000341217.5	37	CCDS45637.1																																																																																				0.619	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446703.1		NM_018182	
C17orf97	400566	broad.mit.edu	37	17	263666	263666	+	Silent	SNP	C	C	A	rs111388956		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr17:263666C>A	ENST00000360127.6	+	2	1048	c.1032C>A	c.(1030-1032)ggC>ggA	p.G344G	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	374	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.							p.G344G(2)		breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCTCAAGGGCTTCCACCCCG	0.687																																																	2	Substitution - coding silent(2)	kidney(2)											11.0	17.0	15.0					17																	263666		1810	3749	5559	SO:0001819	synonymous_variant	400566			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1032C>A	17.37:g.263666C>A		Somatic		WXS	Illumina GAIIx	Phase_I	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000360127.6	37	CCDS32519.2																																																																																				0.687	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4		NM_001013672	
CCKAR	886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	26487295	26487295	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr4:26487295C>T	ENST00000295589.3	-	3	784	c.590G>A	c.(589-591)cGc>cAc	p.R197H		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	197					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)	p.R197H(1)		NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	CAGTAGAAAGCGGCACATATT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											106.0	102.0	104.0					4																	26487295		2203	4300	6503	SO:0001583	missense	886			L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.590G>A	4.37:g.26487295C>T	ENSP00000295589:p.Arg197His	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9Z5	Missense_Mutation	SNP	ENST00000295589.3	37	CCDS3438.1	.	.	.	.	.	.	.	.	.	.	C	33	5.211232	0.95069	.	.	ENSG00000163394	ENST00000295589	T	0.37058	1.22	5.71	5.71	0.89125	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59376	0.2189	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.53995	-0.8359	10	0.40728	T	0.16	.	19.8773	0.96884	0.0:1.0:0.0:0.0	.	197	P32238	CCKAR_HUMAN	H	197	ENSP00000295589:R197H	ENSP00000295589:R197H	R	-	2	0	CCKAR	26096393	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.487000	0.81328	2.686000	0.91538	0.650000	0.86243	CGC		0.393	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			
TRAPPC11	60684	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	184629723	184629723	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr4:184629723T>C	ENST00000334690.6	+	29	3555	c.3353T>C	c.(3352-3354)gTc>gCc	p.V1118A	TRAPPC11_ENST00000512476.1_Missense_Mutation_p.V724A|RNU6-1053P_ENST00000515930.1_RNA|TRAPPC11_ENST00000357207.4_Silent_p.C1078C	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	1118					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.V1118A(1)									AGTATTTTTGTCAAGGTAAAG	0.363																																																	1	Substitution - Missense(1)	kidney(1)											56.0	56.0	56.0					4																	184629723		2203	4300	6503	SO:0001583	missense	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.3353T>C	4.37:g.184629723T>C	ENSP00000335371:p.Val1118Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	T	19.44	3.827707	0.71143	.	.	ENSG00000168538	ENST00000334690;ENST00000512476	.	.	.	4.39	4.39	0.52855	.	0.069681	0.56097	D	0.000022	T	0.62183	0.2407	.	.	.	0.80722	D	1	P;D	0.60575	0.951;0.988	P;P	0.49085	0.525;0.6	T	0.68941	-0.5276	8	0.87932	D	0	.	13.7919	0.63146	0.0:0.0:0.0:1.0	.	724;1118	D6RHE5;Q7Z392	.;TPC11_HUMAN	A	1118;724	.	ENSP00000335371:V1118A	V	+	2	0	C4orf41	184866717	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.845000	0.86875	1.845000	0.53610	0.455000	0.32223	GTC		0.363	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2		NM_021942	
CCNJ	54619	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	97816869	97816869	+	Intron	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr10:97816869C>T	ENST00000265992.5	+	5	947				ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000427846.1_RNA|CCNJ_ENST00000403870.3_Intron|ENTPD1-AS1_ENST00000458228.1_RNA|CCNJ_ENST00000465148.2_Missense_Mutation_p.P202L|CCNJ_ENST00000534974.1_Intron|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J							nucleus (GO:0005634)		p.?(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		AATTATGCACCTTCTTTAGTA	0.423																																																	1	Unknown(1)	kidney(1)											233.0	209.0	217.0					10																	97816869		2203	4300	6503	SO:0001627	intron_variant	54619			AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.581-9C>T	10.37:g.97816869C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z4E7|Q86XL1|Q9NV69	Missense_Mutation	SNP	ENST00000265992.5	37	CCDS7445.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621729	0.87460	.	.	ENSG00000107443	ENST00000419934	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	T	0.78381	0.4274	M	0.90705	3.14	0.80722	D	1	D	0.57571	0.98	P	0.51806	0.68	D	0.83733	0.0199	8	0.87932	D	0	.	18.3376	0.90294	0.0:1.0:0.0:0.0	.	202	Q5T5M9-3	.	L	202	.	ENSP00000388902:P202L	P	+	2	0	CCNJ	97806859	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.690000	0.91761	0.650000	0.86243	CCT		0.423	CCNJ-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090166.3		NM_019084	
CDH4	1002	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	60499490	60499490	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr20:60499490C>G	ENST00000360469.5	+	11	1815	c.1727C>G	c.(1726-1728)aCc>aGc	p.T576S	CDH4_ENST00000543233.1_Missense_Mutation_p.T502S	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	576	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T576S(1)		NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TCCCTCTACACCAAAAACAAC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											132.0	101.0	112.0					20																	60499490		2203	4300	6503	SO:0001583	missense	1002			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1727C>G	20.37:g.60499490C>G	ENSP00000353656:p.Thr576Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597417	0.46318	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.55760	0.5;0.51	4.44	0.168	0.15012	Cadherin (4);Cadherin-like (1);	0.394839	0.29767	N	0.011258	T	0.26738	0.0654	N	0.04508	-0.205	0.25163	N	0.990333	B	0.22480	0.07	B	0.31946	0.138	T	0.28299	-1.0048	9	.	.	.	.	7.8915	0.29680	0.0:0.3181:0.0:0.6819	.	576	P55283	CADH4_HUMAN	S	576;484;502	ENSP00000353656:T576S;ENSP00000443301:T502S	.	T	+	2	0	CDH4	59932885	1.000000	0.71417	0.979000	0.43373	0.889000	0.51656	3.249000	0.51437	-0.263000	0.09378	-0.367000	0.07326	ACC		0.617	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2		NM_001794	
CEP76	79959	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	12701062	12701062	+	Silent	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr18:12701062T>C	ENST00000262127.2	-	2	339	c.114A>G	c.(112-114)gaA>gaG	p.E38E	CEP76_ENST00000423709.2_Silent_p.E38E|PSMG2_ENST00000590217.1_5'Flank|PSMG2_ENST00000585331.2_Intron|CEP76_ENST00000586887.1_5'UTR|PSMG2_ENST00000317615.6_5'Flank	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	38					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)		p.E38E(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTGCCAATTCTTCCCGTATAG	0.358																																																	1	Substitution - coding silent(1)	kidney(1)											140.0	125.0	130.0					18																	12701062		2203	4300	6503	SO:0001819	synonymous_variant	79959			BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.114A>G	18.37:g.12701062T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Silent	SNP	ENST00000262127.2	37	CCDS11861.1																																																																																				0.358	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254611.1		NM_024899	
CLCC1	23155	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	109477333	109477333	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr1:109477333C>T	ENST00000369971.2	-	11	1744	c.1615G>A	c.(1615-1617)Gga>Aga	p.G539R	CLCC1_ENST00000415331.1_Missense_Mutation_p.G489R|CLCC1_ENST00000482889.1_Intron|CLCC1_ENST00000369968.2_Missense_Mutation_p.G354R|CLCC1_ENST00000302500.4_Missense_Mutation_p.G418R|CLCC1_ENST00000356970.2_Missense_Mutation_p.G539R|CLCC1_ENST00000369976.1_Intron|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000369969.2_Missense_Mutation_p.G418R|CLCC1_ENST00000348264.2_Missense_Mutation_p.G354R|CLCC1_ENST00000369970.3_Missense_Mutation_p.G489R	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	539						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)	p.G489R(1)|p.G539R(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CCACGTGGTCCAGCCACACCT	0.577																																																	2	Substitution - Missense(2)	kidney(2)											91.0	82.0	85.0					1																	109477333		2203	4300	6503	SO:0001583	missense	23155			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.1615G>A	1.37:g.109477333C>T	ENSP00000358988:p.Gly539Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183518	0.38609	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369968;ENST00000369970;ENST00000348264;ENST00000302500	T;T;T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46	5.37	-0.0897	0.13667	.	1.158390	0.06442	N	0.726119	T	0.13072	0.0317	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.11235	0.004;0.004;0.002;0.003	B;B;B;B	0.10450	0.004;0.003;0.003;0.005	T	0.20075	-1.0286	10	0.13853	T	0.58	0.0967	5.1276	0.14894	0.0:0.4751:0.2775:0.2475	.	354;418;489;539	Q96S66-4;Q96S66-3;Q96S66-2;Q96S66	.;.;.;CLCC1_HUMAN	R	539;539;489;418;354;489;354;418	ENSP00000349456:G539R;ENSP00000358988:G539R;ENSP00000411591:G489R;ENSP00000358986:G418R;ENSP00000358985:G354R;ENSP00000358987:G489R;ENSP00000337243:G354R;ENSP00000306552:G418R	ENSP00000306552:G418R	G	-	1	0	CLCC1	109278856	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.001000	0.12947	-0.021000	0.14009	-0.136000	0.14681	GGA		0.577	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1		NM_015127	
COX11	1353	broad.mit.edu;hgsc.bcm.edu	37	17	53040153	53040153	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr17:53040153A>G	ENST00000299335.3	-	4	910	c.772T>C	c.(772-774)Tct>Cct	p.S258P	COX11_ENST00000573912.1_5'Flank	NM_004375.3	NP_004366.1	Q9Y6N1	COX11_HUMAN	cytochrome c oxidase assembly homolog 11 (yeast)	258					hydrogen ion transmembrane transport (GO:1902600)|negative regulation of glucokinase activity (GO:0033132)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)	p.S258P(1)		endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|prostate(1)	9						AAAGTGTAAGAAAGAGTGATA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											87.0	88.0	88.0					17																	53040153		2203	4299	6502	SO:0001583	missense	1353			AF044321	CCDS11583.1, CCDS58579.1	17q22	2012-10-15	2012-10-15			ENSG00000166260		"""Mitochondrial respiratory chain complex assembly factors"""	2261	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit 11"", ""cytochrome c oxidase assembly protein COX11"""	603648	"""COX11 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX11 cytochrome c oxidase assembly homolog (yeast)"""			9878253	Standard	NM_004375		Approved	COX11P	uc010wng.1	Q9Y6N1		ENST00000299335.3:c.772T>C	17.37:g.53040153A>G	ENSP00000299335:p.Ser258Pro	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTY5|I3L220|Q6FHB7|Q9BRX0|Q9UME8	Missense_Mutation	SNP	ENST00000299335.3	37	CCDS11583.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425253	0.83667	.	.	ENSG00000166260	ENST00000299335	T	0.56103	0.48	5.33	5.33	0.75918	Cytochrome c oxidase assembly protein CtaG/Cox11, domain (2);	0.000000	0.85682	D	0.000000	T	0.72922	0.3521	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77099	-0.2713	9	0.87932	D	0	1.3894	14.7737	0.69699	1.0:0.0:0.0:0.0	.	258	Q9Y6N1	COX11_HUMAN	P	258	ENSP00000299335:S258P	ENSP00000299335:S258P	S	-	1	0	COX11	50395152	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.221000	0.95188	2.134000	0.65973	0.528000	0.53228	TCT		0.373	COX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439182.1		NM_004375	
