#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA8	10351	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	66924117	66924117	+	Silent	SNP	A	A	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr17:66924117A>G	ENST00000269080.2	-	9	1350	c.1213T>C	c.(1213-1215)Ttg>Ctg	p.L405L	ABCA8_ENST00000586539.1_Silent_p.L405L|ABCA8_ENST00000430352.2_Silent_p.L405L	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	405					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TCAAATGCCAACATGAAATTT	0.318																																																	0													67.0	66.0	67.0					17																	66924117		2203	4300	6503	SO:0001819	synonymous_variant	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1213T>C	17.37:g.66924117A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	37	CCDS11680.1																																																																																				0.318	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1		NM_007168	
ACADS	35	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	121176678	121176678	+	Missense_Mutation	SNP	G	G	A	rs199633532		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:121176678G>A	ENST00000242592.4	+	8	1140	c.989G>A	c.(988-990)cGc>cAc	p.R330H	RP11-173P15.7_ENST00000542620.1_RNA|ACADS_ENST00000411593.2_Missense_Mutation_p.R326H	NM_000017.2	NP_000008.1	P16219	ACADS_HUMAN	acyl-CoA dehydrogenase, C-2 to C-3 short chain	330					butyrate catabolic process (GO:0046359)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|protein homotetramerization (GO:0051289)|response to glucocorticoid (GO:0051384)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|butyryl-CoA dehydrogenase activity (GO:0004085)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)	p.R330H(2)		central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			Flavin adenine dinucleotide(DB03147)	CTGACCTGGCGCGCTGCCATG	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17348	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	prostate(1)|kidney(1)	GRCh37	CM067634	ACADS	M							46.0	52.0	50.0					12																	121176678		2203	4300	6503	SO:0001583	missense	35			M26393	CCDS9207.1	12q24.31	2012-07-13	2010-04-30		ENSG00000122971	ENSG00000122971	1.3.8.1		90	protein-coding gene	gene with protein product		606885	"""acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain"""			2565344	Standard	NM_000017		Approved	SCAD, ACAD3	uc001tza.4	P16219	OTTHUMG00000169203	ENST00000242592.4:c.989G>A	12.37:g.121176678G>A	ENSP00000242592:p.Arg330His	Somatic		WXS	Illumina HiSeq	Phase_I	P78331	Missense_Mutation	SNP	ENST00000242592.4	37	CCDS9207.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357217	0.82243	.	.	ENSG00000122971	ENST00000242592;ENST00000411593	D;D	0.96619	-4.07;-4.07	4.63	4.63	0.57726	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.053187	0.64402	D	0.000001	D	0.96694	0.8921	L	0.33792	1.035	0.58432	D	0.999993	D;P;P	0.89917	1.0;0.737;0.737	D;B;B	0.80764	0.994;0.14;0.14	D	0.97682	1.0173	10	0.62326	D	0.03	.	17.5068	0.87748	0.0:0.0:1.0:0.0	.	326;330;330	E9PE82;E5KSD5;P16219	.;.;ACADS_HUMAN	H	330;326	ENSP00000242592:R330H;ENSP00000401045:R326H	ENSP00000242592:R330H	R	+	2	0	ACADS	119661061	1.000000	0.71417	0.916000	0.36221	0.916000	0.54674	7.185000	0.77714	2.125000	0.65367	0.561000	0.74099	CGC		0.642	ACADS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402861.1		NM_000017	
ACTR2	10097	broad.mit.edu;hgsc.bcm.edu	37	2	65488448	65488448	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:65488448C>T	ENST00000260641.5	+	7	960	c.803C>T	c.(802-804)cCt>cTt	p.P268L	ACTR2_ENST00000542850.1_Missense_Mutation_p.P213L|ACTR2_ENST00000377982.4_Missense_Mutation_p.P273L	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	268					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						TTATTTCAGCCTCACTTGATC	0.413																																																	0													100.0	93.0	95.0					2																	65488448		2203	4300	6503	SO:0001583	missense	10097			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.803C>T	2.37:g.65488448C>T	ENSP00000260641:p.Pro268Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	ENST00000260641.5	37	CCDS1881.1	.	.	.	.	.	.	.	.	.	.	C	33	5.218010	0.95104	.	.	ENSG00000138071	ENST00000260641;ENST00000542850;ENST00000377982;ENST00000535303	T;T;T	0.17854	2.25;2.25;2.25	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.64594	0.2612	H	0.99143	4.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.81017	-0.1123	10	0.87932	D	0	-12.148	19.6376	0.95740	0.0:1.0:0.0:0.0	.	213;268;273	F5H6T1;P61160;E9PF41	.;ARP2_HUMAN;.	L	268;213;273;213	ENSP00000260641:P268L;ENSP00000437383:P213L;ENSP00000367220:P273L	ENSP00000260641:P268L	P	+	2	0	ACTR2	65341952	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.747000	0.85070	2.633000	0.89246	0.591000	0.81541	CCT		0.413	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251730.1		NM_001005386	
ADORA3	140	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	112042773	112042773	+	Silent	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:112042773G>A	ENST00000241356.4	-	2	1161	c.756C>T	c.(754-756)atC>atT	p.I252I	ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Intron|ADORA3_ENST00000369717.4_Intron	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	252					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	TAAAGTAGATGATGCAGTTGA	0.448																																																	0													105.0	99.0	101.0					1																	112042773		2203	4300	6503	SO:0001819	synonymous_variant	140			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.756C>T	1.37:g.112042773G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	ENST00000241356.4	37	CCDS839.1																																																																																				0.448	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1		NM_000677, NM_020683	
AMHR2	269	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53818668	53818668	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:53818668delT	ENST00000257863.4	+	3	488	c.408delT	c.(406-408)ggtfs	p.G136fs	AMHR2_ENST00000550311.1_Frame_Shift_Del_p.G136fs|AMHR2_ENST00000379791.3_Frame_Shift_Del_p.G136fs	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	136					Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	GCTCCCAGGGTCCCCAGGCTG	0.627																																																	0													59.0	65.0	63.0					12																	53818668		2203	4300	6503	SO:0001589	frameshift_variant	269			AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.408delT	12.37:g.53818668delT	ENSP00000257863:p.Gly136fs	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Frame_Shift_Del	DEL	ENST00000257863.4	37	CCDS8858.1																																																																																				0.627	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1		NM_020547	
BCL7A	605	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	122481799	122481799	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:122481799delC	ENST00000261822.4	+	4	485	c.279delC	c.(277-279)aacfs	p.N93fs	BCL7A_ENST00000538010.1_Frame_Shift_Del_p.N93fs	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	93					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CAGACGATAACAGCAACCAGA	0.602			T	MYC	BNHL																																GBM(17;197 467 16477 23242 44349)			Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	0													207.0	182.0	190.0					12																	122481799		2203	4300	6503	SO:0001589	frameshift_variant	605			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.279delC	12.37:g.122481799delC	ENSP00000261822:p.Asn93fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJN6|B7ZB21|Q13843|Q14CT7	Frame_Shift_Del	DEL	ENST00000261822.4	37	CCDS53841.1																																																																																				0.602	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1			
BCOR	54880	hgsc.bcm.edu;ucsc.edu	37	X	39921479	39921479	+	Silent	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chrX:39921479G>C	ENST00000378444.4	-	10	4569	c.4341C>G	c.(4339-4341)cgC>cgG	p.R1447R	BCOR_ENST00000378455.4_Silent_p.R1395R|BCOR_ENST00000342274.4_Silent_p.R1413R|BCOR_ENST00000397354.3_Silent_p.R1413R|BCOR_ENST00000378463.1_Silent_p.R290R	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1447					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GCGGCATAGGGCGAGACTGGG	0.602			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																	Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													90.0	67.0	75.0					X																	39921479		2202	4300	6502	SO:0001819	synonymous_variant	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4341C>G	X.37:g.39921479G>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	9.369	1.069908	0.20147	.	.	ENSG00000183337	ENST00000427012	.	.	.	5.53	2.73	0.32206	.	.	.	.	.	T	0.43411	0.1246	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25813	-1.0121	4	.	.	.	-20.5587	1.507	0.02488	0.2411:0.2783:0.3504:0.1302	.	.	.	.	G	142	.	.	A	-	2	0	BCOR	39806423	0.956000	0.32656	0.996000	0.52242	0.933000	0.57130	0.050000	0.14120	0.133000	0.18654	-0.192000	0.12808	GCC		0.602	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2		NM_017745	
C2orf71	388939	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	29295855	29295855	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:29295855G>A	ENST00000331664.5	-	1	1272	c.1273C>T	c.(1273-1275)Cga>Tga	p.R425*		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	425					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TCCTGTGCTCGTGGCTGAACC	0.572																																																	0													85.0	90.0	89.0					2																	29295855		2021	4173	6194	SO:0001587	stop_gained	388939				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1273C>T	2.37:g.29295855G>A	ENSP00000332809:p.Arg425*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671004	0.88348	.	.	ENSG00000179270	ENST00000331664	.	.	.	5.3	0.431	0.16523	.	0.934123	0.09148	N	0.841936	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	0.1739	0.5046	0.00585	0.1922:0.3134:0.2107:0.2837	.	.	.	.	X	425	.	ENSP00000332809:R425X	R	-	1	2	C2orf71	29149359	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.176000	0.09811	-0.217000	0.10033	-0.311000	0.09066	CGA		0.572	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3		NM_001029883	
CAMSAP1	157922	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	138713412	138713412	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr9:138713412C>T	ENST00000389532.4	-	11	3159	c.3095G>A	c.(3094-3096)aGt>aAt	p.S1032N	CAMSAP1_ENST00000312405.6_Missense_Mutation_p.S754N|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.S1043N|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1032					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CTGCAGCGTACTGATGGTTTC	0.522																																																	0													76.0	68.0	71.0					9																	138713412		2203	4300	6503	SO:0001583	missense	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.3095G>A	9.37:g.138713412C>T	ENSP00000374183:p.Ser1032Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	9.790	1.177777	0.21787	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.15834	2.4;2.39;2.4	4.91	4.91	0.64330	.	0.131570	0.64402	D	0.000001	T	0.32941	0.0846	M	0.62723	1.935	0.40179	D	0.977279	P;P	0.41546	0.605;0.754	B;P	0.49829	0.18;0.623	T	0.12142	-1.0559	10	0.87932	D	0	-1.2085	18.4729	0.90781	0.0:1.0:0.0:0.0	.	1032;1043	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	N	1032;754;1043	ENSP00000374183:S1032N;ENSP00000312463:S754N;ENSP00000386420:S1043N	ENSP00000312463:S754N	S	-	2	0	CAMSAP1	137853233	1.000000	0.71417	0.996000	0.52242	0.018000	0.09664	5.917000	0.69989	2.413000	0.81919	0.655000	0.94253	AGT		0.522	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2		XM_351857	
CCDC42	146849	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	8647475	8647475	+	Silent	SNP	C	C	T	rs149123321		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr17:8647475C>T	ENST00000293845.3	-	2	337	c.111G>A	c.(109-111)tcG>tcA	p.S37S	CCDC42_ENST00000539522.2_Silent_p.S37S	NM_144681.2	NP_653282.2	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	37										kidney(1)|large_intestine(4)|lung(3)|ovary(1)	9						ATGGGGACTCCGACGCCCCCT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		18373	0.001		0.0	False		,,,				2504	0.0																0								C	,	2,4404	4.2+/-10.8	0,2,2201	127.0	107.0	114.0		111,111	-5.9	0.0	17	dbSNP_134	114	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CCDC42	NM_001158261.1,NM_144681.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	37/243,37/317	8647475	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	146849			AK057296	CCDS11145.1, CCDS54088.1	17p13.1	2012-05-28			ENSG00000161973	ENSG00000161973			26528	protein-coding gene	gene with protein product							Standard	NM_144681		Approved	FLJ32734, CCDC42A	uc002gln.3	Q96M95		ENST00000293845.3:c.111G>A	17.37:g.8647475C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N6Q0	Silent	SNP	ENST00000293845.3	37	CCDS11145.1																																																																																				0.547	CCDC42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442491.1		NM_144681	
CCNG2	901	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	78085544	78085544	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:78085544C>T	ENST00000316355.5	+	7	1179	c.823C>T	c.(823-825)Cgc>Tgc	p.R275C	CCNG2_ENST00000354403.5_Missense_Mutation_p.R275C|CCNG2_ENST00000509972.1_Missense_Mutation_p.R275C|CCNG2_ENST00000497512.1_3'UTR|CCNG2_ENST00000395640.1_Missense_Mutation_p.R275C|CCNG2_ENST00000502280.1_Missense_Mutation_p.R275C	NM_004354.2	NP_004345.1	Q16589	CCNG2_HUMAN	cyclin G2	275					cell cycle checkpoint (GO:0000075)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						CGTTTCAAGGCGCACAGCCCA	0.468																																																	0													85.0	85.0	85.0					4																	78085544		2203	4300	6503	SO:0001583	missense	901			BC032518	CCDS3581.1	4q21.22	2009-05-07			ENSG00000138764	ENSG00000138764			1593	protein-coding gene	gene with protein product		603203				8806701	Standard	NM_004354		Approved		uc003hkq.4	Q16589	OTTHUMG00000130100	ENST00000316355.5:c.823C>T	4.37:g.78085544C>T	ENSP00000315743:p.Arg275Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DF25|Q6FGA7|Q6FGC6	Missense_Mutation	SNP	ENST00000316355.5	37	CCDS3581.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915837	0.73098	.	.	ENSG00000138764	ENST00000316355;ENST00000354403;ENST00000502280;ENST00000395640;ENST00000509972	T;T;T;T;T	0.25749	1.78;1.86;1.78;1.78;1.92	5.56	5.56	0.83823	.	0.108032	0.64402	D	0.000005	T	0.54334	0.1852	M	0.73962	2.25	0.80722	D	1	P;D	0.89917	0.937;1.0	B;D	0.75484	0.302;0.986	T	0.56854	-0.7910	10	0.87932	D	0	-6.4768	19.5209	0.95184	0.0:1.0:0.0:0.0	.	275;275	B4DF25;Q16589	.;CCNG2_HUMAN	C	275	ENSP00000315743:R275C;ENSP00000346379:R275C;ENSP00000424665:R275C;ENSP00000379002:R275C;ENSP00000426476:R275C	ENSP00000315743:R275C	R	+	1	0	CCNG2	78304568	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	2.289000	0.43523	2.614000	0.88457	0.561000	0.74099	CGC		0.468	CCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252404.3		NM_004354	
CCNH	902	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	86695281	86695281	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr5:86695281C>A	ENST00000256897.4	-	7	1026	c.802G>T	c.(802-804)Gaa>Taa	p.E268*	CCNH_ENST00000504878.1_Nonsense_Mutation_p.E194*|CCNH_ENST00000508855.1_Nonsense_Mutation_p.E194*	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	268					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		GCAACTTCTTCAGATCTGGGT	0.368								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																									0													232.0	205.0	214.0					5																	86695281		2203	4300	6503	SO:0001587	stop_gained	902			U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.802G>T	5.37:g.86695281C>A	ENSP00000256897:p.Glu268*	Somatic		WXS	Illumina HiSeq	Phase_I	Q53X72|Q8TBL9	Nonsense_Mutation	SNP	ENST00000256897.4	37	CCDS4064.1	.	.	.	.	.	.	.	.	.	.	C	43	9.995035	0.99313	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	.	.	.	5.68	5.68	0.88126	.	0.089115	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-15.2394	19.7923	0.96464	0.0:1.0:0.0:0.0	.	.	.	.	X	194;268;194	.	ENSP00000256897:E268X	E	-	1	0	CCNH	86731037	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.383000	0.66219	2.693000	0.91896	0.655000	0.94253	GAA		0.368	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239291.3		NM_001239	
