#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
A2ML1	144568	hgsc.bcm.edu	37	12	9016563	9016564	+	Frame_Shift_Del	DEL	GC	GC	-	rs144686314		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr12:9016563_9016564delGC	ENST00000299698.7	+	29	3856_3857	c.3676_3677delGC	c.(3676-3678)gccfs	p.A1226fs	A2ML1_ENST00000539547.1_Frame_Shift_Del_p.A735fs	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GGCTTGGTTGGCCAAGCAACAC	0.485														135	0.0269569	0.0023	0.0432	5008	,	,		15031	0.002		0.0447	False		,,,				2504	0.0562																0										39,3661		1,37,1812						1.6	0.3		dbSNP_134	52	418,7468		17,384,3542	no	frameshift	A2ML1	NM_144670.3		18,421,5354	A1A1,A1R,RR		5.3005,1.0541,3.9444				457,11129				SO:0001589	frameshift_variant	144568			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.3676_3677delGC	12.37:g.9016563_9016564delGC	ENSP00000299698:p.Ala1226fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000299698.7	37	CCDS8596.2																																																																																				0.485	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3		NM_144670	
ACTRT1	139741	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	127185839	127185839	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chrX:127185839C>A	ENST00000371124.3	-	1	543	c.347G>T	c.(346-348)aGg>aTg	p.R116M		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	116						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						TCGAATTTCCCTAGGATTCAA	0.488																																																	0													227.0	218.0	221.0					X																	127185839		2203	4300	6503	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.347G>T	X.37:g.127185839C>A	ENSP00000360165:p.Arg116Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	CCDS14611.1	.	.	.	.	.	.	.	.	.	.	C	7.511	0.654750	0.14580	.	.	ENSG00000123165	ENST00000371124	D	0.94793	-3.52	3.76	-0.16	0.13375	.	0.504809	0.17957	N	0.156303	D	0.94614	0.8264	M	0.69823	2.125	0.09310	N	1	D	0.55800	0.973	P	0.60415	0.874	D	0.87639	0.2521	10	0.87932	D	0	.	3.4396	0.07458	0.1825:0.3784:0.0:0.4391	.	116	Q8TDG2	ACTT1_HUMAN	M	116	ENSP00000360165:R116M	ENSP00000360165:R116M	R	-	2	0	ACTRT1	127013520	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.036000	0.12185	-0.169000	0.10834	-0.296000	0.09543	AGG		0.488	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1		NM_138289	
ADCY9	115	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	4033433	4033433	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr16:4033433C>A	ENST00000294016.3	-	7	2857	c.2319G>T	c.(2317-2319)aaG>aaT	p.K773N		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	773					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CGGGGGAGTTCTTTATGACCT	0.577																																																	0													74.0	62.0	66.0					16																	4033433		2197	4300	6497	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2319G>T	16.37:g.4033433C>A	ENSP00000294016:p.Lys773Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.368878	0.24771	.	.	ENSG00000162104	ENST00000294016	D	0.83591	-1.74	5.94	3.67	0.42095	.	0.488579	0.23433	N	0.048231	T	0.67505	0.2900	N	0.11427	0.14	0.22050	N	0.999399	B	0.06786	0.001	B	0.06405	0.002	T	0.54695	-0.8255	10	0.27082	T	0.32	.	13.5327	0.61631	0.0:0.8534:0.0:0.1466	.	773	O60503	ADCY9_HUMAN	N	773	ENSP00000294016:K773N	ENSP00000294016:K773N	K	-	3	2	ADCY9	3973434	0.995000	0.38212	0.179000	0.23059	0.125000	0.20455	1.886000	0.39688	1.520000	0.48965	0.561000	0.74099	AAG		0.577	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			
AIFM1	9131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	129290574	129290574	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chrX:129290574T>G	ENST00000287295.3	-	2	340	c.110A>C	c.(109-111)aAc>aCc	p.N37T	AIFM1_ENST00000346424.2_Intron|AIFM1_ENST00000319908.3_Intron|AIFM1_ENST00000535724.1_Intron	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	37					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CTGGAACAAGTTGCCTAAGAA	0.358																																																	0													162.0	144.0	150.0					X																	129290574		2203	4300	6503	SO:0001583	missense	9131			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.110A>C	X.37:g.129290574T>G	ENSP00000287295:p.Asn37Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	37	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	T	1.323	-0.599016	0.03744	.	.	ENSG00000156709	ENST00000287295	T	0.21191	2.02	5.49	2.9	0.33743	.	0.430097	0.29233	N	0.012746	T	0.16811	0.0404	L	0.47716	1.5	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.05131	-1.0904	10	0.45353	T	0.12	-8.5731	6.6034	0.22712	0.1398:0.0:0.4401:0.4202	.	37;37	Q1L6K6;O95831	.;AIFM1_HUMAN	T	37	ENSP00000287295:N37T	ENSP00000287295:N37T	N	-	2	0	AIFM1	129118255	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.093000	0.30939	0.702000	0.31825	0.437000	0.28790	AAC		0.358	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2			
AKAP1	8165	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	55184285	55184285	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:55184285G>A	ENST00000337714.3	+	2	1693	c.1460G>A	c.(1459-1461)tGt>tAt	p.C487Y	AKAP1_ENST00000571629.1_Missense_Mutation_p.C487Y|AKAP1_ENST00000572557.1_Missense_Mutation_p.C487Y|AKAP1_ENST00000539273.1_Missense_Mutation_p.C487Y|AKAP1_ENST00000314126.3_Missense_Mutation_p.C487Y	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	487					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					GATGCCACCTGTGTCACCTGC	0.577																																																	0													115.0	111.0	112.0					17																	55184285		2203	4300	6503	SO:0001583	missense	8165			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1460G>A	17.37:g.55184285G>A	ENSP00000337736:p.Cys487Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	37	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	9.477	1.097104	0.20552	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.26373	2.02;1.74;2.02	5.8	2.7	0.31948	.	0.230684	0.53938	N	0.000051	T	0.28928	0.0718	M	0.66939	2.045	0.09310	N	1	P	0.52170	0.951	P	0.47376	0.545	T	0.14420	-1.0473	10	0.49607	T	0.09	0.0051	5.3509	0.16036	0.2289:0.0:0.6247:0.1464	.	487	Q92667	AKAP1_HUMAN	Y	487;487;529;487	ENSP00000337736:C487Y;ENSP00000314075:C487Y;ENSP00000443139:C487Y	ENSP00000314075:C487Y	C	+	2	0	AKAP1	52539284	0.039000	0.19947	0.001000	0.08648	0.019000	0.09904	0.876000	0.28092	0.344000	0.23847	0.467000	0.42956	TGT		0.577	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1			
APLP1	333	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	36362632	36362632	+	Missense_Mutation	SNP	C	C	A	rs142658251		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr19:36362632C>A	ENST00000221891.4	+	5	848	c.656C>A	c.(655-657)tCt>tAt	p.S219Y	NPHS1_ENST00000591817.1_5'Flank|APLP1_ENST00000586861.1_Missense_Mutation_p.S213Y|APLP1_ENST00000537454.2_Missense_Mutation_p.S180Y	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	219					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCGACCCATCTGGGACAGCA	0.632																																																	0								C	TYR/SER,TYR/SER	0,4406		0,0,2203	66.0	61.0	63.0		656,656	4.1	1.0	19	dbSNP_134	63	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	APLP1	NM_001024807.1,NM_005166.3	144,144	0,2,6501	AA,AC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	219/652,219/651	36362632	2,13004	2203	4300	6503	SO:0001583	missense	333			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.656C>A	19.37:g.36362632C>A	ENSP00000221891:p.Ser219Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416558	0.62511	0.0	2.33E-4	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.94280	-3.31;-3.39	4.11	4.11	0.48088	.	0.546169	0.15526	N	0.257759	D	0.89729	0.6799	N	0.19112	0.55	0.39947	D	0.974483	D;D;D;D	0.61080	0.978;0.989;0.989;0.981	P;P;P;P	0.52066	0.598;0.578;0.689;0.491	D	0.86068	0.1536	10	0.14656	T	0.56	-1.9649	12.1684	0.54144	0.0:1.0:0.0:0.0	.	213;180;219;219	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	Y	180;219	ENSP00000441501:S180Y;ENSP00000221891:S219Y	ENSP00000221891:S219Y	S	+	2	0	APLP1	41054472	0.450000	0.25697	0.994000	0.49952	0.921000	0.55340	4.839000	0.62810	2.006000	0.58801	0.462000	0.41574	TCT		0.632	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1		NM_001024807	
ARFIP2	23647	broad.mit.edu;hgsc.bcm.edu	37	11	6499971	6499971	+	Silent	SNP	A	A	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr11:6499971A>T	ENST00000254584.2	-	5	617	c.534T>A	c.(532-534)ctT>ctA	p.L178L	TIMM10B_ENST00000530751.1_5'Flank|TIMM10B_ENST00000472836.1_5'Flank|ARFIP2_ENST00000423813.2_Silent_p.L140L|ARFIP2_ENST00000445086.2_Silent_p.L93L|ARFIP2_ENST00000396777.3_Silent_p.L178L|ARFIP2_ENST00000525235.1_Silent_p.L178L|TIMM10B_ENST00000254616.6_5'Flank	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	178	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GAGGCACCTGAAGCTCTGGGG	0.637																																					Melanoma(119;796 1674 9049 20480 24794)												0													30.0	28.0	28.0					11																	6499971		2201	4296	6497	SO:0001819	synonymous_variant	23647			BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.534T>A	11.37:g.6499971A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DX86|B4E306|D3DQT5	Silent	SNP	ENST00000254584.2	37	CCDS7765.1																																																																																				0.637	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387044.1		NM_012402	
ATAD5	79915	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	29196281	29196281	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:29196281T>C	ENST00000321990.4	+	13	3707	c.3329T>C	c.(3328-3330)aTa>aCa	p.I1110T		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1110					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TCGGGTGGCATAGACTTTAAA	0.393																																																	0													111.0	107.0	108.0					17																	29196281		2203	4300	6503	SO:0001583	missense	79915				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3329T>C	17.37:g.29196281T>C	ENSP00000313171:p.Ile1110Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	6.378	0.437900	0.12104	.	.	ENSG00000176208	ENST00000321990	T	0.06218	3.33	5.62	0.879	0.19155	.	1.107710	0.06632	N	0.759414	T	0.04182	0.0116	N	0.20685	0.6	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.12837	0.008;0.003	T	0.48647	-0.9017	10	0.14252	T	0.57	.	5.0726	0.14615	0.0:0.2141:0.2668:0.5191	.	1110;1110	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	T	1110	ENSP00000313171:I1110T	ENSP00000313171:I1110T	I	+	2	0	ATAD5	26220407	0.002000	0.14202	0.007000	0.13788	0.715000	0.41141	-0.061000	0.11693	-0.127000	0.11661	0.482000	0.46254	ATA		0.393	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2		NM_024857	
ATM	472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	108106450	108106450	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr11:108106450A>T	ENST00000452508.2	+	6	574	c.385A>T	c.(385-387)Aaa>Taa	p.K129*	ATM_ENST00000278616.4_Nonsense_Mutation_p.K129*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	129					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGATACAGTGAAAGATTCATC	0.308			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													148.0	150.0	149.0					11																	108106450		2201	4298	6499	SO:0001587	stop_gained	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.385A>T	11.37:g.108106450A>T	ENSP00000388058:p.Lys129*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	38	7.047286	0.98025	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	5.62	5.62	0.85841	.	0.108208	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1251	0.81386	1.0:0.0:0.0:0.0	.	.	.	.	X	129	.	ENSP00000278616:K129X	K	+	1	0	ATM	107611660	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.171000	0.58236	2.267000	0.75376	0.477000	0.44152	AAA		0.308	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	
