#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM28	10863	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	24170950	24170950	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr8:24170950C>T	ENST00000265769.4	+	6	543	c.433C>T	c.(433-435)Ccc>Tcc	p.P145S	ADAM28_ENST00000437154.2_Missense_Mutation_p.P145S|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000397649.3_5'UTR|ADAM28_ENST00000540823.1_Intron|RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	145					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P145S(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		ACCTTTAAGCCCCATACATCG	0.438																																					NSCLC(193;488 2149 22258 34798 40734)												1	Substitution - Missense(1)	kidney(1)											126.0	113.0	118.0					8																	24170950		2203	4300	6503	SO:0001583	missense	10863			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.433C>T	8.37:g.24170950C>T	ENSP00000265769:p.Pro145Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	37	CCDS34865.1	.	.	.	.	.	.	.	.	.	.	C	1.422	-0.572703	0.03882	.	.	ENSG00000042980	ENST00000265769;ENST00000437154	T;T	0.04970	3.52;3.52	5.49	1.51	0.23008	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.03695	0.0105	N	0.24115	0.695	0.09310	N	0.999998	B;B	0.09022	0.002;0.001	B;B	0.14578	0.011;0.004	T	0.48875	-0.8996	9	0.09338	T	0.73	.	5.1403	0.14955	0.0:0.5917:0.1496:0.2586	.	145;145	Q9UKQ2;Q9UKQ2-2	ADA28_HUMAN;.	S	145	ENSP00000265769:P145S;ENSP00000393699:P145S	ENSP00000265769:P145S	P	+	1	0	ADAM28	24226895	0.000000	0.05858	0.010000	0.14722	0.096000	0.18686	-0.651000	0.05372	0.052000	0.16007	-0.254000	0.11334	CCC		0.438	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2		NM_021778	
ANK2	287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	114286249	114286249	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr4:114286249T>A	ENST00000357077.4	+	41	10996	c.10943T>A	c.(10942-10944)cTc>cAc	p.L3648H	ANK2_ENST00000264366.6_Missense_Mutation_p.L3615H|ANK2_ENST00000509550.1_Missense_Mutation_p.L739H|ANK2_ENST00000510275.2_Missense_Mutation_p.L215H|ANK2_ENST00000506722.1_Missense_Mutation_p.L1554H|ANK2_ENST00000394537.3_Missense_Mutation_p.L1563H	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3648	Death 2. {ECO:0000255|PROSITE- ProRule:PRU00064}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.L3648H(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATTGTTCATCTCATGGAGACC	0.418																																																	1	Substitution - Missense(1)	kidney(1)											164.0	145.0	151.0					4																	114286249		2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10943T>A	4.37:g.114286249T>A	ENSP00000349588:p.Leu3648His	Somatic		WXS	Illumina HiSeq	Phase_I	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.815673	0.90790	.	.	ENSG00000145362	ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	D;D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	5.41	5.41	0.78517	.	0.140362	0.32578	N	0.005917	D	0.91402	0.7287	L	0.49126	1.545	0.51482	D	0.999926	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.982;1.0;0.978;1.0;1.0	D	0.91973	0.5588	10	0.59425	D	0.04	.	15.4301	0.75087	0.0:0.0:0.0:1.0	.	739;598;564;1563;3648;1554	E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.;.;.;.;.;.	H	1554;598;1563;3648;3615;1554;739;215;658	ENSP00000421067:L1554H;ENSP00000378044:L1563H;ENSP00000349588:L3648H;ENSP00000264366:L3615H;ENSP00000426944:L739H;ENSP00000421023:L215H;ENSP00000422498:L658H	ENSP00000264366:L3615H	L	+	2	0	ANK2	114505698	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.557000	0.82243	2.056000	0.61249	0.459000	0.35465	CTC		0.418	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2		NM_001148	
ATP1B1	481	broad.mit.edu	37	1	169101269	169101270	+	3'UTR	INS	-	-	G	rs200351363|rs199593766		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:169101269_169101270insG	ENST00000367816.1	+	0	1917_1918				ATP1B1_ENST00000499679.3_3'UTR			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide						blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					tttttttttttttttttttttg	0.317																																																	0																																										SO:0001624	3_prime_UTR_variant	481			U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.*477->G	1.37:g.169101269_169101270insG		Somatic		WXS	Illumina GAIIx	Phase_I	Q5TGZ3	RNA	INS	ENST00000367816.1	37	CCDS1276.1																																																																																				0.317	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1			
B3GALNT2	148789	broad.mit.edu;ucsc.edu	37	1	235618936	235618936	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:235618936G>T	ENST00000366600.3	-	9	1314	c.1086C>A	c.(1084-1086)gaC>gaA	p.D362E		NM_152490.2	NP_689703.1	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	362					protein glycosylation (GO:0006486)|protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|acetylglucosaminyltransferase activity (GO:0008375)|galactosyltransferase activity (GO:0008378)	p.D362E(1)		NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			CAGCTTCGAGGTCTATGTAAC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											112.0	96.0	101.0					1																	235618936		2203	4300	6503	SO:0001583	missense	148789			BC029564	CCDS1606.1, CCDS60453.1	1q42.3	2013-02-19	2006-06-14		ENSG00000162885	ENSG00000162885		"""Beta 3-glycosyltransferases"""	28596	protein-coding gene	gene with protein product		610194	"""UDP-GalNAc:betaGlcNAc beta-1,3-galactosaminyltransferase, polypeptide 2"""			14724282	Standard	NM_001277155		Approved	MGC39558	uc001hxc.3	Q8NCR0	OTTHUMG00000040468	ENST00000366600.3:c.1086C>A	1.37:g.235618936G>T	ENSP00000355559:p.Asp362Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q59GR3|Q5TCI3|Q96AL7	Missense_Mutation	SNP	ENST00000366600.3	37	CCDS1606.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.792143	0.70452	.	.	ENSG00000162885	ENST00000366600	T	0.40756	1.02	5.64	3.42	0.39159	.	0.096849	0.64402	D	0.000001	T	0.58466	0.2124	M	0.71581	2.175	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.60586	-0.7234	10	0.59425	D	0.04	-29.9269	9.3885	0.38359	0.2572:0.0:0.7428:0.0	.	362	Q8NCR0	B3GL2_HUMAN	E	362	ENSP00000355559:D362E	ENSP00000355559:D362E	D	-	3	2	B3GALNT2	233685559	1.000000	0.71417	0.951000	0.38953	0.923000	0.55619	2.596000	0.46205	1.379000	0.46325	0.655000	0.94253	GAC		0.413	B3GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097376.1		NM_152490	