CD6	923	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	60785278	60785278	+	Missense_Mutation	SNP	C	C	A	rs376601820		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr11:60785278C>A	ENST00000313421.7	+	11	1816	c.1630C>A	c.(1630-1632)Cac>Aac	p.H544N	CD6_ENST00000352009.5_Missense_Mutation_p.H512N|CD6_ENST00000452451.2_Missense_Mutation_p.H503N|CD6_ENST00000344028.5_Missense_Mutation_p.H512N|CD6_ENST00000346437.4_Missense_Mutation_p.H471N	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	544					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						CAACCCTGGACACTGCATTAC	0.552																																					Pancreas(169;904 2017 4767 38890 42505)												0													83.0	86.0	85.0					11																	60785278		2203	4299	6502	SO:0001583	missense	923				CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1630C>A	11.37:g.60785278C>A	ENSP00000323280:p.His544Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	37	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	C	1.489	-0.555098	0.03967	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421;ENST00000433107;ENST00000452451;ENST00000352009	T;T;T;T;T;T	0.01369	5.02;4.97;5.04;5.11;4.98;5.0	4.87	4.87	0.63330	.	1.286490	0.05769	N	0.606380	T	0.02610	0.0079	L	0.54323	1.7	0.09310	N	1	P;B;B;B	0.37276	0.589;0.001;0.204;0.255	B;B;B;B	0.32677	0.15;0.001;0.062;0.045	T	0.50923	-0.8770	10	0.33141	T	0.24	.	13.8848	0.63702	0.0:1.0:0.0:0.0	.	503;512;544;544	P30203-5;P30203-4;P30203;Q8N4Q7	.;.;CD6_HUMAN;.	N	512;471;544;411;503;512	ENSP00000344108:H512N;ENSP00000345566:H471N;ENSP00000323280:H544N;ENSP00000410638:H411N;ENSP00000390676:H503N;ENSP00000340628:H512N	ENSP00000323280:H544N	H	+	1	0	CD6	60541854	0.000000	0.05858	0.019000	0.16419	0.020000	0.10135	0.805000	0.27112	2.432000	0.82394	0.467000	0.42956	CAC		0.552	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1		NM_006725	
CELF5	60680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	3293438	3293438	+	Silent	SNP	C	C	A	rs142809979		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr19:3293438C>A	ENST00000292672.2	+	12	1489	c.1452C>A	c.(1450-1452)ccC>ccA	p.P484P	CELF5_ENST00000541430.2_3'UTR	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	484					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						CGGGACACCCCTACTGACCGC	0.687																																																	0													61.0	57.0	59.0					19																	3293438		2203	4300	6503	SO:0001819	synonymous_variant	60680			AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.1452C>A	19.37:g.3293438C>A		Somatic		WXS	Illumina HiSeq	Phase_I	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Silent	SNP	ENST00000292672.2	37	CCDS12106.1																																																																																				0.687	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1		NM_021938	
CELSR3	1951	broad.mit.edu	37	3	48682639	48682639	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:48682639C>G	ENST00000164024.4	-	25	8081	c.7801G>C	c.(7801-7803)Gtg>Ctg	p.V2601L	MIR4793_ENST00000577502.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.V2606L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2601					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCAGTGCACACCAGCTGAGGG	0.627																																																	0													51.0	50.0	50.0					3																	48682639		2200	4296	6496	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.7801G>C	3.37:g.48682639C>G	ENSP00000164024:p.Val2601Leu	Somatic		WXS	Illumina GAIIx	Phase_I	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	2.261	-0.369316	0.05069	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.33654	1.4;1.4	4.5	-0.524	0.11920	GPCR, family 2-like (1);	.	.	.	.	T	0.18045	0.0433	N	0.02736	-0.51	0.24266	N	0.995261	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.31888	-0.9927	9	0.07325	T	0.83	.	22.6753	0.99975	0.0:0.1286:0.8714:0.0	.	2601;2698	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	L	2601;2606	ENSP00000164024:V2601L;ENSP00000445694:V2606L	ENSP00000164024:V2601L	V	-	1	0	CELSR3	48657643	0.525000	0.26290	0.988000	0.46212	0.992000	0.81027	-0.338000	0.07842	-0.686000	0.05170	0.561000	0.74099	GTG		0.627	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1		NM_001407	
CMKLR1	1240	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	108686307	108686307	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:108686307C>T	ENST00000312143.7	-	3	796	c.433G>A	c.(433-435)Gtc>Atc	p.V145I	CMKLR1_ENST00000550402.1_Missense_Mutation_p.V145I|CMKLR1_ENST00000552995.1_Missense_Mutation_p.V143I|CMKLR1_ENST00000412676.1_Missense_Mutation_p.V145I|CMKLR1_ENST00000397688.2_Missense_Mutation_p.V143I	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	145					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						TGGGACCAGACAGGGAGGAGC	0.557																																																	0													76.0	79.0	78.0					12																	108686307		2157	4264	6421	SO:0001583	missense	1240			U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.433G>A	12.37:g.108686307C>T	ENSP00000311733:p.Val145Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	ENST00000312143.7	37	CCDS44965.1	.	.	.	.	.	.	.	.	.	.	c	20.7	4.037956	0.75617	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402;ENST00000550573	T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.134805	0.49916	D	0.000121	T	0.49270	0.1547	L	0.41356	1.27	0.58432	D	0.999993	D	0.71674	0.998	D	0.67382	0.951	T	0.26985	-1.0087	10	0.20519	T	0.43	.	17.788	0.88543	0.0:1.0:0.0:0.0	.	145	Q99788	CML1_HUMAN	I	145;145;143;143;145;145	ENSP00000311733:V145I;ENSP00000401293:V145I;ENSP00000380803:V143I;ENSP00000447579:V143I;ENSP00000449716:V145I;ENSP00000448925:V145I	ENSP00000311733:V145I	V	-	1	0	CMKLR1	107210437	1.000000	0.71417	0.998000	0.56505	0.565000	0.35776	6.055000	0.71103	2.448000	0.82819	0.486000	0.48141	GTC		0.557	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			
COL13A1	1305	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	71692318	71692319	+	Nonsense_Mutation	DNP	AG	AG	TT			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr10:71692318_71692319AG>TT	ENST00000398978.3	+	30	2145_2146	c.1653_1654AG>TT	c.(1651-1656)ggAGag>ggTTag	p.E552*	COL13A1_ENST00000398971.3_Intron|COL13A1_ENST00000398972.3_Nonsense_Mutation_p.E552*|COL13A1_ENST00000520267.1_Intron|COL13A1_ENST00000357811.3_Nonsense_Mutation_p.E530*|COL13A1_ENST00000398966.3_Nonsense_Mutation_p.E530*|COL13A1_ENST00000398974.3_Nonsense_Mutation_p.E540*|COL13A1_ENST00000522165.1_Nonsense_Mutation_p.E533*|COL13A1_ENST00000354547.3_Nonsense_Mutation_p.E530*|COL13A1_ENST00000520133.1_Intron|COL13A1_ENST00000517713.1_Intron|COL13A1_ENST00000398964.3_Nonsense_Mutation_p.E523*|COL13A1_ENST00000398973.3_Nonsense_Mutation_p.E552*|COL13A1_ENST00000356340.3_Nonsense_Mutation_p.E552*|COL13A1_ENST00000398968.3_Nonsense_Mutation_p.E533*|COL13A1_ENST00000398969.3_Intron	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GCCCACAGGGAGAGAAAGGAGA	0.53																																																	0																																										SO:0001587	stop_gained	1305			AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	Exception_encountered	10.37:g.71692318_71692319delinsTT	ENSP00000381949:p.Glu552*	Somatic		WXS	Illumina HiSeq	Phase_I		Silent|Nonsense_Mutation	SNP	ENST00000398978.3	37	CCDS44419.1																																																																																				0.530	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1		NM_005203	
COL15A1	1306	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	101817583	101817583	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr9:101817583G>A	ENST00000375001.3	+	34	3544	c.3121G>A	c.(3121-3123)Gaa>Aaa	p.E1041K		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1041	Triple-helical region 7 (COL7).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TGAAAAAGGAGAAAAAGGAGA	0.502																																																	0													86.0	89.0	88.0					9																	101817583		2203	4300	6503	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3121G>A	9.37:g.101817583G>A	ENSP00000364140:p.Glu1041Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346763	0.61073	.	.	ENSG00000204291	ENST00000375001	D	0.91180	-2.8	5.73	5.73	0.89815	.	0.564682	0.19910	N	0.103303	D	0.91573	0.7338	M	0.69185	2.1	0.51767	D	0.999931	P	0.52463	0.953	P	0.47603	0.551	D	0.91222	0.5007	10	0.45353	T	0.12	.	16.8192	0.85741	0.0:0.0:1.0:0.0	.	1041	P39059	COFA1_HUMAN	K	1041	ENSP00000364140:E1041K	ENSP00000364140:E1041K	E	+	1	0	COL15A1	100857404	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.558000	0.67319	2.722000	0.93159	0.655000	0.94253	GAA		0.502	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3		NM_001855	
CUBN	8029	broad.mit.edu;ucsc.edu	37	10	17151672	17151672	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr10:17151672A>G	ENST00000377833.4	-	10	1143	c.1078T>C	c.(1078-1080)Tgc>Cgc	p.C360R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	360	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCTGGGTGGCAGCCTCCATTA	0.463																																																	0													189.0	130.0	150.0					10																	17151672		2203	4300	6503	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1078T>C	10.37:g.17151672A>G	ENSP00000367064:p.Cys360Arg	Somatic		WXS	Illumina GAIIx	Phase_I	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.594759	0.66219	.	.	ENSG00000107611	ENST00000377833	D	0.99903	-7.67	5.64	5.64	0.86602	EGF domain, merozoite surface protein 1-like (1);Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.49305	D	0.000144	D	0.99932	0.9969	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96276	0.9202	10	0.56958	D	0.05	.	14.7186	0.69289	1.0:0.0:0.0:0.0	.	360	O60494	CUBN_HUMAN	R	360	ENSP00000367064:C360R	ENSP00000367064:C360R	C	-	1	0	CUBN	17191678	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	8.257000	0.89851	2.276000	0.75962	0.455000	0.32223	TGC		0.463	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1		NM_001081	
DCAF5	8816	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	69520975	69520975	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr14:69520975C>T	ENST00000341516.5	-	9	2575	c.2428G>A	c.(2428-2430)Ggc>Agc	p.G810S	DCAF5_ENST00000556847.1_Missense_Mutation_p.G728S|DCAF5_ENST00000554215.1_Missense_Mutation_p.G728S|DCAF5_ENST00000557386.1_Missense_Mutation_p.G809S|DCAF5_ENST00000553293.1_5'Flank	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	810					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						GGACAGTTGCCAGACCCGCTG	0.587																																																	0													80.0	83.0	82.0					14																	69520975		2203	4300	6503	SO:0001583	missense	8816			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2428G>A	14.37:g.69520975C>T	ENSP00000341351:p.Gly810Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210829	0.39102	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.70164	-0.46;-0.29;-0.29;0.1	5.09	4.12	0.48240	.	0.071573	0.53938	D	0.000042	T	0.50051	0.1593	N	0.14661	0.345	0.80722	D	1	B;B	0.14805	0.011;0.006	B;B	0.18263	0.021;0.009	T	0.50056	-0.8872	10	0.49607	T	0.09	-21.4734	14.1372	0.65295	0.0:0.9167:0.0:0.0833	.	809;810	G3V4J7;Q96JK2	.;DCAF5_HUMAN	S	810;728;728;809	ENSP00000341351:G810S;ENSP00000451551:G728S;ENSP00000452052:G728S;ENSP00000451845:G809S	ENSP00000341351:G810S	G	-	1	0	DCAF5	68590728	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.596000	0.54024	2.648000	0.89879	0.561000	0.74099	GGC		0.587	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2		NM_003861	
DCLK1	9201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	36521538	36521538	+	Silent	SNP	C	C	T	rs146364649	byFrequency	TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr13:36521538C>T	ENST00000360631.3	-	4	991	c.780G>A	c.(778-780)ccG>ccA	p.P260P	DCLK1_ENST00000255448.4_Silent_p.P260P|DCLK1_ENST00000379892.4_Silent_p.P260P			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	260	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GGAACTTCTCCGGTCCACATG	0.423													C|||	3	0.000599042	0.0	0.0	5008	,	,		17983	0.0		0.003	False		,,,				2504	0.0																0								C		0,4406		0,0,2203	112.0	101.0	104.0		780	0.2	1.0	13	dbSNP_134	104	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DCLK1	NM_004734.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		260/730	36521538	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9201			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.780G>A	13.37:g.36521538C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	37																																																																																					0.423	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1		NM_004734	
DDX11	1663	broad.mit.edu	37	12	31256928	31256928	+	Silent	SNP	C	C	G	rs536300063		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:31256928C>G	ENST00000407793.2	+	27	3125	c.2874C>G	c.(2872-2874)ggC>ggG	p.G958G	DDX11_ENST00000350437.4_3'UTR|DDX11_ENST00000228264.6_3'UTR|DDX11_ENST00000545668.1_Silent_p.G958G|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	958					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGGCACAGGCGTTAGCTCCC	0.582										Multiple Myeloma(12;0.14)																																							0													22.0	35.0	30.0					12																	31256928		1279	2263	3542	SO:0001819	synonymous_variant	1663			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.2874C>G	12.37:g.31256928C>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000407793.2	37	CCDS44856.1																																																																																				0.582	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1		NM_030653	
DGKH	160851	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	42740809	42740809	+	Splice_Site	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr13:42740809G>A	ENST00000337343.4	+	9	1138	c.1117G>A	c.(1117-1119)Ggt>Agt	p.G373S	DGKH_ENST00000536612.1_Splice_Site_p.G237S|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000540693.1_Splice_Site_p.G373S|DGKH_ENST00000261491.5_Splice_Site_p.G373S|DGKH_ENST00000379274.2_Splice_Site_p.G237S|DGKH_ENST00000538674.1_Splice_Site_p.G128S	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	373	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TCCTCATTTAGGGTAACTGAT	0.358																																																	0													73.0	75.0	74.0					13																	42740809		2203	4300	6503	SO:0001630	splice_region_variant	160851			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1118+1G>A	13.37:g.42740809G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	G	35	5.586168	0.96578	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.06	5.81	5.81	0.92471	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.51669	0.1688	M	0.78285	2.405	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.52223	-0.8604	10	0.87932	D	0	.	20.0795	0.97766	0.0:0.0:1.0:0.0	.	128;237;373;373	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	S	373;373;373;237;237;128	ENSP00000440823:G373S;ENSP00000337572:G373S;ENSP00000261491:G373S;ENSP00000368576:G237S;ENSP00000445114:G237S;ENSP00000441308:G128S	ENSP00000261491:G373S	G	+	1	0	DGKH	41638809	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.813000	0.99286	2.747000	0.94245	0.650000	0.86243	GGT		0.358	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2		NM_178009	Missense_Mutation
RIPPLY3	53820	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	38390298	38390298	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr21:38390298G>A	ENST00000329553.2	+	4	574	c.364G>A	c.(364-366)Gaa>Aaa	p.E122K	RIPPLY3_ENST00000485272.1_3'UTR	NM_018962.2	NP_061835.1	P57055	DSCR6_HUMAN	ripply transcriptional repressor 3	122					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pharyngeal system development (GO:0060037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											GTCTGCTTCCGAAGCTGAAGA	0.582																																																	0													44.0	42.0	43.0					21																	38390298		2203	4300	6503	SO:0001583	missense	53820			AB037158	CCDS13648.1	21q22.2	2013-07-23	2013-07-23	2013-06-04	ENSG00000183145	ENSG00000183145			3047	protein-coding gene	gene with protein product		609892	"""Down syndrome critical region gene 6"", ""ripply3 homolog (zebrafish)"""	DSCR6		10814524, 22354841	Standard	NM_018962		Approved			P57055	OTTHUMG00000086639	ENST00000329553.2:c.364G>A	21.37:g.38390298G>A	ENSP00000331734:p.Glu122Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000329553.2	37	CCDS13648.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840912	0.51057	.	.	ENSG00000183145	ENST00000329553	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	T	0.37839	0.1018	N	0.19112	0.55	0.09310	N	0.999997	D	0.60160	0.987	P	0.53988	0.739	T	0.23119	-1.0197	8	0.62326	D	0.03	0.0089	14.0406	0.64672	0.0:0.0:1.0:0.0	.	122	P57055	DSCR6_HUMAN	K	122	.	ENSP00000331734:E122K	E	+	1	0	DSCR6	37312168	0.951000	0.32395	0.057000	0.19452	0.001000	0.01503	5.206000	0.65192	2.583000	0.87209	0.561000	0.74099	GAA		0.582	RIPPLY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194703.1			