ATM	472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	108216609	108216609	+	Missense_Mutation	SNP	C	C	G	rs141534716		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr11:108216609C>G	ENST00000452508.2	+	59	8747	c.8558C>G	c.(8557-8559)aCg>aGg	p.T2853R	C11orf65_ENST00000526725.1_Intron|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.T2853R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2853	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.T2853M(2)|p.Y2852fs*4(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTGGCTTATACGCGCAGTGTA	0.368			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	3	Substitution - Missense(2)|Deletion - Frameshift(1)	endometrium(2)|prostate(1)											141.0	144.0	143.0					11																	108216609		2201	4298	6499	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8558C>G	11.37:g.108216609C>G	ENSP00000388058:p.Thr2853Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090444	0.94149	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.82255	-1.59;-1.59	5.54	5.54	0.83059	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.93122	0.7810	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94071	0.7335	10	0.87932	D	0	.	19.4688	0.94954	0.0:1.0:0.0:0.0	.	2853	Q13315	ATM_HUMAN	R	2853	ENSP00000278616:T2853R;ENSP00000388058:T2853R	ENSP00000278616:T2853R	T	+	2	0	ATM	107721819	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.802000	0.85969	2.594000	0.87642	0.650000	0.86243	ACG		0.368	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	
WDPCP	51057	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	63401948	63401948	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr2:63401948G>C	ENST00000272321.7	-	15	2462	c.1935C>G	c.(1933-1935)gaC>gaG	p.D645E	WDPCP_ENST00000398544.3_Missense_Mutation_p.D486E|WDPCP_ENST00000409199.1_Missense_Mutation_p.D453E|WDPCP_ENST00000409120.1_Missense_Mutation_p.D453E	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	645					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						TATCCCCTCTGTCCAAGGGTC	0.413																																																	0													120.0	109.0	112.0					2																	63401948		1845	4093	5938	SO:0001583	missense	0				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1935C>G	2.37:g.63401948G>C	ENSP00000272321:p.Asp645Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550763	0.45383	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544	T;T;T;T	0.77229	-1.08;-0.5;-0.5;-0.5	5.58	2.71	0.32032	.	0.513578	0.17076	N	0.187992	T	0.63510	0.2517	L	0.32530	0.975	0.80722	D	1	B;B	0.14805	0.006;0.011	B;B	0.15484	0.006;0.013	T	0.62305	-0.6882	10	0.62326	D	0.03	-1.7988	4.5901	0.12302	0.172:0.0:0.635:0.193	.	645;486	O95876;O95876-3	FRITZ_HUMAN;.	E	645;453;453;486	ENSP00000272321:D645E;ENSP00000386592:D453E;ENSP00000386769:D453E;ENSP00000381552:D486E	ENSP00000272321:D645E	D	-	3	2	WDPCP	63255452	0.989000	0.36119	1.000000	0.80357	0.897000	0.52465	0.989000	0.29629	1.327000	0.45338	0.557000	0.71058	GAC		0.413	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1		NM_015910	
CACNA1C	775	hgsc.bcm.edu	37	12	2794977	2794977	+	Silent	SNP	G	G	A	rs56270948	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr12:2794977G>A	ENST00000347598.4	+	46	5793	c.5793G>A	c.(5791-5793)ccG>ccA	p.P1931P	CACNA1C_ENST00000406454.3_Silent_p.P1954P|CACNA1C_ENST00000399621.1_Silent_p.P1902P|CACNA1C_ENST00000399655.1_Silent_p.P1883P|CACNA1C_ENST00000327702.7_Silent_p.P1918P|CACNA1C_ENST00000399634.1_Silent_p.P1954P|CACNA1C_ENST00000399641.1_Silent_p.P1883P|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399617.1_Silent_p.P1918P|CACNA1C_ENST00000399629.1_Silent_p.P1900P|CACNA1C_ENST00000399637.1_Silent_p.P1902P|CACNA1C_ENST00000399606.1_Silent_p.P1903P|CACNA1C_ENST00000335762.5_Silent_p.P1908P|CACNA1C_ENST00000402845.3_Silent_p.P1902P|CACNA1C_ENST00000399595.1_Silent_p.P1891P|CACNA1C_ENST00000399638.1_Silent_p.P1911P|CACNA1C_ENST00000399603.1_Silent_p.P1883P|CACNA1C_ENST00000399644.1_Silent_p.P1883P|CACNA1C_ENST00000399597.1_Silent_p.P1883P|CACNA1C_ENST00000399649.1_Silent_p.P1889P|CACNA1C_ENST00000399591.1_Silent_p.P1891P|CACNA1C_ENST00000344100.3_Silent_p.P1924P|CACNA1C_ENST00000399601.1_Silent_p.P1883P	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1966					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCAATCTCCGAAGAGGGGTT	0.567													a|||	180	0.0359425	0.0575	0.0317	5008	,	,		20996	0.0446		0.0249	False		,,,				2504	0.0123																0													48.0	49.0	49.0					12																	2794977		1989	4164	6153	SO:0001819	synonymous_variant	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5793G>A	12.37:g.2794977G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																				0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1		NM_000719	
CENPH	64946	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	68505612	68505612	+	Missense_Mutation	SNP	G	G	T	rs375648256		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr5:68505612G>T	ENST00000283006.2	+	9	817	c.730G>T	c.(730-732)Gtt>Ttt	p.V244F	CENPH_ENST00000515001.1_Missense_Mutation_p.V225F	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		TGAGAAGAATGTTGACATGAT	0.353																																																	0													99.0	100.0	100.0					5																	68505612		2203	4299	6502	SO:0001583	missense	64946			AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.730G>T	5.37:g.68505612G>T	ENSP00000283006:p.Val244Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000283006.2	37	CCDS3998.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.537|9.537	1.112332|1.112332	0.20795|0.20795	.|.	.|.	ENSG00000153044|ENSG00000153044	ENST00000502689|ENST00000283006;ENST00000515001	.|.	.|.	.|.	5.25|5.25	2.52|2.52	0.30459|0.30459	.|.	.|0.243532	.|0.32918	.|N	.|0.005497	T|T	0.11879|0.11879	0.0289|0.0289	N|N	0.08118|0.08118	0|0	0.25971|0.25971	N|N	0.982493|0.982493	.|B;P	.|0.35433	.|0.0;0.501	.|B;B	.|0.27500	.|0.001;0.08	T|T	0.12656|0.12656	-1.0539|-1.0539	5|9	.|0.56958	.|D	.|0.05	-29.0802|-29.0802	5.388|5.388	0.16227|0.16227	0.0:0.4803:0.3424:0.1773|0.0:0.4803:0.3424:0.1773	.|.	.|225;244	.|B3KVZ3;Q9H3R5	.|.;CENPH_HUMAN	F|F	183|244;225	.|.	.|ENSP00000283006:V244F	C|V	+|+	2|1	0|0	CENPH|CENPH	68541368|68541368	0.969000|0.969000	0.33509|0.33509	0.872000|0.872000	0.34217|0.34217	0.210000|0.210000	0.24377|0.24377	0.189000|0.189000	0.17037|0.17037	0.905000|0.905000	0.36596|0.36596	-0.165000|-0.165000	0.13383|0.13383	TGT|GTT		0.353	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215083.1			
COL3A1	1281	hgsc.bcm.edu;ucsc.edu	37	2	189856440	189856440	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr2:189856440delG	ENST00000304636.3	+	13	1113	c.943delG	c.(943-945)gggfs	p.G315fs	COL3A1_ENST00000317840.5_Frame_Shift_Del_p.G315fs	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	315	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	AGGACTTCCTGGGGCTGCAGT	0.433																																																	0													107.0	120.0	115.0					2																	189856440		2203	4300	6503	SO:0001589	frameshift_variant	1281			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.943delG	2.37:g.189856440delG	ENSP00000304408:p.Gly315fs	Somatic		WXS	Illumina HiSeq	Phase_I	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Frame_Shift_Del	DEL	ENST00000304636.3	37	CCDS2297.1																																																																																				0.433	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3		NM_000090	
DNAH7	56171	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	196750888	196750888	+	Nonsense_Mutation	SNP	G	G	A	rs201737013		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr2:196750888G>A	ENST00000312428.6	-	34	5615	c.5515C>T	c.(5515-5517)Cga>Tga	p.R1839*		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1839					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TAAGTTTCTCGATCATTTCTC	0.403																																																	0								G	stop/ARG	0,3756		0,0,1878	158.0	158.0	158.0		5515	2.8	1.0	2		158	4,8226		0,4,4111	yes	stop-gained	DNAH7	NM_018897.2		0,4,5989	AA,AG,GG		0.0486,0.0,0.0334		1839/4025	196750888	4,11982	1878	4115	5993	SO:0001587	stop_gained	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5515C>T	2.37:g.196750888G>A	ENSP00000311273:p.Arg1839*	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Nonsense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	44	10.904488	0.99486	0.0	4.86E-4	ENSG00000118997	ENST00000312428	.	.	.	4.81	2.85	0.33270	.	0.257153	0.28057	N	0.016780	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	11.54	0.50661	0.0:0.1344:0.7266:0.139	.	.	.	.	X	1839	.	ENSP00000311273:R1839X	R	-	1	2	DNAH7	196459133	0.939000	0.31865	0.996000	0.52242	0.457000	0.32468	1.645000	0.37238	1.125000	0.41998	0.557000	0.71058	CGA		0.403	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3		NM_018897	
FIGNL2	401720	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	52216199	52216199	+	lincRNA	SNP	T	T	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr12:52216199T>G	ENST00000562343.2	+	0	4188				RP11-923I11.4_ENST00000567167.1_lincRNA																							CCAGTGCATCTTCAACAGAGC	0.642																																																	0													27.0	32.0	30.0					12																	52216199		2132	4236	6368			401720																															12.37:g.52216199T>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000562343.2	37																																																																																					0.642	RP11-923I11.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000430848.2			
EP400NL	347918	broad.mit.edu	37	12	132611059	132611059	+	IGR	SNP	G	G	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr12:132611059G>C	ENST00000376625.4	+	0	3487				EP400NL_ENST00000475841.1_3'UTR			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like											endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						TTGGCAAAGAGTACAAGGAGG	0.448																																																	0																																										SO:0001628	intergenic_variant	347918			AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251		12.37:g.132611059G>C		Somatic		WXS	Illumina GAIIx	Phase_I	A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	RNA	SNP	ENST00000376625.4	37																																																																																					0.448	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_182613	
FLG2	388698	hgsc.bcm.edu	37	1	152327667	152327667	+	Silent	SNP	C	C	T	rs12738471	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:152327667C>T	ENST00000388718.5	-	3	2667	c.2595G>A	c.(2593-2595)tcG>tcA	p.S865S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	865	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCTGTCCCGAACTTGACC	0.502													c|||	787	0.157149	0.0091	0.2565	5008	,	,		24019	0.3373		0.0696	False		,,,				2504	0.1912																0													377.0	328.0	344.0					1																	152327667		2203	4294	6497	SO:0001819	synonymous_variant	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2595G>A	1.37:g.152327667C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																				0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5		NM_001014342	
GOT2	2806	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	58749998	58749998	+	Silent	SNP	A	A	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr16:58749998A>C	ENST00000245206.5	-	8	1067	c.939T>G	c.(937-939)cgT>cgG	p.R313R	GOT2_ENST00000434819.2_Silent_p.R270R|GOT2_ENST00000564400.1_5'UTR	NM_002080.2	NP_002071.2	P00505	AATM_HUMAN	glutamic-oxaloacetic transaminase 2, mitochondrial	313					2-oxoglutarate metabolic process (GO:0006103)|4-hydroxyproline catabolic process (GO:0019470)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid transport (GO:0015908)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|oxaloacetate metabolic process (GO:0006107)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|prostate(2)|skin(1)	22					L-Aspartic Acid(DB00128)	AATACATGGGACGGATCAAGA	0.488																																																	0													149.0	133.0	138.0					16																	58749998		2198	4300	6498	SO:0001819	synonymous_variant	2806				CCDS10801.1, CCDS67045.1	16q21	2013-05-29	2013-05-29		ENSG00000125166	ENSG00000125166	2.6.1.1		4433	protein-coding gene	gene with protein product	"""kynurenine aminotransferase IV"", ""aspartate aminotransferase 2"", ""aspartate transaminase 2"""	138150	"""glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)"""			17442055	Standard	NM_002080		Approved	mitAAT, KATIV, KAT4	uc002eof.1	P00505	OTTHUMG00000133769	ENST00000245206.5:c.939T>G	16.37:g.58749998A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DJA6|E7ERW2|Q53FL3|Q9BWA3	Silent	SNP	ENST00000245206.5	37	CCDS10801.1																																																																																				0.488	GOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258289.3			