RGCC	28984	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	42042974	42042974	+	Splice_Site	SNP	A	A	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr13:42042974A>G	ENST00000379359.3	+	4	555	c.406A>G	c.(406-408)Agt>Ggt	p.S136G	RGCC_ENST00000487837.1_3'UTR	NM_014059.2	NP_054778.2	Q9H4X1	RGCC_HUMAN	regulator of cell cycle	136					cellular response to hypoxia (GO:0071456)|complement activation (GO:0006956)|fibroblast activation (GO:0072537)|mitotic cell cycle arrest (GO:0071850)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of exit from mitosis (GO:0001100)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mitotic cell cycle phase transition (GO:1901991)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of mitosis (GO:0045840)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stress fiber assembly (GO:0051496)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)	p.S136G(1)									AACTTTAGCAAGTAAGTACAT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											64.0	59.0	60.0					13																	42042974		1826	4087	5913	SO:0001630	splice_region_variant	0			AF036549	CCDS41880.1	13q14.11	2012-02-20	2012-02-20	2012-02-20	ENSG00000102760	ENSG00000102760			20369	protein-coding gene	gene with protein product	"""response gene to complement 32"""	610077	"""chromosome 13 open reading frame 15"""	C13orf15		17146433, 19158077, 19652095	Standard	NM_014059		Approved	bA157L14.2, RGC-32, RGC32	uc001uyi.2	Q9H4X1	OTTHUMG00000016796	ENST00000379359.3:c.406+1A>G	13.37:g.42042974A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6NZ48|Q9UL69	Missense_Mutation	SNP	ENST00000379359.3	37	CCDS41880.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.023075	0.75275	.	.	ENSG00000102760	ENST00000379359	.	.	.	5.84	4.65	0.58169	.	0.041945	0.85682	D	0.000000	T	0.56775	0.2008	M	0.66939	2.045	0.49798	D	0.999822	P	0.46142	0.873	B	0.43251	0.413	T	0.60974	-0.7156	9	0.46703	T	0.11	-13.7277	11.3509	0.49587	0.9262:0.0:0.0738:0.0	.	136	Q9H4X1	RGC32_HUMAN	G	136	.	ENSP00000368664:S136G	S	+	1	0	C13orf15	40940974	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.039000	0.76544	2.239000	0.73571	0.533000	0.62120	AGT		0.383	RGCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044684.1		NM_014059	Missense_Mutation
CALR	811	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	13051666	13051666	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:13051666G>T	ENST00000316448.5	+	7	998	c.925G>T	c.(925-927)Gat>Tat	p.D309Y		NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	309	C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.D309Y(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	CTATGCCTATGATAACTTTGG	0.532																																																	1	Substitution - Missense(1)	kidney(1)											116.0	114.0	114.0					19																	13051666		2203	4300	6503	SO:0001583	missense	811			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.925G>T	19.37:g.13051666G>T	ENSP00000320866:p.Asp309Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	ENST00000316448.5	37	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.877012	0.33162	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.51325	0.71	5.27	3.02	0.34903	.	0.049550	0.85682	D	0.000000	T	0.60340	0.2261	M	0.65320	2	0.80722	D	1	D	0.55800	0.973	P	0.59115	0.852	T	0.61436	-0.7063	10	0.49607	T	0.09	-21.1217	14.2346	0.65916	0.0:0.2857:0.7143:0.0	.	309	P27797	CALR_HUMAN	Y	309;188	ENSP00000320866:D309Y	ENSP00000320866:D309Y	D	+	1	0	CALR	12912666	1.000000	0.71417	0.018000	0.16275	0.046000	0.14306	5.492000	0.66893	0.536000	0.28733	0.557000	0.71058	GAT		0.532	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1		NM_004343	
CBLB	868	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	105389115	105389115	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr3:105389115C>A	ENST00000264122.4	-	18	2972	c.2651G>T	c.(2650-2652)aGa>aTa	p.R884I	CBLB_ENST00000394027.3_Missense_Mutation_p.R862I|CBLB_ENST00000407712.1_Missense_Mutation_p.R99I	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	884	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R884I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						CTGTGATGTTCTGTTAGTTTT	0.368			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)			Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	1	Substitution - Missense(1)	kidney(1)											158.0	139.0	145.0					3																	105389115		2203	4300	6503	SO:0001583	missense	868			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.2651G>T	3.37:g.105389115C>A	ENSP00000264122:p.Arg884Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658506	0.88154	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000407712;ENST00000394027	T;D;T;D	0.86432	-1.47;-2.07;-1.4;-2.12	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90130	0.6916	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.998	D;D;D	0.78314	0.986;0.991;0.991	D	0.90892	0.4762	10	0.87932	D	0	-19.2085	18.4242	0.90604	0.0:1.0:0.0:0.0	.	862;884;862	E7ENW2;Q13191;B4DYP3	.;CBLB_HUMAN;.	I	223;884;99;862	ENSP00000377598:R223I;ENSP00000264122:R884I;ENSP00000384170:R99I;ENSP00000377595:R862I	ENSP00000264122:R884I	R	-	2	0	CBLB	106871805	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.464000	0.53057	2.865000	0.98341	0.655000	0.94253	AGA		0.368	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2		NM_170662	
GPATCH11	253635	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	37321281	37321281	+	Silent	SNP	A	A	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:37321281A>G	ENST00000608836.1	+	7	730	c.585A>G	c.(583-585)gaA>gaG	p.E195E	GPATCH11_ENST00000409774.1_Silent_p.E221E|GPATCH11_ENST00000281932.5_Silent_p.E92E	NM_174931.2	NP_777591.3	Q8N954	GPT11_HUMAN	G patch domain containing 11	195							nucleic acid binding (GO:0003676)	p.E92E(1)|p.E195E(1)									aggagactgaagaagatgaag	0.393																																																	2	Substitution - coding silent(2)	kidney(2)											89.0	76.0	80.0					2																	37321281		2203	4300	6503	SO:0001819	synonymous_variant	253635			AK095667	CCDS1785.2, CCDS62891.1, CCDS1785.3	2p22.2	2013-11-05	2013-01-28	2013-01-28	ENSG00000152133	ENSG00000152133		"""G patch domain containing"""	26768	protein-coding gene	gene with protein product	"""centromere protein Y"""		"""coiled-coil domain containing 75"""	CCDC75			Standard	NM_001278505		Approved	FLJ38348, CENPY, CENP-Y	uc010ezz.3	Q8N954	OTTHUMG00000128469	ENST00000608836.1:c.585A>G	2.37:g.37321281A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0D9|B7Z2G4|B8ZZ44	Silent	SNP	ENST00000608836.1	37	CCDS1785.2																																																																																				0.393	GPATCH11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_174931	