DIP2A	23181	broad.mit.edu;ucsc.edu	37	21	47980645	47980645	+	Missense_Mutation	SNP	G	G	T	rs370283379		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr21:47980645G>T	ENST00000417564.2	+	33	4001	c.3980G>T	c.(3979-3981)gGc>gTc	p.G1327V	DIP2A_ENST00000318711.7_Missense_Mutation_p.G1328V|DIP2A_ENST00000400274.1_Missense_Mutation_p.G1323V			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1327					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGCACAGCTGGCCCGGACCCC	0.597																																																	0								G	VAL/GLY,VAL/GLY	0,3982		0,0,1991	28.0	32.0	30.0		3968,3980	5.6	1.0	21		30	1,8329		0,1,4164	no	missense,missense	DIP2A	NM_001146116.1,NM_015151.3	109,109	0,1,6155	TT,TG,GG		0.012,0.0,0.0081	possibly-damaging,possibly-damaging	1323/1568,1327/1572	47980645	1,12311	1991	4165	6156	SO:0001583	missense	23181			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3980G>T	21.37:g.47980645G>T	ENSP00000392066:p.Gly1327Val	Somatic		WXS	Illumina GAIIx	Phase_I	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841350	0.91197	0.0	1.2E-4	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.11169	2.8;2.8;2.8	5.58	5.58	0.84498	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.37945	0.1022	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.11012	-1.0605	10	0.59425	D	0.04	-25.6345	18.5491	0.91057	0.0:0.0:1.0:0.0	.	1328;1327	E9PER1;Q14689	.;DIP2A_HUMAN	V	1323;1328;1327	ENSP00000383133:G1323V;ENSP00000323633:G1328V;ENSP00000392066:G1327V	ENSP00000323633:G1328V	G	+	2	0	DIP2A	46805073	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	9.689000	0.98673	2.645000	0.89757	0.655000	0.94253	GGC		0.597	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1		NM_015151	
DSPP	1834	broad.mit.edu	37	4	88536917	88536917	+	Missense_Mutation	SNP	G	G	A	rs199901845		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:88536917G>A	ENST00000282478.7	+	4	3136	c.3103G>A	c.(3103-3105)Gat>Aat	p.D1035N	DSPP_ENST00000399271.1_Missense_Mutation_p.D1035N|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1035	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.D1035N(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.522																																																	1	Substitution - Missense(1)	kidney(1)											62.0	68.0	66.0					4																	88536917		1560	2750	4310	SO:0001583	missense	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3103G>A	4.37:g.88536917G>A	ENSP00000282478:p.Asp1035Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	5.819	0.335399	0.11013	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88664	-2.41;-2.41	1.43	0.544	0.17185	.	.	.	.	.	T	0.73999	0.3659	L	0.29908	0.895	0.18873	N	0.999989	B	0.30542	0.284	B	0.13407	0.009	T	0.59783	-0.7389	9	0.06494	T	0.89	-6.585	4.0989	0.10004	0.2347:0.0:0.7653:0.0	.	1035	Q9NZW4	DSPP_HUMAN	N	1035	ENSP00000382213:D1035N;ENSP00000282478:D1035N	ENSP00000282478:D1035N	D	+	1	0	DSPP	88755941	0.238000	0.23825	0.544000	0.28141	0.014000	0.08584	1.337000	0.33862	0.180000	0.19960	-0.791000	0.03333	GAT		0.522	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3		NM_014208	
DTHD1	401124	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	36345346	36345346	+	Missense_Mutation	SNP	G	G	A	rs186265781	byFrequency	TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:36345346G>A	ENST00000456874.2	+	9	2304	c.2246G>A	c.(2245-2247)cGc>cAc	p.R749H	RP11-431M7.2_ENST00000504344.1_RNA|DTHD1_ENST00000503528.1_3'UTR|DTHD1_ENST00000357504.3_Missense_Mutation_p.R584H|DTHD1_ENST00000507598.1_Missense_Mutation_p.R789H	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	749	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.			R -> S (in Ref. 1; BAG65199/BAH14894). {ECO:0000305}.	signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						CGACATCTCCGCAAGATTGGC	0.458													G|||	11	0.00219649	0.0	0.0144	5008	,	,		21215	0.0		0.001	False		,,,				2504	0.0																0													23.0	23.0	23.0					4																	36345346		692	1591	2283	SO:0001583	missense	401124			AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.2246G>A	4.37:g.36345346G>A	ENSP00000401597:p.Arg749His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RXK4|B4E2N7	Missense_Mutation	SNP	ENST00000456874.2	37	CCDS54754.1	6	0.0027472527472527475	0	0.0	6	0.016574585635359115	0	0.0	0	0.0	G	15.42	2.826877	0.50739	.	.	ENSG00000197057	ENST00000357504;ENST00000507598;ENST00000456874	D;D;D	0.86627	-2.15;-2.15;-2.15	4.3	1.57	0.23409	.	0.269957	0.30989	N	0.008473	T	0.82245	0.4995	M	0.70595	2.14	0.25193	N	0.990113	D	0.69078	0.997	P	0.60236	0.871	T	0.76945	-0.2771	10	0.51188	T	0.08	-2.9099	6.2581	0.20885	0.254:0.1356:0.6104:0.0	.	584	Q6ZMT9-2	.	H	584;789;749	ENSP00000350103:R584H;ENSP00000424426:R789H;ENSP00000401597:R749H	ENSP00000350103:R584H	R	+	2	0	DTHD1	36021741	0.141000	0.22595	0.998000	0.56505	0.582000	0.36321	1.031000	0.30165	0.100000	0.17581	-0.339000	0.08088	CGC		0.458	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_001136536	
DSPP	1834	broad.mit.edu	37	4	88536919	88536919	+	Silent	SNP	T	T	C	rs369387818		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:88536919T>C	ENST00000282478.7	+	4	3138	c.3105T>C	c.(3103-3105)gaT>gaC	p.D1035D	DSPP_ENST00000399271.1_Silent_p.D1035D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1035	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.D1035D(2)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcgatagcagtgaca	0.517																																																	2	Substitution - coding silent(2)	kidney(2)											63.0	70.0	67.0					4																	88536919		1560	2747	4307	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3105T>C	4.37:g.88536919T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																				0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3		NM_014208	
DYNC1H1	1778	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	102510612	102510612	+	Splice_Site	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr14:102510612G>A	ENST00000360184.4	+	71	12850	c.12686G>A	c.(12685-12687)gGc>gAc	p.G4229D	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4229					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CTCCCCCAGGGCAGGCAGAAC	0.602																																																	0													52.0	41.0	44.0					14																	102510612		2203	4300	6503	SO:0001630	splice_region_variant	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12685-1G>A	14.37:g.102510612G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	34	5.319501	0.95682	.	.	ENSG00000197102	ENST00000360184	T	0.31510	1.49	5.56	5.56	0.83823	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.66346	0.2780	M	0.92604	3.325	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.72276	-0.4341	10	0.46703	T	0.11	.	19.5375	0.95260	0.0:0.0:1.0:0.0	.	4229	Q14204	DYHC1_HUMAN	D	4229	ENSP00000348965:G4229D	ENSP00000348965:G4229D	G	+	2	0	DYNC1H1	101580365	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	9.869000	0.99810	2.620000	0.88729	0.655000	0.94253	GGC		0.602	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1		NM_001376	Missense_Mutation
DYSF	8291	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	71896302	71896302	+	Silent	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:71896302C>A	ENST00000258104.3	+	49	5767	c.5490C>A	c.(5488-5490)ctC>ctA	p.L1830L	DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000410020.3_Silent_p.L1869L|DYSF_ENST00000409582.3_Silent_p.L1868L|DYSF_ENST00000429174.2_Silent_p.L1851L|DYSF_ENST00000413539.2_Silent_p.L1861L|DYSF_ENST00000410041.1_Silent_p.L1848L|DYSF_ENST00000409366.1_Silent_p.L1852L|DYSF_ENST00000409744.1_Silent_p.L1838L|DYSF_ENST00000394120.2_Silent_p.L1831L|DYSF_ENST00000409762.1_Silent_p.L1847L|DYSF_ENST00000409651.1_Silent_p.L1862L	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1830	C2 7. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ACCTGAGCCTCACGGGGGAGA	0.527																																																	0													62.0	55.0	57.0					2																	71896302		2203	4300	6503	SO:0001819	synonymous_variant	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5490C>A	2.37:g.71896302C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1																																																																																				0.527	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3		NM_003494	
ERVFRD-1	405754	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	11104942	11104942	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr6:11104942C>T	ENST00000472091.1	-	2	977	c.602G>A	c.(601-603)aGt>aAt	p.S201N	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Missense_Mutation_p.S201N	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	201					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						GTTTCGAGTACTGCATGAGCT	0.468																																																	0													80.0	89.0	86.0					6																	11104942		2203	4300	6503	SO:0001583	missense	0			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.602G>A	6.37:g.11104942C>T	ENSP00000420174:p.Ser201Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000472091.1	37	CCDS4519.1	.	.	.	.	.	.	.	.	.	.	C	4.129	0.022144	0.08006	.	.	ENSG00000244476	ENST00000472091;ENST00000542862	T;T	0.14893	2.47;2.47	0.225	0.225	0.15325	.	.	.	.	.	T	0.02418	0.0074	N	0.22421	0.69	0.09310	N	1	P	0.38110	0.618	B	0.28638	0.092	T	0.42207	-0.9465	8	0.27082	T	0.32	.	.	.	.	.	201	P60508	EFRD1_HUMAN	N	201	ENSP00000420174:S201N;ENSP00000444461:S201N	ENSP00000420174:S201N	S	-	2	0	ERVFRD-1	11212928	0.179000	0.23135	0.018000	0.16275	0.019000	0.09904	0.305000	0.19254	0.300000	0.22699	0.305000	0.20034	AGT		0.468	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353776.1		NM_207582	
FLG	2312	broad.mit.edu;hgsc.bcm.edu	37	1	152277657	152277657	+	Silent	SNP	A	A	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:152277657A>G	ENST00000368799.1	-	3	9740	c.9705T>C	c.(9703-9705)gcT>gcC	p.A3235A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3235	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGTTTCTGGAAGCAGACCCAG	0.597									Ichthyosis																																								0													179.0	190.0	186.0					1																	152277657		2203	4300	6503	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9705T>C	1.37:g.152277657A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1		NM_002016	
FCRL2	79368	broad.mit.edu;ucsc.edu	37	1	157739752	157739752	+	Missense_Mutation	SNP	C	C	T	rs138011295		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:157739752C>T	ENST00000361516.3	-	4	547	c.499G>A	c.(499-501)Gtg>Atg	p.V167M	FCRL2_ENST00000392274.3_Missense_Mutation_p.V167M|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	167	Ig-like C2-type 2.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCACTCCACACGGCAGAAATC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		16596	0.0		0.001	False		,,,				2504	0.0																0								C	MET/VAL	0,4406		0,0,2203	70.0	73.0	72.0		499	-9.2	0.0	1	dbSNP_134	72	2,8598	2.2+/-6.3	0,2,4298	yes	missense	FCRL2	NM_030764.3	21	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	167/509	157739752	2,13004	2203	4300	6503	SO:0001583	missense	79368			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.499G>A	1.37:g.157739752C>T	ENSP00000355157:p.Val167Met	Somatic		WXS	Illumina GAIIx	Phase_I	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.467007	0.01053	0.0	2.33E-4	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.05786	3.39;3.39	4.61	-9.21	0.00678	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.900950	0.01577	N	0.020878	T	0.00754	0.0025	N	0.10685	0.025	0.09310	N	1	B;B;B	0.21381	0.027;0.055;0.025	B;B;B	0.26202	0.041;0.067;0.041	T	0.32241	-0.9914	10	0.32370	T	0.25	.	4.9473	0.13997	0.3584:0.4346:0.0903:0.1167	.	167;167;167	B4E0W2;B4DVJ9;Q96LA5	.;.;FCRL2_HUMAN	M	167	ENSP00000355157:V167M;ENSP00000376100:V167M	ENSP00000355157:V167M	V	-	1	0	FCRL2	156006376	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.191000	0.01246	-3.399000	0.00171	-1.215000	0.01618	GTG		0.532	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2		NM_030764	
FMR1NB	158521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	147088242	147088242	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chrX:147088242C>T	ENST00000370467.3	+	3	492	c.418C>T	c.(418-420)Cag>Tag	p.Q140*	5S_rRNA_ENST00000364415.1_RNA	NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	140	P-type.					integral component of membrane (GO:0016021)|nucleolus (GO:0005730)				breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGAAAATCAGGTGGCAAA	0.378																																																	0													161.0	152.0	155.0					X																	147088242		2203	4300	6503	SO:0001587	stop_gained	158521				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.418C>T	X.37:g.147088242C>T	ENSP00000359498:p.Gln140*	Somatic		WXS	Illumina HiSeq	Phase_I	D3DWT3	Nonsense_Mutation	SNP	ENST00000370467.3	37	CCDS14683.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901518	0.72754	.	.	ENSG00000176988	ENST00000370467	.	.	.	5.32	0.0925	0.14473	.	0.377799	0.19429	N	0.114485	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-15.2649	8.5482	0.33435	0.2775:0.3229:0.3996:0.0	.	.	.	.	X	140	.	ENSP00000359498:Q140X	Q	+	1	0	FMR1NB	146895934	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.120000	0.10660	-0.472000	0.06881	-0.292000	0.09595	CAG		0.378	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1		NM_152578	
FPR3	2359	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52327023	52327023	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr19:52327023C>T	ENST00000339223.4	+	2	201	c.22C>T	c.(22-24)Cct>Tct	p.P8S	FPR3_ENST00000595991.1_Missense_Mutation_p.P8S	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	8					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						CTTCTCCATTCCTCTGAATGA	0.473																																																	0													95.0	78.0	84.0					19																	52327023		2203	4300	6503	SO:0001583	missense	2359				CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.22C>T	19.37:g.52327023C>T	ENSP00000341821:p.Pro8Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000339223.4	37	CCDS12841.1	.	.	.	.	.	.	.	.	.	.	.	9.051	0.992124	0.18966	.	.	ENSG00000187474	ENST00000339223	T	0.37584	1.19	2.32	1.16	0.20824	.	0.546723	0.16036	N	0.232646	T	0.16085	0.0387	N	0.08118	0	0.09310	N	0.999998	P	0.42649	0.786	B	0.37943	0.261	T	0.09530	-1.0670	10	0.51188	T	0.08	.	6.4715	0.22011	0.2891:0.7109:0.0:0.0	.	8	P25089	FPR3_HUMAN	S	8	ENSP00000341821:P8S	ENSP00000341821:P8S	P	+	1	0	FPR3	57018835	0.000000	0.05858	0.115000	0.21578	0.617000	0.37484	-0.697000	0.05098	0.222000	0.20900	0.467000	0.42956	CCT		0.473	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1		NM_002030	
GGNBP2	79893	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	34943427	34943427	+	Splice_Site	SNP	A	A	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr17:34943427A>C	ENST00000304718.4	+	13	1958	c.1642A>C	c.(1642-1644)Atc>Ctc	p.I548L		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	548					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GTGGTATCAGATCCAGAAGCT	0.403																																																	0													47.0	48.0	48.0					17																	34943427		2203	4300	6503	SO:0001630	splice_region_variant	79893			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1642-1A>C	17.37:g.34943427A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081359	0.55753	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.93	5.93	0.95920	.	0.114581	0.64402	D	0.000018	T	0.39759	0.1090	N	0.14661	0.345	0.80722	D	1	B	0.25312	0.123	B	0.18871	0.023	T	0.28618	-1.0038	8	.	.	.	-8.8045	14.954	0.71098	1.0:0.0:0.0:0.0	.	548	Q9H3C7	GGNB2_HUMAN	L	548	.	.	I	+	1	0	GGNBP2	32017540	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.030000	0.70903	2.271000	0.75665	0.459000	0.35465	ATC		0.403	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2		NM_024835	Missense_Mutation
HIF1A	3091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	62200986	62200986	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr14:62200986T>A	ENST00000337138.4	+	8	1276	c.1011T>A	c.(1009-1011)tgT>tgA	p.C337*	HIF1A_ENST00000539097.1_Nonsense_Mutation_p.C361*|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000394997.1_Nonsense_Mutation_p.C338*|HIF1A_ENST00000557538.1_Nonsense_Mutation_p.C278*|HIF1A_ENST00000323441.6_Nonsense_Mutation_p.C337*|HIF1A-AS2_ENST00000554254.1_lincRNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	337	Interaction with TSGA10. {ECO:0000250}.|PAC.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	GCATTGTATGTGTGAATTACG	0.353																																																	0													107.0	95.0	99.0					14																	62200986		2203	4300	6503	SO:0001587	stop_gained	3091			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1011T>A	14.37:g.62200986T>A	ENSP00000338018:p.Cys337*	Somatic		WXS	Illumina HiSeq	Phase_I	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Nonsense_Mutation	SNP	ENST00000337138.4	37	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	T	41	8.640802	0.98897	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	.	.	.	5.44	4.29	0.51040	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.445	0.50118	0.0:0.071:0.0:0.929	.	.	.	.	X	88;278;337;338;337;278;361	.	ENSP00000323326:C337X	C	+	3	2	HIF1A	61270739	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.486000	0.35530	1.001000	0.39076	0.455000	0.32223	TGT		0.353	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2		NM_001530	