GSK3A	2931	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	42736808	42736808	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr19:42736808C>A	ENST00000222330.3	-	9	1252	c.1125G>T	c.(1123-1125)gaG>gaT	p.E375D	GSK3A_ENST00000398249.4_Missense_Mutation_p.E293D	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	375	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				GCGCGATGGCCTCTGGCGGCG	0.582																																																	0													58.0	58.0	58.0					19																	42736808		2203	4300	6503	SO:0001583	missense	2931				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1125G>T	19.37:g.42736808C>A	ENSP00000222330:p.Glu375Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O14959	Missense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029148	0.54790	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.68025	-0.3;-0.3	4.92	3.81	0.43845	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.126749	0.51477	D	0.000100	T	0.43389	0.1245	N	0.10945	0.07	0.80722	D	1	B;B	0.15141	0.012;0.0	B;B	0.17433	0.018;0.004	T	0.39375	-0.9617	10	0.44086	T	0.13	-18.937	7.0896	0.25277	0.1728:0.7379:0.0:0.0893	.	375;293	P49840;A8MT37	GSK3A_HUMAN;.	D	375;293;320	ENSP00000222330:E375D;ENSP00000381301:E293D	ENSP00000222330:E375D	E	-	3	2	GSK3A	47428648	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.962000	0.29280	2.468000	0.83385	0.561000	0.74099	GAG		0.582	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1			
HHIP	64399	broad.mit.edu;hgsc.bcm.edu	37	4	145655993	145655993	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr4:145655993G>A	ENST00000296575.3	+	12	2516	c.1861G>A	c.(1861-1863)Gga>Aga	p.G621R		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	621	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		CACCCCCACGGGAAAGTGCTG	0.537																																																	0													71.0	70.0	70.0					4																	145655993		2203	4300	6503	SO:0001583	missense	64399			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1861G>A	4.37:g.145655993G>A	ENSP00000296575:p.Gly621Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	ENST00000296575.3	37	CCDS3762.1	.	.	.	.	.	.	.	.	.	.	G	35	5.421285	0.96111	.	.	ENSG00000164161	ENST00000296575	T	0.70282	-0.47	6.05	6.05	0.98169	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.86075	0.5846	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85843	0.1399	10	0.62326	D	0.03	-20.5151	20.6013	0.99457	0.0:0.0:1.0:0.0	.	621	Q96QV1	HHIP_HUMAN	R	621	ENSP00000296575:G621R	ENSP00000296575:G621R	G	+	1	0	HHIP	145875443	1.000000	0.71417	0.430000	0.26722	0.938000	0.57974	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	GGA		0.537	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2			
IL13RA1	3597	hgsc.bcm.edu;ucsc.edu	37	X	117900881	117900882	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chrX:117900881_117900882insAA	ENST00000371666.3	+	8	1018_1019	c.951_952insAA	c.(952-954)aagfs	p.K318fs	IL13RA1_ENST00000371637.3_5'Flank	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	318	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						TCAAAACAAATAAGTTATGCTA	0.317																																																	0																																										SO:0001589	frameshift_variant	3597			U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.952_953dupAA	X.37:g.117900882_117900883dupAA	ENSP00000360730:p.Lys318fs	Somatic		WXS	Illumina HiSeq	Phase_I	O95646|Q5JSL4|Q99656|Q9UDY5	Frame_Shift_Ins	INS	ENST00000371666.3	37	CCDS14573.1																																																																																				0.317	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1		NM_001560	
KIAA1109	84162	hgsc.bcm.edu;ucsc.edu	37	4	123265686	123265686	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr4:123265686delA	ENST00000264501.4	+	74	13076	c.12703delA	c.(12703-12705)aaafs	p.K4235fs	KIAA1109_ENST00000388738.3_Frame_Shift_Del_p.K4235fs			Q2LD37	K1109_HUMAN	KIAA1109	4235					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTCTGCAAGCAAAATGGATAC	0.318																																																	0													128.0	121.0	123.0					4																	123265686		1842	4097	5939	SO:0001589	frameshift_variant	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12703delA	4.37:g.123265686delA	ENSP00000264501:p.Lys4235fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Frame_Shift_Del	DEL	ENST00000264501.4	37	CCDS43267.1																																																																																				0.318	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1		NM_020797	
KANSL1	284058	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	44248335	44248335	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:44248335C>G	ENST00000262419.6	-	2	1645	c.1175G>C	c.(1174-1176)aGg>aCg	p.R392T	KANSL1_ENST00000572904.1_Missense_Mutation_p.R392T|KANSL1_ENST00000432791.1_Missense_Mutation_p.R392T|KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000574590.1_Missense_Mutation_p.R392T|KANSL1_ENST00000576248.1_5'UTR|KANSL1_ENST00000575318.1_Missense_Mutation_p.R392T	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	392					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TTCACTGCACCTCAAGTTGGC	0.453																																																	0													109.0	138.0	128.0					17																	44248335		2203	4300	6503	SO:0001583	missense	0			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1175G>C	17.37:g.44248335C>G	ENSP00000262419:p.Arg392Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	C	9.950	1.219801	0.22373	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.12774	2.65;2.65	5.21	2.82	0.32997	.	0.104689	0.64402	D	0.000005	T	0.09069	0.0224	N	0.17082	0.46	0.80722	D	1	B;B	0.18610	0.029;0.022	B;B	0.24974	0.032;0.057	T	0.16778	-1.0391	10	0.41790	T	0.15	-4.4036	10.582	0.45261	0.0:0.7739:0.139:0.0871	.	392;392	C9JHY2;Q7Z3B3	.;K1267_HUMAN	T	392	ENSP00000262419:R392T;ENSP00000387393:R392T	ENSP00000262419:R392T	R	-	2	0	KIAA1267	41604112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.548000	0.53670	1.173000	0.42796	0.561000	0.74099	AGG		0.453	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1		NM_015443	
KIAA1731	85459	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	93432025	93432025	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr11:93432025T>A	ENST00000325212.6	+	15	4109	c.3947T>A	c.(3946-3948)tTt>tAt	p.F1316Y	KIAA1731_ENST00000411936.1_Missense_Mutation_p.F1316Y|KIAA1731_ENST00000531700.1_Intron|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	1316						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GAACCTCTTTTTACAGAGAGT	0.413																																																	0													45.0	37.0	39.0					11																	93432025		692	1590	2282	SO:0001583	missense	85459			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.3947T>A	11.37:g.93432025T>A	ENSP00000316681:p.Phe1316Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	37	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	T	5.048	0.194560	0.09599	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.21543	2.0;2.0	5.16	2.2	0.27929	.	1.185640	0.06278	N	0.696830	T	0.12902	0.0313	N	0.22421	0.69	0.18873	N	0.999986	B	0.27264	0.173	B	0.28709	0.093	T	0.30822	-0.9965	10	0.06494	T	0.89	0.119	6.7768	0.23624	0.0:0.712:0.0:0.288	.	1316	Q9C0D2	K1731_HUMAN	Y	1316	ENSP00000316681:F1316Y;ENSP00000406505:F1316Y	ENSP00000316681:F1316Y	F	+	2	0	KIAA1731	93071673	0.004000	0.15560	0.191000	0.23289	0.016000	0.09150	0.467000	0.22035	0.343000	0.23821	-0.177000	0.13119	TTT		0.413	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1		NM_033395	
KLC3	147700	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	45854226	45854226	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr19:45854226T>G	ENST00000391946.2	+	12	1496	c.1394T>G	c.(1393-1395)aTg>aGg	p.M465R	KLC3_ENST00000585434.1_Missense_Mutation_p.M464R|KLC3_ENST00000470402.1_Missense_Mutation_p.M479R|ERCC2_ENST00000391945.4_3'UTR	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	465					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AAGAGAGCCATGTCACTCAAC	0.557																																																	0													60.0	60.0	60.0					19																	45854226		2070	4210	6280	SO:0001583	missense	147700			AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.1394T>G	19.37:g.45854226T>G	ENSP00000375810:p.Met465Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	ENST00000391946.2	37	CCDS12660.2	.	.	.	.	.	.	.	.	.	.	T	8.773	0.926365	0.18056	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	D;D	0.82081	-1.56;-1.57	3.69	3.69	0.42338	.	0.356820	0.24345	U	0.039332	T	0.65984	0.2744	N	0.08118	0	0.80722	D	1	B;B;B	0.13594	0.008;0.008;0.005	B;B;B	0.14023	0.01;0.01;0.005	T	0.64672	-0.6352	10	0.66056	D	0.02	-18.2624	8.9358	0.35700	0.0:0.0:0.0:1.0	.	464;479;465	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	R	465;479	ENSP00000375810:M465R;ENSP00000436019:M479R	ENSP00000375810:M465R	M	+	2	0	KLC3	50546066	0.966000	0.33281	0.916000	0.36221	0.555000	0.35460	2.323000	0.43823	1.689000	0.51079	0.379000	0.24179	ATG		0.557	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1		NM_145275	
LAP3	51056	hgsc.bcm.edu	37	4	17579091	17579091	+	Start_Codon_SNP	SNP	G	G	A	rs139709924		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr4:17579091G>A	ENST00000226299.4	+	1	277	c.3G>A	c.(1-3)atG>atA	p.M1I	LAP3_ENST00000606142.1_5'Flank	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	1					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						CCGACAAGATGTTCTTGCTGC	0.701																																																	0													22.0	21.0	21.0					4																	17579091		2199	4294	6493	SO:0001582	initiator_codon_variant	51056			AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.3G>A	4.37:g.17579091G>A	ENSP00000226299:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	37	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636652	0.67130	.	.	ENSG00000002549	ENST00000226299	T	0.39787	1.06	5.39	4.48	0.54585	.	0.497698	0.23074	N	0.052237	T	0.34366	0.0895	.	.	.	0.58432	D	0.999994	B	0.15930	0.015	B	0.09377	0.004	T	0.20940	-1.0260	9	0.72032	D	0.01	-35.1859	11.5573	0.50755	0.0:0.1802:0.8198:0.0	.	1	P28838	AMPL_HUMAN	I	1	ENSP00000226299:M1I	ENSP00000226299:M1I	M	+	3	0	LAP3	17188189	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.862000	0.48388	2.684000	0.91462	0.585000	0.79938	ATG		0.701	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1			Missense_Mutation
LRP1B	53353	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	141128833	141128833	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr2:141128833C>T	ENST00000389484.3	-	70	11761	c.10790G>A	c.(10789-10791)cGt>cAt	p.R3597H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3597	LDL-receptor class A 28. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATATATTCACGTGATGAGCA	0.289										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													35.0	35.0	35.0					2																	141128833		2201	4290	6491	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10790G>A	2.37:g.141128833C>T	ENSP00000374135:p.Arg3597His	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468242	0.63625	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95342	-3.68	5.5	5.5	0.81552	.	0.057767	0.64402	D	0.000002	D	0.88078	0.6340	N	0.05050	-0.12	0.24955	N	0.991767	P	0.37038	0.579	B	0.34991	0.193	T	0.82248	-0.0551	10	0.51188	T	0.08	.	19.3873	0.94563	0.0:1.0:0.0:0.0	.	3597	Q9NZR2	LRP1B_HUMAN	H	3597;3535	ENSP00000374135:R3597H	ENSP00000374135:R3597H	R	-	2	0	LRP1B	140845303	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.811000	0.47986	2.578000	0.87016	0.591000	0.81541	CGT		0.289	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557	