CDK11A	728642	hgsc.bcm.edu	37	1	1647893	1647894	+	In_Frame_Ins	INS	-	-	TTTCTT	rs200224067|rs199866927|rs144636354		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:1647893_1647894insTTTCTT	ENST00000378633.1	-	5	428_429	c.349_350insAAGAAA	c.(349-351)aga>aAAGAAAga	p.116_117insKE	CDK11A_ENST00000378638.2_In_Frame_Ins_p.92_93insKE|CDK11A_ENST00000404249.3_In_Frame_Ins_p.126_127insKE|CDK11A_ENST00000358779.5_In_Frame_Ins_p.116_117insKE|CDK11A_ENST00000356200.3_In_Frame_Ins_p.92_93insKE|CDK11A_ENST00000378635.3_In_Frame_Ins_p.116_117insKE|CDK11A_ENST00000357760.2_In_Frame_Ins_p.116_117insKE|RP1-283E3.8_ENST00000598846.1_RNA			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	116	Glu-rich.				apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						TTCGTGCTCTCTTTCTTTCACT	0.485																																					Pancreas(186;965 2119 30274 40311 50569)												0																																										SO:0001652	inframe_insertion	984			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.344_349dupAAGAAA	1.37:g.1647894_1647899dupTTTCTT	ENSP00000367900:p.Lys115_Glu116dup	Somatic		WXS	Illumina HiSeq	Phase_I	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	In_Frame_Ins	INS	ENST00000378633.1	37																																																																																					0.485	CDK11A-005	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000001735.1		NM_024011	
CNNM2	54805	broad.mit.edu	37	10	104678907	104678909	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr10:104678907_104678909delCCG	ENST00000369878.4	+	1	858_860	c.670_672delCCG	c.(670-672)ccgdel	p.P227del	CNNM2_ENST00000433628.2_In_Frame_Del_p.P227del|CNNM2_ENST00000369875.3_In_Frame_Del_p.P227del	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	227					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGCCGGGCTCCCGCCGCCCCCGT	0.719																																																	0																																										SO:0001651	inframe_deletion	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.670_672delCCG	10.37:g.104678910_104678912delCCG	ENSP00000358894:p.Pro227del	Somatic		WXS	Illumina GAIIx	Phase_I	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	In_Frame_Del	DEL	ENST00000369878.4	37	CCDS44474.1																																																																																				0.719	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3		NM_017649	
CROCCP3	114819	broad.mit.edu	37	1	16802965	16802965	+	RNA	DEL	G	G	-			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:16802965delG	ENST00000263511.4	-	0	2366					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGCTTGGACAGGGAGTCCTGC	0.627																																																	0																																												0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16802965delG		Somatic		WXS	Illumina GAIIx	Phase_I	Q96PW6	Frame_Shift_Del	DEL	ENST00000263511.4	37																																																																																					0.627	CROCCP3-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000458172.1		XM_057040	
CRTAC1	55118	broad.mit.edu;ucsc.edu	37	10	99664546	99664546	+	Silent	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr10:99664546C>T	ENST00000370597.3	-	7	1231	c.876G>A	c.(874-876)ggG>ggA	p.G292G	CRTAC1_ENST00000370591.2_Silent_p.G292G|CRTAC1_ENST00000298819.4_Silent_p.G292G	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	292						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.G292G(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CGACACCTCGCCCATGCTGGT	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	86.0	87.0					10																	99664546		2203	4300	6503	SO:0001819	synonymous_variant	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.876G>A	10.37:g.99664546C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Silent	SNP	ENST00000370597.3	37	CCDS31266.1																																																																																				0.607	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1		NM_018058	
DAAM1	23002	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	59834241	59834241	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr14:59834241C>T	ENST00000395125.1	+	24	2974	c.2951C>T	c.(2950-2952)tCa>tTa	p.S984L	DAAM1_ENST00000351081.1_Missense_Mutation_p.S984L|DAAM1_ENST00000360909.3_Missense_Mutation_p.S974L|DAAM1_ENST00000553966.1_3'UTR	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	984	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.S984L(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CAAGCTGTGTCAGAAGCCAAA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											115.0	112.0	113.0					14																	59834241		2203	4300	6503	SO:0001583	missense	23002			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.2951C>T	14.37:g.59834241C>T	ENSP00000378557:p.Ser984Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.886674	0.33348	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000395125	T;T;T	0.62941	-0.01;-0.01;-0.01	5.87	5.87	0.94306	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (2);	0.696787	0.15303	N	0.269539	T	0.46814	0.1412	N	0.21373	0.66	0.09310	N	1	B;B	0.26445	0.149;0.052	B;B	0.28465	0.09;0.055	T	0.28202	-1.0051	10	0.23891	T	0.37	.	9.5114	0.39078	0.1434:0.7861:0.0:0.0705	.	974;984	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	L	974;984;984	ENSP00000354162:S974L;ENSP00000247170:S984L;ENSP00000378557:S984L	ENSP00000247170:S984L	S	+	2	0	DAAM1	58903994	0.721000	0.28007	1.000000	0.80357	0.991000	0.79684	3.088000	0.50175	2.941000	0.99782	0.655000	0.94253	TCA		0.408	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2		NM_014992	
DIDO1	11083	hgsc.bcm.edu	37	20	61513427	61513438	+	In_Frame_Del	DEL	GCTGCTGTTGTG	GCTGCTGTTGTG	-	rs374696200|rs141398076|rs199561380	byFrequency	TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	GCTGCTGTTGTG	GCTGCTGTTGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr20:61513427_61513438delGCTGCTGTTGTG	ENST00000266070.4	-	16	4195_4206	c.3870_3881delCACAACAGCAGC	c.(3868-3882)gccacaacagcagcg>gcg	p.1290_1294ATTAA>A	DIDO1_ENST00000395343.1_In_Frame_Del_p.1290_1294ATTAA>A	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1290					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGAGGCTGCCGCTGCTGTTGTGGCTGCTGTGG	0.608														13	0.00259585	0.0	0.0014	5008	,	,		16798	0.0		0.006	False		,,,				2504	0.0061				Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0									,	4,4242		0,4,2119					,	-7.5	0.0			71	31,8193		0,31,4081	no	coding,coding	DIDO1	NM_033081.2,NM_001193369.1	,	0,35,6200	A1A1,A1R,RR		0.3769,0.0942,0.2807	,	,		35,12435				SO:0001651	inframe_deletion	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3870_3881delCACAACAGCAGC	20.37:g.61513427_61513438delGCTGCTGTTGTG	ENSP00000266070:p.Ala1290_Ala1293del	Somatic		WXS	Illumina HiSeq	Phase_I	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	In_Frame_Del	DEL	ENST00000266070.4	37	CCDS33506.1																																																																																				0.608	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2		NM_080796	