CTNNA3	29119	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	68139003	68139003	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr10:68139003C>G	ENST00000433211.2	-	12	1813	c.1639G>C	c.(1639-1641)Gtt>Ctt	p.V547L	CTNNA3_ENST00000373744.4_Missense_Mutation_p.V547L	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.V547L(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						ATGTGAGCAACTCTTGCTGCC	0.473																																																	2	Substitution - Missense(2)	kidney(2)											143.0	134.0	137.0					10																	68139003		2203	4300	6503	SO:0001583	missense	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1639G>C	10.37:g.68139003C>G	ENSP00000389714:p.Val547Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	35	5.571915	0.96553	.	.	ENSG00000183230	ENST00000433211;ENST00000373744	T;T	0.52057	0.68;0.68	5.87	5.87	0.94306	.	0.000000	0.48767	D	0.000168	T	0.74313	0.3700	M	0.88310	2.945	0.80722	D	1	D	0.57257	0.979	D	0.70487	0.969	T	0.78521	-0.2172	10	0.87932	D	0	-21.6518	17.6929	0.88273	0.0:1.0:0.0:0.0	.	547	Q9UI47	CTNA3_HUMAN	L	547	ENSP00000389714:V547L;ENSP00000362849:V547L	ENSP00000362849:V547L	V	-	1	0	CTNNA3	67809009	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.060000	0.71141	2.775000	0.95449	0.650000	0.86243	GTT		0.473	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2		NM_013266	
CTNND1	1500	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	57573353	57573353	+	Splice_Site	SNP	G	G	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr11:57573353G>A	ENST00000399050.4	+	10	2258		c.e10-1		CTNND1_ENST00000529986.1_Splice_Site|CTNND1_ENST00000415361.2_Splice_Site|CTNND1_ENST00000529919.1_Splice_Site|CTNND1_ENST00000524630.1_Splice_Site|CTNND1_ENST00000530748.1_Splice_Site|CTNND1_ENST00000532649.1_Splice_Site|CTNND1_ENST00000526938.1_Splice_Site|CTNND1_ENST00000528621.1_Splice_Site|CTNND1_ENST00000530094.1_Splice_Site|CTNND1_ENST00000361796.4_Splice_Site|CTNND1_ENST00000358694.6_Splice_Site|CTNND1_ENST00000532787.1_Splice_Site|CTNND1_ENST00000532463.1_Splice_Site|CTNND1_ENST00000526357.1_Splice_Site|CTNND1_ENST00000532844.1_Splice_Site|CTNND1_ENST00000361332.4_Splice_Site|CTNND1_ENST00000360682.6_Splice_Site|CTNND1_ENST00000528232.1_Splice_Site|CTNND1_ENST00000533667.1_Splice_Site|CTNND1_ENST00000531014.1_Splice_Site|CTNND1_ENST00000532245.1_Splice_Site|CTNND1_ENST00000525902.1_Splice_Site|CTNND1_ENST00000529873.1_Splice_Site|CTNND1_ENST00000527467.1_Splice_Site|CTNND1_ENST00000529526.1_Splice_Site|CTNND1_ENST00000399039.4_Splice_Site|CTNND1_ENST00000534579.1_Splice_Site|CTNND1_ENST00000426142.2_Splice_Site|CTNND1_ENST00000361391.6_Splice_Site|CTNND1_ENST00000526772.1_Splice_Site|CTNND1_ENST00000428599.2_Splice_Site	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1						adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)	p.?(2)		breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				ATGTCCCTAAGCTTGTAGAGA	0.423																																																	2	Unknown(2)	kidney(2)											71.0	67.0	68.0					11																	57573353		1877	4109	5986	SO:0001630	splice_region_variant	1500			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1723-1G>A	11.37:g.57573353G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Splice_Site	SNP	ENST00000399050.4	37	CCDS44604.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232945	0.79688	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5786	0.95455	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTNND1	57329929	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.476000	0.97823	2.726000	0.93360	0.655000	0.94253	.		0.423	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1		NM_001331	Intron
DENND4B	9909	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	153916542	153916542	+	Silent	SNP	A	A	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr1:153916542A>T	ENST00000361217.4	-	2	727	c.309T>A	c.(307-309)gtT>gtA	p.V103V		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	103	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V103V(1)|p.L55*(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ACCCCAGCTCAACGAGGGGGG	0.632																																																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	kidney(2)											26.0	30.0	29.0					1																	153916542		1902	4107	6009	SO:0001819	synonymous_variant	9909			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.309T>A	1.37:g.153916542A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	A	10.61	1.398760	0.25291	.	.	ENSG00000198837	ENST00000472932	.	.	.	4.7	-0.897	0.10553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.0749	5.5841	0.17266	0.2247:0.5757:0.0787:0.1209	.	.	.	.	R	9	.	.	X	-	1	0	DENND4B	152183166	0.000000	0.05858	0.996000	0.52242	0.961000	0.63080	-2.134000	0.01307	-0.362000	0.08113	-0.728000	0.03583	TGA		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2		XM_375806	
DSE	29940	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	116752301	116752301	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr6:116752301T>A	ENST00000331677.3	+	5	1299	c.855T>A	c.(853-855)ttT>ttA	p.F285L	DSE_ENST00000537543.1_Missense_Mutation_p.F304L|DSE_ENST00000359564.2_Missense_Mutation_p.F285L|DSE_ENST00000452085.3_Missense_Mutation_p.F285L			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	285					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)	p.F285L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TCAACCACTTTGGCCATCCGT	0.428																																																	1	Substitution - Missense(1)	kidney(1)											162.0	131.0	142.0					6																	116752301		2203	4300	6503	SO:0001583	missense	29940			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.855T>A	6.37:g.116752301T>A	ENSP00000332151:p.Phe285Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766646	0.69878	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	6.17	0.779	0.18550	.	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	N	0.26042	0.785	0.58432	D	0.999991	D;D	0.58268	0.982;0.982	P;P	0.54889	0.763;0.763	T	0.02075	-1.1218	10	0.24483	T	0.36	-19.251	9.4407	0.38666	0.0:0.5167:0.0:0.4833	.	304;285	B7Z765;Q9UL01	.;DSE_HUMAN	L	285;304;285;285	ENSP00000404049:F285L;ENSP00000441152:F304L;ENSP00000332151:F285L;ENSP00000352567:F285L	ENSP00000332151:F285L	F	+	3	2	DSE	116858994	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.868000	0.04236	0.149000	0.19098	0.533000	0.62120	TTT		0.428	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2		NM_013352	
FBLN2	2199	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	13659663	13659663	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr3:13659663A>T	ENST00000295760.7	+	6	1886	c.1817A>T	c.(1816-1818)gAt>gTt	p.D606V	FBLN2_ENST00000404922.3_Missense_Mutation_p.D606V|FBLN2_ENST00000492059.1_Missense_Mutation_p.D606V|FBLN2_ENST00000535798.1_Missense_Mutation_p.D632V	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	606	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.D606V(1)|p.D25V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GATGACCAGGATGAGTGCCTT	0.612																																																	2	Substitution - Missense(2)	kidney(2)											106.0	115.0	112.0					3																	13659663		2053	4207	6260	SO:0001583	missense	2199			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1817A>T	3.37:g.13659663A>T	ENSP00000295760:p.Asp606Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	a	19.12	3.765676	0.69878	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3	4.92	4.92	0.64577	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.061366	0.64402	D	0.000006	D	0.99007	0.9661	H	0.98111	4.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	D	0.99113	1.0847	10	0.87932	D	0	.	12.799	0.57576	1.0:0.0:0.0:0.0	.	606;606;632	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	V	632;606;606;606	ENSP00000445705:D632V;ENSP00000384169:D606V;ENSP00000295760:D606V;ENSP00000420042:D606V	ENSP00000295760:D606V	D	+	2	0	FBLN2	13634664	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	7.163000	0.77524	1.842000	0.53543	0.520000	0.50463	GAT		0.612	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3		NM_001004019	
FMO2	2327	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	171173043	171173043	+	Missense_Mutation	SNP	C	C	A	rs574231506		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr1:171173043C>A	ENST00000209929.7	+	6	825	c.667C>A	c.(667-669)Cgt>Agt	p.R223S	RP1-127D3.4_ENST00000422841.1_RNA|FMO2_ENST00000441535.1_Missense_Mutation_p.R223S|FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	223					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.R223S(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GGTCATGAGCCGTATCTCTGA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											127.0	99.0	108.0					1																	171173043		2203	4300	6503	SO:0001583	missense	2327			BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.667C>A	1.37:g.171173043C>A	ENSP00000209929:p.Arg223Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q53XR0	Missense_Mutation	SNP	ENST00000209929.7	37	CCDS1293.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206539	0.58343	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	T;T	0.63096	-0.02;-0.02	6.13	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.82939	0.5146	H	0.96777	3.88	0.49483	D	0.999792	D	0.89917	1.0	D	0.97110	1.0	D	0.89211	0.3564	10	0.87932	D	0	-10.755	14.7146	0.69257	0.2635:0.7365:0.0:0.0	.	223	Q99518	FMO2_HUMAN	S	223	ENSP00000209929:R223S;ENSP00000405905:R223S	ENSP00000209929:R223S	R	+	1	0	FMO2	169439667	0.999000	0.42202	0.446000	0.26920	0.059000	0.15707	4.290000	0.59019	1.580000	0.49851	0.650000	0.86243	CGT		0.473	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2		NM_001460	
GAA	2548	broad.mit.edu;hgsc.bcm.edu	37	17	78090863	78090863	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr17:78090863A>T	ENST00000302262.3	+	16	2505	c.2286A>T	c.(2284-2286)gaA>gaT	p.E762D	GAA_ENST00000390015.3_Missense_Mutation_p.E762D	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	762					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)	p.E762D(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	GGAAGGCCGAAGTGACTGGCT	0.652																																																	1	Substitution - Missense(1)	kidney(1)											63.0	55.0	57.0					17																	78090863		2202	4300	6502	SO:0001583	missense	2548				CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2286A>T	17.37:g.78090863A>T	ENSP00000305692:p.Glu762Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q09GN4|Q14351|Q16302|Q8IWE7	Missense_Mutation	SNP	ENST00000302262.3	37	CCDS32760.1	.	.	.	.	.	.	.	.	.	.	A	9.776	1.173974	0.21704	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	D;D	0.91577	-2.87;-2.87	5.1	-10.0	0.00425	.	0.800530	0.11633	N	0.544614	T	0.76140	0.3946	N	0.25201	0.72	0.23192	N	0.99815	B	0.10296	0.003	B	0.15484	0.013	T	0.60260	-0.7298	10	0.20046	T	0.44	-5.7568	7.4781	0.27390	0.3503:0.2957:0.354:0.0	.	762	P10253	LYAG_HUMAN	D	762	ENSP00000305692:E762D;ENSP00000374665:E762D	ENSP00000305692:E762D	E	+	3	2	GAA	75705458	0.000000	0.05858	0.029000	0.17559	0.456000	0.32438	-1.387000	0.02535	-1.263000	0.02455	0.482000	0.46254	GAA		0.652	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1			