MAP1B	4131	hgsc.bcm.edu;ucsc.edu	37	5	71489932	71489932	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr5:71489932delA	ENST00000296755.7	+	5	1048	c.750delA	c.(748-750)acafs	p.T250fs		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	250					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AACCTCCCACATCGGGTGGAT	0.468																																					Melanoma(17;367 822 11631 31730 47712)												0													92.0	90.0	91.0					5																	71489932		2203	4300	6503	SO:0001589	frameshift_variant	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.750delA	5.37:g.71489932delA	ENSP00000296755:p.Thr250fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2BDK5	Frame_Shift_Del	DEL	ENST00000296755.7	37	CCDS4012.1																																																																																				0.468	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6		NM_005909	
MCM2	4171	broad.mit.edu;hgsc.bcm.edu	37	3	127337930	127337930	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr3:127337930G>T	ENST00000265056.7	+	13	2318	c.2074G>T	c.(2074-2076)Gag>Tag	p.E692*	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	692					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						CAGCAACAAGGAGGAGGAGGG	0.617																																																	0													33.0	31.0	31.0					3																	127337930		2203	4300	6503	SO:0001587	stop_gained	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2074G>T	3.37:g.127337930G>T	ENSP00000265056:p.Glu692*	Somatic		WXS	Illumina HiSeq	Phase_I	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Nonsense_Mutation	SNP	ENST00000265056.7	37	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.587146|7.587146	0.98374|0.98374	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142|ENST00000491422	.|.	.|.	.|.	3.06|3.06	1.73|1.73	0.24493|0.24493	.|.	0.138507|.	0.64402|.	D|.	0.000004|.	.|T	.|0.37348	.|0.1000	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.41502	.|-0.9505	.|3	0.18710|.	T|.	0.47|.	-23.7054|-23.7054	5.1379|5.1379	0.14945|0.14945	0.274:0.0:0.726:0.0|0.274:0.0:0.726:0.0	.|.	.|.	.|.	.|.	X|S	692;596;742|623	.|.	ENSP00000265056:E692X|.	E|R	+|+	1|3	0|2	MCM2|MCM2	128820620|128820620	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.841000|0.841000	0.47740|0.47740	4.701000|4.701000	0.61810|0.61810	0.252000|0.252000	0.21531|0.21531	0.591000|0.591000	0.81541|0.81541	GAG|AGG		0.617	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1			
MFHAS1	9258	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	8748320	8748320	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr8:8748320T>C	ENST00000276282.6	-	1	2835	c.2249A>G	c.(2248-2250)cAt>cGt	p.H750R		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	750										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GAGCAGCTTATGCAGCAGCAA	0.632																																					Melanoma(103;1201 2045 17515 28966)												0													61.0	58.0	59.0					8																	8748320		2203	4300	6503	SO:0001583	missense	9258			AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2249A>G	8.37:g.8748320T>C	ENSP00000276282:p.His750Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	T	2.175	-0.388862	0.04932	.	.	ENSG00000147324	ENST00000276282	T	0.32515	1.45	4.76	3.6	0.41247	.	0.258615	0.32608	N	0.005879	T	0.08714	0.0216	N	0.01352	-0.895	0.28621	N	0.908181	B	0.02656	0.0	B	0.01281	0.0	T	0.24261	-1.0165	10	0.14252	T	0.57	.	5.8391	0.18623	0.0:0.0957:0.1713:0.733	.	750	Q9Y4C4	MFHA1_HUMAN	R	750	ENSP00000276282:H750R	ENSP00000276282:H750R	H	-	2	0	MFHAS1	8785730	1.000000	0.71417	0.988000	0.46212	0.990000	0.78478	3.699000	0.54778	2.008000	0.58898	0.533000	0.62120	CAT		0.632	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2		NM_004225	
MFSD6L	162387	broad.mit.edu;hgsc.bcm.edu	37	17	8702333	8702333	+	Missense_Mutation	SNP	G	G	A	rs371017606		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:8702333G>A	ENST00000329805.4	-	1	334	c.106C>T	c.(106-108)Ctt>Ttt	p.L36F		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	36						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						CTCAGGTAAAGGGTCAGGAAC	0.667																																																	0													31.0	36.0	34.0					17																	8702333		2202	4298	6500	SO:0001583	missense	162387			AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.106C>T	17.37:g.8702333G>A	ENSP00000330051:p.Leu36Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6YL34|Q8NA76	Missense_Mutation	SNP	ENST00000329805.4	37	CCDS11146.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324537	0.81580	.	.	ENSG00000185156	ENST00000329805	T	0.78707	-1.2	4.46	4.46	0.54185	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.64402	D	0.000005	D	0.85847	0.5792	M	0.76002	2.32	0.45502	D	0.998469	D	0.89917	1.0	D	0.97110	1.0	D	0.86390	0.1735	10	0.59425	D	0.04	-8.5544	10.3357	0.43847	0.0963:0.0:0.9037:0.0	.	36	Q8IWD5	MFS6L_HUMAN	F	36	ENSP00000330051:L36F	ENSP00000330051:L36F	L	-	1	0	MFSD6L	8643058	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	3.497000	0.53295	2.298000	0.77334	0.650000	0.86243	CTT		0.667	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442554.1		NM_152599	
MMP17	4326	broad.mit.edu;hgsc.bcm.edu	37	12	132329961	132329961	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr12:132329961C>T	ENST00000360564.1	+	8	1273	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C	MMP17_ENST00000535004.1_5'UTR|MMP17_ENST00000535291.1_Missense_Mutation_p.R307C	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	391					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	CGTGTACGAGCGCACCAGCGA	0.692																																																	0													28.0	34.0	32.0					12																	132329961		2203	4299	6502	SO:0001583	missense	4326			X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.1171C>T	12.37:g.132329961C>T	ENSP00000353767:p.Arg391Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q14850	Missense_Mutation	SNP	ENST00000360564.1	37	CCDS31927.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233291	0.79688	.	.	ENSG00000198598	ENST00000360564;ENST00000535291;ENST00000534865;ENST00000542648	T;T;T;T	0.02631	4.22;4.22;4.22;4.22	4.74	2.67	0.31697	Hemopexin/matrixin (2);	0.056973	0.64402	D	0.000004	T	0.16085	0.0387	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00267	-1.1863	10	0.87932	D	0	.	7.3723	0.26808	0.2937:0.6077:0.0:0.0986	.	391	Q9ULZ9	MMP17_HUMAN	C	391;307;232;21	ENSP00000353767:R391C;ENSP00000441106:R307C;ENSP00000442104:R232C;ENSP00000439542:R21C	ENSP00000353767:R391C	R	+	1	0	MMP17	130895914	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.334000	0.59291	0.992000	0.38840	0.591000	0.81541	CGC		0.692	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397757.1		NM_016155	
MST1L	11223	broad.mit.edu	37	1	17084968	17084968	+	RNA	SNP	G	G	C	rs2761533		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:17084968G>C	ENST00000455405.2	-	0	220							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R472G(1)|p.R503G(1)									CACCGATTCCGCAAGCTGACT	0.617																																																	2	Substitution - Missense(2)	prostate(2)																																										0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084968G>C		Somatic		WXS	Illumina GAIIx	Phase_I	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	11.51	1.661479	0.29515	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.38778	N	0.001564	T	0.61362	0.2341	.	.	.	.	.	.	B;D	0.55800	0.436;0.973	B;P	0.62885	0.146;0.908	T	0.65582	-0.6133	6	0.72032	D	0.01	.	4.8114	0.13345	1.0E-4:0.0:0.6578:0.3421	rs2761533;rs3981969;rs3982160;rs4052591;rs11485892	503;503	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	G	472;503;503	.	ENSP00000439273:R503G	R	-	1	2	MST1P9	16957555	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.873000	0.39558	-0.000000	0.14550	0.000000	0.15137	CGG		0.617	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1		NM_001271733	
MUC17	140453	broad.mit.edu;hgsc.bcm.edu	37	7	100696341	100696341	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr7:100696341G>A	ENST00000306151.4	+	10	13242	c.13178G>A	c.(13177-13179)gGc>gAc	p.G4393D		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4393					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTGGTGTACGGCCTCGTGGGG	0.597																																																	0													91.0	79.0	83.0					7																	100696341		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13178G>A	7.37:g.100696341G>A	ENSP00000302716:p.Gly4393Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315805	0.23908	.	.	ENSG00000169876	ENST00000306151	T	0.46451	0.87	5.52	4.62	0.57501	.	.	.	.	.	T	0.65354	0.2683	M	0.79805	2.47	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.58578	-0.7612	9	0.66056	D	0.02	.	12.209	0.54369	0.0:0.1718:0.8282:0.0	.	4393	Q685J3	MUC17_HUMAN	D	4393	ENSP00000302716:G4393D	ENSP00000302716:G4393D	G	+	2	0	MUC17	100483061	0.913000	0.31002	0.027000	0.17364	0.128000	0.20619	4.067000	0.57527	1.289000	0.44618	0.650000	0.86243	GGC		0.597	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1		NM_001040105	
MUC4	4585	broad.mit.edu	37	3	195509498	195509498	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr3:195509498C>T	ENST00000463781.3	-	2	9412	c.8953G>A	c.(8953-8955)Gca>Aca	p.A2985T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2985T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A2985T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCTGTGGATGCTGAGGAAGTG	0.572																																																	2	Substitution - Missense(2)	endometrium(2)											18.0	10.0	12.0					3																	195509498		655	1551	2206	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8953G>A	3.37:g.195509498C>T	ENSP00000417498:p.Ala2985Thr	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	4.352	0.064824	0.08388	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.58;1.53	.	.	.	.	.	.	.	.	T	0.13500	0.0327	N	0.14661	0.345	0.09310	N	0.999999	B	0.22480	0.07	B	0.14023	0.01	T	0.25745	-1.0123	7	.	.	.	.	2.3265	0.04224	0.0:0.3925:0.3321:0.2754	.	2857	E7ESK3	.	T	2985	ENSP00000417498:A2985T;ENSP00000420243:A2985T	.	A	-	1	0	MUC4	196994277	.	.	0.014000	0.15608	0.000000	0.00434	.	.	0.482000	0.27582	0.000000	0.15137	GCA		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195515413	195515414	+	Missense_Mutation	DNP	CT	CT	TC	rs55868431|rs200193644|rs71180964	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr3:195515413_195515414CT>TC	ENST00000463781.3	-	2	3496_3497	c.3037_3038AG>GA	c.(3037-3039)AGc>GAc	p.S1013D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1013D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	448	Repeat.|Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1013_T1028delSPSSVSTGHTTPLPVT(4)|p.S1013G(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGGGCTGGTGACAGGA	0.574																																																	6	Deletion - In frame(4)|Substitution - Missense(2)	stomach(6)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3037_3038delinsTC	3.37:g.195515413_195515414delinsTC	ENSP00000417498:p.Ser1013Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.574	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NFATC1	4772	broad.mit.edu;hgsc.bcm.edu	37	18	77170523	77170523	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr18:77170523C>T	ENST00000427363.2	+	2	248	c.248C>T	c.(247-249)gCg>gTg	p.A83V	NFATC1_ENST00000397790.2_Intron|NFATC1_ENST00000542384.1_Missense_Mutation_p.A83V|NFATC1_ENST00000253506.5_Missense_Mutation_p.A83V|NFATC1_ENST00000591814.1_Missense_Mutation_p.A83V|NFATC1_ENST00000586434.1_Missense_Mutation_p.A70V|NFATC1_ENST00000329101.4_Missense_Mutation_p.A70V|NFATC1_ENST00000318065.5_Missense_Mutation_p.A70V|NFATC1_ENST00000592223.1_Missense_Mutation_p.A70V|NFATC1_ENST00000545796.1_Intron|NFATC1_ENST00000587635.1_Missense_Mutation_p.A83V			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	83					calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	ATCCCGCCGGCGGATCACCCC	0.721																																					GBM(151;1210 2593 28719 45011)												0													44.0	48.0	47.0					18																	77170523		2203	4299	6502	SO:0001583	missense	4772			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.248C>T	18.37:g.77170523C>T	ENSP00000389377:p.Ala83Val	Somatic		WXS	Illumina HiSeq	Phase_I	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	ENST00000427363.2	37		.	.	.	.	.	.	.	.	.	.	C	12.50	1.957752	0.34565	.	.	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000542384;ENST00000329101;ENST00000427363;ENST00000397794	T;T;T	0.45668	0.89;0.89;0.89	3.81	1.98	0.26296	.	1.978000	0.02885	N	0.133416	T	0.39332	0.1074	L	0.42245	1.32	0.39455	D	0.967477	B;B;B;B;B;B;B	0.17465	0.022;0.003;0.001;0.001;0.001;0.003;0.001	B;B;B;B;B;B;B	0.08055	0.002;0.001;0.0;0.001;0.001;0.003;0.0	T	0.15065	-1.0450	10	0.62326	D	0.03	-4.656	8.4418	0.32820	0.0:0.742:0.1696:0.0885	.	70;70;83;83;83;70;83	B5B2M7;B5B2N1;B5B2M6;O95644;B5B2M4;B5B2M5;Q2M1S3	.;.;.;NFAC1_HUMAN;.;.;.	V	83;83;83;70;70;47	ENSP00000253506:A83V;ENSP00000442435:A83V;ENSP00000327850:A70V	ENSP00000253506:A83V	A	+	2	0	NFATC1	75271511	0.432000	0.25554	0.000000	0.03702	0.000000	0.00434	3.761000	0.55242	0.271000	0.22005	-0.254000	0.11334	GCG		0.721	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1		NM_172390	