HKR1	284459	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	37853658	37853658	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr19:37853658A>G	ENST00000324411.4	+	6	1230	c.961A>G	c.(961-963)Agg>Ggg	p.R321G	HKR1_ENST00000544914.1_Missense_Mutation_p.R48G|HKR1_ENST00000392153.3_Missense_Mutation_p.R302G|HKR1_ENST00000541583.2_Missense_Mutation_p.R260G|HKR1_ENST00000589392.1_Missense_Mutation_p.R303G|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000591471.1_Missense_Mutation_p.R48G	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	321					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACACATCAGAGGACACACTC	0.507																																																	0													105.0	101.0	102.0					19																	37853658		2203	4300	6503	SO:0001583	missense	284459			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.961A>G	19.37:g.37853658A>G	ENSP00000315505:p.Arg321Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	A	11.83	1.756951	0.31137	.	.	ENSG00000181666	ENST00000544914;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	3.05	3.05	0.35203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38931	0.1059	M	0.72353	2.195	0.80722	D	1	P;P;D;P	0.67145	0.687;0.875;0.996;0.608	B;B;P;B	0.57776	0.226;0.341;0.827;0.138	T	0.22800	-1.0206	9	0.56958	D	0.05	-15.9411	6.4516	0.21906	0.8779:0.0:0.1221:0.0	.	260;302;321;303	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	G	48;302;357;321;260	ENSP00000437774:R48G;ENSP00000375994:R302G;ENSP00000315505:R321G;ENSP00000438261:R260G	ENSP00000315505:R321G	R	+	1	2	HKR1	42545498	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	0.328000	0.19681	1.397000	0.46682	0.529000	0.55759	AGG		0.507	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1		NM_181786	
IQGAP2	10788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	75886273	75886273	+	Silent	SNP	A	A	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr5:75886273A>G	ENST00000274364.6	+	8	978	c.681A>G	c.(679-681)aaA>aaG	p.K227K	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	227					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CAGTTGAAAAAGGAATAGCAG	0.378																																																	0													109.0	110.0	110.0					5																	75886273		2203	4300	6503	SO:0001819	synonymous_variant	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.681A>G	5.37:g.75886273A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	ENST00000274364.6	37	CCDS34188.1																																																																																				0.378	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1		NM_006633	
ITIH4	3700	broad.mit.edu;hgsc.bcm.edu	37	3	52858241	52858241	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:52858241A>T	ENST00000266041.4	-	9	1232	c.1136T>A	c.(1135-1137)cTc>cAc	p.L379H	ITIH4_ENST00000434759.3_Missense_Mutation_p.L291H|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4-AS1_ENST00000478366.1_RNA|ITIH4_ENST00000467462.1_5'Flank|ITIH4_ENST00000485816.1_Missense_Mutation_p.L379H|ITIH4_ENST00000406595.1_Missense_Mutation_p.L379H|ITIH4_ENST00000346281.5_Missense_Mutation_p.L379H	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	379	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CAGGATGATGAGTGAGACACT	0.632																																																	0													85.0	78.0	80.0					3																	52858241		2203	4300	6503	SO:0001583	missense	3700			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.1136T>A	3.37:g.52858241A>T	ENSP00000266041:p.Leu379His	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	37	CCDS2865.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.424059	0.62733	.	.	ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421;ENST00000434759	D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92	4.78	4.78	0.61160	von Willebrand factor, type A (3);	0.309765	0.26377	N	0.024734	D	0.89677	0.6784	L	0.50847	1.595	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.998;1.0	D;D;D;D	0.77004	0.989;0.974;0.968;0.979	D	0.90709	0.4626	10	0.87932	D	0	-17.5675	13.9898	0.64359	1.0:0.0:0.0:0.0	.	379;379;379;379	E9PGN5;B7ZKJ8;Q14624;Q14624-2	.;.;ITIH4_HUMAN;.	H	379;379;379;379;367;291	ENSP00000266041:L379H;ENSP00000340520:L379H;ENSP00000417824:L379H;ENSP00000384425:L379H;ENSP00000440036:L291H	ENSP00000266041:L379H	L	-	2	0	ITIH4	52833281	0.995000	0.38212	0.892000	0.35008	0.275000	0.26752	5.841000	0.69409	1.795000	0.52594	0.379000	0.24179	CTC		0.632	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1		NM_002218	
JSRP1	126306	broad.mit.edu;hgsc.bcm.edu	37	19	2252973	2252973	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr19:2252973C>A	ENST00000300961.6	-	6	530	c.466G>T	c.(466-468)Gca>Tca	p.A156S	JSRP1_ENST00000586471.2_Missense_Mutation_p.A156S|MIR4321_ENST00000592276.1_RNA	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	156	Pro-rich.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCACACGTGCTTGGAGTGCT	0.692																																																	0													26.0	26.0	26.0					19																	2252973		2188	4297	6485	SO:0001583	missense	126306			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.466G>T	19.37:g.2252973C>A	ENSP00000300961:p.Ala156Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.400689	0.42613	.	.	ENSG00000167476	ENST00000300961	T	0.49720	0.77	2.61	0.345	0.16011	.	0.666680	0.12376	N	0.474366	T	0.33235	0.0856	N	0.24115	0.695	0.09310	N	1	P	0.52061	0.95	P	0.46339	0.513	T	0.14504	-1.0470	10	0.44086	T	0.13	-3.6725	5.4045	0.16314	0.0:0.6595:0.209:0.1315	.	156	Q96MG2	JSPR1_HUMAN	S	156	ENSP00000300961:A156S	ENSP00000300961:A156S	A	-	1	0	JSRP1	2203973	0.002000	0.14202	0.002000	0.10522	0.000000	0.00434	0.856000	0.27818	0.168000	0.19655	-0.305000	0.09177	GCA		0.692	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2		NM_144616	
KCTD19	146212	broad.mit.edu;ucsc.edu	37	16	67324887	67324887	+	Silent	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr16:67324887G>C	ENST00000304372.5	-	15	2623	c.2568C>G	c.(2566-2568)acC>acG	p.T856T		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	856					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TGATGTGCAGGGTCTGCCAGG	0.617																																																	0													44.0	48.0	46.0					16																	67324887		2036	4198	6234	SO:0001819	synonymous_variant	146212			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.2568C>G	16.37:g.67324887G>C		Somatic		WXS	Illumina GAIIx	Phase_I	B4DZ49|Q8N804	Silent	SNP	ENST00000304372.5	37	CCDS42179.1																																																																																				0.617	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1		XM_085367	
KIF4B	285643	hgsc.bcm.edu;ucsc.edu	37	5	154395061	154395061	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr5:154395061delA	ENST00000435029.4	+	1	1802	c.1642delA	c.(1642-1644)aacfs	p.N548fs		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	548					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCAGAACGACAACCAACTACA	0.418																																																	0													70.0	71.0	71.0					5																	154395061		2201	4300	6501	SO:0001589	frameshift_variant	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1642delA	5.37:g.154395061delA	ENSP00000387875:p.Asn548fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000435029.4	37	CCDS47324.1																																																																																				0.418	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			
KLF9	687	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	73028059	73028059	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr9:73028059C>A	ENST00000377126.2	-	1	1481	c.221G>T	c.(220-222)cGa>cTa	p.R74L		NM_001206.2	NP_001197.1	Q13886	KLF9_HUMAN	Kruppel-like factor 9	74					cellular response to thyroid hormone stimulus (GO:0097067)|embryo implantation (GO:0007566)|progesterone receptor signaling pathway (GO:0050847)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	9						CTGGATGGGTCGGTACTTGTT	0.592																																																	0													129.0	94.0	106.0					9																	73028059		2203	4300	6503	SO:0001583	missense	687			BC069431	CCDS6633.1	9q21.11	2013-01-08	2004-11-29	2004-12-01	ENSG00000119138	ENSG00000119138		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	1123	protein-coding gene	gene with protein product		602902	"""basic transcription element binding protein 1"""	BTEB1		1356762	Standard	NM_001206		Approved		uc004aht.3	Q13886	OTTHUMG00000019991	ENST00000377126.2:c.221G>T	9.37:g.73028059C>A	ENSP00000366330:p.Arg74Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R943|Q16196	Missense_Mutation	SNP	ENST00000377126.2	37	CCDS6633.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.054211	0.55218	.	.	ENSG00000119138	ENST00000377126	T	0.05199	3.48	4.85	4.85	0.62838	.	0.000000	0.51477	D	0.000094	T	0.05593	0.0147	N	0.19112	0.55	0.51233	D	0.999919	B	0.19817	0.039	B	0.15052	0.012	T	0.44467	-0.9326	10	0.26408	T	0.33	.	16.7593	0.85507	0.0:1.0:0.0:0.0	.	74	Q13886	KLF9_HUMAN	L	74	ENSP00000366330:R74L	ENSP00000366330:R74L	R	-	2	0	KLF9	72217879	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.829000	0.48128	2.250000	0.74265	0.557000	0.71058	CGA		0.592	KLF9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052602.1		NM_001206	
KRT85	3891	broad.mit.edu;hgsc.bcm.edu	37	12	52760791	52760791	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:52760791C>G	ENST00000257901.3	-	1	474	c.399G>C	c.(397-399)agG>agC	p.R133S	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	133	Coil 1A.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGCCGCGAACCTGCTGTTGA	0.617																																																	0													175.0	162.0	166.0					12																	52760791		2203	4300	6503	SO:0001583	missense	3891			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.399G>C	12.37:g.52760791C>G	ENSP00000257901:p.Arg133Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159475	0.38119	.	.	ENSG00000135443	ENST00000257901	D	0.94000	-3.33	4.61	3.72	0.42706	Filament (1);	0.447708	0.20939	N	0.082943	D	0.96018	0.8703	M	0.91038	3.17	0.80722	D	1	B	0.30482	0.281	P	0.47705	0.555	D	0.95847	0.8871	10	0.87932	D	0	.	8.0036	0.30313	0.0:0.7645:0.0:0.2355	.	133	P78386	KRT85_HUMAN	S	133	ENSP00000257901:R133S	ENSP00000257901:R133S	R	-	3	2	KRT85	51047058	1.000000	0.71417	0.998000	0.56505	0.324000	0.28378	1.600000	0.36762	1.303000	0.44873	-0.379000	0.06801	AGG		0.617	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1		NM_002283	
KRTAP5-3	387266	hgsc.bcm.edu	37	11	1629359	1629359	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr11:1629359delC	ENST00000399685.1	-	1	334	c.257delG	c.(256-258)ggcfs	p.G86fs		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	86	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		GGAGCCACAGCCCCCCTTGGA	0.677																																																	0													39.0	59.0	52.0					11																	1629359		2179	4285	6464	SO:0001589	frameshift_variant	387266			AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.257delG	11.37:g.1629359delC	ENSP00000382592:p.Gly86fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PL44|Q701N3	Frame_Shift_Del	DEL	ENST00000399685.1	37	CCDS41591.1																																																																																				0.677	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1			
L3MBTL4	91133	broad.mit.edu;hgsc.bcm.edu	37	18	6215828	6215828	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr18:6215828G>C	ENST00000284898.6	-	11	991	c.791C>G	c.(790-792)cCc>cGc	p.P264R	L3MBTL4_ENST00000400105.2_Missense_Mutation_p.P264R|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.P264R|L3MBTL4_ENST00000535782.1_Missense_Mutation_p.P77R|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.P264R	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	264					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TTCTGGATTGGGATAACCTGA	0.333																																					Esophageal Squamous(41;748 902 17366 28959 43175)												0													31.0	33.0	33.0					18																	6215828		2201	4300	6501	SO:0001583	missense	91133			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.791C>G	18.37:g.6215828G>C	ENSP00000284898:p.Pro264Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8MTL8|Q8IXS3	Missense_Mutation	SNP	ENST00000284898.6	37	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753413	0.49362	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.3	4.42	0.53409	.	0.167484	0.39020	N	0.001491	T	0.20414	0.0491	L	0.39566	1.225	0.39401	D	0.966595	B;B	0.33755	0.424;0.22	B;B	0.32149	0.141;0.106	T	0.06499	-1.0823	10	0.45353	T	0.12	.	10.0282	0.42085	0.094:0.0:0.906:0.0	.	264;264	Q8NA19;F8W9S8	LMBL4_HUMAN;.	R	264;264;264;77;264	ENSP00000382976:P264R;ENSP00000318543:P264R;ENSP00000284898:P264R;ENSP00000444774:P77R;ENSP00000382975:P264R	ENSP00000284898:P264R	P	-	2	0	L3MBTL4	6205828	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	2.814000	0.48010	1.372000	0.46190	0.655000	0.94253	CCC		0.333	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2		NM_173464	
LCN1	3933	hgsc.bcm.edu	37	9	138414015	138414016	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr9:138414015_138414016delCA	ENST00000263598.2	+	2	273_274	c.213_214delCA	c.(211-216)gtcaccfs	p.T72fs	LCN1_ENST00000371781.3_Frame_Shift_Del_p.T72fs	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	72					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		AAGCCAAGGTCACCATGCTGTG	0.634																																																	0																																										SO:0001589	frameshift_variant	3933				CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.213_214delCA	9.37:g.138414015_138414016delCA	ENSP00000263598:p.Thr72fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T8A1	Frame_Shift_Del	DEL	ENST00000263598.2	37	CCDS6991.1																																																																																				0.634	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1		NM_002297	
LMNA	4000	broad.mit.edu;hgsc.bcm.edu	37	1	156105094	156105094	+	Silent	SNP	C	C	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:156105094C>G	ENST00000368300.4	+	5	1139	c.927C>G	c.(925-927)ctC>ctG	p.L309L	LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000368299.3_Silent_p.L309L|LMNA_ENST00000448611.2_Silent_p.L197L|LMNA_ENST00000473598.2_Silent_p.L210L|LMNA_ENST00000361308.4_Silent_p.L309L|LMNA_ENST00000392353.3_Silent_p.L228L|LMNA_ENST00000368297.1_Silent_p.L228L|LMNA_ENST00000368301.2_Silent_p.L309L|LMNA_ENST00000347559.2_Silent_p.L309L	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	309	Coil 2.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TCAGCCAGCTCCAGAAGCAGG	0.667									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																																								0													24.0	27.0	26.0					1																	156105094		2203	4300	6503	SO:0001819	synonymous_variant	4000	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.927C>G	1.37:g.156105094C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	37	CCDS1129.1																																																																																				0.667	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2		NM_170707	
LPCAT4	254531	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	34651395	34651395	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr15:34651395G>A	ENST00000314891.6	-	14	1685	c.1508C>T	c.(1507-1509)tCa>tTa	p.S503L		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	503					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						GCCTGGGGATGAGGCATTTGG	0.607																																																	0													92.0	84.0	87.0					15																	34651395		2201	4298	6499	SO:0001583	missense	254531			AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1508C>T	15.37:g.34651395G>A	ENSP00000317300:p.Ser503Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	SNP	ENST00000314891.6	37	CCDS32191.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426006	0.43020	.	.	ENSG00000176454	ENST00000314891	T	0.80480	-1.38	5.66	2.76	0.32466	.	1.000160	0.08070	N	0.999669	T	0.70996	0.3288	L	0.36672	1.1	0.09310	N	1	B	0.17038	0.02	B	0.16722	0.016	T	0.53578	-0.8419	10	0.17369	T	0.5	-0.081	9.0023	0.36090	0.2393:0.0:0.7607:0.0	.	503	Q643R3	LPCT4_HUMAN	L	503	ENSP00000317300:S503L	ENSP00000317300:S503L	S	-	2	0	LPCAT4	32438687	0.719000	0.27986	0.436000	0.26797	0.965000	0.64279	1.432000	0.34936	0.759000	0.33084	0.491000	0.48974	TCA		0.607	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2		NM_153613	