GNAS	2778	hgsc.bcm.edu;ucsc.edu	37	20	57484440	57484441	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr20:57484440_57484441insT	ENST00000371085.3	+	8	1045_1046	c.621_622insT	c.(622-624)tttfs	p.F208fs	GNAS_ENST00000306090.10_Frame_Shift_Ins_p.F194fs|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000265620.7_Frame_Shift_Ins_p.F193fs|GNAS_ENST00000354359.7_Frame_Shift_Ins_p.F209fs|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000371102.4_Frame_Shift_Ins_p.F837fs|GNAS_ENST00000371095.3_Frame_Shift_Ins_p.F194fs|GNAS_ENST00000371100.4_Frame_Shift_Ins_p.F851fs|GNAS_ENST00000313949.7_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	208					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCTGGAATCTTTGAGACCAA	0.436			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										SO:0001589	frameshift_variant	2778			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.624dupT	20.37:g.57484443_57484443dupT	ENSP00000360126:p.Phe208fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Frame_Shift_Ins	INS	ENST00000371085.3	37	CCDS13472.1																																																																																				0.436	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2		NM_000516	
GPR158	57512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	25887644	25887644	+	Missense_Mutation	SNP	C	C	G	rs200285541		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr10:25887644C>G	ENST00000376351.3	+	11	3448	c.3089C>G	c.(3088-3090)tCt>tGt	p.S1030C	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1030					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S1030C(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AAGCACGTATCTATTGTGGCT	0.453																																																	1	Substitution - Missense(1)	kidney(1)											66.0	65.0	65.0					10																	25887644		2203	4300	6503	SO:0001583	missense	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3089C>G	10.37:g.25887644C>G	ENSP00000365529:p.Ser1030Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058571	0.36277	.	.	ENSG00000151025	ENST00000376351	T	0.36878	1.23	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000003	T	0.39835	0.1093	M	0.68952	2.095	0.80722	D	1	P	0.43885	0.82	B	0.36335	0.222	T	0.49899	-0.8890	10	0.87932	D	0	.	19.2193	0.93790	0.0:1.0:0.0:0.0	.	1030	Q5T848	GP158_HUMAN	C	1030	ENSP00000365529:S1030C	ENSP00000365529:S1030C	S	+	2	0	GPR158	25927650	1.000000	0.71417	0.415000	0.26534	0.277000	0.26821	7.487000	0.81328	2.524000	0.85096	0.655000	0.94253	TCT		0.453	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2		XM_166110	
GRM4	2914	broad.mit.edu	37	6	34100855	34100855	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr6:34100855C>T	ENST00000538487.2	-	2	862	c.419G>A	c.(418-420)gGc>gAc	p.G140D	GRM4_ENST00000374181.4_Missense_Mutation_p.G140D|GRM4_ENST00000374177.3_Intron	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	140					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.G140D(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GATGGGTGGGCCGCCACTGCC	0.612																																																	2	Substitution - Missense(2)	kidney(2)											55.0	45.0	49.0					6																	34100855		2203	4299	6502	SO:0001583	missense	2914			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.419G>A	6.37:g.34100855C>T	ENSP00000440556:p.Gly140Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	9.483	1.098610	0.20552	.	.	ENSG00000124493	ENST00000374181;ENST00000538487	D;D	0.83250	-1.7;-1.7	3.73	3.73	0.42828	Extracellular ligand-binding receptor (1);	0.148193	0.43579	D	0.000559	T	0.45054	0.1323	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.12013	0.001;0.005;0.005	B;B;B	0.12156	0.006;0.007;0.005	T	0.46091	-0.9216	10	0.21014	T	0.42	.	9.5267	0.39169	0.0:0.8992:0.0:0.1008	.	140;140;140	B7ZLU9;A1L4F9;Q14833	.;.;GRM4_HUMAN	D	140	ENSP00000363296:G140D;ENSP00000440556:G140D	ENSP00000363296:G140D	G	-	2	0	GRM4	34208833	0.994000	0.37717	0.992000	0.48379	0.957000	0.61999	0.595000	0.24029	2.078000	0.62432	0.467000	0.42956	GGC		0.612	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			
HDAC6	10013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	48674573	48674573	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chrX:48674573A>G	ENST00000334136.5	+	18	1697	c.1519A>G	c.(1519-1521)Atc>Gtc	p.I507V	HDAC6_ENST00000376619.2_Missense_Mutation_p.I507V|HDAC6_ENST00000444343.2_Missense_Mutation_p.I521V			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	507	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.I507V(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	ACCCCAGCGCATCTTGCGGAT	0.652																																					Pancreas(112;205 1675 2305 8976 15959)												1	Substitution - Missense(1)	kidney(1)											100.0	80.0	87.0					X																	48674573		2203	4300	6503	SO:0001583	missense	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1519A>G	X.37:g.48674573A>G	ENSP00000334061:p.Ile507Val	Somatic		WXS	Illumina HiSeq	Phase_I	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	A	9.659	1.143647	0.21205	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	T;T;T	0.70399	-0.48;-0.48;-0.48	5.85	3.36	0.38483	Histone deacetylase domain (2);	0.174104	0.47093	N	0.000241	T	0.68072	0.2961	L	0.49455	1.56	0.80722	D	1	B;B;B	0.27316	0.009;0.175;0.009	B;B;B	0.39876	0.032;0.312;0.032	T	0.60786	-0.7194	10	0.40728	T	0.16	-13.2619	8.6744	0.34170	0.882:0.0:0.118:0.0	.	497;155;507	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	V	521;507;507;507	ENSP00000398566:I521V;ENSP00000334061:I507V;ENSP00000365804:I507V	ENSP00000334061:I507V	I	+	1	0	HDAC6	48559517	0.994000	0.37717	0.104000	0.21259	0.167000	0.22549	2.026000	0.41069	0.274000	0.22072	0.481000	0.45027	ATC		0.652	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2		NM_006044	
HLA-E	3133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	30457321	30457321	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr6:30457321A>G	ENST00000376630.4	+	1	78	c.13A>G	c.(13-15)Acc>Gcc	p.T5A		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	5					antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)	p.T5A(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						GGTAGATGGAACCCTCCTTTT	0.592																																																	1	Substitution - Missense(1)	kidney(1)											79.0	84.0	82.0					6																	30457321		2203	4300	6503	SO:0001583	missense	3133			M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.13A>G	6.37:g.30457321A>G	ENSP00000365817:p.Thr5Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	ENST00000376630.4	37	CCDS34379.1	.	.	.	.	.	.	.	.	.	.	a	9.689	1.151268	0.21371	.	.	ENSG00000204592	ENST00000376630	T	0.00662	5.93	1.45	-2.9	0.05648	.	2.195050	0.03279	N	0.185941	T	0.00300	0.0009	L	0.41632	1.29	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45498	-0.9257	10	0.87932	D	0	.	3.7407	0.08528	0.2989:0.4941:0.2069:0.0	.	5	Q6DU44	.	A	5	ENSP00000365817:T5A	ENSP00000365817:T5A	T	+	1	0	HLA-E	30565300	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.464000	0.02359	-1.111000	0.02988	0.246000	0.17985	ACC		0.592	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2		NM_005516	
IQGAP3	128239	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	156498730	156498730	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr1:156498730C>T	ENST00000361170.2	-	35	4559	c.4549G>A	c.(4549-4551)Gac>Aac	p.D1517N	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1517					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.D1517N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCCAGGTGGTCCAGGCAGGCC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											94.0	93.0	93.0					1																	156498730		2203	4300	6503	SO:0001583	missense	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4549G>A	1.37:g.156498730C>T	ENSP00000354451:p.Asp1517Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212380	0.58452	.	.	ENSG00000183856	ENST00000361170	T	0.44881	0.91	4.41	2.52	0.30459	RasGAP protein, C-terminal (1);	0.181882	0.45606	D	0.000354	T	0.21921	0.0528	M	0.62088	1.915	0.42471	D	0.992823	B	0.10296	0.003	B	0.10450	0.005	T	0.07888	-1.0749	10	0.42905	T	0.14	-3.9182	9.5583	0.39353	0.0:0.8348:0.0:0.1652	.	1517	Q86VI3	IQGA3_HUMAN	N	1517	ENSP00000354451:D1517N	ENSP00000354451:D1517N	D	-	1	0	IQGAP3	154765354	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	3.002000	0.49496	0.609000	0.30018	0.491000	0.48974	GAC		0.577	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1		NM_178229	
KIAA1033	23325	broad.mit.edu;hgsc.bcm.edu	37	12	105537004	105537004	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr12:105537004A>G	ENST00000332180.5	+	20	2080	c.1993A>G	c.(1993-1995)Atg>Gtg	p.M665V		NM_015275.1	NP_056090.1			KIAA1033									p.M665V(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						CAAGGAAATTATGGAAATTTT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											65.0	59.0	61.0					12																	105537004		1837	4095	5932	SO:0001583	missense	23325			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.1993A>G	12.37:g.105537004A>G	ENSP00000328062:p.Met665Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000332180.5	37	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.285158	0.40394	.	.	ENSG00000136051	ENST00000332180	T	0.40756	1.02	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.35038	0.0918	L	0.43152	1.355	0.80722	D	1	B;B	0.30973	0.302;0.302	B;B	0.27380	0.079;0.079	T	0.12604	-1.0541	10	0.15066	T	0.55	.	16.1435	0.81544	1.0:0.0:0.0:0.0	.	666;665	B7ZKT9;Q2M389	.;WASH7_HUMAN	V	665	ENSP00000328062:M665V	ENSP00000328062:M665V	M	+	1	0	KIAA1033	104061134	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.212000	0.71576	0.528000	0.53228	ATG		0.358	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4		NM_015275	
KLK14	43847	broad.mit.edu;hgsc.bcm.edu	37	19	51582708	51582708	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr19:51582708A>T	ENST00000156499.2	-	5	730	c.512T>A	c.(511-513)aTc>aAc	p.I171N	KLK14_ENST00000391802.1_Missense_Mutation_p.I171N			Q9P0G3	KLK14_HUMAN	kallikrein-related peptidase 14	171	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis morphogenesis (GO:0048730)|fertilization (GO:0009566)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|proteolysis (GO:0006508)|seminal clot liquefaction (GO:0070684)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.I171N(1)|p.I155N(1)		kidney(4)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	11		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		GTCCTCACCGATGGGGCTGGA	0.677																																					GBM(117;2161 2172 2448 22911)												2	Substitution - Missense(2)	kidney(2)											28.0	30.0	29.0					19																	51582708		1921	4153	6074	SO:0001583	missense	43847			AF283670	CCDS12823.2	19q13.3-q13.4	2008-02-05	2006-10-27		ENSG00000129437	ENSG00000129437		"""Kallikreins"""	6362	protein-coding gene	gene with protein product		606135	"""kallikrein 14"""			16800724, 16800723	Standard	XM_006723224		Approved	KLK-L6	uc002pvs.1	Q9P0G3	OTTHUMG00000143721	ENST00000156499.2:c.512T>A	19.37:g.51582708A>T	ENSP00000156499:p.Ile171Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A7UNK5|Q1RMZ2|Q6B089	Missense_Mutation	SNP	ENST00000156499.2	37	CCDS12823.2	.	.	.	.	.	.	.	.	.	.	.	10.63	1.402840	0.25291	.	.	ENSG00000129437	ENST00000156499;ENST00000391802	D;D	0.87729	-2.29;-2.29	4.88	-0.0634	0.13777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.66645	0.2810	N	0.02697	-0.525	0.09310	N	1	B	0.15930	0.015	B	0.13407	0.009	T	0.54984	-0.8211	9	0.33940	T	0.23	.	4.4215	0.11482	0.4708:0.0:0.0872:0.442	.	171	Q9P0G3	KLK14_HUMAN	N	171	ENSP00000156499:I171N;ENSP00000375678:I171N	ENSP00000156499:I171N	I	-	2	0	KLK14	56274520	0.000000	0.05858	0.000000	0.03702	0.520000	0.34377	-0.715000	0.04997	-0.064000	0.13043	0.235000	0.17854	ATC		0.677	KLK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289774.2		NM_022046	
Unknown	0	broad.mit.edu	37	3	101432120	101432120	+	IGR	SNP	C	C	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr3:101432120C>G								RPL24 (26494 upstream) : CEP97 (10648 downstream)																							ATGAATCCTTCTGGTTTTTAG	0.299																																																	0																																										SO:0001628	intergenic_variant	0																															3.37:g.101432120C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.299									