NLRP4	147945	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	56369989	56369989	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr19:56369989C>A	ENST00000301295.6	+	3	1652	c.1230C>A	c.(1228-1230)gaC>gaA	p.D410E	NLRP4_ENST00000587891.1_Missense_Mutation_p.D335E|NLRP4_ENST00000346986.5_Missense_Mutation_p.D410E	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	410	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TGTGGACAGACACATTTGAGT	0.577																																																	0													95.0	95.0	95.0					19																	56369989		2203	4300	6503	SO:0001583	missense	147945			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1230C>A	19.37:g.56369989C>A	ENSP00000301295:p.Asp410Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283662	0.40394	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83673	-1.75;-1.75	4.09	-2.33	0.06724	.	.	.	.	.	T	0.79155	0.4398	L	0.45137	1.4	0.09310	N	1	P;D;D	0.65815	0.544;0.995;0.981	B;P;P	0.61477	0.234;0.889;0.76	T	0.68025	-0.5518	9	0.02654	T	1	.	5.1717	0.15114	0.0:0.3044:0.4033:0.2923	.	410;335;410	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	E	410	ENSP00000301295:D410E;ENSP00000344787:D410E	ENSP00000301295:D410E	D	+	3	2	NLRP4	61061801	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.471000	0.06631	-0.080000	0.12685	-0.145000	0.13849	GAC		0.577	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2		NM_134444	
NUCKS1	64710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	205696856	205696856	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:205696856G>C	ENST00000367142.4	-	3	447	c.145C>G	c.(145-147)Cga>Gga	p.R49G		NM_022731.4	NP_073568.2	Q9H1E3	NUCKS_HUMAN	nuclear casein kinase and cyclin-dependent kinase substrate 1	49						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(1)|lung(9)	14	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			TTTCCAGATCGCCTCTTATTT	0.408																																																	0													122.0	113.0	116.0					1																	205696856		2203	4300	6503	SO:0001583	missense	64710				CCDS30987.1	1q32.1	2008-02-05			ENSG00000069275	ENSG00000069275			29923	protein-coding gene	gene with protein product		611912				11298763	Standard	NM_022731		Approved	NUCKS	uc001hdb.3	Q9H1E3	OTTHUMG00000035996	ENST00000367142.4:c.145C>G	1.37:g.205696856G>C	ENSP00000356110:p.Arg49Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q54AC0|Q5PXE7|Q9H1D6|Q9H723	Missense_Mutation	SNP	ENST00000367142.4	37	CCDS30987.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077523	0.76528	.	.	ENSG00000069275	ENST00000367142	T	0.23348	1.91	5.59	4.64	0.57946	.	0.069288	0.53938	D	0.000050	T	0.38931	0.1059	L	0.38175	1.15	0.49130	D	0.999754	D	0.56968	0.978	D	0.70487	0.969	T	0.04360	-1.0957	10	0.42905	T	0.14	-4.8142	13.8519	0.63501	0.0:0.0:0.8476:0.1524	.	49	Q9H1E3	NUCKS_HUMAN	G	49	ENSP00000356110:R49G	ENSP00000356110:R49G	R	-	1	2	NUCKS1	203963479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.999000	0.40806	2.621000	0.88768	0.650000	0.86243	CGA		0.408	NUCKS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087729.1		NM_022731	
OTOL1	131149	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	161221335	161221335	+	Missense_Mutation	SNP	G	G	C	rs182735973	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr3:161221335G>C	ENST00000327928.4	+	4	1039	c.1039G>C	c.(1039-1041)Gct>Cct	p.A347P		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	347	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						GGCTTTCAGCGCTGGTTTGTC	0.517																																																	0													45.0	43.0	43.0					3																	161221335		1866	4099	5965	SO:0001583	missense	131149				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.1039G>C	3.37:g.161221335G>C	ENSP00000330808:p.Ala347Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074586	0.36566	.	.	ENSG00000182447	ENST00000327928	D	0.89485	-2.52	5.23	5.23	0.72850	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.122703	0.56097	D	0.000023	D	0.95608	0.8572	M	0.92691	3.335	0.41734	D	0.989574	D	0.89917	1.0	D	0.79108	0.992	D	0.95396	0.8486	10	0.35671	T	0.21	.	17.3955	0.87444	0.0:0.0:1.0:0.0	.	347	A6NHN0	OTOL1_HUMAN	P	347	ENSP00000330808:A347P	ENSP00000330808:A347P	A	+	1	0	OTOL1	162704029	1.000000	0.71417	0.050000	0.19076	0.017000	0.09413	6.467000	0.73547	2.427000	0.82271	0.557000	0.71058	GCT		0.517	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1		NM_001080440	
PDLIM5	10611	hgsc.bcm.edu;ucsc.edu	37	4	95503859	95503859	+	Intron	SNP	T	T	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr4:95503859T>G	ENST00000317968.4	+	6	846				PDLIM5_ENST00000380180.3_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000514743.1_Intron|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000538141.1_Intron|PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000542407.1_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5						regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TGTGTTATTCTTCCCTCAGTA	0.378																																																	0													197.0	175.0	182.0					4																	95503859		1847	4101	5948	SO:0001627	intron_variant	10611			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.711-2857T>G	4.37:g.95503859T>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	RNA	SNP	ENST00000317968.4	37	CCDS3641.1																																																																																				0.378	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1			
PFKFB3	5209	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	6257233	6257233	+	Silent	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr10:6257233C>T	ENST00000379775.4	+	3	582	c.252C>T	c.(250-252)tcC>tcT	p.S84S	PFKFB3_ENST00000379789.4_Silent_p.S64S|PFKFB3_ENST00000536985.1_Silent_p.S64S|PFKFB3_ENST00000379785.1_Silent_p.S84S|PFKFB3_ENST00000360521.2_Silent_p.S84S|PFKFB3_ENST00000317350.4_Silent_p.S84S|PFKFB3_ENST00000540253.1_Silent_p.S98S|PFKFB3_ENST00000379782.3_Silent_p.S84S	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	84	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						AGTACAGCTCCTACAACTTCT	0.607																																																	0													69.0	52.0	58.0					10																	6257233		2203	4300	6503	SO:0001819	synonymous_variant	5209				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.252C>T	10.37:g.6257233C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Silent	SNP	ENST00000379775.4	37	CCDS7078.1																																																																																				0.607	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1			
POLG2	11232	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	62492539	62492539	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:62492539T>A	ENST00000539111.2	-	1	615	c.548A>T	c.(547-549)gAg>gTg	p.E183V		NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	183					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			AAGAAGGTTCTCCCGTAGTTT	0.468																																					Colon(3;18 21 435 17652 48887)												0													112.0	119.0	117.0					17																	62492539		2203	4300	6503	SO:0001583	missense	11232			U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.548A>T	17.37:g.62492539T>A	ENSP00000442563:p.Glu183Val	Somatic		WXS	Illumina HiSeq	Phase_I	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	ENST00000539111.2	37	CCDS32706.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.703463	0.48412	.	.	ENSG00000256525	ENST00000539111	T	0.78003	-1.14	5.15	2.74	0.32292	.	0.494434	0.22349	N	0.061233	T	0.68128	0.2967	L	0.46157	1.445	0.28150	N	0.929448	B;B	0.31680	0.335;0.335	B;B	0.25140	0.058;0.058	T	0.64698	-0.6346	10	0.87932	D	0	-8.9423	10.671	0.45757	0.0:0.0:0.3052:0.6948	.	183;183	E5KS15;Q9UHN1	.;DPOG2_HUMAN	V	183	ENSP00000442563:E183V	ENSP00000442563:E183V	E	-	2	0	POLG2	59923001	0.990000	0.36364	0.995000	0.50966	0.995000	0.86356	1.407000	0.34657	0.786000	0.33708	0.454000	0.30748	GAG		0.468	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1		NM_007215	
POLI	11201	hgsc.bcm.edu	37	18	51795958	51795960	+	In_Frame_Del	DEL	CGA	CGA	-	rs78943519|rs10584411|rs3729509	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	CGA	CGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr18:51795958_51795960delCGA	ENST00000579534.1	+	1	185_187	c.42_44delCGA	c.(40-45)ggcgac>ggc	p.D17del	POLI_ENST00000579434.1_5'UTR|POLI_ENST00000406285.3_In_Frame_Del_p.D17del|POLI_ENST00000217800.5_5'Flank	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	17					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.D17delD(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AAGGCGGCGGCGACGACGACGAG	0.729								DNA polymerases (catalytic subunits)						3926	0.783946	0.9705	0.6427	5008	,	,		12312	0.7054		0.7078	False		,,,				2504	0.7914																1	Deletion - In frame(1)	large_intestine(1)								3523,343		1644,235,54						1.5	0.0		dbSNP_119	14	5235,2405		1985,1265,570	no	coding	POLI	NM_007195.2		3629,1500,624	A1A1,A1R,RR		31.4791,8.8722,23.8832				8758,2748				SO:0001651	inframe_deletion	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.42_44delCGA	18.37:g.51795967_51795969delCGA	ENSP00000462664:p.Asp17del	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N590|Q9H0S1|Q9NYH6	In_Frame_Del	DEL	ENST00000579534.1	37	CCDS11954.2																																																																																				0.729	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3		NM_007195	
PTCHD2	57540	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11594487	11594488	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:11594487_11594488GC>AT	ENST00000294484.6	+	18	3563_3564	c.3425_3426GC>AT	c.(3424-3426)cGC>cAT	p.R1142H	PTCHD2_ENST00000389575.3_Missense_Mutation_p.R1142H|PTCHD2_ENST00000304391.6_Silent_p.28_29AL>AL	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1142					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GACTACCTGCGCTGGGAGAGCT	0.619																																																	0																																										SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	Exception_encountered	1.37:g.11594487_11594488delinsAT	ENSP00000294484:p.Arg1142His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VTU9|Q9UJD6	Missense_Mutation|Silent	SNP	ENST00000294484.6	37	CCDS41247.1																																																																																				0.619	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2		XM_052561	