LOC645752	645752	broad.mit.edu	37	15	78207580	78207580	+	lincRNA	SNP	G	G	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr15:78207580G>T	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA																							CAGTGGGGTTGTCATGGGGAG	0.577																																																	0																																												645752																															15.37:g.78207580G>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000565869.1	37																																																																																					0.577	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			
LRP1B	53353	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	141806678	141806678	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:141806678C>T	ENST00000389484.3	-	11	2637	c.1666G>A	c.(1666-1668)Gta>Ata	p.V556I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	556					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGAGGGTTTACCAGATTTTCT	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													195.0	190.0	192.0					2																	141806678		2203	4300	6503	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1666G>A	2.37:g.141806678C>T	ENSP00000374135:p.Val556Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618061	0.28801	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91011	-2.77	5.49	4.62	0.57501	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	U	0.000005	D	0.86916	0.6048	L	0.59436	1.845	0.48185	D	0.999604	P	0.43287	0.802	B	0.34931	0.192	D	0.85667	0.1292	10	0.36615	T	0.2	.	14.2715	0.66154	0.0:0.9283:0.0:0.0717	.	556	Q9NZR2	LRP1B_HUMAN	I	556;494	ENSP00000374135:V556I	ENSP00000374135:V556I	V	-	1	0	LRP1B	141523148	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	3.241000	0.51376	1.316000	0.45131	-0.253000	0.11424	GTA		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557	
LRRC1	55227	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	53787556	53787556	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr6:53787556A>C	ENST00000370888.1	+	14	1817	c.1540A>C	c.(1540-1542)Aat>Cat	p.N514H	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	514						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		AAACGAGGTCAATCATGCCAT	0.468																																																	0													235.0	241.0	239.0					6																	53787556		1986	4171	6157	SO:0001583	missense	55227			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1540A>C	6.37:g.53787556A>C	ENSP00000359925:p.Asn514His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	A	18.21	3.573276	0.65765	.	.	ENSG00000137269	ENST00000370888	T	0.55588	0.51	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.46249	0.1383	L	0.36672	1.1	0.80722	D	1	D	0.56521	0.976	P	0.53450	0.726	T	0.47209	-0.9135	10	0.48119	T	0.1	.	15.5324	0.75974	1.0:0.0:0.0:0.0	.	514	Q9BTT6	LRRC1_HUMAN	H	514	ENSP00000359925:N514H	ENSP00000359925:N514H	N	+	1	0	LRRC1	53895515	1.000000	0.71417	0.996000	0.52242	0.621000	0.37620	6.967000	0.76079	2.266000	0.75297	0.533000	0.62120	AAT		0.468	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2		NM_025168	
MAGI1	9223	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	65415803	65415805	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	ACA	ACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:65415803_65415805delACA	ENST00000497477.2	-	12	1556_1558	c.1557_1559delTGT	c.(1555-1560)attgta>ata	p.V520del	MAGI1_ENST00000330909.8_In_Frame_Del_p.V520del|MAGI1_ENST00000402939.2_In_Frame_Del_p.V520del|MAGI1_ENST00000483466.1_In_Frame_Del_p.V520del|MAGI1_ENST00000470990.1_5'UTR			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	520	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		ATTCACACTTACAATCACATCCC	0.448																																																	0																																										SO:0001651	inframe_deletion	9223			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1557_1559delTGT	3.37:g.65415803_65415805delACA	ENSP00000424369:p.Val520del	Somatic		WXS	Illumina HiSeq	Phase_I	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	In_Frame_Del	DEL	ENST00000497477.2	37																																																																																					0.448	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2		NM_004742	
MAMSTR	284358	broad.mit.edu	37	19	49216785	49216785	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr19:49216785C>T	ENST00000318083.6	-	10	1050	c.987G>A	c.(985-987)ctG>ctA	p.L329L	MAMSTR_ENST00000377367.3_Silent_p.L161L|MAMSTR_ENST00000356751.4_Silent_p.L226L|MAMSTR_ENST00000594582.1_Silent_p.L161L|MAMSTR_ENST00000419611.1_Silent_p.L226L			Q6ZN01	MASTR_HUMAN	MEF2 activating motif and SAP domain containing transcriptional regulator	329	Pro-rich.|Transcription activation. {ECO:0000250}.				positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(1)|ovary(1)	2						CAGGGAAGTCCAGGGGAATAG	0.602											OREG0025608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													15.0	18.0	17.0					19																	49216785		2188	4276	6464	SO:0001819	synonymous_variant	284358			AK093389	CCDS12730.1, CCDS46137.1, CCDS74415.1	19q13.33	2009-07-09			ENSG00000176909	ENSG00000176909			26689	protein-coding gene	gene with protein product	"""MEF2-activating SAP transcriptional regulator"""	610349				16818234	Standard	NM_182574		Approved	MASTR, FLJ36070	uc002pkg.2	Q6ZN01		ENST00000318083.6:c.987G>A	19.37:g.49216785C>T		Somatic	960	WXS	Illumina GAIIx	Phase_I	B7ZKX4|Q3KQU9|Q8N9Y3	Silent	SNP	ENST00000318083.6	37	CCDS46137.1																																																																																				0.602	MAMSTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466179.1		NM_182574	
MED4	29079	broad.mit.edu;hgsc.bcm.edu	37	13	48669206	48669206	+	Silent	SNP	C	C	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr13:48669206C>G	ENST00000258648.2	-	1	34	c.9G>C	c.(7-9)gcG>gcC	p.A3A	MED4_ENST00000378586.1_5'UTR	NM_014166.3	NP_054885.1	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4	3					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		CACTCGAAGACGCAGCCATTT	0.662											OREG0022406	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(38;399 1016 9170 13426 20145)												0													47.0	42.0	44.0					13																	48669206		2203	4300	6503	SO:0001819	synonymous_variant	29079			AF161475	CCDS9408.1, CCDS59241.1	13q14.12	2008-02-05	2007-07-30	2004-11-09	ENSG00000136146	ENSG00000136146			17903	protein-coding gene	gene with protein product		605718	"""vitamin D receptor interacting protein"", ""mediator of RNA polymerase II transcription, subunit 4 homolog (S. cerevisiae)"""	VDRIP		10235266, 11042152	Standard	NM_014166		Approved	HSPC126, DRIP36, TRAP36	uc001vby.2	Q9NPJ6	OTTHUMG00000016891	ENST00000258648.2:c.9G>C	13.37:g.48669206C>G		Somatic	956	WXS	Illumina HiSeq	Phase_I	B4DX67|Q53GB4|Q53H68|Q5T912|Q6FHC4|Q6IA79|Q9BS95|Q9NYR5	Silent	SNP	ENST00000258648.2	37	CCDS9408.1																																																																																				0.662	MED4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044863.1		NM_014166	
MON1A	84315	broad.mit.edu	37	3	49948281	49948281	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:49948281A>T	ENST00000417270.1	-	5	1367	c.674T>A	c.(673-675)cTg>cAg	p.L225Q	CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000296473.3_Missense_Mutation_p.L314Q|MON1A_ENST00000483022.1_5'Flank|MON1A_ENST00000455683.2_Missense_Mutation_p.L152Q			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	217										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CACTAGCACCAGCGGGCTCCG	0.607																																																	0													26.0	27.0	27.0					3																	49948281		2202	4297	6499	SO:0001583	missense	84315			AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.674T>A	3.37:g.49948281A>T	ENSP00000399613:p.Leu225Gln	Somatic		WXS	Illumina GAIIx	Phase_I	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Missense_Mutation	SNP	ENST00000417270.1	37		.	.	.	.	.	.	.	.	.	.	A	26.7	4.766179	0.90020	.	.	ENSG00000164077	ENST00000296473;ENST00000417270;ENST00000455683	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86368	0.5916	M	0.93241	3.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.90020	0.4127	8	.	.	.	-11.0199	15.8145	0.78589	1.0:0.0:0.0:0.0	.	55;152;217	Q86VX9-3;G5E9N1;Q86VX9	.;.;MON1A_HUMAN	Q	314;225;152	.	.	L	-	2	0	MON1A	49923285	1.000000	0.71417	0.997000	0.53966	0.866000	0.49608	9.297000	0.96120	2.144000	0.66660	0.454000	0.30748	CTG		0.607	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2		NM_032355	
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	G	C	rs369326402	byFrequency	TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:195505836G>C	ENST00000463781.3	-	2	13074	c.12615C>G	c.(12613-12615)caC>caG	p.H4205Q	MUC4_ENST00000475231.1_Missense_Mutation_p.H4205Q|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H4205Q(10)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597																																																	10	Substitution - Missense(10)	kidney(4)|prostate(3)|urinary_tract(2)|endometrium(1)											15.0	14.0	14.0					3																	195505836		687	1573	2260	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12615C>G	3.37:g.195505836G>C	ENSP00000417498:p.His4205Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.099	-1.155501	0.01686	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.55;1.53	.	.	.	.	.	.	.	.	T	0.17619	0.0423	N	0.19112	0.55	0.21950	N	0.999454	P	0.35208	0.49	B	0.40038	0.317	T	0.24368	-1.0162	6	.	.	.	.	.	.	.	.	4077	E7ESK3	.	Q	4205	ENSP00000417498:H4205Q;ENSP00000420243:H4205Q	.	H	-	3	2	MUC4	196990615	.	.	0.016000	0.15963	0.046000	0.14306	.	.	-0.849000	0.04158	0.074000	0.15403	CAC		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	broad.mit.edu	37	3	195508903	195508903	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:195508903G>A	ENST00000463781.3	-	2	10007	c.9548C>T	c.(9547-9549)aCg>aTg	p.T3183M	MUC4_ENST00000475231.1_Missense_Mutation_p.T3183M|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3183I(1)|p.T3183M(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGCGTGGTGTCACC	0.592																																																	2	Substitution - Missense(2)	NS(2)											3.0	2.0	2.0					3																	195508903		442	957	1399	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9548C>T	3.37:g.195508903G>A	ENSP00000417498:p.Thr3183Met	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	1.721	-0.496684	0.04291	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38887	1.11;1.23	.	.	.	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.55615	0.78	T	0.16247	-1.0409	7	.	.	.	.	4.5608	0.12160	0.0:0.4156:0.5844:0.0	.	3055	E7ESK3	.	M	3183	ENSP00000417498:T3183M;ENSP00000420243:T3183M	.	T	-	2	0	MUC4	196993682	0.001000	0.12720	0.010000	0.14722	0.010000	0.07245	0.267000	0.18552	0.073000	0.16731	0.074000	0.15403	ACG		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NAT8	9027	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	73868466	73868467	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:73868466_73868467insT	ENST00000272425.3	-	2	438_439	c.289_290insA	c.(289-291)attfs	p.I97fs		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						GGATTTGGTAATGTCAGACATG	0.54																																																	0																																										SO:0001589	frameshift_variant	9027			AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.290dupA	2.37:g.73868467_73868467dupT	ENSP00000272425:p.Ile97fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000272425.3	37	CCDS1926.1																																																																																				0.540	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1		NM_003960	
NIF3L1	60491	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	201761932	201761932	+	Missense_Mutation	SNP	C	C	A	rs368107216		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:201761932C>A	ENST00000409020.1	+	5	1154	c.860C>A	c.(859-861)aCc>aAc	p.T287N	NIF3L1_ENST00000359683.4_Missense_Mutation_p.T260N|NIF3L1_ENST00000409357.1_Missense_Mutation_p.T287N|NIF3L1_ENST00000416651.1_Missense_Mutation_p.T287N|NIF3L1_ENST00000409588.1_Intron|RNU6-762P_ENST00000517107.1_RNA			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	287					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						GTGGGGAGAACCTTAGGTAAA	0.403																																																	0								C	ASN/THR,ASN/THR,,ASN/THR	0,3784		0,0,1892	109.0	101.0	103.0		860,779,,779	5.1	1.0	2		103	1,8231		0,1,4115	no	missense,missense,intron,missense	NIF3L1	NM_001136039.2,NM_001142355.1,NM_001142356.1,NM_021824.3	65,65,,65	0,1,6007	AA,AC,CC		0.0121,0.0,0.0083	possibly-damaging,possibly-damaging,,possibly-damaging	287/378,260/351,,260/351	201761932	1,12015	1892	4116	6008	SO:0001583	missense	60491			AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.860C>A	2.37:g.201761932C>A	ENSP00000386394:p.Thr287Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	ENST00000409020.1	37	CCDS46485.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.93|19.93	3.918994|3.918994	0.73098|0.73098	0.0|0.0	1.21E-4|1.21E-4	ENSG00000196290|ENSG00000196290	ENST00000436412|ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357	.|T;T;T;T	.|0.40476	.|1.03;1.03;1.03;1.03	6.01|6.01	5.12|5.12	0.69794|0.69794	.|.	.|0.046740	.|0.85682	.|D	.|0.000000	T|T	0.51873|0.51873	0.1700|0.1700	L|L	0.52266|0.52266	1.64|1.64	0.58432|0.58432	D|D	0.999998|0.999998	.|D	.|0.59767	.|0.986	.|P	.|0.58172	.|0.834	T|T	0.45264|0.45264	-0.9273|-0.9273	5|10	.|0.12430	.|T	.|0.62	-9.805|-9.805	17.1257|17.1257	0.86713|0.86713	0.0:0.8733:0.1266:0.0|0.0:0.8733:0.1266:0.0	.|.	.|287	.|Q9GZT8	.|NIF3L_HUMAN	T|N	46|287;287;260;287	.|ENSP00000400787:T287N;ENSP00000386394:T287N;ENSP00000352711:T260N;ENSP00000387315:T287N	.|ENSP00000352711:T260N	P|T	+|+	1|2	0|0	NIF3L1|NIF3L1	201470177|201470177	0.997000|0.997000	0.39634|0.39634	0.997000|0.997000	0.53966|0.53966	0.969000|0.969000	0.65631|0.65631	3.740000|3.740000	0.55082|0.55082	1.508000|1.508000	0.48769|0.48769	0.655000|0.655000	0.94253|0.94253	CCT|ACC		0.403	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1		NM_021824	
NPC1L1	29881	broad.mit.edu;ucsc.edu	37	7	44561397	44561397	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr7:44561397T>G	ENST00000289547.4	-	12	2922	c.2867A>C	c.(2866-2868)gAc>gCc	p.D956A	NPC1L1_ENST00000381160.3_Missense_Mutation_p.D956A|NPC1L1_ENST00000546276.1_Missense_Mutation_p.D910A	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	956					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GTCAATGAAGTCATCCACCCA	0.607																																																	0													89.0	78.0	82.0					7																	44561397		2203	4300	6503	SO:0001583	missense	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2867A>C	7.37:g.44561397T>G	ENSP00000289547:p.Asp956Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.398250	0.83120	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.96802	-3.68;-3.68;-4.13	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.98495	0.9498	H	0.94925	3.6	0.54753	D	0.999985	D;D;D	0.89917	0.998;0.995;1.0	D;D;D	0.72338	0.927;0.962;0.977	D	0.99201	1.0873	10	0.52906	T	0.07	-47.4649	13.5245	0.61586	0.0:0.0:0.0:1.0	.	910;956;956	B7ZLE6;Q17RV5;D3DVK9	.;.;.	A	956;956;910	ENSP00000289547:D956A;ENSP00000370552:D956A;ENSP00000438033:D910A	ENSP00000289547:D956A	D	-	2	0	NPC1L1	44527922	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	6.892000	0.75644	2.090000	0.63153	0.533000	0.62120	GAC		0.607	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1		NM_013389	
NRK	203447	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	105132300	105132300	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chrX:105132300A>C	ENST00000243300.9	+	5	569	c.266A>C	c.(265-267)gAt>gCt	p.D89A	NRK_ENST00000536164.1_Missense_Mutation_p.D89A|NRK_ENST00000428173.2_Missense_Mutation_p.D89A	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	89	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GAGGAAGAGGATCTCAGGACT	0.423										HNSCC(51;0.14)																																							0													101.0	84.0	90.0					X																	105132300		1893	4097	5990	SO:0001583	missense	203447			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.266A>C	X.37:g.105132300A>C	ENSP00000434830:p.Asp89Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	A	15.52	2.858130	0.51376	.	.	ENSG00000123572	ENST00000243300;ENST00000428173;ENST00000536164	T;T;T	0.48522	1.89;1.89;0.81	4.95	4.95	0.65309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44902	D	0.000406	T	0.56499	0.1989	L	0.33668	1.02	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	T	0.60209	-0.7308	10	0.72032	D	0.01	.	12.6741	0.56884	1.0:0.0:0.0:0.0	.	89	Q7Z2Y5	NRK_HUMAN	A	89	ENSP00000434830:D89A;ENSP00000438378:D89A;ENSP00000438785:D89A	ENSP00000434830:D89A	D	+	2	0	NRK	105018956	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.147000	0.94646	1.741000	0.51731	0.481000	0.45027	GAT		0.423	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6		NM_198465	