MAML2	84441	broad.mit.edu;hgsc.bcm.edu	37	11	95825502	95825502	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr11:95825502C>T	ENST00000524717.1	-	2	2977	c.1693G>A	c.(1693-1695)Gat>Aat	p.D565N		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	565					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.D565N(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TTCGCTTGATCTGAGTTAAAA	0.507			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	1	Substitution - Missense(1)	kidney(1)											54.0	61.0	58.0					11																	95825502		2147	4283	6430	SO:0001583	missense	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1693G>A	11.37:g.95825502C>T	ENSP00000434552:p.Asp565Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	37	CCDS44714.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290920	0.59976	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.63417	-0.04;-0.04	5.26	5.26	0.73747	.	0.175702	0.38326	N	0.001735	T	0.60157	0.2247	L	0.60455	1.87	0.42742	D	0.993748	P	0.43094	0.799	B	0.38378	0.272	T	0.62515	-0.6838	10	0.33940	T	0.23	-19.8129	18.8795	0.92351	0.0:1.0:0.0:0.0	.	565	Q8IZL2	MAML2_HUMAN	N	565	ENSP00000434552:D565N;ENSP00000412394:D565N	ENSP00000412394:D565N	D	-	1	0	MAML2	95465150	1.000000	0.71417	0.948000	0.38648	0.993000	0.82548	3.331000	0.52075	2.452000	0.82932	0.555000	0.69702	GAT		0.507	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1			
MARK4	57787	broad.mit.edu;ucsc.edu	37	19	45800968	45800968	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr19:45800968T>C	ENST00000262891.4	+	15	1964	c.1633T>C	c.(1633-1635)Tcc>Ccc	p.S545P	MARK4_ENST00000300843.4_Missense_Mutation_p.S545P	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	545					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)	p.S545P(2)		NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGCCTCCCCCTCCAGTCACAG	0.697																																																	2	Substitution - Missense(2)	kidney(2)											8.0	10.0	9.0					19																	45800968		2033	3989	6022	SO:0001583	missense	57787			AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1633T>C	19.37:g.45800968T>C	ENSP00000262891:p.Ser545Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	t	15.31	2.796107	0.50208	.	.	ENSG00000007047	ENST00000262891;ENST00000300843	T;T	0.46451	0.87;0.87	3.88	3.88	0.44766	.	0.629298	0.14570	N	0.311527	T	0.42314	0.1197	L	0.48362	1.52	0.58432	D	0.999998	P;D	0.58620	0.567;0.983	B;P	0.47603	0.249;0.551	T	0.37056	-0.9722	10	0.56958	D	0.05	.	10.7168	0.46017	0.0:0.0:0.0:1.0	.	545;545	Q96L34;Q96L34-2	MARK4_HUMAN;.	P	545	ENSP00000262891:S545P;ENSP00000300843:S545P	ENSP00000262891:S545P	S	+	1	0	MARK4	50492808	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.159000	0.77483	1.629000	0.50426	0.248000	0.18094	TCC		0.697	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1		NM_031417	
MCM7	4176	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	99697218	99697218	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr7:99697218C>A	ENST00000303887.5	-	3	915	c.270G>T	c.(268-270)gaG>gaT	p.E90D	AP4M1_ENST00000422582.1_5'Flank|MCM7_ENST00000354230.3_5'UTR|AP4M1_ENST00000429084.1_5'Flank|AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000343023.6_Missense_Mutation_p.E90D	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	90					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.E90D(1)		endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCACTTCCCTCTCCTTGTACT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											147.0	145.0	146.0					7																	99697218		2203	4300	6503	SO:0001583	missense	4176				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.270G>T	7.37:g.99697218C>A	ENSP00000307288:p.Glu90Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.462736	0.26248	.	.	ENSG00000166508	ENST00000343023;ENST00000303887;ENST00000542483	T;T	0.11821	2.74;2.74	4.48	-0.936	0.10419	Nucleic acid-binding, OB-fold-like (1);	0.282934	0.38111	N	0.001803	T	0.06872	0.0175	L	0.31065	0.9	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.38415	-0.9662	10	0.17832	T	0.49	-5.9146	3.5415	0.07812	0.4146:0.3662:0.1351:0.0841	.	90	P33993	MCM7_HUMAN	D	90;90;27	ENSP00000344006:E90D;ENSP00000307288:E90D	ENSP00000307288:E90D	E	-	3	2	MCM7	99535154	0.981000	0.34729	0.861000	0.33841	0.865000	0.49528	0.187000	0.16998	-0.432000	0.07297	0.563000	0.77884	GAG		0.512	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3			
MPP5	64398	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	67779288	67779288	+	Silent	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr14:67779288T>C	ENST00000261681.4	+	9	1747	c.1086T>C	c.(1084-1086)ccT>ccC	p.P362P	ATP6V1D_ENST00000553974.1_Intron|MPP5_ENST00000555925.1_Silent_p.P328P	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	362	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)	p.P362P(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		CAGATGACCCTTATGTTCCAT	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											132.0	119.0	123.0					14																	67779288		2203	4300	6503	SO:0001819	synonymous_variant	64398			AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.1086T>C	14.37:g.67779288T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Silent	SNP	ENST00000261681.4	37	CCDS9779.1																																																																																				0.373	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412498.1		NM_022474	
MUC4	4585	broad.mit.edu	37	3	195505876	195505876	+	Missense_Mutation	SNP	G	G	C	rs199716248		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr3:195505876G>C	ENST00000463781.3	-	2	13034	c.12575C>G	c.(12574-12576)cCt>cGt	p.P4192R	MUC4_ENST00000475231.1_Missense_Mutation_p.P4192R|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P4192R(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGAGGGGTGGTGTC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											22.0	16.0	18.0					3																	195505876		689	1582	2271	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12575C>G	3.37:g.195505876G>C	ENSP00000417498:p.Pro4192Arg	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.272	-0.992392	0.02162	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.39;1.5	.	.	.	.	.	.	.	.	T	0.35537	0.0935	N	0.19112	0.55	0.09310	N	1	D	0.71674	0.998	D	0.72982	0.979	T	0.13548	-1.0505	7	.	.	.	.	2.8772	0.05635	0.3986:0.0:0.6014:0.0	.	4064	E7ESK3	.	R	4192	ENSP00000417498:P4192R;ENSP00000420243:P4192R	.	P	-	2	0	MUC4	196990655	0.009000	0.17119	0.118000	0.21660	0.044000	0.14063	1.659000	0.37387	0.452000	0.26830	0.074000	0.15403	CCT		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
N4BP2L2	10443	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	33110645	33110645	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr13:33110645G>T	ENST00000267068.3	-	2	684	c.520C>A	c.(520-522)Cag>Aag	p.Q174K	N4BP2L2_ENST00000446957.2_Missense_Mutation_p.Q174K|N4BP2L2_ENST00000357505.6_Intron|N4BP2L2_ENST00000399396.3_Intron|N4BP2L2_ENST00000504114.1_Intron	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	174					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.Q174K(1)		kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TTGTAAAACTGGAATAATTCA	0.318																																																	1	Substitution - Missense(1)	kidney(1)											58.0	61.0	60.0					13																	33110645		2202	4298	6500	SO:0001583	missense	10443			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.520C>A	13.37:g.33110645G>T	ENSP00000267068:p.Gln174Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A3KME8	Missense_Mutation	SNP	ENST00000267068.3	37	CCDS9346.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067510	0.55539	.	.	ENSG00000244754	ENST00000446957;ENST00000505213;ENST00000267068	T;T;T	0.41065	1.01;1.01;1.01	5.82	5.82	0.92795	.	.	.	.	.	T	0.62270	0.2414	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.63980	-0.6514	9	0.87932	D	0	-13.2434	13.3228	0.60442	0.0719:0.0:0.9281:0.0	.	174;174	D6R968;Q92802	.;N42L2_HUMAN	K	174	ENSP00000394239:Q174K;ENSP00000423362:Q174K;ENSP00000267068:Q174K	ENSP00000267068:Q174K	Q	-	1	0	N4BP2L2	32008645	1.000000	0.71417	0.988000	0.46212	0.977000	0.68977	4.664000	0.61540	2.756000	0.94617	0.563000	0.77884	CAG		0.318	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1		NM_014887	
NLRP2	55655	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	55497591	55497591	+	Silent	SNP	G	G	T	rs144434448		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr19:55497591G>T	ENST00000543010.1	+	8	2417	c.2274G>T	c.(2272-2274)acG>acT	p.T758T	NLRP2_ENST00000537859.1_Silent_p.T736T|NLRP2_ENST00000427260.2_Silent_p.T735T|NLRP2_ENST00000448584.2_Silent_p.T758T|NLRP2_ENST00000538819.1_Silent_p.T734T|NLRP2_ENST00000339757.7_Silent_p.T736T|NLRP2_ENST00000263437.6_Silent_p.T755T|NLRP2_ENST00000391721.4_Silent_p.T734T	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	758					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.T758T(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AGACTGTAACGTATCTGACCC	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											150.0	118.0	128.0					19																	55497591		2203	4300	6503	SO:0001819	synonymous_variant	55655			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2274G>T	19.37:g.55497591G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	ENST00000543010.1	37	CCDS12913.1																																																																																				0.458	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1		NM_017852	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52643768	52643768	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr3:52643768G>A	ENST00000296302.7	-	16	2129	c.2128C>T	c.(2128-2130)Cga>Tga	p.R710*	PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R710*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R678*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R710*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R725*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R725*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.R710*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.R710*			Q86U86	PB1_HUMAN	polybromo 1	710	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R710*(2)|p.R678*(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATGTGACTTCGAATTTTTTCC	0.438			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Nonsense(3)	kidney(3)											147.0	143.0	144.0					3																	52643768		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2128C>T	3.37:g.52643768G>A	ENSP00000296302:p.Arg710*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	38	7.040996	0.98021	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	6.17	3.13	0.36017	.	0.055075	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.7405	15.7	0.77536	0.0:0.0:0.6414:0.3586	.	.	.	.	X	678;710;710;710;710;710;725;725;710;669	.	ENSP00000296302:R710X	R	-	1	2	PBRM1	52618808	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	0.705000	0.25675	1.587000	0.49959	0.655000	0.94253	CGA		0.438	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