DNAH14	127602	broad.mit.edu	37	1	225273305	225273305	+	Intron	SNP	T	T	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:225273305T>C	ENST00000445597.2	+	16	2938				DNAH14_ENST00000430092.1_Silent_p.A1129A|DNAH14_ENST00000439375.2_Silent_p.A1129A			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.A1129A(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATGAAGCTGCTCTTGAAAAAA	0.299																																																	1	Substitution - coding silent(1)	kidney(1)											137.0	114.0	121.0					1																	225273305		692	1591	2283	SO:0001627	intron_variant	127602			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2939-74T>C	1.37:g.225273305T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	37																																																																																					0.299	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3		XM_059166	
DNAH6	1768	broad.mit.edu;ucsc.edu	37	2	84945368	84945368	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:84945368A>G	ENST00000237449.6	+	58	9660	c.9652A>G	c.(9652-9654)Aga>Gga	p.R3218G	DNAH6_ENST00000389394.3_Missense_Mutation_p.R3218G			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3218	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3218G(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GGAAGAACAAAGAATTAAGCT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											188.0	170.0	176.0					2																	84945368		692	1591	2283	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9652A>G	2.37:g.84945368A>G	ENSP00000237449:p.Arg3218Gly	Somatic		WXS	Illumina GAIIx	Phase_I	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.358110	0.61403	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.23348	1.91;1.91	5.69	5.69	0.88448	.	0.130133	0.35124	N	0.003439	T	0.58878	0.2153	M	0.91768	3.24	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.68750	-0.5326	10	0.87932	D	0	.	13.899	0.63790	1.0:0.0:0.0:0.0	.	3218	Q9C0G6	DYH6_HUMAN	G	3218	ENSP00000374045:R3218G;ENSP00000237449:R3218G	ENSP00000237449:R3218G	R	+	1	2	DNAH6	84798879	1.000000	0.71417	0.994000	0.49952	0.619000	0.37552	3.730000	0.55006	2.170000	0.68504	0.528000	0.53228	AGA		0.378	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2		NM_001370	
DNAH7	56171	broad.mit.edu;hgsc.bcm.edu;ucsc.edu|broad.mit.edu;ucsc.edu	37	2	196737119	196737120	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:196737119_196737120GC>TT	ENST00000312428.6	-	40	6587_6588	c.6487_6488GC>AA	c.(6487-6489)GCa>AAa	p.A2163K		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2163	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.A2163E(1)|p.A2163T(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ATTCTTCATTGCTTCTTTATAC	0.337																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6487_6488delinsTT	2.37:g.196737119_196737120delinsTT	ENSP00000311273:p.Ala2163Lys	Somatic		WXS	Illumina HiSeq|Illumina GAIIx	Phase_I	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																				0.337	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3		NM_018897	
DNHD1	144132	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6566997	6566997	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr11:6566997G>C	ENST00000527990.2	+	19	4828	c.4828G>C	c.(4828-4830)Ggt>Cgt	p.G1610R	DNHD1_ENST00000254579.6_Missense_Mutation_p.G1610R			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1610					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.G268R(1)|p.G1610R(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GTATCACTTGGGTTCACCTCA	0.512																																																	2	Substitution - Missense(2)	kidney(2)											68.0	62.0	63.0					11																	6566997		692	1591	2283	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.4828G>C	11.37:g.6566997G>C	ENSP00000436180:p.Gly1610Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277888	0.59758	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.25749	1.78;1.78	5.65	5.65	0.86999	.	0.287900	0.33938	N	0.004405	T	0.43366	0.1244	L	0.53249	1.67	0.41513	D	0.988359	D	0.63880	0.993	D	0.62955	0.909	T	0.06373	-1.0830	10	0.25106	T	0.35	.	16.6573	0.85232	0.0:0.0:1.0:0.0	.	1610	Q96M86	DNHD1_HUMAN	R	1610	ENSP00000254579:G1610R;ENSP00000436180:G1610R	ENSP00000254579:G1610R	G	+	1	0	DNHD1	6523573	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	5.990000	0.70595	2.655000	0.90218	0.655000	0.94253	GGT		0.512	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2		NM_144666	
DPP10	57628	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	116594279	116594279	+	Silent	SNP	C	C	A	rs138029087		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:116594279C>A	ENST00000410059.1	+	24	2619	c.2139C>A	c.(2137-2139)ggC>ggA	p.G713G	DPP10_ENST00000310323.8_Silent_p.G706G|DPP10_ENST00000393147.2_Silent_p.G717G|DPP10_ENST00000409163.1_Silent_p.G663G	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	713						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.G713G(1)|p.G706G(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATGTTCATGGCTTGAAAGAAG	0.313																																																	2	Substitution - coding silent(2)	kidney(2)											84.0	100.0	95.0					2																	116594279		2203	4300	6503	SO:0001819	synonymous_variant	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2139C>A	2.37:g.116594279C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																				0.313	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4		NM_020868	
DSC2	1824	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	28651750	28651750	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr18:28651750G>A	ENST00000280904.6	-	13	2389	c.1946C>T	c.(1945-1947)cCt>cTt	p.P649L	snoU13_ENST00000459603.1_RNA|DSC2_ENST00000251081.6_Missense_Mutation_p.P649L	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	649	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P649L(2)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CACTGTTATAGGTACTACATA	0.373																																																	2	Substitution - Missense(2)	kidney(2)											113.0	96.0	101.0					18																	28651750		2203	4300	6503	SO:0001583	missense	1824			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1946C>T	18.37:g.28651750G>A	ENSP00000280904:p.Pro649Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595717	0.66219	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.60171	0.21;0.21	6.02	5.15	0.70609	Cadherin (2);Cadherin-like (1);	0.267169	0.20056	N	0.100184	T	0.68375	0.2994	M	0.78637	2.42	0.48571	D	0.999672	P;P	0.50528	0.894;0.936	P;P	0.51615	0.476;0.675	T	0.72818	-0.4178	10	0.87932	D	0	.	12.1474	0.54031	0.1368:0.0:0.8632:0.0	.	649;649	Q02487;Q02487-2	DSC2_HUMAN;.	L	649;649;415;662	ENSP00000251081:P649L;ENSP00000280904:P649L	ENSP00000251081:P649L	P	-	2	0	DSC2	26905748	0.995000	0.38212	0.017000	0.16124	0.004000	0.04260	2.451000	0.44952	1.538000	0.49270	0.650000	0.86243	CCT		0.373	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1		NM_004949	