POU2F1	5451	broad.mit.edu;ucsc.edu	37	1	167365546	167365546	+	Silent	SNP	G	G	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:167365546G>A	ENST00000541643.3	+	11	1104	c.942G>A	c.(940-942)ggG>ggA	p.G314G	POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000452019.1_3'UTR|POU2F1_ENST00000420254.3_Silent_p.G314G|POU2F1_ENST00000367866.2_Silent_p.G337G|POU2F1_ENST00000367862.5_Silent_p.G326G|POU2F1_ENST00000429375.2_Silent_p.G274G			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	314	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						TCGCTATGGGGAAACTATATG	0.448																																																	0													211.0	191.0	198.0					1																	167365546		2203	4300	6503	SO:0001819	synonymous_variant	5451			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.942G>A	1.37:g.167365546G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Silent	SNP	ENST00000541643.3	37																																																																																					0.448	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_002697	
PTPN13	5783	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	87662970	87662970	+	Splice_Site	SNP	G	G	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr4:87662970G>T	ENST00000411767.2	+	16	2550		c.e16+1		PTPN13_ENST00000316707.6_Splice_Site|PTPN13_ENST00000427191.2_Splice_Site|PTPN13_ENST00000511467.1_Splice_Site|PTPN13_ENST00000436978.1_Splice_Site			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ATCTTTTTCTGTATGTCCATT	0.373																																																	0													77.0	70.0	72.0					4																	87662970		1846	4095	5941	SO:0001630	splice_region_variant	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.2487+1G>T	4.37:g.87662970G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Splice_Site	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018453	0.75275	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5833	0.95478	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPN13	87881994	1.000000	0.71417	0.991000	0.47740	0.708000	0.40852	9.188000	0.94921	2.612000	0.88384	0.655000	0.94253	.		0.373	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			Intron
RBL2	5934	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	53487478	53487478	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr16:53487478A>C	ENST00000262133.6	+	6	1018	c.881A>C	c.(880-882)aAg>aCg	p.K294T	RBL2_ENST00000544545.1_Missense_Mutation_p.K78T|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	294					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AAGGGGATAAAGGAACATTTC	0.353																																																	0													96.0	99.0	98.0					16																	53487478		2198	4300	6498	SO:0001583	missense	5934			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.881A>C	16.37:g.53487478A>C	ENSP00000262133:p.Lys294Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124007	0.56613	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000544545	D;D;D	0.91631	-2.88;-2.42;-2.18	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.96172	0.8752	M	0.85777	2.775	0.50467	D	0.999878	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.922;0.996;0.994	D	0.96843	0.9619	10	0.87932	D	0	-16.7393	14.5267	0.67894	1.0:0.0:0.0:0.0	.	78;294;294	B7Z913;Q8NE70;Q08999	.;.;RBL2_HUMAN	T	294;220;78	ENSP00000262133:K294T;ENSP00000443744:K220T;ENSP00000444685:K78T	ENSP00000262133:K294T	K	+	2	0	RBL2	52044979	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.925000	0.75829	1.815000	0.52974	0.402000	0.26972	AAG		0.353	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3		NM_005611	
RBM12B	389677	broad.mit.edu;hgsc.bcm.edu	37	8	94746348	94746348	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr8:94746348C>A	ENST00000399300.2	-	3	2504	c.2291G>T	c.(2290-2292)aGg>aTg	p.R764M	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.R644M|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	764							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GGGTGGCCGCCTGAAGTGCTC	0.682																																																	0													28.0	34.0	32.0					8																	94746348		1773	4020	5793	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2291G>T	8.37:g.94746348C>A	ENSP00000382239:p.Arg764Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333774	0.60853	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.09163	3.02;3.01	4.35	3.48	0.39840	.	.	.	.	.	T	0.15219	0.0367	L	0.27053	0.805	0.09310	N	1	D	0.65815	0.995	P	0.59357	0.856	T	0.09185	-1.0686	9	0.87932	D	0	3.41	6.7439	0.23451	0.0:0.7945:0.0:0.2055	.	764	Q8IXT5	RB12B_HUMAN	M	764;644	ENSP00000382239:R764M;ENSP00000427729:R644M	ENSP00000382239:R764M	R	-	2	0	RBM12B	94815524	0.001000	0.12720	0.043000	0.18650	0.128000	0.20619	0.453000	0.21811	1.422000	0.47177	0.563000	0.77884	AGG		0.682	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1		NM_203390	
RBM23	55147	hgsc.bcm.edu	37	14	23371265	23371265	+	Silent	SNP	G	G	A	rs376457710|rs568447355	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr14:23371265G>A	ENST00000359890.3	-	12	1365	c.1170C>T	c.(1168-1170)gcC>gcT	p.A390A	RBM23_ENST00000346528.5_Silent_p.A356A|RBM23_ENST00000399922.2_Silent_p.A374A|RBM23_ENST00000542016.2_Silent_p.A220A|RBM23_ENST00000555209.1_Silent_p.A140A	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	390	Ala-rich.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		GGgcggcggcggcagcagcag	0.552													G|||	3	0.000599042	0.0008	0.0014	5008	,	,		16976	0.0		0.001	False		,,,				2504	0.0																0													36.0	39.0	38.0					14																	23371265		1973	4161	6134	SO:0001819	synonymous_variant	55147			AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.1170C>T	14.37:g.23371265G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Silent	SNP	ENST00000359890.3	37	CCDS41921.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.085813	0.00371	.	.	ENSG00000100461	ENST00000553884	.	.	.	1.37	-1.47	0.08772	.	.	.	.	.	T	0.27594	0.0678	.	.	.	0.29570	N	0.850013	.	.	.	.	.	.	T	0.32613	-0.9900	4	.	.	.	-1.1482	4.4328	0.11536	0.5883:0.0:0.4117:0.0	.	.	.	.	C	165	.	.	R	-	1	0	RBM23	22441105	0.019000	0.18553	0.046000	0.18839	0.018000	0.09664	-1.748000	0.01826	-0.441000	0.07201	-2.474000	0.00201	CGC		0.552	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3			
RGS2	5997	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	192780679	192780679	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:192780679G>T	ENST00000235382.5	+	5	620	c.589G>T	c.(589-591)Gac>Tac	p.D197Y		NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	197	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			large_intestine(3)|lung(1)|urinary_tract(1)	5						ATTCTACCAGGACTTGTGTAA	0.438																																					Pancreas(71;51 2183 4981)												0													133.0	137.0	136.0					1																	192780679		2203	4300	6503	SO:0001583	missense	5997			L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.589G>T	1.37:g.192780679G>T	ENSP00000235382:p.Asp197Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6I9U5	Missense_Mutation	SNP	ENST00000235382.5	37	CCDS1377.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298854	0.81025	.	.	ENSG00000116741	ENST00000235382	T	0.65364	-0.15	5.97	5.97	0.96955	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.088688	0.85682	D	0.000000	T	0.76870	0.4048	M	0.76002	2.32	0.49051	D	0.999743	D	0.67145	0.996	P	0.57548	0.823	T	0.78653	-0.2120	10	0.87932	D	0	.	18.9877	0.92779	0.0:0.0:1.0:0.0	.	197	P41220	RGS2_HUMAN	Y	197	ENSP00000235382:D197Y	ENSP00000235382:D197Y	D	+	1	0	RGS2	191047302	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.715000	0.68430	2.828000	0.97474	0.655000	0.94253	GAC		0.438	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086396.1		NM_002923	
SEMA4G	57715	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	102740600	102740600	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr10:102740600C>T	ENST00000370250.4	+	12	1862	c.1489C>T	c.(1489-1491)Cct>Tct	p.P497S	MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000370242.4_Intron|MRPL43_ENST00000318325.2_Intron|SEMA4G_ENST00000210633.3_Missense_Mutation_p.P497S|SEMA4G_ENST00000517724.1_Missense_Mutation_p.P497S|RP11-108L7.4_ENST00000447344.1_RNA	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	497	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		TGTGGGGGCTCCTAGCGGAGT	0.617																																																	0													78.0	84.0	82.0					10																	102740600		2203	4300	6503	SO:0001583	missense	57715			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1489C>T	10.37:g.102740600C>T	ENSP00000359270:p.Pro497Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		.	.	.	.	.	.	.	.	.	.	C	0.679	-0.799011	0.02841	.	.	ENSG00000095539	ENST00000519649;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T	0.27890	1.64;1.64;1.64;1.64	5.03	-0.332	0.12675	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.573010	0.19279	N	0.118220	T	0.11110	0.0271	N	0.08118	0	0.09310	N	1	B;B;B	0.14805	0.001;0.011;0.0	B;B;B	0.17098	0.003;0.017;0.003	T	0.35176	-0.9799	10	0.06757	T	0.87	.	6.7505	0.23485	0.0:0.3685:0.3996:0.2318	.	497;497;497	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	S	497	ENSP00000428896:P497S;ENSP00000359270:P497S;ENSP00000430175:P497S;ENSP00000210633:P497S	ENSP00000210633:P497S	P	+	1	0	SEMA4G	102730590	0.000000	0.05858	0.710000	0.30468	0.969000	0.65631	-0.432000	0.06956	-0.371000	0.08004	0.305000	0.20034	CCT		0.617	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2			
SLC17A2	10246	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	25913557	25913557	+	3'UTR	SNP	A	A	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr6:25913557A>C	ENST00000265425.3	-	0	1480				SLC17A2_ENST00000360488.3_Nonsense_Mutation_p.L426*|SLC17A2_ENST00000377850.3_Silent_p.L475L			O00624	NPT3_HUMAN	solute carrier family 17, member 2						phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						AGAGGCGGGTAAGGGTCCTCT	0.423																																																	0													127.0	120.0	122.0					6																	25913557		2203	4300	6503	SO:0001624	3_prime_UTR_variant	10246			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.*140T>G	6.37:g.25913557A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NK81|A6NLD6|Q5TB84|Q76P85	Nonsense_Mutation	SNP	ENST00000265425.3	37		.	.	.	.	.	.	.	.	.	.	A	16.04	3.010248	0.54361	.	.	ENSG00000112337	ENST00000360488	.	.	.	4.65	-0.201	0.13212	.	0.367561	0.23716	N	0.045275	.	.	.	.	.	.	0.19945	N	0.999942	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.5085	0.11899	0.3542:0.1549:0.4909:0.0	.	.	.	.	X	426	.	ENSP00000353677:L426X	L	-	2	0	SLC17A2	26021536	0.696000	0.27757	0.093000	0.20910	0.008000	0.06430	-0.220000	0.09215	-0.051000	0.13334	-0.154000	0.13518	TTA		0.423	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1			
SLC2A11	66035	hgsc.bcm.edu;ucsc.edu	37	22	24226035	24226036	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr22:24226035_24226036insC	ENST00000345044.6	+	9	1329_1330	c.1061_1062insC	c.(1060-1065)atcttcfs	p.F355fs	SLC2A11_ENST00000316185.8_Frame_Shift_Ins_p.F358fs|SLC2A11_ENST00000398356.2_Frame_Shift_Ins_p.F362fs|AP000350.10_ENST00000433835.3_Intron			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	355					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						TGGGGGAGCATCTTCACTGTGG	0.653																																																	0																																										SO:0001589	frameshift_variant	66035			AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.1062dupC	22.37:g.24226036_24226036dupC	ENSP00000342542:p.Phe355fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Frame_Shift_Ins	INS	ENST00000345044.6	37	CCDS46673.1																																																																																				0.653	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319889.3		NM_030807	