POR	5447	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	75611556	75611556	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr7:75611556A>G	ENST00000461988.1	+	8	851	c.746A>G	c.(745-747)gAg>gGg	p.E249G	POR_ENST00000450476.1_Missense_Mutation_p.E148G|POR_ENST00000439269.1_5'UTR|POR_ENST00000394893.1_Missense_Mutation_p.E249G|POR_ENST00000545601.1_Missense_Mutation_p.E57G|POR_ENST00000419840.1_Missense_Mutation_p.E63G	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	246					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)	p.E148G(1)|p.E246G(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	CGCCAGTACGAGCTTGTGGTC	0.632																																																	2	Substitution - Missense(2)	kidney(2)											78.0	89.0	86.0					7																	75611556		2073	4176	6249	SO:0001583	missense	5447			AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.746A>G	7.37:g.75611556A>G	ENSP00000419970:p.Glu249Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	37	CCDS5579.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.704268	0.48412	.	.	ENSG00000127948	ENST00000461988;ENST00000419840;ENST00000394893;ENST00000545601;ENST00000450476	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.34	4.2	0.49525	.	0.097108	0.64402	D	0.000001	T	0.76744	0.4030	L	0.56769	1.78	0.58432	D	0.999997	P;B;B	0.36171	0.541;0.195;0.123	B;B;B	0.30943	0.122;0.085;0.024	T	0.78510	-0.2176	10	0.56958	D	0.05	-40.8284	9.8661	0.41145	0.9196:0.0:0.0803:0.0	.	148;57;255	E7EVY7;F5H468;Q59ED7	.;.;.	G	249;63;249;57;148	ENSP00000419970:E249G;ENSP00000414244:E63G;ENSP00000378355:E249G;ENSP00000446149:E57G;ENSP00000416572:E148G	ENSP00000378355:E249G	E	+	2	0	POR	75449492	1.000000	0.71417	0.963000	0.40424	0.710000	0.40934	5.084000	0.64462	2.014000	0.59158	0.459000	0.35465	GAG		0.632	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7		NM_000941	
POU4F1	5457	broad.mit.edu	37	13	79176484	79176486	+	In_Frame_Del	DEL	TGG	TGG	-	rs371388366		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr13:79176484_79176486delTGG	ENST00000377208.5	-	2	535_537	c.324_326delCCA	c.(322-327)caccag>cag	p.H108del	RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000607205.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000606376.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	108	Poly-His.				axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.H108delH(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTCGAGCGCCtggtggtggtggt	0.729																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)												1	Deletion - In frame(1)	central_nervous_system(1)																																								SO:0001651	inframe_deletion	5457			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.324_326delCCA	13.37:g.79176493_79176495delTGG	ENSP00000366413:p.His108del	Somatic		WXS	Illumina GAIIx	Phase_I	Q14986|Q15318|Q5T227	In_Frame_Del	DEL	ENST00000377208.5	37	CCDS31996.1																																																																																				0.729	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3			
PPIC	5480	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	122359616	122359616	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr5:122359616T>A	ENST00000306442.4	-	5	708	c.593A>T	c.(592-594)aAg>aTg	p.K198M	RN7SL689P_ENST00000577215.1_RNA	NM_000943.4	NP_000934.1	P45877	PPIC_HUMAN	peptidylprolyl isomerase C (cyclophilin C)	198	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.K198M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	6		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	CACGTCTATCTTGCCACTGTT	0.498																																					Ovarian(99;690 1502 20765 45543 49568)												1	Substitution - Missense(1)	kidney(1)											278.0	248.0	259.0					5																	122359616		2203	4300	6503	SO:0001583	missense	5480			S71018	CCDS4133.1	5q23.2	2008-02-05			ENSG00000168938	ENSG00000168938	5.2.1.8		9256	protein-coding gene	gene with protein product		123842				1383094, 8031755	Standard	NM_000943		Approved	CYPC	uc003kth.3	P45877	OTTHUMG00000128921	ENST00000306442.4:c.593A>T	5.37:g.122359616T>A	ENSP00000303057:p.Lys198Met	Somatic		WXS	Illumina HiSeq	Phase_I	A4LBB5	Missense_Mutation	SNP	ENST00000306442.4	37	CCDS4133.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.212127	0.58452	.	.	ENSG00000168938	ENST00000306442	T	0.35421	1.31	5.93	5.93	0.95920	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (1);Cyclophilin-like (1);	0.199221	0.51477	D	0.000090	T	0.27594	0.0678	N	0.12502	0.225	0.53005	D	0.999964	P	0.45827	0.867	P	0.45881	0.496	T	0.12553	-1.0543	10	0.87932	D	0	.	11.4605	0.50208	0.1343:0.0:0.0:0.8657	.	198	P45877	PPIC_HUMAN	M	198	ENSP00000303057:K198M	ENSP00000303057:K198M	K	-	2	0	PPIC	122387515	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.516000	0.60496	2.271000	0.75665	0.533000	0.62120	AAG		0.498	PPIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250898.2		NM_000943	
PPL	5493	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	4953981	4953981	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr16:4953981C>G	ENST00000345988.2	-	3	312	c.223G>C	c.(223-225)Gtg>Ctg	p.V75L	PPL_ENST00000590782.2_Missense_Mutation_p.V75L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	75					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.V75L(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GAGTCCAACACCTTCTGCAGG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											69.0	54.0	59.0					16																	4953981		2197	4300	6497	SO:0001583	missense	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.223G>C	16.37:g.4953981C>G	ENSP00000340510:p.Val75Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	C	2.061	-0.415348	0.04766	.	.	ENSG00000118898	ENST00000345988	T	0.65178	-0.14	5.28	2.08	0.27032	.	0.155279	0.44688	D	0.000440	T	0.28333	0.0700	N	0.03154	-0.405	0.28356	N	0.920663	B	0.10296	0.003	B	0.06405	0.002	T	0.29458	-1.0011	10	0.02654	T	1	.	7.113	0.25401	0.0:0.5656:0.2583:0.1761	.	75	O60437	PEPL_HUMAN	L	75	ENSP00000340510:V75L	ENSP00000340510:V75L	V	-	1	0	PPL	4893982	0.999000	0.42202	0.995000	0.50966	0.592000	0.36648	1.801000	0.38843	1.212000	0.43366	0.655000	0.94253	GTG		0.612	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1		NM_002705	
PRMT3	10196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	20486044	20486044	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr11:20486044A>C	ENST00000331079.6	+	13	1516	c.1299A>C	c.(1297-1299)gaA>gaC	p.E433D	PRMT3_ENST00000437750.2_Missense_Mutation_p.E371D	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	433	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)	p.E433D(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						CAGATTTGGAATTTTCATCAG	0.338																																																	1	Substitution - Missense(1)	kidney(1)											117.0	115.0	115.0					11																	20486044		2203	4300	6503	SO:0001583	missense	10196			AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.1299A>C	11.37:g.20486044A>C	ENSP00000331879:p.Glu433Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DUC7	Missense_Mutation	SNP	ENST00000331079.6	37	CCDS7853.1	.	.	.	.	.	.	.	.	.	.	A	6.966	0.548233	0.13312	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.70749	-0.51;-0.51	5.98	-1.34	0.09143	.	0.043371	0.85682	D	0.000000	T	0.40067	0.1102	N	0.12887	0.27	0.44995	D	0.998019	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.04693	-1.0933	10	0.12766	T	0.61	-25.4627	3.1498	0.06484	0.4896:0.1144:0.2788:0.1172	.	371;433	O60678-2;O60678	.;ANM3_HUMAN	D	433;433;371	ENSP00000331879:E433D;ENSP00000397766:E371D	ENSP00000331879:E433D	E	+	3	2	PRMT3	20442620	0.998000	0.40836	0.988000	0.46212	0.364000	0.29643	0.406000	0.21032	-0.274000	0.09232	-1.021000	0.02439	GAA		0.338	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1		NM_005788	
PRMT3	10196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	20486049	20486049	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr11:20486049C>T	ENST00000331079.6	+	13	1521	c.1304C>T	c.(1303-1305)tCa>tTa	p.S435L	PRMT3_ENST00000437750.2_Missense_Mutation_p.S373L	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	435	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)	p.S435L(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						TTGGAATTTTCATCAGATTTT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											117.0	114.0	115.0					11																	20486049		2203	4300	6503	SO:0001583	missense	10196			AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.1304C>T	11.37:g.20486049C>T	ENSP00000331879:p.Ser435Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DUC7	Missense_Mutation	SNP	ENST00000331079.6	37	CCDS7853.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239896	0.58995	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.78595	-1.19;-1.19	5.98	5.98	0.97165	.	0.255560	0.45867	D	0.000333	T	0.77301	0.4110	L	0.60012	1.86	0.58432	D	0.999998	B;B	0.31227	0.314;0.025	B;B	0.31812	0.136;0.02	T	0.74408	-0.3675	10	0.45353	T	0.12	-13.3695	19.2235	0.93808	0.0:1.0:0.0:0.0	.	373;435	O60678-2;O60678	.;ANM3_HUMAN	L	435;435;373	ENSP00000331879:S435L;ENSP00000397766:S373L	ENSP00000331879:S435L	S	+	2	0	PRMT3	20442625	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	6.949000	0.75971	2.838000	0.97847	0.591000	0.81541	TCA		0.353	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1		NM_005788	
RENBP	5973	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	153209149	153209149	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chrX:153209149T>C	ENST00000393700.3	-	5	391	c.311A>G	c.(310-312)tAt>tGt	p.Y104C	RENBP_ENST00000369997.3_Missense_Mutation_p.Y90C|RENBP_ENST00000412763.1_Missense_Mutation_p.Y104C|RENBP_ENST00000462086.1_5'Flank	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	104					N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)|regulation of blood pressure (GO:0008217)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|endopeptidase inhibitor activity (GO:0004866)|N-acylglucosamine 2-epimerase activity (GO:0050121)	p.Y104C(1)|p.Y94C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	CACCCGGGCATACCGCAGCAA	0.627																																																	2	Substitution - Missense(2)	kidney(2)											67.0	55.0	59.0					X																	153209149		2203	4300	6503	SO:0001583	missense	5973				CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032			9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""			1618798	Standard	NM_002910		Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.311A>G	X.37:g.153209149T>C	ENSP00000377303:p.Tyr104Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DNZ3|Q96BI6	Missense_Mutation	SNP	ENST00000393700.3	37	CCDS14738.2	.	.	.	.	.	.	.	.	.	.	T	12.29	1.892127	0.33442	.	.	ENSG00000102032	ENST00000393700;ENST00000412763;ENST00000369997	T;T;T	0.32753	1.44;1.51;1.44	4.66	0.799	0.18667	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.417238	0.26582	N	0.023575	T	0.26304	0.0642	M	0.64080	1.96	0.32239	N	0.573025	B;B	0.21905	0.062;0.053	B;B	0.25405	0.024;0.06	T	0.14783	-1.0460	10	0.54805	T	0.06	-0.0834	4.1544	0.10254	0.1523:0.1784:0.0:0.6693	.	104;104	P51606-2;P51606	.;RENBP_HUMAN	C	104;104;90	ENSP00000377303:Y104C;ENSP00000387811:Y104C;ENSP00000359014:Y90C	ENSP00000359014:Y90C	Y	-	2	0	RENBP	152862343	0.008000	0.16893	0.826000	0.32828	0.804000	0.45430	0.409000	0.21082	-0.218000	0.10018	0.417000	0.27973	TAT		0.627	RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061103.3		NM_002910	
RFTN2	130132	broad.mit.edu	37	2	198508984	198508984	+	Silent	SNP	C	C	T	rs199531161		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr2:198508984C>T	ENST00000295049.4	-	3	872	c.336G>A	c.(334-336)tcG>tcA	p.S112S		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	112					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)		p.S112S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TGGGTGCTGCCGAATTCTTTG	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		16251	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											136.0	127.0	130.0					2																	198508984		2203	4300	6503	SO:0001819	synonymous_variant	130132			AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.336G>A	2.37:g.198508984C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Silent	SNP	ENST00000295049.4	37	CCDS2323.1																																																																																				0.453	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2		NM_144629	