DSG1	1828	broad.mit.edu;ucsc.edu	37	18	28908167	28908167	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr18:28908167G>T	ENST00000257192.4	+	4	444	c.232G>T	c.(232-234)Gct>Tct	p.A78S		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	78	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)	p.A78S(1)		NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CTCAGATTGTGCTGCAAACCA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											85.0	83.0	84.0					18																	28908167		2203	4299	6502	SO:0001583	missense	1828			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.232G>T	18.37:g.28908167G>T	ENSP00000257192:p.Ala78Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706413	0.68615	.	.	ENSG00000134760	ENST00000257192	T	0.52295	0.67	5.59	4.67	0.58626	Cadherin (4);Cadherin-like (1);	0.218952	0.32608	N	0.005879	T	0.40119	0.1104	N	0.17674	0.51	0.80722	D	1	B	0.25719	0.132	B	0.36378	0.223	T	0.36672	-0.9738	10	0.49607	T	0.09	.	15.2721	0.73712	0.0:0.0:0.8591:0.1409	.	78	Q02413	DSG1_HUMAN	S	78	ENSP00000257192:A78S	ENSP00000257192:A78S	A	+	1	0	DSG1	27162165	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.753000	0.68736	2.635000	0.89317	0.563000	0.77884	GCT		0.373	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1		NM_001942	
ENTHD1	150350	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	40231926	40231926	+	Silent	SNP	G	G	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr22:40231926G>A	ENST00000325157.6	-	4	880	c.630C>T	c.(628-630)tgC>tgT	p.C210C		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	210								p.C210C(2)		breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GAACATCTTGGCAATGCTCTT	0.358																																																	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)											284.0	260.0	268.0					22																	40231926		2203	4300	6503	SO:0001819	synonymous_variant	150350			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.630C>T	22.37:g.40231926G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0QYD5|Q5H9F7|Q96LK3	Silent	SNP	ENST00000325157.6	37	CCDS13998.1																																																																																				0.358	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1		NM_152512	
GNPTAB	79158	hgsc.bcm.edu;ucsc.edu	37	12	102151009	102151009	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr12:102151009C>T	ENST00000299314.7	-	18	3677	c.3415G>A	c.(3415-3417)Gac>Aac	p.D1139N		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1139					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TTTCTTATGTCATCCAACTGG	0.313																																																	0													69.0	67.0	67.0					12																	102151009		2203	4300	6503	SO:0001583	missense	79158			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3415G>A	12.37:g.102151009C>T	ENSP00000299314:p.Asp1139Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	37	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	C	34	5.317768	0.95682	.	.	ENSG00000111670	ENST00000299314	D	0.82255	-1.59	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.90232	0.6946	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86794	0.1987	10	0.30078	T	0.28	-29.9449	20.6282	0.99521	0.0:1.0:0.0:0.0	.	1139	Q3T906	GNPTA_HUMAN	N	1139	ENSP00000299314:D1139N	ENSP00000299314:D1139N	D	-	1	0	GNPTAB	100675140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.459000	0.80802	2.871000	0.98454	0.655000	0.94253	GAC		0.313	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1			
GOLGA6L3	100133220	broad.mit.edu	37	15	83014132	83014132	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr15:83014132C>G	ENST00000557886.1	-	6	550	c.451G>C	c.(451-453)Gag>Cag	p.E151Q															p.E151Q(4)		endometrium(6)|kidney(5)|prostate(1)	12						GCTGGGGGCTCTGGGGCCAGG	0.522																																																	4	Substitution - Missense(4)	kidney(4)																																								SO:0001583	missense	647042																														ENST00000557886.1:c.451G>C	15.37:g.83014132C>G	ENSP00000452844:p.Glu151Gln	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000557886.1	37																																																																																					0.522	RP13-996F3.4-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419277.1			
GPR52	9293	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	174418158	174418158	+	Silent	SNP	C	C	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:174418158C>A	ENST00000367685.2	+	1	947	c.909C>A	c.(907-909)acC>acA	p.T303T	RABGAP1L_ENST00000251507.4_Intron|RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000357444.6_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	303					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T303T(1)		breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						TCTTAACAACCTGGCTTGCAA	0.423																																					Ovarian(92;924 1390 1930 16467 40583)												1	Substitution - coding silent(1)	kidney(1)											93.0	97.0	96.0					1																	174418158		2203	4300	6503	SO:0001819	synonymous_variant	9293			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.909C>A	1.37:g.174418158C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75654|Q4VBL6|Q6ISM0	Silent	SNP	ENST00000367685.2	37	CCDS30941.1																																																																																				0.423	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084511.1		NM_005684	
HLA-A	3105	broad.mit.edu	37	6	29910607	29910607	+	Silent	SNP	G	G	C	rs72555397		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr6:29910607G>C	ENST00000396634.1	+	4	488	c.147G>C	c.(145-147)gtG>gtC	p.V49V	HLA-A_ENST00000376809.5_Silent_p.V49V|HLA-A_ENST00000376806.5_Silent_p.V49V|HLA-A_ENST00000376802.2_Silent_p.V49V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	49	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.V49V(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TCATCGCCGTGGGCTACGTGG	0.692									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																																							2	Substitution - coding silent(2)	lung(1)|kidney(1)																																								SO:0001819	synonymous_variant	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.147G>C	6.37:g.29910607G>C		Somatic		WXS	Illumina GAIIx	Phase_I	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	CCDS34373.1																																																																																				0.692	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1		NM_002116	