SMG5	23381	hgsc.bcm.edu	37	1	156252471	156252473	+	Start_Codon_Del	DEL	TGG	TGG	-			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:156252471_156252473delTGG	ENST00000361813.5	-	0	143_145				TMEM79_ENST00000405535.2_5'Flank|TMEM79_ENST00000357501.2_5'Flank|SMG5_ENST00000368267.5_Start_Codon_Del|TMEM79_ENST00000295694.5_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CCTTGGCTCATGGTGCCCGGGTC	0.709																																																	0																																										SO:0001582	initiator_codon_variant	23381			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491		1.37:g.156252471_156252473delTGG		Somatic		WXS	Illumina HiSeq	Phase_I	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Frame_Shift_Del	DEL	ENST00000361813.5	37	CCDS1137.1																																																																																				0.709	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1		NM_015327	
SNX18	112574	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	53815390	53815390	+	Silent	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr5:53815390C>T	ENST00000326277.3	+	1	1798	c.1608C>T	c.(1606-1608)atC>atT	p.I536I	SNX18_ENST00000343017.6_Silent_p.I536I|SNX18_ENST00000381410.4_Silent_p.I536I	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	536	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CGGACATCATCCACGTTCAGA	0.552																																																	0													138.0	123.0	128.0					5																	53815390		2203	4300	6503	SO:0001819	synonymous_variant	112574			AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.1608C>T	5.37:g.53815390C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																				0.552	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2			
SPOCK1	6695	broad.mit.edu;hgsc.bcm.edu	37	5	136448175	136448175	+	Silent	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr5:136448175C>A	ENST00000394945.1	-	5	592	c.423G>T	c.(421-423)gtG>gtT	p.V141V	SPOCK1_ENST00000282223.7_Silent_p.V141V	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	141	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGACTGTGCCACGGGACAGG	0.473																																																	0													99.0	96.0	97.0					5																	136448175		2203	4300	6503	SO:0001819	synonymous_variant	6695			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.423G>T	5.37:g.136448175C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Silent	SNP	ENST00000394945.1	37	CCDS4191.1																																																																																				0.473	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1		NM_004598	
STAM	8027	hgsc.bcm.edu;ucsc.edu	37	10	17737083	17737085	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	TCA	TCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr10:17737083_17737085delTCA	ENST00000377524.3	+	7	786_788	c.571_573delTCA	c.(571-573)tcadel	p.S191del	RP11-390B4.3_ENST00000445235.1_RNA|STAM_ENST00000540523.1_In_Frame_Del_p.S80del	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	191					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						AAGGCAGCAGTCAACCACCCTTT	0.399																																																	0																																										SO:0001651	inframe_deletion	8027			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.571_573delTCA	10.37:g.17737083_17737085delTCA	ENSP00000366746:p.Ser191del	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ99|D3DRU5|Q8N6D9	In_Frame_Del	DEL	ENST00000377524.3	37	CCDS7122.1																																																																																				0.399	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1		NM_003473	
STX4	6810	hgsc.bcm.edu;ucsc.edu	37	16	31049919	31049919	+	Missense_Mutation	SNP	G	G	A	rs373829816		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr16:31049919G>A	ENST00000313843.3	+	8	968	c.653G>A	c.(652-654)cGt>cAt	p.R218H	STX4_ENST00000394998.1_Missense_Mutation_p.R216H|STX4_ENST00000493902.1_3'UTR	NM_004604.3	NP_004595.2	Q12846	STX4_HUMAN	syntaxin 4	218	Interaction with CENPF. {ECO:0000250}.|t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|neurotransmitter transport (GO:0006836)|platelet activation (GO:0030168)|post-Golgi vesicle-mediated transport (GO:0006892)|SNARE complex assembly (GO:0035493)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|membrane (GO:0016020)|myelin sheath adaxonal region (GO:0035749)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)				NS(2)|breast(1)|large_intestine(3)|lung(3)	9						CGCAGTATTCGTGAGCTGCAC	0.582																																																	0								G	HIS/ARG	0,4394		0,0,2197	83.0	72.0	76.0		653	5.0	1.0	16		76	1,8599	1.2+/-3.3	0,1,4299	no	missense	STX4	NM_004604.3	29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	218/298	31049919	1,12993	2197	4300	6497	SO:0001583	missense	6810			AF026007	CCDS10700.1, CCDS61916.1	16p11.2	2008-02-05	2006-04-25	2006-04-25	ENSG00000103496	ENSG00000103496			11439	protein-coding gene	gene with protein product		186591	"""syntaxin 4A (placental)"""	STX4A		8206394, 16339081	Standard	NM_001272095		Approved	p35-2	uc002eak.4	Q12846	OTTHUMG00000132404	ENST00000313843.3:c.653G>A	16.37:g.31049919G>A	ENSP00000317714:p.Arg218His	Somatic		WXS	Illumina HiSeq	Phase_I	A8MXY0|Q15525|Q6FHE8	Missense_Mutation	SNP	ENST00000313843.3	37	CCDS10700.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405027	0.83230	0.0	1.16E-4	ENSG00000103496	ENST00000394998;ENST00000313843	T;T	0.23348	1.91;1.91	5.93	4.97	0.65823	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.177714	0.46758	D	0.000271	T	0.22399	0.0540	L	0.29908	0.895	0.30871	N	0.732489	P;D	0.58620	0.889;0.983	B;P	0.45377	0.383;0.478	T	0.11348	-1.0591	10	0.87932	D	0	.	11.62	0.51113	0.1382:0.0:0.8618:0.0	.	218;216	Q12846;A8MXY0	STX4_HUMAN;.	H	216;218	ENSP00000378447:R216H;ENSP00000317714:R218H	ENSP00000317714:R218H	R	+	2	0	STX4	30957420	0.996000	0.38824	0.999000	0.59377	0.685000	0.39939	2.613000	0.46351	2.833000	0.97629	0.650000	0.86243	CGT		0.582	STX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255538.3		NM_004604	
TAF4	6874	hgsc.bcm.edu;ucsc.edu	37	20	60574076	60574077	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr20:60574076_60574077insC	ENST00000252996.4	-	12	2874_2875	c.2875_2876insG	c.(2875-2877)gatfs	p.D959fs		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	959					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CTCCTGCTCATCCTTCCTCTGC	0.545																																																	0																																										SO:0001589	frameshift_variant	6874			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2876dupG	20.37:g.60574078_60574078dupC	ENSP00000252996:p.Asp959fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Frame_Shift_Ins	INS	ENST00000252996.4	37	CCDS33500.1																																																																																				0.545	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2		NM_003185	
TBL1X	6907	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	9677737	9677737	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chrX:9677737C>A	ENST00000217964.7	+	15	2016	c.1376C>A	c.(1375-1377)aCc>aAc	p.T459N	TBL1X_ENST00000407597.2_Missense_Mutation_p.T459N|TBL1X_ENST00000424279.1_Missense_Mutation_p.T408N|TBL1X_ENST00000380961.1_Missense_Mutation_p.T408N|TBL1X_ENST00000536365.1_Missense_Mutation_p.T408N	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	459					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				GAGATCTACACCATCAAGTGG	0.522											OREG0019658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	37.0	42.0					X																	9677737		2202	4300	6502	SO:0001583	missense	6907			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1376C>A	X.37:g.9677737C>A	ENSP00000217964:p.Thr459Asn	Somatic	658	WXS	Illumina HiSeq	Phase_I	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482903	0.84747	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18	4.19	4.19	0.49359	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	L	0.28274	0.84	0.80722	D	1	D;D	0.89917	1.0;0.988	D;D	0.85130	0.997;0.951	T	0.71504	-0.4573	10	0.87932	D	0	.	16.6004	0.84815	0.0:1.0:0.0:0.0	.	422;459	Q59F53;O60907	.;TBL1X_HUMAN	N	459;408;408;408;459	ENSP00000385988:T459N;ENSP00000394097:T408N;ENSP00000445317:T408N;ENSP00000370348:T408N;ENSP00000217964:T459N	ENSP00000217964:T459N	T	+	2	0	TBL1X	9637737	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.253000	0.78320	2.028000	0.59812	0.600000	0.82982	ACC		0.522	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1		NM_005647	
TMEM144	55314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	159138498	159138499	+	Frame_Shift_Ins	INS	-	-	A	rs202038549		TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr4:159138498_159138499insA	ENST00000296529.6	+	5	778_779	c.258_259insA	c.(259-261)aaafs	p.K87fs	TMEM144_ENST00000514558.1_Frame_Shift_Ins_p.K87fs	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	87						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		TCCCAATTATCAAAACCATTGG	0.327																																																	0																																										SO:0001589	frameshift_variant	55314			AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.262dupA	4.37:g.159138502_159138502dupA	ENSP00000296529:p.Lys87fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DP24|Q49A05|Q9NUT3	Frame_Shift_Ins	INS	ENST00000296529.6	37	CCDS3799.1																																																																																				0.327	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1		NM_018342	
TMPRSS13	84000	broad.mit.edu;ucsc.edu	37	11	117774795	117774795	+	Missense_Mutation	SNP	C	C	G	rs200481694	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr11:117774795C>G	ENST00000430170.2	-	11	1490	c.1403G>C	c.(1402-1404)cGg>cCg	p.R468P	TMPRSS13_ENST00000445164.2_Missense_Mutation_p.R468P|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.R433P|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.R468P	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	468	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		CTGCACCTCCCGGAGGAAGGG	0.527																																																	0													63.0	71.0	68.0					11																	117774795		2029	4173	6202	SO:0001583	missense	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.1403G>C	11.37:g.117774795C>G	ENSP00000387702:p.Arg468Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020919	0.75275	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	4.98	4.98	0.66077	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.56097	D	0.000035	T	0.76688	0.4022	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.968;0.999;0.992	T	0.77395	-0.2604	10	0.51188	T	0.08	.	16.4305	0.83840	0.0:1.0:0.0:0.0	.	463;463;468	E9PHM4;Q9BYE2;E9PRA0	.;TMPSD_HUMAN;.	P	433;463;468;468;468	ENSP00000435813:R433P;ENSP00000434279:R468P;ENSP00000387702:R468P;ENSP00000394114:R468P	ENSP00000337113:R463P	R	-	2	0	TMPRSS13	117280005	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.569000	0.45973	2.489000	0.83994	0.551000	0.68910	CGG		0.527	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1		NM_032046	
TPRG1L	127262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	3545158	3545158	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:3545158A>G	ENST00000378344.2	+	5	881	c.810A>G	c.(808-810)atA>atG	p.I270M	TPRG1L_ENST00000344579.5_Missense_Mutation_p.I211M	NM_182752.3	NP_877429.2	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	270						cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(1)	8	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		GGGGCAAAATAGGCTTTTAGC	0.617																																																	0													59.0	52.0	55.0					1																	3545158		2203	4299	6502	SO:0001583	missense	127262			BC019034	CCDS47.1	1p36.32	2008-02-05	2008-01-16	2008-01-16	ENSG00000158109	ENSG00000158109			27007	protein-coding gene	gene with protein product		611460	"""family with sequence similarity 79, member A"""	FAM79A		12477932	Standard	NM_182752		Approved	RP11-46F15.3, FLJ21811	uc001akm.3	Q5T0D9	OTTHUMG00000000609	ENST00000378344.2:c.810A>G	1.37:g.3545158A>G	ENSP00000367595:p.Ile270Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1K4|Q8WV04	Missense_Mutation	SNP	ENST00000378344.2	37	CCDS47.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.409029	0.62399	.	.	ENSG00000158109	ENST00000378344;ENST00000456805;ENST00000344579	.	.	.	5.3	-10.6	0.00265	.	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	M	0.78049	2.395	0.51012	D	0.999904	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.991	T	0.77555	-0.2544	9	0.87932	D	0	-1.0215	7.8447	0.29419	0.2227:0.4043:0.0:0.373	.	211;270	Q5T0D9-2;Q5T0D9	.;TPRGL_HUMAN	M	270;227;211	.	ENSP00000339714:I211M	I	+	3	3	TPRG1L	3535018	0.590000	0.26815	0.198000	0.23420	0.786000	0.44442	-0.221000	0.09202	-1.722000	0.01377	-0.333000	0.08304	ATA		0.617	TPRG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001466.1		NM_182752	