S1PR3	1903	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	91616543	91616543	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr9:91616543T>C	ENST00000375846.3	+	1	5123	c.428T>C	c.(427-429)aTg>aCg	p.M143T	S1PR3_ENST00000358157.2_Missense_Mutation_p.M143T			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	143					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.M143T(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						ATGATCAAAATGAGGCCTTAC	0.607											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											129.0	98.0	108.0					9																	91616543		2203	4300	6503	SO:0001583	missense	1903			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.428T>C	9.37:g.91616543T>C	ENSP00000365006:p.Met143Thr	Somatic	1283	WXS	Illumina HiSeq	Phase_I	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	CCDS6680.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688272	0.68271	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.36520	1.25;1.25	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.042355	0.85682	D	0.000000	T	0.54319	0.1851	M	0.76002	2.32	0.53005	D	0.999963	D	0.63880	0.993	P	0.57846	0.828	T	0.55354	-0.8154	10	0.37606	T	0.19	.	14.9483	0.71050	0.0:0.0:0.0:1.0	.	143	Q99500	S1PR3_HUMAN	T	143	ENSP00000350878:M143T;ENSP00000365006:M143T	ENSP00000350878:M143T	M	+	2	0	S1PR3	90806363	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.993000	0.70616	2.117000	0.64856	0.459000	0.35465	ATG		0.607	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2		NM_005226	
SAG	6295	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	234237149	234237149	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr2:234237149A>G	ENST00000409110.1	+	8	768	c.538A>G	c.(538-540)Aaa>Gaa	p.K180E	SAG_ENST00000449594.2_Missense_Mutation_p.K46E	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	180				K -> S (in Ref. 1; CAA30984). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)	p.K180E(2)		cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		ACTGATCCGCAAAGTACAGCA	0.602																																																	2	Substitution - Missense(2)	kidney(2)											172.0	152.0	158.0					2																	234237149		1997	4172	6169	SO:0001583	missense	6295				CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.538A>G	2.37:g.234237149A>G	ENSP00000386444:p.Lys180Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	37	CCDS46545.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.520660	0.64747	.	.	ENSG00000130561	ENST00000252857;ENST00000409110;ENST00000449594	T;T	0.21734	1.99;1.99	4.19	4.19	0.49359	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50769	0.1635	M	0.91459	3.21	0.58432	D	0.999999	D;D	0.69078	0.994;0.997	P;P	0.62560	0.649;0.904	T	0.64330	-0.6433	10	0.87932	D	0	-5.6723	13.7339	0.62807	1.0:0.0:0.0:0.0	.	46;180	B7Z7L5;P10523	.;ARRS_HUMAN	E	180;180;46	ENSP00000386444:K180E;ENSP00000392889:K46E	ENSP00000252857:K180E	K	+	1	0	SAG	233901888	1.000000	0.71417	0.584000	0.28653	0.217000	0.24651	9.083000	0.94067	1.898000	0.54952	0.533000	0.62120	AAA		0.602	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1		NM_000541	
SAMD14	201191	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	48191587	48191587	+	Silent	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr17:48191587A>G	ENST00000330175.4	-	8	1223	c.906T>C	c.(904-906)tcT>tcC	p.S302S	SAMD14_ENST00000503734.1_5'Flank|SAMD14_ENST00000503131.1_Silent_p.S330S	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	302								p.S330S(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						GGTAGGGGTAAGAACATTTGG	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											70.0	67.0	68.0					17																	48191587		2203	4300	6503	SO:0001819	synonymous_variant	201191				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.906T>C	17.37:g.48191587A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A5D8V1|Q8N2X0	Silent	SNP	ENST00000330175.4	37	CCDS58562.1																																																																																				0.592	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366661.1		NM_174920	
SGSM1	129049	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	25251635	25251635	+	Silent	SNP	T	T	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr22:25251635T>A	ENST00000400359.4	+	8	796	c.789T>A	c.(787-789)gtT>gtA	p.V263V	SGSM1_ENST00000400358.4_Silent_p.V263V	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	263						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)	p.V263V(2)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						AAAACAACGTTCTTGTTCAGC	0.547																																																	2	Substitution - coding silent(2)	kidney(2)											81.0	88.0	86.0					22																	25251635		2013	4180	6193	SO:0001819	synonymous_variant	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.789T>A	22.37:g.25251635T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Silent	SNP	ENST00000400359.4	37	CCDS46674.1																																																																																				0.547	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1		XM_059318	
SIL1	64374	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	138378410	138378410	+	Splice_Site	SNP	T	T	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr5:138378410T>A	ENST00000394817.2	-	5	493		c.e5-2		SIL1_ENST00000265195.5_Splice_Site|CTB-46B19.2_ENST00000512875.2_RNA|SIL1_ENST00000509534.1_Splice_Site	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor						intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)	p.?(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ATATCCAGCCTGTCCAAAGAA	0.488									Marinesco-Sjgren syndrome																																								1	Unknown(1)	kidney(1)											153.0	139.0	144.0					5																	138378410		2203	4300	6503	SO:0001630	splice_region_variant	64374	Familial Cancer Database	Marinesco-Sjogren syndrome	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.354-2A>T	5.37:g.138378410T>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DQC2|Q8N2L3	Splice_Site	SNP	ENST00000394817.2	37	CCDS4209.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936745	0.52972	.	.	ENSG00000120725	ENST00000394817;ENST00000265195;ENST00000537511;ENST00000509534;ENST00000508639;ENST00000513453	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2214	0.48857	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIL1	138406309	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	2.438000	0.44837	2.217000	0.71921	0.454000	0.30748	.		0.488	SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251319.1		NM_022464	Intron
SLC4A10	57282	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	162815017	162815017	+	Silent	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr2:162815017A>G	ENST00000446997.1	+	21	2907	c.2814A>G	c.(2812-2814)ctA>ctG	p.L938L	SLC4A10_ENST00000415876.2_Silent_p.L908L|SLC4A10_ENST00000272716.5_Silent_p.L908L|SLC4A10_ENST00000375514.5_Silent_p.L919L|SLC4A10_ENST00000421911.1_Silent_p.L938L	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	938					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)	p.L938L(1)|p.L908L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TGCCAGTGCTATATGGAGTGT	0.353																																																	2	Substitution - coding silent(2)	kidney(2)											162.0	144.0	149.0					2																	162815017		1847	4091	5938	SO:0001819	synonymous_variant	57282				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2814A>G	2.37:g.162815017A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Silent	SNP	ENST00000446997.1	37	CCDS54411.1																																																																																				0.353	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1		NM_022058	
SLITRK2	84631	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	144905975	144905975	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chrX:144905975G>A	ENST00000370490.1	+	1	6287	c.2032G>A	c.(2032-2034)Gat>Aat	p.D678N	SLITRK2_ENST00000447897.2_Missense_Mutation_p.D678N|SLITRK2_ENST00000428560.2_Missense_Mutation_p.D678N|SLITRK2_ENST00000434188.2_Missense_Mutation_p.D678N|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000413937.2_Missense_Mutation_p.D678N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	678					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.D678N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGACTCACGATAAAACAGA	0.493																																																	1	Substitution - Missense(1)	kidney(1)											77.0	68.0	71.0					X																	144905975		2203	4300	6503	SO:0001583	missense	84631			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2032G>A	X.37:g.144905975G>A	ENSP00000359521:p.Asp678Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198707	0.38806	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.50813	0.78;0.73;0.73;0.73;0.73;0.73	5.67	5.67	0.87782	.	0.192733	0.46758	D	0.000268	T	0.45316	0.1336	L	0.51422	1.61	0.58432	D	0.999999	D	0.56746	0.977	B	0.43301	0.415	T	0.37865	-0.9687	10	0.30078	T	0.28	-11.8358	16.0092	0.80385	0.0:0.0:1.0:0.0	.	678	Q9H156	SLIK2_HUMAN	N	678	ENSP00000334374:D678N;ENSP00000411681:D678N;ENSP00000359521:D678N;ENSP00000397015:D678N;ENSP00000407347:D678N;ENSP00000412010:D678N	ENSP00000334374:D678N	D	+	1	0	SLITRK2	144713667	1.000000	0.71417	0.977000	0.42913	0.959000	0.62525	7.581000	0.82535	2.380000	0.81148	0.600000	0.82982	GAT		0.493	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1		NM_032539	
SLU7	10569	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	159835383	159835383	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr5:159835383T>C	ENST00000297151.4	-	8	1159	c.772A>G	c.(772-774)Aga>Gga	p.R258G		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	258					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)	p.R258G(1)		endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTAATTCGTCTCTTGGAGTCA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											92.0	94.0	93.0					5																	159835383		2203	4300	6503	SO:0001583	missense	10569			AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.772A>G	5.37:g.159835383T>C	ENSP00000297151:p.Arg258Gly	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Missense_Mutation	SNP	ENST00000297151.4	37	CCDS4352.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118565	0.77323	.	.	ENSG00000164609	ENST00000297151	T	0.41758	0.99	6.16	6.16	0.99307	Pre-mRNA splicing Prp18-interacting factor (1);	0.000000	0.85682	D	0.000000	T	0.47985	0.1475	L	0.50333	1.59	0.80722	D	1	P	0.37594	0.601	B	0.43701	0.428	T	0.44452	-0.9327	10	0.54805	T	0.06	-3.7263	16.8061	0.85666	0.0:0.0:0.0:1.0	.	258	O95391	SLU7_HUMAN	G	258	ENSP00000297151:R258G	ENSP00000297151:R258G	R	-	1	2	SLU7	159767961	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.765000	0.62271	2.367000	0.80283	0.528000	0.53228	AGA		0.368	SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252673.1		NM_006425	
SMEK1	55671	broad.mit.edu;hgsc.bcm.edu	37	14	91925215	91925215	+	Splice_Site	SNP	T	T	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr14:91925215T>A	ENST00000554943.1	-	15	2507		c.e15-2		SMEK1_ENST00000555462.1_Splice_Site|SMEK1_ENST00000337238.4_Splice_Site|SMEK1_ENST00000554684.1_Splice_Site|SMEK1_ENST00000428424.2_Splice_Site|SMEK1_ENST00000555718.1_Splice_Site			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)						positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)		p.?(1)		NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		GAGGCCTCCCTGTTAAGAAAT	0.348																																																	1	Unknown(1)	kidney(1)											54.0	47.0	49.0					14																	91925215		2203	4300	6503	SO:0001630	splice_region_variant	55671			AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.2392-2A>T	14.37:g.91925215T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Splice_Site	SNP	ENST00000554943.1	37		.	.	.	.	.	.	.	.	.	.	T	15.54	2.864903	0.51482	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7725	0.78180	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMEK1	90994968	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.117000	0.77129	2.118000	0.64928	0.533000	0.62120	.		0.348	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1		NM_032560	Intron