RP3-470B24.5	0	broad.mit.edu	37	6	168377135	168377136	+	lincRNA	DNP	TT	TT	CG	rs377136730|rs372663828		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr6:168377135_168377136TT>CG	ENST00000538528.1	-	0	483_484																											CTGCAGTGTGTTGGGAGGAGGA	0.619																																																	0																																												100128124																														Exception_encountered	6.37:g.168377135_168377136delinsCG		Somatic		WXS	Illumina GAIIx	Phase_I		Silent|Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.619	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
IFNL2	282616	broad.mit.edu	37	19	39759493	39759493	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:39759493G>T	ENST00000331982.5	+	2	242	c.187G>T	c.(187-189)Gcc>Tcc	p.A63S		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	63					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)		p.A63S(1)									GGCCAAAGATGCCTTAGTGAG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											26.0	29.0	28.0					19																	39759493		2203	4298	6501	SO:0001583	missense	0			AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.187G>T	19.37:g.39759493G>T	ENSP00000333639:p.Ala63Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	ENST00000331982.5	37	CCDS42567.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764231	0.31228	.	.	ENSG00000183709	ENST00000331982	T	0.34472	1.36	3.25	-0.174	0.13319	.	1.328460	0.05051	N	0.478222	T	0.43144	0.1234	M	0.74647	2.275	0.09310	N	1	P	0.35192	0.489	B	0.41299	0.353	T	0.45454	-0.9260	10	0.62326	D	0.03	-0.548	5.3042	0.15795	0.4105:0.0:0.5895:0.0	.	63	Q8IZJ0	IL28A_HUMAN	S	63	ENSP00000333639:A63S	ENSP00000333639:A63S	A	+	1	0	IL28A	44451333	0.001000	0.12720	0.110000	0.21437	0.745000	0.42441	0.078000	0.14761	0.214000	0.20742	0.430000	0.28490	GCC		0.612	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463833.1		NM_172138	
IQGAP2	10788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	75896708	75896708	+	Silent	SNP	C	C	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr5:75896708C>G	ENST00000274364.6	+	11	1440	c.1143C>G	c.(1141-1143)gcC>gcG	p.A381A	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	381					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.A381A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TAAACCAGGCCTTGGAAAGCA	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											155.0	137.0	143.0					5																	75896708		2203	4300	6503	SO:0001819	synonymous_variant	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1143C>G	5.37:g.75896708C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	ENST00000274364.6	37	CCDS34188.1																																																																																				0.448	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1		NM_006633	
JAK3	3718	broad.mit.edu;ucsc.edu	37	19	17954627	17954627	+	Silent	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:17954627G>T	ENST00000527670.1	-	2	296	c.267C>A	c.(265-267)tcC>tcA	p.S89S	JAK3_ENST00000534444.1_Silent_p.S89S|JAK3_ENST00000458235.1_Silent_p.S89S|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	89	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.S89S(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CATCCTCCACGGAGAAGATGT	0.582		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	2	Substitution - coding silent(2)	kidney(2)											55.0	57.0	56.0					19																	17954627		2203	4300	6503	SO:0001819	synonymous_variant	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.267C>A	19.37:g.17954627G>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Silent	SNP	ENST00000527670.1	37	CCDS12366.1																																																																																				0.582	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1		NM_000215	
KLHL34	257240	broad.mit.edu	37	X	21674384	21674384	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chrX:21674384delT	ENST00000379499.2	-	1	2064	c.1523delA	c.(1522-1524)aagfs	p.K509fs		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	509						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						GGGTGCCTTCTTGCTCCAAAC	0.632																																																	0													39.0	23.0	28.0					X																	21674384		2203	4299	6502	SO:0001589	frameshift_variant	257240			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1523delA	X.37:g.21674384delT	ENSP00000368813:p.Lys509fs	Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000379499.2	37	CCDS14199.1																																																																																				0.632	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1		NM_153270	
CERS2	29956	broad.mit.edu;hgsc.bcm.edu	37	1	150939613	150939613	+	Silent	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:150939613G>T	ENST00000271688.6	-	8	1064	c.678C>A	c.(676-678)gcC>gcA	p.A226A	CERS2_ENST00000345896.4_5'UTR|RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000561294.1_Silent_p.A217A|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000368954.5_Silent_p.A226A	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	226	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.A226A(1)									GGATGTAATTGGCAAACCAGG	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											101.0	97.0	98.0					1																	150939613		2203	4300	6503	SO:0001819	synonymous_variant	0			AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.678C>A	1.37:g.150939613G>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Silent	SNP	ENST00000271688.6	37	CCDS973.1																																																																																				0.502	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084897.2		NM_022075	
Unknown	0	broad.mit.edu	37	12	88906	88906	+	IGR	SNP	A	A	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr12:88906A>T								AC215219.1 (15584 upstream) : AC026369.1 (58145 downstream)																							ccccaccaccacccccaGCTC	0.642																																																	0																																										SO:0001628	intergenic_variant	100288778																															12.37:g.88906A>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.642									
Unknown	0	broad.mit.edu	37	1	13183615	13183615	+	IGR	SNP	T	T	C	rs200176197		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:13183615T>C								RP13-221M14.3 (19147 upstream) : PRAMEF26 (32740 downstream)																							CTTTTGGCTCTGCAGCCAGGT	0.493																																																	0													62.0	49.0	53.0					1																	13183615		692	1591	2283	SO:0001628	intergenic_variant	440563																															1.37:g.13183615T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.493									