NUP214	8021	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	134072982	134072982	+	Silent	SNP	C	C	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr9:134072982C>G	ENST00000359428.5	+	29	4245	c.4101C>G	c.(4099-4101)ggC>ggG	p.G1367G	NUP214_ENST00000483497.2_Silent_p.G193G|NUP214_ENST00000465486.2_3'UTR|NUP214_ENST00000411637.2_Silent_p.G1357G|NUP214_ENST00000451030.1_Silent_p.G1368G			P35658	NU214_HUMAN	nucleoporin 214kDa	1367	11 X 5 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		AGACGTCAGGCGTGCCCTCAG	0.542			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0													115.0	116.0	116.0					9																	134072982		2203	4300	6503	SO:0001819	synonymous_variant	8021			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4101C>G	9.37:g.134072982C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	ENST00000359428.5	37	CCDS6940.1																																																																																				0.542	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2		NM_005085	
OBSCN	84033	broad.mit.edu;hgsc.bcm.edu	37	1	228528242	228528242	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:228528242C>T	ENST00000422127.1	+	71	17495	c.17451C>T	c.(17449-17451)ccC>ccT	p.P5817P	OBSCN_ENST00000284548.11_Silent_p.P5817P|OBSCN_ENST00000570156.2_Silent_p.P6774P|OBSCN_ENST00000366709.4_Silent_p.P2936P|OBSCN_ENST00000366707.4_Silent_p.P3451P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5817	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGGGACCCCTCTCAGCCCC	0.657																																																	0													19.0	25.0	23.0					1																	228528242		1944	4122	6066	SO:0001819	synonymous_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17451C>T	1.37:g.228528242C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349068	0.24426	.	.	ENSG00000154358	ENST00000441106	.	.	.	5.47	4.55	0.56014	.	.	.	.	.	T	0.56470	0.1987	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54091	-0.8345	4	.	.	.	.	6.8572	0.24048	0.0:0.6662:0.1348:0.199	.	.	.	.	F	434	.	.	L	+	1	0	OBSCN	226594865	0.051000	0.20477	0.965000	0.40720	0.152000	0.21847	-0.348000	0.07740	1.310000	0.45006	0.561000	0.74099	CTC		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_052843	
PABPC1	26986	hgsc.bcm.edu	37	8	101719004	101719004	+	Missense_Mutation	SNP	G	G	A	rs62513924		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr8:101719004G>A	ENST00000318607.5	-	11	2605	c.1477C>T	c.(1477-1479)Cgt>Tgt	p.R493C	PABPC1_ENST00000519004.1_Missense_Mutation_p.R448C|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000522387.1_Missense_Mutation_p.R461C|PABPC1_ENST00000519596.1_Intron	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	493					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			GCTGCAGGACGTGGACCCATT	0.423																																																	0													47.0	45.0	46.0					8																	101719004		2203	4300	6503	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1477C>T	8.37:g.101719004G>A	ENSP00000313007:p.Arg493Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.729404	0.69074	.	.	ENSG00000070756	ENST00000318607;ENST00000519004;ENST00000522387;ENST00000517990;ENST00000522658	T;T;T;T	0.51574	1.52;1.45;2.5;0.7	5.3	5.3	0.74995	Polyadenylate-binding protein/Hyperplastic disc protein (1);	0.000000	0.64402	D	0.000004	T	0.51092	0.1654	L	0.49513	1.565	0.80722	D	1	B;B;B	0.34399	0.452;0.452;0.452	B;B;B	0.39531	0.027;0.302;0.302	T	0.53830	-0.8383	10	0.62326	D	0.03	.	19.3206	0.94237	0.0:0.0:1.0:0.0	rs62513924	461;493;493	E7ERJ7;B3KT93;P11940	.;.;PABP1_HUMAN	C	493;448;461;2;40	ENSP00000313007:R493C;ENSP00000429594:R448C;ENSP00000429395:R461C;ENSP00000428840:R40C	ENSP00000313007:R493C	R	-	1	0	PABPC1	101788180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.248000	0.78268	2.658000	0.90341	0.591000	0.81541	CGT		0.423	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52651513	52651513	+	Missense_Mutation	SNP	T	T	A	rs201580633		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:52651513T>A	ENST00000296302.7	-	14	1584	c.1583A>T	c.(1582-1584)aAt>aTt	p.N528I	PBRM1_ENST00000356770.4_Missense_Mutation_p.N496I|PBRM1_ENST00000337303.4_Missense_Mutation_p.N528I|PBRM1_ENST00000409057.1_Missense_Mutation_p.N528I|PBRM1_ENST00000409114.3_Missense_Mutation_p.N543I|PBRM1_ENST00000394830.3_Missense_Mutation_p.N528I|PBRM1_ENST00000409767.1_Missense_Mutation_p.N543I|PBRM1_ENST00000410007.1_Missense_Mutation_p.N528I			Q86U86	PB1_HUMAN	polybromo 1	528					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.N528fs*41(2)|p.N496fs*41(1)|p.N528I(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAGAACAACATTGAATAAGAT	0.348			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	4	Deletion - Frameshift(3)|Substitution - Missense(1)	kidney(3)|upper_aerodigestive_tract(1)											80.0	80.0	80.0					3																	52651513		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1583A>T	3.37:g.52651513T>A	ENSP00000296302:p.Asn528Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	20.6	4.021491	0.75275	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22	5.84	5.84	0.93424	Bromodomain (3);	0.150483	0.64402	D	0.000013	T	0.20251	0.0487	N	0.08118	0	0.58432	D	0.999999	D;P;D;D;P;P;D;P;P	0.63046	0.992;0.95;0.978;0.982;0.785;0.768;0.969;0.939;0.939	P;P;P;P;B;B;P;P;P	0.59703	0.862;0.805;0.743;0.815;0.289;0.44;0.693;0.743;0.679	T	0.18713	-1.0328	10	0.41790	T	0.15	-26.4922	16.2167	0.82231	0.0:0.0:0.0:1.0	.	528;528;528;528;543;543;528;496;528	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	I	496;528;528;528;528;528;543;543;528;487	ENSP00000349213:N496I;ENSP00000378307:N528I;ENSP00000296302:N528I;ENSP00000338302:N528I;ENSP00000386593:N528I;ENSP00000386529:N528I;ENSP00000386643:N543I;ENSP00000386601:N543I;ENSP00000387775:N528I;ENSP00000397662:N487I	ENSP00000296302:N528I	N	-	2	0	PBRM1	52626553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.578000	0.46051	2.231000	0.72958	0.533000	0.62120	AAT		0.348	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDHB6	56130	broad.mit.edu;hgsc.bcm.edu	37	5	140531176	140531176	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr5:140531176C>T	ENST00000231136.1	+	1	1338	c.1338C>T	c.(1336-1338)gtC>gtT	p.V446V	PCDHB6_ENST00000543635.1_Silent_p.V310V	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	446	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.		V -> A (in dbSNP:rs246707). {ECO:0000269|PubMed:14702039}.		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGACAACGTCCCCGCCTTCA	0.577																																																	0													105.0	109.0	107.0					5																	140531176		2203	4300	6503	SO:0001819	synonymous_variant	56130			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1338C>T	5.37:g.140531176C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																				0.577	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2		NM_018939	
PGBD1	84547	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	28269985	28269985	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr6:28269985C>T	ENST00000405948.2	+	7	2774	c.2354C>T	c.(2353-2355)gCt>gTt	p.A785V	PGBD1_ENST00000259883.3_Missense_Mutation_p.A785V	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	785						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						AACCCAGGTGCTTCTCTAGAC	0.418																																																	0													73.0	73.0	73.0					6																	28269985		2203	4300	6503	SO:0001583	missense	84547			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.2354C>T	6.37:g.28269985C>T	ENSP00000385213:p.Ala785Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	C	5.205	0.223378	0.09863	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01388	4.95;4.95	3.82	2.01	0.26516	.	0.746367	0.10442	U	0.674215	T	0.00412	0.0013	L	0.27053	0.805	0.09310	N	1	B	0.28439	0.212	B	0.27380	0.079	T	0.44952	-0.9294	10	0.33141	T	0.24	-22.9382	4.4377	0.11559	0.2222:0.6622:0.0:0.1156	.	785	Q96JS3	PGBD1_HUMAN	V	785	ENSP00000385213:A785V;ENSP00000259883:A785V	ENSP00000259883:A785V	A	+	2	0	PGBD1	28377964	0.000000	0.05858	0.003000	0.11579	0.423000	0.31445	0.581000	0.23819	0.566000	0.29273	-0.182000	0.12963	GCT		0.418	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			
PLEKHM1	9842	broad.mit.edu;hgsc.bcm.edu	37	17	43552739	43552739	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr17:43552739T>C	ENST00000430334.3	-	4	783	c.650A>G	c.(649-651)aAg>aGg	p.K217R	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.K128R	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	217					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					CAGAGATTCCTTCCGCTGTAG	0.532																																																	0													24.0	23.0	23.0					17																	43552739		2202	4286	6488	SO:0001583	missense	9842			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.650A>G	17.37:g.43552739T>C	ENSP00000389913:p.Lys217Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.816711	0.32145	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.68903	-0.35;-0.36	5.03	5.03	0.67393	.	0.111367	0.64402	D	0.000014	T	0.47764	0.1463	N	0.17082	0.46	0.37316	D	0.90933	B;P	0.44241	0.372;0.829	B;B	0.40901	0.133;0.343	T	0.53704	-0.8401	10	0.32370	T	0.25	.	8.3979	0.32568	0.0:0.0876:0.0:0.9124	.	128;217	F8W648;Q9Y4G2	.;PKHM1_HUMAN	R	217;166;128	ENSP00000389913:K217R;ENSP00000414352:K128R	ENSP00000414352:K128R	K	-	2	0	PLEKHM1	40908522	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	3.859000	0.55987	2.108000	0.64289	0.533000	0.62120	AAG		0.532	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1		NM_014798	
PNO1	56902	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	68401898	68401898	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:68401898T>G	ENST00000263657.2	+	7	814	c.723T>G	c.(721-723)atT>atG	p.I241M	RP11-474G23.1_ENST00000406334.3_Intron	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	241						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						ATGGCAATATTCGAGCTGTGG	0.408																																					NSCLC(83;642 1410 13044 32832 40058)												0													114.0	109.0	111.0					2																	68401898		2203	4300	6503	SO:0001583	missense	56902			AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.723T>G	2.37:g.68401898T>G	ENSP00000263657:p.Ile241Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6Q0|Q53G13|Q8WVB8	Missense_Mutation	SNP	ENST00000263657.2	37	CCDS1885.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416390	0.42918	.	.	ENSG00000115946	ENST00000263657	T	0.42513	0.97	5.93	-2.28	0.06826	.	0.047155	0.85682	D	0.000000	T	0.12987	0.0315	N	0.01242	-0.935	0.44899	D	0.997919	B	0.14805	0.011	B	0.19148	0.024	T	0.04495	-1.0947	10	0.42905	T	0.14	0.1491	7.1917	0.25828	0.1121:0.4163:0.0:0.4716	.	241	Q9NRX1	PNO1_HUMAN	M	241	ENSP00000263657:I241M	ENSP00000263657:I241M	I	+	3	3	PNO1	68255402	0.665000	0.27466	0.966000	0.40874	0.981000	0.71138	-0.120000	0.10660	-0.308000	0.08792	0.533000	0.62120	ATT		0.408	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251756.1		NM_020143	
PRKCB	5579	broad.mit.edu;ucsc.edu	37	16	24185869	24185869	+	Silent	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr16:24185869G>C	ENST00000321728.7	+	12	1537	c.1362G>C	c.(1360-1362)ctG>ctC	p.L454L	PRKCB_ENST00000303531.7_Silent_p.L454L	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	CCATCGGTCTGTTCTTCTTAC	0.428																																																	0													109.0	103.0	105.0					16																	24185869		2197	4300	6497	SO:0001819	synonymous_variant	5579			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1362G>C	16.37:g.24185869G>C		Somatic		WXS	Illumina GAIIx	Phase_I	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	ENST00000321728.7	37	CCDS10618.1																																																																																				0.428	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2		NM_212535	
PTGER3	5733	hgsc.bcm.edu;ucsc.edu	37	1	71328117	71328117	+	Intron	SNP	A	A	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:71328117A>T	ENST00000370931.3	-	5	1407				PTGER3_ENST00000370932.2_Intron|PTGER3_ENST00000460330.1_Intron|PTGER3_ENST00000351052.5_Intron	NM_198714.1	NP_942007.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)						cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TTGTGCTGAAAAAGTCCTGCT	0.418																																																	0													91.0	84.0	87.0					1																	71328117		2203	4299	6502	SO:0001627	intron_variant	5733			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000370931.3:c.1171-9575T>A	1.37:g.71328117A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	RNA	SNP	ENST00000370931.3	37	CCDS656.1																																																																																				0.418	PTGER3-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026077.1		NM_000957	
PZP	5858	hgsc.bcm.edu;ucsc.edu	37	12	9305470	9305471	+	Frame_Shift_Ins	INS	-	-	GTTT			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr12:9305470_9305471insGTTT	ENST00000261336.2	-	31	4098_4099	c.4070_4071insAAAC	c.(4069-4071)actfs	p.-1357fs	PZP_ENST00000381997.2_Frame_Shift_Ins_p.-1143fs	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein						female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GTCCATCGCAAGTTTGGGGCAC	0.441																																					Melanoma(125;1402 1695 4685 34487 38571)												0																																										SO:0001589	frameshift_variant	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.4067_4070dupAAAC	12.37:g.9305471_9305474dupGTTT	ENSP00000261336:p.Thr1357fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND27|Q15273|Q2NKL2|Q7M4N7	Frame_Shift_Ins	INS	ENST00000261336.2	37	CCDS8600.1																																																																																				0.441	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1		NM_002864	
RIPK1	8737	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	3081329	3081329	+	Silent	SNP	T	T	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr6:3081329T>C	ENST00000259808.4	+	4	736	c.438T>C	c.(436-438)gtT>gtC	p.V146V	RIPK1_ENST00000380409.2_Silent_p.V146V|RIPK1_ENST00000541791.1_Intron|RIPK1_ENST00000479389.1_3'UTR			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				ATATCCTTGTTGATAATGACT	0.368																																																	0													131.0	113.0	119.0					6																	3081329		2203	4300	6503	SO:0001819	synonymous_variant	8737			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.438T>C	6.37:g.3081329T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Silent	SNP	ENST00000259808.4	37	CCDS4482.1																																																																																				0.368	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039659.2		NM_003804	
SDK1	221935	hgsc.bcm.edu	37	7	4007044	4007045	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr7:4007044_4007045insC	ENST00000404826.2	+	10	1663_1664	c.1524_1525insC	c.(1525-1527)cccfs	p.P509fs	SDK1_ENST00000389531.3_Frame_Shift_Ins_p.P509fs	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	509	Ig-like C2-type 5.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGGCTCCCAAACCCGCCATCAC	0.55																																																	0																																										SO:0001589	frameshift_variant	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1527dupC	7.37:g.4007047_4007047dupC	ENSP00000385899:p.Pro509fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TEN9|Q8TEP5|Q96N44	Frame_Shift_Ins	INS	ENST00000404826.2	37	CCDS34590.1																																																																																				0.550	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1		NM_152744	