SMS	6611	broad.mit.edu;hgsc.bcm.edu	37	X	22010764	22010764	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chrX:22010764delT	ENST00000404933.2	+	10	1247	c.995delT	c.(994-996)ctgfs	p.L332fs	SMS_ENST00000415881.2_Frame_Shift_Del_p.L236fs|SMS_ENST00000379404.1_Frame_Shift_Del_p.L279fs	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase	332	PABS. {ECO:0000255|PROSITE- ProRule:PRU00354}.				cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	GAAGAACAGCTGGGGCGCCTG	0.463																																																	0													131.0	101.0	111.0					X																	22010764		2203	4300	6503	SO:0001589	frameshift_variant	6611			AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.995delT	X.37:g.22010764delT	ENSP00000385746:p.Leu332fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Frame_Shift_Del	DEL	ENST00000404933.2	37	CCDS14203.1																																																																																				0.463	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056032.1		NM_004595	
SPAG9	9043	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	49057150	49057150	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr17:49057150A>C	ENST00000262013.7	-	26	3574	c.3366T>G	c.(3364-3366)caT>caG	p.H1122Q	SPAG9_ENST00000357122.4_Missense_Mutation_p.H1108Q|SPAG9_ENST00000505279.1_Missense_Mutation_p.H1112Q|SPAG9_ENST00000510283.1_Missense_Mutation_p.H965Q	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	1122					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.H1108Q(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CATCCTGTAGATGTTGATAAG	0.458																																																	1	Substitution - Missense(1)	kidney(1)											205.0	172.0	183.0					17																	49057150		2203	4300	6503	SO:0001583	missense	9043			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.3366T>G	17.37:g.49057150A>C	ENSP00000262013:p.His1122Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.120925	0.77436	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.74	-0.872	0.10638	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47469	0.1447	M	0.81682	2.555	0.58432	D	0.999992	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.97110	0.994;0.986;1.0;1.0	T	0.44406	-0.9330	10	0.41790	T	0.15	-17.6443	12.284	0.54781	0.4539:0.0:0.5461:0.0	.	1112;1122;1108;965	O60271-2;O60271;O60271-4;E7ENU2	.;JIP4_HUMAN;.;.	Q	1122;879;869;965;1112;1108;720	ENSP00000262013:H1122Q;ENSP00000423165:H965Q;ENSP00000426900:H1112Q;ENSP00000349636:H1108Q	ENSP00000262013:H1122Q	H	-	3	2	SPAG9	46412149	0.997000	0.39634	0.968000	0.41197	0.969000	0.65631	0.492000	0.22435	-0.188000	0.10499	0.402000	0.26972	CAT		0.458	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2		NM_003971	
SPIN2A	54466	broad.mit.edu;hgsc.bcm.edu	37	X	57162317	57162317	+	Silent	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chrX:57162317C>T	ENST00000374908.1	-	1	1113	c.714G>A	c.(712-714)gtG>gtA	p.V238V	SPIN2A_ENST00000374906.3_Silent_p.V238V			Q99865	SPI2A_HUMAN	spindlin family, member 2A	238					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)		p.V238V(1)		breast(1)|kidney(1)|ovary(1)	3						TGATGAAATACACAGAGGGTT	0.388																																																	1	Substitution - coding silent(1)	kidney(1)											126.0	106.0	113.0					X																	57162317		2202	4294	6496	SO:0001819	synonymous_variant	54466			Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.714G>A	X.37:g.57162317C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O75650|Q6IPW2|Q9UJJ0	Silent	SNP	ENST00000374908.1	37	CCDS35312.1																																																																																				0.388	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058915.1		NM_019003	
SSTR3	6753	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	37603580	37603580	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr22:37603580A>G	ENST00000328544.3	-	2	796	c.263T>C	c.(262-264)cTg>cCg	p.L88P	SSTR3_ENST00000402501.1_Missense_Mutation_p.L88P	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	88					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.L88P(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	CTCGTCGGCCAGCGCCAGGTT	0.652																																																	1	Substitution - Missense(1)	kidney(1)											75.0	71.0	72.0					22																	37603580		2203	4300	6503	SO:0001583	missense	6753				CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.263T>C	22.37:g.37603580A>G	ENSP00000330138:p.Leu88Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039205	0.75617	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.44482	0.92;0.92	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.080665	0.52532	D	0.000075	T	0.71065	0.3296	M	0.89534	3.04	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.78272	-0.2268	10	0.87932	D	0	.	15.802	0.78458	1.0:0.0:0.0:0.0	.	88	P32745	SSR3_HUMAN	P	88	ENSP00000330138:L88P;ENSP00000384904:L88P	ENSP00000330138:L88P	L	-	2	0	SSTR3	35933526	1.000000	0.71417	0.978000	0.43139	0.805000	0.45488	9.339000	0.96797	2.138000	0.66242	0.455000	0.32223	CTG		0.652	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1			
SUCLG1	8802	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	84652566	84652566	+	Silent	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr2:84652566A>G	ENST00000393868.2	-	8	1197	c.987T>C	c.(985-987)ccT>ccC	p.P329P	SUCLG1_ENST00000491123.1_5'UTR	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	329					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)	p.P329P(1)		kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	CCAGCTGTGCAGGAGACATAC	0.542																																					Ovarian(48;203 1101 37206 40305 50790)												1	Substitution - coding silent(1)	kidney(1)											102.0	91.0	95.0					2																	84652566		2203	4300	6503	SO:0001819	synonymous_variant	8802			Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.987T>C	2.37:g.84652566A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q9BWB0|Q9UNP6	Silent	SNP	ENST00000393868.2	37	CCDS1967.2																																																																																				0.542	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2		NM_003849	
TEX10	54881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	103109629	103109629	+	Silent	SNP	T	T	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr9:103109629T>G	ENST00000374902.4	-	3	416	c.240A>C	c.(238-240)ggA>ggC	p.G80G	TEX10_ENST00000535814.1_Silent_p.G83G|TEX10_ENST00000537512.1_Silent_p.G15G	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	80						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)		p.G80G(1)		NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		GGTCTTTAAGTCCAAGAAGAG	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											129.0	139.0	136.0					9																	103109629		2203	4300	6503	SO:0001819	synonymous_variant	54881			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.240A>C	9.37:g.103109629T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Silent	SNP	ENST00000374902.4	37	CCDS6748.1																																																																																				0.323	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1		NM_017746	
TGM6	343641	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	2381082	2381082	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr20:2381082C>G	ENST00000202625.2	+	7	1042	c.981C>G	c.(979-981)gaC>gaG	p.D327E	TGM6_ENST00000477505.1_3'UTR|TGM6_ENST00000381423.1_Missense_Mutation_p.D327E	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	327			D -> G (in SCA35). {ECO:0000269|PubMed:21106500}.		cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.D327E(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TGACAGAAGACAGCATGTGGT	0.607																																																	1	Substitution - Missense(1)	kidney(1)											89.0	79.0	83.0					20																	2381082		2203	4300	6503	SO:0001583	missense	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.981C>G	20.37:g.2381082C>G	ENSP00000202625:p.Asp327Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669289	0.88348	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.95788	-3.81;-3.81	4.27	4.27	0.50696	Transglutaminase-like (2);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.86097	2.795	0.45366	D	0.998354	D;D	0.89917	0.975;1.0	P;D	0.97110	0.787;1.0	D	0.97889	1.0296	10	0.59425	D	0.04	-37.278	14.5714	0.68213	0.0:1.0:0.0:0.0	.	327;327	O95932-2;O95932	.;TGM3L_HUMAN	E	327	ENSP00000202625:D327E;ENSP00000370831:D327E	ENSP00000202625:D327E	D	+	3	2	TGM6	2329082	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.619000	0.67729	2.395000	0.81488	0.462000	0.41574	GAC		0.607	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2		NM_198994	
THADA	63892	broad.mit.edu	37	2	43571338	43571338	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr2:43571338G>C	ENST00000405006.4	-	30	4617	c.4266C>G	c.(4264-4266)caC>caG	p.H1422Q	THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Missense_Mutation_p.H1422Q|THADA_ENST00000415080.2_Missense_Mutation_p.H1103Q|THADA_ENST00000485353.1_5'UTR	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1422								p.H1422Q(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AATTCGTTCCGTGTTTGGAGT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											80.0	72.0	75.0					2																	43571338		1914	4131	6045	SO:0001583	missense	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4266C>G	2.37:g.43571338G>C	ENSP00000385995:p.His1422Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.43|12.43	1.936840|1.936840	0.34189|0.34189	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006|ENST00000407351	T;T;T|.	0.11277|.	2.97;2.79;2.97|.	4.8|4.8	3.93|3.93	0.45458|0.45458	.|.	0.476170|.	0.22358|.	N|.	0.061112|.	T|T	0.32734|0.32734	0.0839|0.0839	L|L	0.27053|0.27053	0.805|0.805	0.27836|0.27836	N|N	0.941273|0.941273	B;B;B|.	0.18166|.	0.026;0.013;0.01|.	B;B;B|.	0.17979|.	0.02;0.011;0.011|.	T|T	0.19321|0.19321	-1.0309|-1.0309	10|5	0.16420|.	T|.	0.52|.	-16.6187|-16.6187	9.2863|9.2863	0.37760|0.37760	0.083:0.1854:0.7316:0.0|0.083:0.1854:0.7316:0.0	.|.	1349;1103;1422|.	B6ZDQ0;C9JJB1;Q6YHU6|.	.;.;THADA_HUMAN|.	Q|R	1422;1349;1103;1422|662	ENSP00000386088:H1422Q;ENSP00000416048:H1103Q;ENSP00000385995:H1422Q|.	ENSP00000349464:H1349Q|.	H|T	-|-	3|2	2|0	THADA|THADA	43424842|43424842	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.913000|0.913000	0.54294|0.54294	1.654000|1.654000	0.37334|0.37334	1.260000|1.260000	0.44134|0.44134	-0.203000|-0.203000	0.12734|0.12734	CAC|ACG		0.403	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3		NM_022065	
THBS1	7057	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	39885311	39885311	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr15:39885311T>C	ENST00000260356.5	+	18	3043	c.2878T>C	c.(2878-2880)Ttc>Ctc	p.F960L	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	960	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.F960L(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TTTCCGCCGATTCCAGATGAT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											80.0	69.0	73.0					15																	39885311		2200	4297	6497	SO:0001583	missense	7057				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2878T>C	15.37:g.39885311T>C	ENSP00000260356:p.Phe960Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.878731	0.91740	.	.	ENSG00000137801	ENST00000260356	D	0.90133	-2.62	5.68	5.68	0.88126	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (1);	0.000000	0.37809	N	0.001926	D	0.93413	0.7899	L	0.47016	1.485	0.58432	D	0.999996	D;D	0.89917	1.0;0.995	D;D	0.87578	0.998;0.958	D	0.93304	0.6679	10	0.46703	T	0.11	-23.7788	15.8963	0.79336	0.0:0.0:0.0:1.0	.	875;960	B4E3J7;P07996	.;TSP1_HUMAN	L	960	ENSP00000260356:F960L	ENSP00000260356:F960L	F	+	1	0	THBS1	37672603	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.036000	0.88901	2.153000	0.67306	0.533000	0.62120	TTC		0.488	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2		NM_003246	