LRFN2	57497	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	40400231	40400231	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr6:40400231G>A	ENST00000338305.6	-	2	1164	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	208						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R208W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TTCTGCAGCCGATTGGAGGTG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											60.0	65.0	63.0					6																	40400231		2203	4300	6503	SO:0001583	missense	57497			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.622C>T	6.37:g.40400231G>A	ENSP00000345985:p.Arg208Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747409	0.49257	.	.	ENSG00000156564	ENST00000338305	T	0.60040	0.22	5.76	-0.821	0.10822	.	0.000000	0.85682	D	0.000000	T	0.66771	0.2823	M	0.83012	2.62	0.53688	D	0.999975	D	0.89917	1.0	D	0.81914	0.995	T	0.73036	-0.4109	10	0.87932	D	0	.	13.4278	0.61037	0.0:0.0957:0.2379:0.6664	.	208	Q9ULH4	LRFN2_HUMAN	W	208	ENSP00000345985:R208W	ENSP00000345985:R208W	R	-	1	2	LRFN2	40508209	1.000000	0.71417	0.726000	0.30738	0.801000	0.45260	0.991000	0.29654	-0.493000	0.06678	0.655000	0.94253	CGG		0.612	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1		XM_166372	
LRP2	4036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	170027130	170027130	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:170027130A>G	ENST00000263816.3	-	59	11596	c.11311T>C	c.(11311-11313)Tgc>Cgc	p.C3771R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3771	LDL-receptor class A 32. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.C3771R(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GAGGGAATGCACTGCTGATTG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											179.0	145.0	157.0					2																	170027130		2203	4300	6503	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11311T>C	2.37:g.170027130A>G	ENSP00000263816:p.Cys3771Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.552383	0.65311	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.99919	-8.0	5.86	5.86	0.93980	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99949	0.9978	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95982	0.8978	10	0.87932	D	0	.	16.2668	0.82588	1.0:0.0:0.0:0.0	.	3771	P98164	LRP2_HUMAN	R	3771;466	ENSP00000263816:C3771R	ENSP00000263816:C3771R	C	-	1	0	LRP2	169735376	1.000000	0.71417	0.927000	0.36925	0.137000	0.21094	9.339000	0.96797	2.240000	0.73641	0.533000	0.62120	TGC		0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2		NM_004525	
LRP4	4038	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	46894661	46894661	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr11:46894661C>G	ENST00000378623.1	-	30	4815	c.4573G>C	c.(4573-4575)Gat>Cat	p.D1525H	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1525					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.D1525H(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CTGCGGGTATCATAGTCCAGG	0.502																																																	1	Substitution - Missense(1)	kidney(1)											116.0	112.0	113.0					11																	46894661		2201	4299	6500	SO:0001583	missense	4038			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.4573G>C	11.37:g.46894661C>G	ENSP00000367888:p.Asp1525His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470954	0.84533	.	.	ENSG00000134569	ENST00000378623	D	0.93547	-3.24	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.88644	0.6492	N	0.20401	0.57	0.80722	D	1	B	0.31100	0.308	B	0.27076	0.076	D	0.86301	0.1680	10	0.48119	T	0.1	.	19.5934	0.95525	0.0:1.0:0.0:0.0	.	1525	O75096	LRP4_HUMAN	H	1525	ENSP00000367888:D1525H	ENSP00000367888:D1525H	D	-	1	0	LRP4	46851237	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.016000	0.70798	2.724000	0.93272	0.561000	0.74099	GAT		0.502	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1		NM_002334	
LYST	1130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	235918888	235918889	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:235918888_235918889insT	ENST00000389794.3	-	25	7292_7293	c.7118_7119insA	c.(7117-7119)aatfs	p.N2373fs	LYST_ENST00000389793.2_Frame_Shift_Ins_p.N2373fs			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2373					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAAATCCACGATTCTTCAGAAA	0.327																																																	0																																										SO:0001589	frameshift_variant	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.7119dupA	1.37:g.235918890_235918890dupT	ENSP00000374444:p.Asn2373fs	Somatic		WXS	Illumina HiSeq	Phase_I	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Frame_Shift_Ins	INS	ENST00000389794.3	37	CCDS31062.1																																																																																				0.327	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			
TRPM3	80036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	73424944	73424944	+	Intron	SNP	C	C	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr9:73424944C>A	ENST00000377111.2	-	6	1217				TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000396283.1_Intron|TRPM3_ENST00000377106.1_Intron|TRPM3_ENST00000377110.3_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000360823.2_Intron|TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000361823.5_Intron|TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000358082.3_Intron|TRPM3_ENST00000423814.3_Intron|MIR204_ENST00000385200.1_RNA|TRPM3_ENST00000396292.4_Intron	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TTCATATATTCTCAGGCATAG	0.478																																																	0													191.0	169.0	176.0					9																	73424944		1568	3582	5150	SO:0001627	intron_variant	406987			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.973+17818G>T	9.37:g.73424944C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	RNA	SNP	ENST00000377111.2	37																																																																																					0.478	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5		NM_206945	
Unknown	0	broad.mit.edu	37	1	16975093	16975093	+	IGR	SNP	C	C	T	rs2095111	byFrequency	TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:16975093C>T								CROCCP2 (14039 upstream) : RNU1-3 (18186 downstream)																							TGGGGATAGCCATGGGCCCTG	0.622																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16975093C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.622									