SETD5	55209	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	9486834	9486834	+	Silent	SNP	A	A	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:9486834A>C	ENST00000406341.1	+	11	1480	c.1290A>C	c.(1288-1290)ccA>ccC	p.P430P	SETD5_ENST00000402466.1_Silent_p.P332P|SETD5_ENST00000407969.1_Silent_p.P449P|SETD5_ENST00000402198.1_Silent_p.P430P|SETD5_ENST00000302463.6_Silent_p.P332P			Q9C0A6	SETD5_HUMAN	SET domain containing 5	430										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CACCTCCTCCAAGCCTACCCA	0.473																																																	0													78.0	80.0	79.0					3																	9486834		1954	4148	6102	SO:0001819	synonymous_variant	55209			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.1290A>C	3.37:g.9486834A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.513687	0.27123	.	.	ENSG00000168137	ENST00000399686	.	.	.	5.63	1.36	0.22044	.	.	.	.	.	T	0.54029	0.1833	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44832	-0.9302	4	.	.	.	-5.1411	6.845	0.23982	0.4891:0.2883:0.0:0.2226	.	.	.	.	Q	98	.	.	K	+	1	0	SETD5	9461834	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.974000	0.29436	0.436000	0.26393	0.533000	0.62120	AAG		0.473	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1		XM_371614	
SIGLEC1	6614	broad.mit.edu	37	20	3679976	3679976	+	Silent	SNP	G	G	A	rs369763140		TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr20:3679976G>A	ENST00000344754.4	-	7	1658	c.1659C>T	c.(1657-1659)caC>caT	p.H553H	SIGLEC1_ENST00000202578.4_Silent_p.H553H	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	553	Ig-like C2-type 5.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CGGGACCCTCGTGAAGCAGGG	0.677																																																	0								G		2,4402		0,2,2200	38.0	28.0	32.0		1659	-6.3	0.0	20		32	0,8596		0,0,4298	no	coding-synonymous	SIGLEC1	NM_023068.3		0,2,6498	AA,AG,GG		0.0,0.0454,0.0154		553/1710	3679976	2,12998	2202	4298	6500	SO:0001819	synonymous_variant	6614			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1659C>T	20.37:g.3679976G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1																																																																																				0.677	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2		NM_023068	
SIX4	51804	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	61190108	61190108	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr14:61190108A>T	ENST00000216513.4	-	1	744	c.685T>A	c.(685-687)Tgt>Agt	p.C229S		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	229					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		TCCTTGAAACAATACACCGTC	0.652																																																	0													35.0	34.0	34.0					14																	61190108		2203	4299	6502	SO:0001583	missense	51804			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.685T>A	14.37:g.61190108A>T	ENSP00000216513:p.Cys229Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	37	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	A	16.44	3.122936	0.56613	.	.	ENSG00000100625	ENST00000216513;ENST00000556952	D	0.91351	-2.83	3.63	3.63	0.41609	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.051197	0.85682	D	0.000000	D	0.91222	0.7234	L	0.28740	0.885	0.80722	D	1	D;B	0.89917	1.0;0.176	D;B	0.77557	0.99;0.359	D	0.91469	0.5195	10	0.59425	D	0.04	.	12.0754	0.53641	1.0:0.0:0.0:0.0	.	221;229	G3V2N2;Q9UIU6	.;SIX4_HUMAN	S	229;221	ENSP00000216513:C229S	ENSP00000216513:C229S	C	-	1	0	SIX4	60259861	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.824000	0.92023	1.508000	0.48769	0.528000	0.53228	TGT		0.652	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2			
SLC22A7	10864	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43267765	43267765	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr6:43267765C>T	ENST00000372585.5	+	5	883	c.788C>T	c.(787-789)gCt>gTt	p.A263V	SLC22A7_ENST00000372589.3_Missense_Mutation_p.A261V|SLC22A7_ENST00000372574.3_Missense_Mutation_p.A261V|SLC22A7_ENST00000487175.1_3'UTR	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	263					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CTTCTGCTAGCTGTCACCCTG	0.597																																																	0													193.0	146.0	162.0					6																	43267765		2203	4300	6503	SO:0001583	missense	10864			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.788C>T	6.37:g.43267765C>T	ENSP00000361666:p.Ala263Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474342	0.43942	.	.	ENSG00000137204	ENST00000451757;ENST00000372589;ENST00000372585;ENST00000372574	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.329111	0.31566	N	0.007438	T	0.37156	0.0993	L	0.33093	0.98	0.80722	D	1	B;B;B	0.34349	0.45;0.395;0.395	B;B;B	0.42653	0.394;0.273;0.382	T	0.21518	-1.0243	10	0.26408	T	0.33	.	16.4222	0.83766	0.0:1.0:0.0:0.0	.	263;261;261	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	V	135;261;263;261	ENSP00000416052:A135V;ENSP00000361670:A261V;ENSP00000361666:A263V;ENSP00000361655:A261V	ENSP00000361655:A261V	A	+	2	0	SLC22A7	43375743	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	2.825000	0.48096	2.604000	0.88044	0.563000	0.77884	GCT		0.597	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1			
SLC27A6	28965	broad.mit.edu;ucsc.edu	37	5	128321007	128321007	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr5:128321007C>T	ENST00000262462.4	+	2	1673	c.663C>T	c.(661-663)taC>taT	p.Y221Y	SLC27A6_ENST00000395266.1_Silent_p.Y221Y|SLC27A6_ENST00000506176.1_Silent_p.Y221Y			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	221					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CTTGTCTTTACATTTTTACCT	0.418																																																	0													109.0	91.0	97.0					5																	128321007		2203	4300	6503	SO:0001819	synonymous_variant	28965			AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.663C>T	5.37:g.128321007C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6IAM5|Q7Z6E6|Q86YF6	Silent	SNP	ENST00000262462.4	37	CCDS4145.1																																																																																				0.418	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1		NM_014031	
SLC23A1	9963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	138713670	138713670	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr5:138713670T>G	ENST00000348729.3	-	12	1493	c.1447A>C	c.(1447-1449)Aat>Cat	p.N483H	SLC23A1_ENST00000353963.3_Missense_Mutation_p.N487H|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	483					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	GCACCTGTATTGATGGCGCCA	0.562																																																	0													43.0	41.0	41.0					5																	138713670		2203	4300	6503	SO:0001583	missense	9963			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1447A>C	5.37:g.138713670T>G	ENSP00000302701:p.Asn483His	Somatic		WXS	Illumina HiSeq	Phase_I	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.465361	0.43839	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881	T;T	0.19250	2.17;2.16	5.83	3.45	0.39498	.	0.322792	0.41097	D	0.000955	T	0.14830	0.0358	L	0.38175	1.15	0.40789	D	0.983246	P;B	0.46395	0.877;0.009	B;B	0.41723	0.365;0.02	T	0.06752	-1.0809	10	0.37606	T	0.19	-10.7989	5.3382	0.15969	0.0:0.2154:0.1382:0.6465	.	483;487	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	H	487;483;144	ENSP00000302851:N487H;ENSP00000302701:N483H	ENSP00000343584:N144H	N	-	1	0	SLC23A1	138741569	0.998000	0.40836	1.000000	0.80357	0.940000	0.58332	0.435000	0.21510	0.479000	0.27511	0.459000	0.35465	AAT		0.562	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1		NM_152685	
STIL	6491	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	47717395	47717395	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:47717395A>T	ENST00000360380.3	-	18	3640	c.3277T>A	c.(3277-3279)Ttc>Atc	p.F1093I	STIL_ENST00000371877.3_Missense_Mutation_p.F1094I|STIL_ENST00000396221.2_Missense_Mutation_p.F1076I|STIL_ENST00000337817.5_Missense_Mutation_p.F1093I|STIL_ENST00000243182.6_Missense_Mutation_p.F1093I	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	1093					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AGAAGGCTGAATGGGTCACAA	0.363																																																	0													154.0	159.0	158.0					1																	47717395		2203	4300	6503	SO:0001583	missense	6491			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.3277T>A	1.37:g.47717395A>T	ENSP00000353544:p.Phe1093Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	A	9.515	1.106893	0.20714	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182	T;T;T;T;T	0.18016	2.25;2.25;2.25;2.24;2.25	5.58	3.29	0.37713	.	0.493832	0.20897	N	0.083719	T	0.09730	0.0239	N	0.16478	0.41	0.21553	N	0.999647	P;P;P	0.45531	0.86;0.86;0.86	B;B;B	0.40410	0.328;0.328;0.328	T	0.18935	-1.0321	10	0.22706	T	0.39	-1.7413	9.442	0.38675	0.8568:0.0:0.1432:0.0	.	1076;1094;1093	E9PSF2;Q15468-2;Q15468	.;.;STIL_HUMAN	I	1093;1093;1094;1076;1093	ENSP00000353544:F1093I;ENSP00000337367:F1093I;ENSP00000360944:F1094I;ENSP00000379523:F1076I;ENSP00000243182:F1093I	ENSP00000243182:F1093I	F	-	1	0	STIL	47489982	1.000000	0.71417	0.866000	0.34008	0.926000	0.56050	2.312000	0.43726	0.951000	0.37770	0.377000	0.23210	TTC		0.363	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2		NM_003035	
TDRD9	122402	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	104441754	104441754	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr14:104441754G>C	ENST00000409874.4	+	7	923	c.875G>C	c.(874-876)tGt>tCt	p.C292S	TDRD9_ENST00000339063.5_Missense_Mutation_p.C292S	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	292	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ACCATCAGCTGTAAAGAGTTT	0.373																																																	0													141.0	128.0	132.0					14																	104441754		2203	4300	6503	SO:0001583	missense	122402			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.875G>C	14.37:g.104441754G>C	ENSP00000387303:p.Cys292Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	37	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344234	0.41498	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.26067	1.76;1.76	5.49	4.59	0.56863	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.080663	0.52532	D	0.000073	T	0.08358	0.0208	N	0.01048	-1.04	0.80722	D	1	P;B	0.34615	0.459;0.027	B;B	0.34824	0.19;0.089	T	0.33445	-0.9868	10	0.17369	T	0.5	.	10.7911	0.46434	0.0722:0.1324:0.7954:0.0	.	292;292	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	S	292	ENSP00000387303:C292S;ENSP00000343545:C292S	ENSP00000343545:C292S	C	+	2	0	TDRD9	103511507	1.000000	0.71417	0.934000	0.37439	0.963000	0.63663	6.633000	0.74286	2.580000	0.87095	0.650000	0.86243	TGT		0.373	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3		NM_153046	
TEX15	56154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	30702516	30702516	+	Missense_Mutation	SNP	C	C	T	rs148542296	byFrequency	TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr8:30702516C>T	ENST00000256246.2	-	1	4092	c.4018G>A	c.(4018-4020)Gct>Act	p.A1340T		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1340					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.A1340T(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTCACTGCAGCGGCTGATAAC	0.388																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						C	THR/ALA	0,4406		0,0,2203	112.0	125.0	121.0		4018	-12.1	0.0	8	dbSNP_134	121	1,8599		0,1,4299	no	missense	TEX15	NM_031271.3	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1340/2790	30702516	1,13005	2203	4300	6503	SO:0001583	missense	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4018G>A	8.37:g.30702516C>T	ENSP00000256246:p.Ala1340Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	2.207	-0.381585	0.05000	0.0	1.16E-4	ENSG00000133863	ENST00000256246	T	0.22336	1.96	6.07	-12.1	0.00011	.	1.665860	0.02792	N	0.122133	T	0.06917	0.0176	N	0.01048	-1.04	0.09310	N	1	B	0.15141	0.012	B	0.06405	0.002	T	0.48433	-0.9036	10	0.87932	D	0	.	13.3428	0.60555	0.0871:0.6824:0.0879:0.1426	.	1340	Q9BXT5	TEX15_HUMAN	T	1340	ENSP00000256246:A1340T	ENSP00000256246:A1340T	A	-	1	0	TEX15	30822058	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.978000	0.03778	-3.011000	0.00272	-3.029000	0.00073	GCT		0.388	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			
TGFB2	7042	broad.mit.edu;hgsc.bcm.edu	37	1	218609363	218609363	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:218609363C>T	ENST00000366930.4	+	5	1273	c.806C>T	c.(805-807)tCc>tTc	p.S269F	TGFB2_ENST00000366929.4_Missense_Mutation_p.S297F|TGFB2_ENST00000479322.1_3'UTR	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	269					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		ACTATAAAGTCCACTAGGAAA	0.423																																																	0													82.0	82.0	82.0					1																	218609363		2203	4300	6503	SO:0001583	missense	7042			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.806C>T	1.37:g.218609363C>T	ENSP00000355897:p.Ser269Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	37	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768508	0.69878	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.74842	-0.76;-0.88	6.17	6.17	0.99709	.	0.266020	0.40469	N	0.001082	T	0.75722	0.3888	L	0.39898	1.24	0.39298	D	0.964855	D;B	0.53885	0.963;0.001	P;B	0.53809	0.735;0.003	T	0.68119	-0.5493	10	0.07325	T	0.83	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	297;269	P61812-2;P61812	.;TGFB2_HUMAN	F	269;297	ENSP00000355897:S269F;ENSP00000355896:S297F	ENSP00000355896:S297F	S	+	2	0	TGFB2	216675986	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.975000	0.56859	2.941000	0.99782	0.655000	0.94253	TCC		0.423	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2		NM_003238	
TMC2	117532	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	2616597	2616597	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr20:2616597G>T	ENST00000358864.1	+	18	2347	c.2332G>T	c.(2332-2334)Gtt>Ttt	p.V778F		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	778					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CCTGAACTCAGTTTCCAAAAG	0.493																																																	0													110.0	94.0	99.0					20																	2616597		2203	4300	6503	SO:0001583	missense	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2332G>T	20.37:g.2616597G>T	ENSP00000351732:p.Val778Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250915	0.80135	.	.	ENSG00000149488	ENST00000358864	T	0.68903	-0.36	5.53	5.53	0.82687	.	0.121832	0.53938	D	0.000044	T	0.79499	0.4456	M	0.73217	2.22	0.50313	D	0.999865	D	0.63046	0.992	D	0.64237	0.923	T	0.80951	-0.1153	10	0.72032	D	0.01	-14.8062	15.3352	0.74247	0.0:0.0:1.0:0.0	.	778	Q8TDI7	TMC2_HUMAN	F	778	ENSP00000351732:V778F	ENSP00000351732:V778F	V	+	1	0	TMC2	2564597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.484000	0.60271	2.766000	0.95052	0.655000	0.94253	GTT		0.493	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2			
TMEM129	92305	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	1719303	1719303	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:1719303G>C	ENST00000382936.3	-	3	1273	c.780C>G	c.(778-780)ttC>ttG	p.F260L	TMEM129_ENST00000536901.1_Missense_Mutation_p.F260L|TMEM129_ENST00000303277.2_Intron	NM_001127266.1	NP_001120738.1	A0AVI4	TM129_HUMAN	transmembrane protein 129, E3 ubiquitin protein ligase	260					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(23;0.00765)			ATGTCTCCAGGAACAGGTCGC	0.672																																																	0													59.0	68.0	65.0					4																	1719303		692	1591	2283	SO:0001583	missense	92305			BC009331	CCDS3351.1, CCDS46998.1	4p16.3	2014-07-25	2014-07-25		ENSG00000168936	ENSG00000168936			25137	protein-coding gene	gene with protein product		615975	"""transmembrane protein 129"""			24807418, 25030448	Standard	NM_138385		Approved	D4S2561E	uc003gdn.3	A0AVI4	OTTHUMG00000121150	ENST00000382936.3:c.780C>G	4.37:g.1719303G>C	ENSP00000372394:p.Phe260Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NH49|A6NI98|D3DVP8	Missense_Mutation	SNP	ENST00000382936.3	37	CCDS46998.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701961	0.68501	.	.	ENSG00000168936	ENST00000382936;ENST00000536901	T;T	0.46451	0.87;0.87	4.39	2.17	0.27698	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.88775	2.98	0.53688	D	0.999979	D	0.71674	0.998	D	0.68943	0.961	T	0.66760	-0.5842	10	0.87932	D	0	-13.9893	8.3122	0.32077	0.315:0.0:0.685:0.0	.	260	A0AVI4	TM129_HUMAN	L	260	ENSP00000372394:F260L;ENSP00000441812:F260L	ENSP00000372394:F260L	F	-	3	2	TMEM129	1689101	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	1.227000	0.32576	0.809000	0.34255	0.555000	0.69702	TTC		0.672	TMEM129-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350724.1		NM_138385	
TNRC6A	27327	hgsc.bcm.edu	37	16	24805924	24805925	+	In_Frame_Ins	INS	-	-	CCA			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr16:24805924_24805925insCCA	ENST00000395799.3	+	8	3541_3542	c.3412_3413insCCA	c.(3412-3414)ccc>cCCAcc	p.1139_1140insT	TNRC6A_ENST00000315183.7_In_Frame_Ins_p.1139_1140insT	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1139	Sufficient for interaction with AGO1 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TGGAAATCGCCCCACTGGCTGG	0.411																																																	0																																										SO:0001652	inframe_insertion	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3413_3415dupCCA	16.37:g.24805925_24805927dupCCA	ENSP00000379144:p.Thr1139_Thr1139dup	Somatic		WXS	Illumina HiSeq	Phase_I	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	In_Frame_Ins	INS	ENST00000395799.3	37	CCDS10624.2																																																																																				0.411	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1		NM_020847	