TMOD2	29767	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	52065996	52065996	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr15:52065996C>A	ENST00000249700.4	+	4	592	c.371C>A	c.(370-372)gCc>gAc	p.A124D	TMOD2_ENST00000539962.2_Missense_Mutation_p.A80D|TMOD2_ENST00000435126.2_Missense_Mutation_p.A124D	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	124					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)	p.A124D(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		GAAGCTTTGGCCAGTGCCTCT	0.468																																																	1	Substitution - Missense(1)	kidney(1)											144.0	140.0	141.0					15																	52065996		2195	4293	6488	SO:0001583	missense	29767			AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.371C>A	15.37:g.52065996C>A	ENSP00000249700:p.Ala124Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DEW6	Missense_Mutation	SNP	ENST00000249700.4	37	CCDS10144.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219441	0.79464	.	.	ENSG00000128872	ENST00000435126;ENST00000249700;ENST00000539962	T;T;T	0.29917	1.55;1.55;1.55	5.46	5.46	0.80206	.	0.113656	0.64402	D	0.000009	T	0.33030	0.0849	L	0.35341	1.055	0.49915	D	0.999834	B;P	0.38863	0.001;0.65	B;P	0.45913	0.004;0.497	T	0.01424	-1.1358	10	0.12430	T	0.62	-15.0836	19.5125	0.95148	0.0:1.0:0.0:0.0	.	124;124	Q9NZR1-2;Q9NZR1	.;TMOD2_HUMAN	D	124;124;80	ENSP00000404590:A124D;ENSP00000249700:A124D;ENSP00000437743:A80D	ENSP00000249700:A124D	A	+	2	0	TMOD2	49853288	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.873000	0.69644	2.840000	0.97914	0.655000	0.94253	GCC		0.468	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2			
TMOD2	29767	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	52066002	52066002	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr15:52066002C>T	ENST00000249700.4	+	4	598	c.377C>T	c.(376-378)gCc>gTc	p.A126V	TMOD2_ENST00000539962.2_Missense_Mutation_p.A82V|TMOD2_ENST00000435126.2_Missense_Mutation_p.A126V	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	126					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)	p.A126V(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		TTGGCCAGTGCCTCTGACACC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											146.0	142.0	143.0					15																	52066002		2195	4293	6488	SO:0001583	missense	29767			AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.377C>T	15.37:g.52066002C>T	ENSP00000249700:p.Ala126Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DEW6	Missense_Mutation	SNP	ENST00000249700.4	37	CCDS10144.1	.	.	.	.	.	.	.	.	.	.	C	35	5.572721	0.96553	.	.	ENSG00000128872	ENST00000435126;ENST00000249700;ENST00000539962	T;T;T	0.51325	0.71;0.71;0.71	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.72606	0.3481	M	0.88906	2.99	0.80722	D	1	P;P	0.52170	0.886;0.951	P;P	0.59643	0.782;0.861	T	0.77153	-0.2692	10	0.72032	D	0.01	-16.0113	19.5125	0.95148	0.0:1.0:0.0:0.0	.	126;126	Q9NZR1-2;Q9NZR1	.;TMOD2_HUMAN	V	126;126;82	ENSP00000404590:A126V;ENSP00000249700:A126V;ENSP00000437743:A82V	ENSP00000249700:A126V	A	+	2	0	TMOD2	49853294	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.639000	0.83342	2.840000	0.97914	0.655000	0.94253	GCC		0.473	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2			
TOR2A	27433	hgsc.bcm.edu	37	9	130495610	130495610	+	Intron	SNP	T	T	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr9:130495610T>C	ENST00000373284.5	-	3	640				TOR2A_ENST00000373281.5_Missense_Mutation_p.Q216R|TOR2A_ENST00000458505.3_3'UTR|TOR2A_ENST00000336067.6_Intron|TOR2A_ENST00000472723.1_5'UTR	NM_001085347.2	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A						chaperone mediated protein folding requiring cofactor (GO:0051085)|protein homooligomerization (GO:0051260)	endoplasmic reticulum lumen (GO:0005788)	ATP binding (GO:0005524)			NS(1)|endometrium(2)	3						GCTGTAGAGCTGAACCTCTGA	0.577																																																	0													61.0	60.0	60.0					9																	130495610		2203	4300	6503	SO:0001627	intron_variant	27433			AA873275	CCDS6876.1, CCDS43879.1, CCDS48024.1	9q34.11	2010-08-20			ENSG00000160404	ENSG00000160404			11996	protein-coding gene	gene with protein product		608052				10644435	Standard	NM_001085347		Approved	FLJ14771, TORP1	uc004brs.4	Q5JU69	OTTHUMG00000020706	ENST00000373284.5:c.593+53A>G	9.37:g.130495610T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A4FU12|A4FU13|Q3ZCN9|Q3ZCP0|Q5JU68|Q66K87|Q6UXW6|Q8NAN5|Q96SL7	Missense_Mutation	SNP	ENST00000373284.5	37	CCDS43879.1	.	.	.	.	.	.	.	.	.	.	T	9.628	1.135754	0.21123	.	.	ENSG00000160404	ENST00000373281	T	0.66280	-0.2	4.79	0.935	0.19483	.	.	.	.	.	T	0.31071	0.0785	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.23476	-1.0187	8	0.06365	T	0.9	.	3.5599	0.07878	0.1334:0.0788:0.1383:0.6495	.	216	Q5JU69-2	.	R	216	ENSP00000362378:Q216R	ENSP00000362378:Q216R	Q	-	2	0	TOR2A	129535431	0.078000	0.21339	0.001000	0.08648	0.029000	0.11900	1.336000	0.33850	0.251000	0.21505	0.459000	0.35465	CAG		0.577	TOR2A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054205.1		NM_130459	
TTC7A	57217	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	47221561	47221561	+	Silent	SNP	C	C	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr2:47221561C>A	ENST00000319190.5	+	7	1277	c.909C>A	c.(907-909)ccC>ccA	p.P303P	TTC7A_ENST00000409245.1_Silent_p.P269P|TTC7A_ENST00000263737.6_Intron|TTC7A_ENST00000461601.1_3'UTR|TTC7A_ENST00000394850.2_Silent_p.P303P	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	303					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)			p.P303P(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ACTGGAGCCCCCTGTCCCACC	0.612																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	76.0	76.0					2																	47221561		2203	4300	6503	SO:0001819	synonymous_variant	57217			AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.909C>A	2.37:g.47221561C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6PIX4|Q8ND67|Q9BUS3	Silent	SNP	ENST00000319190.5	37	CCDS33193.1																																																																																				0.612	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2		XM_372927	
UNC5A	90249	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	176295140	176295140	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr5:176295140C>A	ENST00000329542.4	+	3	576	c.302C>A	c.(301-303)aCc>aAc	p.T101N	UNC5A_ENST00000261961.3_Missense_Mutation_p.T61N	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	101	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T101N(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCTGCCCACCATGGAGGTC	0.652																																																	1	Substitution - Missense(1)	kidney(1)											97.0	98.0	98.0					5																	176295140		2203	4300	6503	SO:0001583	missense	90249			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.302C>A	5.37:g.176295140C>A	ENSP00000332737:p.Thr101Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	CCDS34299.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.419|9.419	1.082625|1.082625	0.20309|0.20309	.|.	.|.	ENSG00000113763|ENSG00000113763	ENST00000509580|ENST00000329542;ENST00000261961	.|T;T	.|0.39229	.|1.09;2.0	5.13|5.13	0.645|0.645	0.17782|0.17782	.|Immunoglobulin-like fold (1);	.|0.811066	.|0.11461	.|N	.|0.561719	T|T	0.24812|0.24812	0.0602|0.0602	N|N	0.14661|0.14661	0.345|0.345	0.22500|0.22500	N|N	0.999048|0.999048	.|B;B;B	.|0.17268	.|0.003;0.0;0.021	.|B;B;B	.|0.21708	.|0.036;0.0;0.015	T|T	0.26538|0.26538	-1.0100|-1.0100	5|10	.|0.87932	.|D	.|0	-5.2289|-5.2289	6.4867|6.4867	0.22093|0.22093	0.0:0.3868:0.0:0.6132|0.0:0.3868:0.0:0.6132	.|.	.|61;101;101	.|Q6ZN44-3;Q6ZN44;Q6ZN44-2	.|.;UNC5A_HUMAN;.	Q|N	66|101;61	.|ENSP00000332737:T101N;ENSP00000261961:T61N	.|ENSP00000261961:T61N	H|T	+|+	3|2	2|0	UNC5A|UNC5A	176227746|176227746	1.000000|1.000000	0.71417|0.71417	0.124000|0.124000	0.21820|0.21820	0.125000|0.125000	0.20455|0.20455	5.052000|5.052000	0.64263|0.64263	0.188000|0.188000	0.20168|0.20168	0.491000|0.491000	0.48974|0.48974	CAC|ACC		0.652	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1		XM_030300	
VHL	7428	hgsc.bcm.edu	37	3	10183863	10183863	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5187-01A-01W-1477-10	TCGA-BP-5187-11A-01W-1477-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b7a53f90-c15e-4b5d-9c9f-2e4818b2e5af	f355d7f7-5d7c-49e5-b272-76709cbfa0d7	g.chr3:10183863G>A	ENST00000256474.2	+	1	1172	c.332G>A	c.(331-333)aGc>aAc	p.S111N	VHL_ENST00000345392.2_Missense_Mutation_p.S111N|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	111	Involved in binding to CCT complex.		S -> C (in VHLD; type II).|S -> N (in VHLD; type I). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829911}.|S -> R (in VHLD; type I). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.S111N(5)|p.S111I(2)|p.S111fs*49(1)|p.?(1)|p.I109_R113del(1)|p.S111fs*22(1)|p.S111fs*45(1)|p.H110_S111del(1)|p.S111_Y112del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGCATCCACAGCTACCGAGGT	0.692		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																													.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	14	Substitution - Missense(7)|Deletion - In frame(3)|Insertion - Frameshift(2)|Deletion - Frameshift(1)|Unknown(1)	kidney(14)	GRCh37	CM951280|HM971583	VHL	M							10.0	12.0	11.0					3																	10183863		1804	3758	5562	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.332G>A	3.37:g.10183863G>A	ENSP00000256474:p.Ser111Asn	Somatic		WXS	Illumina MiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342270	0.61073	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99760	-6.66;-6.66	5.17	3.37	0.38596	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.096185	0.64402	N	0.000001	D	0.98532	0.9510	L	0.36672	1.1	0.21220	N	0.999751	B;B	0.27229	0.172;0.143	B;B	0.31686	0.134;0.091	D	0.99293	1.0899	10	0.54805	T	0.06	-5.879	4.2645	0.10757	0.0854:0.1565:0.5963:0.1618	.	111;111	P40337-2;P40337	.;VHL_HUMAN	N	111;111;29	ENSP00000256474:S111N;ENSP00000344757:S111N	ENSP00000256474:S111N	S	+	2	0	VHL	10158863	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.866000	0.56040	0.580000	0.29522	0.479000	0.44913	AGC		0.692	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZNF257	113835	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	22271280	22271280	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a0367d6-1237-454c-a4b0-4fa53782303e	6cc23233-3e06-4b8e-9c48-de62e5c49ebf	g.chr19:22271280A>G	ENST00000594947.1	+	4	872	c.728A>G	c.(727-729)cAc>cGc	p.H243R		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.H243R(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				CGGTCTTCACACCTTACTCAA	0.403																																																	1	Substitution - Missense(1)	kidney(1)											38.0	41.0	40.0					19																	22271280		2147	4263	6410	SO:0001583	missense	113835			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.728A>G	19.37:g.22271280A>G	ENSP00000470209:p.His243Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	A	2.767	-0.256509	0.05829	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	-1.22	0.09494	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26122	0.0637	L	0.35723	1.085	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.28038	-1.0056	8	0.15952	T	0.53	.	5.6936	0.17843	0.7241:0.2758:0.0:0.0	.	243	Q9Y2Q1	ZN257_HUMAN	R	243;215	.	ENSP00000380312:H215R	H	+	2	0	ZNF257	22063120	0.000000	0.05858	0.019000	0.16419	0.580000	0.36256	-0.158000	0.10070	-0.554000	0.06150	0.260000	0.18958	CAC		0.403	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			