TRIM42	287015	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	140401925	140401925	+	Silent	SNP	C	C	T			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr3:140401925C>T	ENST00000286349.3	+	2	1154	c.963C>T	c.(961-963)caC>caT	p.H321H		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	321						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.H321H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACAATGGCCACGACACCATTA	0.552																																																	1	Substitution - coding silent(1)	large_intestine(1)											224.0	194.0	204.0					3																	140401925		2203	4300	6503	SO:0001819	synonymous_variant	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.963C>T	3.37:g.140401925C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																				0.552	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2		NM_152616	
TUBBP5	643224	broad.mit.edu	37	9	141070687	141070687	+	RNA	SNP	C	C	T	rs199688784	byFrequency	TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr9:141070687C>T	ENST00000503395.1	+	0	1462									tubulin, beta pseudogene 5																		ACAACTGGGCCAAGGGACGCT	0.577																																																	0																																												643224			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070687C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000503395.1	37																																																																																					0.577	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1		NR_027156	
UBR4	23352	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	19445444	19445444	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:19445444T>G	ENST00000375254.3	-	71	10490	c.10463A>C	c.(10462-10464)gAg>gCg	p.E3488A	UBR4_ENST00000375226.2_Missense_Mutation_p.E3464A|UBR4_ENST00000375267.2_Missense_Mutation_p.E3488A|UBR4_ENST00000375218.3_5'Flank|UBR4_ENST00000375217.2_Missense_Mutation_p.E3481A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3488					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGTGAATACTCCTTCAACTG	0.388																																																	0													109.0	102.0	104.0					1																	19445444		2203	4300	6503	SO:0001583	missense	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.10463A>C	1.37:g.19445444T>G	ENSP00000364403:p.Glu3488Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	T	19.48	3.835677	0.71373	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.74359	0.3706	M	0.62088	1.915	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.73582	-0.3937	10	0.39692	T	0.17	.	15.0884	0.72174	0.0:0.0:0.0:1.0	.	3488	Q5T4S7	UBR4_HUMAN	A	3488;3488;3481;3464	ENSP00000364403:E3488A;ENSP00000364416:E3488A;ENSP00000364365:E3481A;ENSP00000364374:E3464A	ENSP00000364365:E3481A	E	-	2	0	UBR4	19318031	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.698000	0.84413	2.244000	0.73946	0.528000	0.53228	GAG		0.388	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1		NM_020765	
USP32P3	347716	broad.mit.edu	37	17	20319816	20319816	+	RNA	SNP	T	T	C			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:20319816T>C	ENST00000583574.2	+	0	145									ubiquitin specific peptidase 32 pseudogene 3																		CAAAGGAAAATGACAGGCCCT	0.507																																																	0																																												0					17p11.2	2013-02-15			ENSG00000189423	ENSG00000189423			43576	pseudogene	pseudogene							Standard	NG_002719		Approved				OTTHUMG00000179809		17.37:g.20319816T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000583574.2	37																																																																																					0.507	USP32P3-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467714.1		NG_002719	
USH2A	7399	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	216019306	216019306	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr1:216019306G>A	ENST00000307340.3	-	45	9301	c.8915C>T	c.(8914-8916)tCt>tTt	p.S2972F	USH2A_ENST00000366943.2_Missense_Mutation_p.S2972F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2972	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATTTTTAGAGAGTCGTTTGA	0.403										HNSCC(13;0.011)																																							0													98.0	95.0	96.0					1																	216019306		2203	4300	6503	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8915C>T	1.37:g.216019306G>A	ENSP00000305941:p.Ser2972Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154564	0.57259	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.58797	0.31;0.31	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.44097	D	0.000481	T	0.75700	0.3885	M	0.76838	2.35	0.49798	D	0.999825	D	0.89917	1.0	D	0.97110	1.0	T	0.68853	-0.5299	10	0.09338	T	0.73	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	2972	O75445	USH2A_HUMAN	F	2972	ENSP00000305941:S2972F;ENSP00000355910:S2972F	ENSP00000305941:S2972F	S	-	2	0	USH2A	214085929	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	5.740000	0.68629	2.793000	0.96121	0.655000	0.94253	TCT		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1		NM_007123	
VDR	7421	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	48272814	48272814	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr12:48272814C>G	ENST00000395324.2	-	3	351	c.83G>C	c.(82-84)gGa>gCa	p.G28A	VDR_ENST00000535672.1_5'UTR|VDR_ENST00000550325.1_Missense_Mutation_p.G78A|VDR_ENST00000229022.3_Missense_Mutation_p.G28A|VDR_ENST00000549336.1_Missense_Mutation_p.G28A			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	28					bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GGCTCGGTCTCCACACACCCC	0.592																																																	0													102.0	86.0	91.0					12																	48272814		2203	4300	6503	SO:0001583	missense	7421			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.83G>C	12.37:g.48272814C>G	ENSP00000378734:p.Gly28Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5Q1|G3V1V9|Q5PSV3	Missense_Mutation	SNP	ENST00000395324.2	37	CCDS8757.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944110	0.92593	.	.	ENSG00000111424	ENST00000395324;ENST00000229022;ENST00000549336;ENST00000550325;ENST00000546653;ENST00000550314;ENST00000548664	D;D;D;D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18;-4.18;-4.18;-4.18	5.58	5.58	0.84498	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.98544	0.9514	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.995	D	0.99521	1.0958	10	0.87932	D	0	.	18.1475	0.89662	0.0:1.0:0.0:0.0	.	28;78	P11473;G3V1V9	VDR_HUMAN;.	A	28;28;28;78;28;28;28	ENSP00000378734:G28A;ENSP00000229022:G28A;ENSP00000449573:G28A;ENSP00000447173:G78A;ENSP00000448659:G28A;ENSP00000449561:G28A;ENSP00000450105:G28A	ENSP00000229022:G28A	G	-	2	0	VDR	46559081	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.590000	0.82653	2.630000	0.89119	0.655000	0.94253	GGA		0.592	VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406433.1			
XK	7504	broad.mit.edu;hgsc.bcm.edu	37	X	37586901	37586901	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chrX:37586901C>A	ENST00000378616.3	+	3	724	c.521C>A	c.(520-522)aCc>aAc	p.T174N	TM4SF2_ENST00000465127.1_Intron	NM_021083.2	NP_066569.1	P51811	XK_HUMAN	X-linked Kx blood group	174					amino acid transport (GO:0006865)|transport (GO:0006810)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	15		all_lung(315;0.175)				CTCCTCATGACCATATCCCTG	0.498																																																	0													79.0	62.0	68.0					X																	37586901		2202	4300	6502	SO:0001583	missense	7504			Z32684	CCDS14241.1	Xp21.1	2014-07-19	2014-06-18		ENSG00000047597	ENSG00000047597		"""Blood group antigens"""	12811	protein-coding gene	gene with protein product	"""Kx antigen"", ""McLeod syndrome"""	314850	"""Kell blood group precursor (McLeod phenotype)"", ""XK, Kell blood group complex subunit (McLeod syndrome)"", ""neuroacanthocytosis"", ""neurocanthocytosis"""	NA, NAC		8004674, 11761473	Standard	NM_021083		Approved	XKR1, Kx, X1k	uc004ddq.3	P51811	OTTHUMG00000033171	ENST00000378616.3:c.521C>A	X.37:g.37586901C>A	ENSP00000367879:p.Thr174Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q4TTN6|Q8IUK6|Q9UC77	Missense_Mutation	SNP	ENST00000378616.3	37	CCDS14241.1	.	.	.	.	.	.	.	.	.	.	C	7.455	0.643490	0.14451	.	.	ENSG00000047597	ENST00000378616	T	0.65732	-0.17	5.34	2.29	0.28610	.	0.612404	0.17650	N	0.166732	T	0.45796	0.1360	L	0.29908	0.895	0.09310	N	1	B	0.26902	0.163	B	0.29942	0.109	T	0.35798	-0.9774	10	0.46703	T	0.11	-20.5575	4.5792	0.12250	0.0:0.3861:0.1586:0.4553	.	174	P51811	XK_HUMAN	N	174	ENSP00000367879:T174N	ENSP00000367879:T174N	T	+	2	0	XK	37471840	0.052000	0.20516	0.003000	0.11579	0.591000	0.36615	1.511000	0.35801	0.024000	0.15214	0.556000	0.70494	ACC		0.498	XK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080875.1		NM_021083	
ZACN	353174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	74076506	74076506	+	Splice_Site	SNP	G	G	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr17:74076506G>A	ENST00000334586.5	+	5	627		c.e5+1		ZACN_ENST00000392503.2_Intron|EXOC7_ENST00000591724.1_5'Flank	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel						ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						AGCAACACGGGTGCTGACAGG	0.662																																																	0													59.0	54.0	56.0					17																	74076506		2203	4300	6503	SO:0001630	splice_region_variant	353174			AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.544+1G>A	17.37:g.74076506G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q2TB29|Q6ZWK3|Q86YW4	Splice_Site	SNP	ENST00000334586.5	37	CCDS11740.2	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068300	0.55539	.	.	ENSG00000186919	ENST00000334586	.	.	.	4.69	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5366	0.45007	0.0935:0.0:0.9065:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZACN	71588101	0.993000	0.37304	0.978000	0.43139	0.791000	0.44710	1.211000	0.32382	1.175000	0.42826	0.655000	0.94253	.		0.662	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2		NM_180990	Intron
ZNF106	64397	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42744055	42744055	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4639-01A-02D-1386-10	TCGA-CJ-4639-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9df6d1b1-5a09-4082-8ec0-61b12b3c8801	bb11b4d9-1656-4dd8-9916-c2a717201dc2	g.chr15:42744055T>A	ENST00000263805.4	-	2	672	c.346A>T	c.(346-348)Agt>Tgt	p.S116C	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	116					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGACTGTAACTCTCTCTGTCT	0.448																																																	0													201.0	177.0	186.0					15																	42744055		2203	4299	6502	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.346A>T	15.37:g.42744055T>A	ENSP00000263805:p.Ser116Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.413006	0.62511	.	.	ENSG00000103994	ENST00000263805	T	0.18016	2.24	5.63	3.37	0.38596	.	0.305004	0.30302	N	0.009935	T	0.12305	0.0299	L	0.40543	1.245	0.80722	D	1	P	0.48162	0.906	B	0.40702	0.338	T	0.01702	-1.1292	10	0.59425	D	0.04	-7.0155	5.0467	0.14487	0.0:0.3166:0.0:0.6834	.	116	Q9H2Y7	ZF106_HUMAN	C	116	ENSP00000263805:S116C	ENSP00000263805:S116C	S	-	1	0	ZFP106	40531347	0.118000	0.22208	1.000000	0.80357	0.991000	0.79684	0.662000	0.25038	2.146000	0.66826	0.515000	0.50301	AGT		0.448	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1		NM_022473	