TRA2A	29896	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	23547080	23547080	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr7:23547080C>T	ENST00000297071.4	-	5	816	c.600G>A	c.(598-600)gcG>gcA	p.A200A	TRA2A_ENST00000474586.1_5'UTR|TRA2A_ENST00000538367.1_Silent_p.A99A|TRA2A_ENST00000392502.4_Silent_p.A99A	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	200	Linker.				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						TTGGTGTGTGCGCTCTCTTGG	0.418																																					Pancreas(121;2137 2973 46590)												0													256.0	242.0	247.0					7																	23547080		2203	4300	6503	SO:0001819	synonymous_variant	29896			U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.600G>A	7.37:g.23547080C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DUA9	Silent	SNP	ENST00000297071.4	37	CCDS5383.1																																																																																				0.418	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1		NM_013293	
TRAM1L1	133022	broad.mit.edu;ucsc.edu	37	4	118005673	118005673	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:118005673C>A	ENST00000310754.4	-	1	1063	c.877G>T	c.(877-879)Gtg>Ttg	p.V293L		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	293	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						GCTGCCAACACATTTACATTT	0.458																																																	0													104.0	93.0	97.0					4																	118005673		2203	4300	6503	SO:0001583	missense	133022			AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.877G>T	4.37:g.118005673C>A	ENSP00000309402:p.Val293Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N2L7	Missense_Mutation	SNP	ENST00000310754.4	37	CCDS3707.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265934	0.40095	.	.	ENSG00000174599	ENST00000310754	D	0.83075	-1.68	3.74	3.74	0.42951	TRAM/LAG1/CLN8 homology domain (3);	0.296909	0.32190	N	0.006453	T	0.79667	0.4485	L	0.54323	1.7	0.33557	D	0.596879	P	0.39376	0.67	B	0.43194	0.411	D	0.85008	0.0904	10	0.72032	D	0.01	-25.7866	7.3349	0.26605	0.0:0.8838:0.0:0.1161	.	293	Q8N609	TR1L1_HUMAN	L	293	ENSP00000309402:V293L	ENSP00000309402:V293L	V	-	1	0	TRAM1L1	118225121	0.101000	0.21875	0.954000	0.39281	0.561000	0.35649	0.538000	0.23160	2.385000	0.81259	0.650000	0.86243	GTG		0.458	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1		NM_152402	
Unknown	0	broad.mit.edu	37	1	13634735	13634735	+	IGR	SNP	C	C	T	rs200269882	byFrequency	TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr1:13634735C>T								PRAMEF21 (107792 upstream) : PRAMEF15 (7237 downstream)																							CTCAAGAACCCCTTGGGGGCC	0.502													.|||	132	0.0263578	0.0219	0.0375	5008	,	,		11167	0.0099		0.0388	False		,,,				2504	0.0286																0																																										SO:0001628	intergenic_variant	0																															1.37:g.13634735C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.502									
USP41	373856	broad.mit.edu	37	22	20718476	20718477	+	Splice_Site	INS	-	-	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr22:20718476_20718477insA	ENST00000454608.2	-	11	1021_1022	c.1022_1023insT	c.(1021-1023)ttg>ttTg	p.L341fs	USP41_ENST00000486536.2_5'UTR			Q3LFD5	UBP41_HUMAN	ubiquitin specific peptidase 41	341	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(1)|kidney(1)|lung(2)|skin(1)	5						TGTTTCTTACCAAGCAAATATT	0.505																																																	0																																										SO:0001630	splice_region_variant	0			AJ586979		22q11.22	2011-01-31	2005-08-08		ENSG00000161133	ENSG00000161133		"""Ubiquitin-specific peptidases"""	20070	protein-coding gene	gene with protein product			"""ubiquitin specific protease 41"""			12838346	Standard	XM_006710116		Approved		uc011ahq.1	Q3LFD5	OTTHUMG00000151317	ENST00000454608.2:c.1023+1->T	22.37:g.20718478_20718478dupA		Somatic		WXS	Illumina GAIIx	Phase_I	A8MXD0|Q70BM7	Frame_Shift_Ins	INS	ENST00000454608.2	37																																																																																					0.505	USP41-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			XM_036729	Frame_Shift_Ins
USP37	57695	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	219423354	219423354	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr2:219423354C>A	ENST00000258399.3	-	4	435	c.23G>T	c.(22-24)gGt>gTt	p.G8V	USP37_ENST00000415516.1_Intron|USP37_ENST00000454775.1_Missense_Mutation_p.G8V|USP37_ENST00000418019.1_Missense_Mutation_p.G8V|USP37_ENST00000338465.5_Missense_Mutation_p.G8V	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	8					G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TCTGATAGGACCATGTATCTT	0.343																																																	0													142.0	152.0	149.0					2																	219423354		2203	4299	6502	SO:0001583	missense	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.23G>T	2.37:g.219423354C>A	ENSP00000258399:p.Gly8Val	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	ENST00000258399.3	37	CCDS2418.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555395	0.86231	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000418019;ENST00000338465	T;T;T;T	0.62498	0.06;0.06;0.06;0.02	6.06	6.06	0.98353	.	0.047393	0.85682	D	0.000000	T	0.80423	0.4620	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80317	-0.1433	10	0.87932	D	0	-19.8214	20.6397	0.99537	0.0:1.0:0.0:0.0	.	8;8	Q86W68;Q86T82	.;UBP37_HUMAN	V	8	ENSP00000258399:G8V;ENSP00000393662:G8V;ENSP00000396585:G8V;ENSP00000345043:G8V	ENSP00000258399:G8V	G	-	2	0	USP37	219131598	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.296000	0.65698	2.880000	0.98712	0.650000	0.86243	GGT		0.343	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3		NM_020935	
VHL	7428	broad.mit.edu;hgsc.bcm.edu	37	3	10188296	10188297	+	Frame_Shift_Ins	INS	-	-	TTTT			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:10188296_10188297insTTTT	ENST00000256474.2	+	2	1279_1280	c.439_440insTTTT	c.(439-441)attfs	p.-148fs	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase						cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.I147fs*12(4)|p.A149fs*25(4)|p.F148fs*11(4)|p.I147fs*27(2)|p.I147fs*13(1)|p.I147fs*25(1)|p.I147fs*11(1)|p.I147fs*26(1)|p.I147_F148del(1)|p.I147fs*10(1)|p.F148fs*25(1)|p.P146fs*23(1)|p.G144fs*19(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGGACAGCCTATTTTTGCCAAT	0.416		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	23	Deletion - Frameshift(15)|Insertion - Frameshift(6)|Complex - frameshift(1)|Deletion - In frame(1)	kidney(23)	GRCh37	CM982009	VHL	M																																				SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.440_443dupTTTT	3.37:g.10188297_10188300dupTTTT	ENSP00000256474:p.Phe148fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Ins	INS	ENST00000256474.2	37	CCDS2597.1																																																																																				0.416	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS18	57617	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	41188258	41188258	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr15:41188258G>C	ENST00000220509.5	+	2	553	c.214G>C	c.(214-216)Ggc>Cgc	p.G72R	VPS18_ENST00000558474.1_Missense_Mutation_p.G72R	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	72					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CATGAGCCTGGGCAAGGATAC	0.517																																																	0													167.0	148.0	154.0					15																	41188258		2203	4300	6503	SO:0001583	missense	57617			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.214G>C	15.37:g.41188258G>C	ENSP00000220509:p.Gly72Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	ENST00000220509.5	37	CCDS10069.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918915	0.92249	.	.	ENSG00000104142	ENST00000220509	T	0.40756	1.02	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.36248	0.0960	L	0.49350	1.555	0.80722	D	1	B	0.28998	0.23	B	0.20955	0.032	T	0.20571	-1.0271	10	0.10636	T	0.68	-34.954	18.4309	0.90624	0.0:0.0:1.0:0.0	.	72	Q9P253	VPS18_HUMAN	R	72	ENSP00000220509:G72R	ENSP00000220509:G72R	G	+	1	0	VPS18	38975550	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.360000	0.97119	2.584000	0.87258	0.557000	0.71058	GGC		0.517	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252443.2			
WTAP	9589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	160176079	160176079	+	Silent	SNP	C	C	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr6:160176079C>A	ENST00000358372.4	+	8	2384	c.627C>A	c.(625-627)atC>atA	p.I209I	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	209					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		ACTTCATCATCCAGCTTGATG	0.448																																																	0													51.0	49.0	50.0					6																	160176079		2203	4300	6503	SO:0001819	synonymous_variant	9589			AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.627C>A	6.37:g.160176079C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Silent	SNP	ENST00000358372.4	37	CCDS5266.1																																																																																				0.448	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042905.1		NM_152857	
XKR4	114786	broad.mit.edu	37	8	56015738	56015738	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr8:56015738C>T	ENST00000327381.6	+	1	790	c.690C>T	c.(688-690)ggC>ggT	p.G230G		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	230						integral component of membrane (GO:0016021)		p.G230G(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			CCAACAGCGGCAGCAACAGCA	0.647																																																	1	Substitution - coding silent(1)	pancreas(1)											40.0	43.0	42.0					8																	56015738		2203	4297	6500	SO:0001819	synonymous_variant	114786			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.690C>T	8.37:g.56015738C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q96PZ8	Silent	SNP	ENST00000327381.6	37	CCDS34893.1																																																																																				0.647	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2		NM_052898	
YEATS2	55689	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	183490251	183490251	+	Silent	SNP	G	G	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr3:183490251G>C	ENST00000305135.5	+	16	2301	c.2106G>C	c.(2104-2106)gtG>gtC	p.V702V		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	702					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AAGCAATTGTGAGTGGAGGTG	0.547																																																	0													99.0	97.0	98.0					3																	183490251		2004	4171	6175	SO:0001819	synonymous_variant	55689			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2106G>C	3.37:g.183490251G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2B9|D3DNS9|Q641P6|Q9NW96	Silent	SNP	ENST00000305135.5	37	CCDS43175.1																																																																																				0.547	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2		NM_018023	
ZNF274	10782	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	58695360	58695360	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr19:58695360T>A	ENST00000326804.4	+	2	487	c.28T>A	c.(28-30)Tcc>Acc	p.S10T	ZNF274_ENST00000345813.3_Missense_Mutation_p.S10T|ZNF274_ENST00000424679.2_Intron|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		GACGGCCTGGTCCTGTGTGAG	0.572																																																	0													62.0	65.0	64.0					19																	58695360		1998	4172	6170	SO:0001583	missense	10782			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.28T>A	19.37:g.58695360T>A	ENSP00000321209:p.Ser10Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	ENST00000326804.4	37		.	.	.	.	.	.	.	.	.	.	T	9.196	1.027290	0.19512	.	.	ENSG00000171606	ENST00000326804;ENST00000345813	T;T	0.00816	5.66;5.66	3.56	1.38	0.22167	Krueppel-associated box (1);	.	.	.	.	T	0.00580	0.0019	L	0.28344	0.845	0.25260	N	0.989601	B;P	0.37466	0.318;0.596	B;B	0.29785	0.107;0.067	T	0.30909	-0.9962	9	0.02654	T	1	-3.4608	5.0945	0.14725	0.0:0.2672:0.0:0.7328	.	10;10	Q96GC6-2;Q96GC6	.;ZN274_HUMAN	T	10	ENSP00000321209:S10T;ENSP00000321187:S10T	ENSP00000321209:S10T	S	+	1	0	ZNF274	63387172	0.187000	0.23238	0.236000	0.24074	0.975000	0.68041	0.094000	0.15107	0.222000	0.20900	0.460000	0.39030	TCC		0.572	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_133502	
ZNF521	25925	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	22806642	22806642	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr18:22806642A>C	ENST00000361524.3	-	4	1388	c.1240T>G	c.(1240-1242)Tta>Gta	p.L414V	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.L194V|ZNF521_ENST00000538137.2_Missense_Mutation_p.L414V	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	414					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTTGAAAATAATTGTTTGTTG	0.453			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													91.0	90.0	90.0					18																	22806642		2203	4300	6503	SO:0001583	missense	25925			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1240T>G	18.37:g.22806642A>C	ENSP00000354794:p.Leu414Val	Somatic		WXS	Illumina HiSeq	Phase_I	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	A	5.455	0.269016	0.10349	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.08282	3.11;3.18	6.16	-3.3	0.05003	Zinc finger, C2H2-like (1);	0.074355	0.49916	D	0.000138	T	0.03220	0.0094	N	0.08118	0	0.24387	N	0.994763	B	0.09022	0.002	B	0.10450	0.005	T	0.41998	-0.9477	10	0.20046	T	0.44	-12.8534	9.1553	0.36990	0.4318:0.1144:0.4538:0.0	.	414	Q96K83	ZN521_HUMAN	V	414;448;414	ENSP00000354794:L414V;ENSP00000382352:L414V	ENSP00000354794:L414V	L	-	1	2	ZNF521	21060640	0.978000	0.34361	0.216000	0.23742	0.909000	0.53808	0.565000	0.23578	-0.549000	0.06191	-0.263000	0.10527	TTA		0.453	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2		NM_015461	
ZNF532	55205	broad.mit.edu	37	18	56601783	56601783	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr18:56601783C>T	ENST00000336078.4	+	5	3241	c.2465C>T	c.(2464-2466)tCg>tTg	p.S822L	ZNF532_ENST00000591808.1_Missense_Mutation_p.S822L|ZNF532_ENST00000591083.1_Missense_Mutation_p.S822L|ZNF532_ENST00000591230.1_Missense_Mutation_p.S822L|ZNF532_ENST00000589288.1_Missense_Mutation_p.S822L	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	822			S -> L (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S822L(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						ATCTGCAGGTCGGTGCACTTC	0.502																																																	2	Substitution - Missense(2)	breast(2)											141.0	120.0	127.0					18																	56601783		2203	4300	6503	SO:0001583	missense	55205			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2465C>T	18.37:g.56601783C>T	ENSP00000338217:p.Ser822Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	C	33	5.268072	0.95429	.	.	ENSG00000074657	ENST00000336078	T	0.27890	1.64	5.32	5.32	0.75619	Zinc finger, C2H2-like (1);	0.057576	0.64402	N	0.000001	T	0.53302	0.1788	L	0.56124	1.755	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.51896	-0.8647	10	0.59425	D	0.04	-5.4258	18.9741	0.92728	0.0:1.0:0.0:0.0	.	822	Q9HCE3	ZN532_HUMAN	L	822	ENSP00000338217:S822L	ENSP00000338217:S822L	S	+	2	0	ZNF532	54752763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.774000	0.62339	2.644000	0.89710	0.561000	0.74099	TCG		0.502	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1		NM_018181	
ZNF827	152485	broad.mit.edu	37	4	146824030	146824030	+	Silent	SNP	C	C	T			TCGA-CJ-4634-01A-02D-1386-10	TCGA-CJ-4634-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59f18fac-c6f8-4cbf-9259-8c22d6ba0c58	2edd8e13-514b-40ec-ace4-86e733c0f94e	g.chr4:146824030C>T	ENST00000508784.1	-	2	608	c.381G>A	c.(379-381)ctG>ctA	p.L127L	ZNF827_ENST00000379448.4_Silent_p.L127L|ZNF827_ENST00000513320.1_Intron			Q17R98	ZN827_HUMAN	zinc finger protein 827	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					AACCAGCCTCCAGCAGCCGCC	0.582																																																	0													39.0	39.0	39.0					4																	146824030		2203	4300	6503	SO:0001819	synonymous_variant	152485			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.381G>A	4.37:g.146824030C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B7ZL52|Q7Z4S7|Q8N279	Silent	SNP	ENST00000508784.1	37																																																																																					0.582	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2		NM_178835	