MUC4	4585	broad.mit.edu	37	3	195505960	195505960	+	Missense_Mutation	SNP	G	G	C	rs112020305	byFrequency	TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr3:195505960G>C	ENST00000463781.3	-	2	12950	c.12491C>G	c.(12490-12492)aCc>aGc	p.T4164S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4164S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4164S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGCGTCGGTGACAGGAAG	0.587													.|||	17	0.00339457	0.0129	0.0	5008	,	,		10875	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(1)|endometrium(1)											19.0	12.0	14.0					3																	195505960		671	1528	2199	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12491C>G	3.37:g.195505960G>C	ENSP00000417498:p.Thr4164Ser	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.985	0.182849	0.09495	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.38;1.29	.	.	.	.	.	.	.	.	T	0.19248	0.0462	N	0.19112	0.55	0.09310	N	0.999997	P	0.37985	0.613	B	0.35899	0.213	T	0.14587	-1.0467	7	.	.	.	.	5.8529	0.18704	9.0E-4:0.0:0.9991:0.0	.	4036	E7ESK3	.	S	4164	ENSP00000417498:T4164S;ENSP00000420243:T4164S	.	T	-	2	0	MUC4	196990739	0.002000	0.14202	0.025000	0.17156	0.022000	0.10575	0.413000	0.21148	0.073000	0.16731	0.074000	0.15403	ACC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195508298	195508299	+	Missense_Mutation	DNP	CC	CC	AT	rs562164725|rs2453135	byFrequency	TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr3:195508298_195508299CC>AT	ENST00000463781.3	-	2	10611_10612	c.10152_10153GG>AT	c.(10150-10155)tcGGca>tcATca	p.A3385S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3385S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCTGTGGATGCCGAGGAAATGT	0.579																																																	0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10152_10153delinsAT	3.37:g.195508298_195508299delinsAT	ENSP00000417498:p.Ala3385Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation|Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.579	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NAP1L4	4676	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	2992733	2992733	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr11:2992733G>A	ENST00000380542.4	-	6	487	c.347C>T	c.(346-348)cCa>cTa	p.P116L	NAP1L4_ENST00000526115.1_Missense_Mutation_p.P116L	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	116					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.P116L(1)		endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		CGCATCTGTTGGTTCAACATC	0.343																																																	1	Substitution - Missense(1)	kidney(1)											102.0	94.0	96.0					11																	2992733		1826	4086	5912	SO:0001583	missense	4676			AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.347C>T	11.37:g.2992733G>A	ENSP00000369915:p.Pro116Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6J4|F5HFY4	Missense_Mutation	SNP	ENST00000380542.4	37	CCDS41599.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761350	0.69763	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115;ENST00000448187;ENST00000399614;ENST00000430811;ENST00000529361;ENST00000528968;ENST00000530064;ENST00000526842	T;T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.61788	0.2375	M	0.87682	2.9	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.70016	0.964;0.967	T	0.67856	-0.5562	10	0.56958	D	0.05	-7.1136	18.478	0.90800	0.0:0.0:1.0:0.0	.	116;116	F5HFY4;Q99733	.;NP1L4_HUMAN	L	116;116;116;128;85;116;128;116;116;116	ENSP00000369915:P116L;ENSP00000436397:P116L;ENSP00000387783:P128L;ENSP00000382523:P85L;ENSP00000405912:P116L;ENSP00000435327:P128L;ENSP00000434759:P116L;ENSP00000432126:P116L;ENSP00000431799:P116L	ENSP00000369915:P116L	P	-	2	0	NAP1L4	2949309	1.000000	0.71417	0.914000	0.36105	0.164000	0.22412	8.850000	0.92190	2.587000	0.87381	0.655000	0.94253	CCA		0.343	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030273.3		NM_005969	
NAPSA	9476	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	50862276	50862276	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:50862276C>T	ENST00000253719.2	-	8	1235	c.1027G>A	c.(1027-1029)Gtc>Atc	p.V343I	NR1H2_ENST00000542413.1_Intron|NR1H2_ENST00000600978.1_Intron	NM_004851.1	NP_004842.1	O96009	NAPSA_HUMAN	napsin A aspartic peptidase	343					membrane protein proteolysis (GO:0033619)|proteolysis (GO:0006508)|surfactant homeostasis (GO:0043129)	alveolar lamellar body (GO:0097208)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)|peptidase activity (GO:0008233)	p.V343I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)		ACCTGGATGACGTAATCATGG	0.557																																																	1	Substitution - Missense(1)	kidney(1)											94.0	91.0	92.0					19																	50862276		2203	4300	6503	SO:0001583	missense	9476			AF090386	CCDS12794.1	19q13.33	2011-08-25				ENSG00000131400			13395	protein-coding gene	gene with protein product	"""kidney-derived aspartic protease-like protein"""	605631					Standard	NM_004851		Approved	NAP1, NAPA, Kdap, KAP	uc002prx.3	O96009		ENST00000253719.2:c.1027G>A	19.37:g.50862276C>T	ENSP00000253719:p.Val343Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WWD9	Missense_Mutation	SNP	ENST00000253719.2	37	CCDS12794.1	.	.	.	.	.	.	.	.	.	.	C	10.10	1.258115	0.23051	.	.	ENSG00000131400	ENST00000253719	T	0.59638	0.25	3.48	3.48	0.39840	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.268585	0.35870	N	0.002932	T	0.54287	0.1849	N	0.21282	0.65	0.44221	D	0.997051	D	0.76494	0.999	D	0.81914	0.995	T	0.50311	-0.8843	10	0.11794	T	0.64	.	7.083	0.25241	0.0:0.867:0.0:0.133	.	343	O96009	NAPSA_HUMAN	I	343	ENSP00000253719:V343I	ENSP00000253719:V343I	V	-	1	0	NAPSA	55554088	0.954000	0.32549	1.000000	0.80357	0.265000	0.26407	1.492000	0.35594	1.649000	0.50652	0.313000	0.20887	GTC		0.557	NAPSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464714.1		NM_004851	
NIF3L1	60491	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	201768224	201768224	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:201768224G>T	ENST00000409020.1	+	7	1251	c.957G>T	c.(955-957)atG>atT	p.M319I	NIF3L1_ENST00000409588.1_Missense_Mutation_p.C273F|NIF3L1_ENST00000359683.4_Missense_Mutation_p.M292I|NIF3L1_ENST00000416651.1_Missense_Mutation_p.M319I|NIF3L1_ENST00000409357.1_Missense_Mutation_p.M319I			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	319					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)	p.M292I(1)|p.M319I(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						TAGGTGAGATGTCCCATCATG	0.398																																																	2	Substitution - Missense(2)	kidney(2)											149.0	143.0	145.0					2																	201768224		1897	4128	6025	SO:0001583	missense	60491			AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.957G>T	2.37:g.201768224G>T	ENSP00000386394:p.Met319Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	ENST00000409020.1	37	CCDS46485.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.31|19.31	3.802648|3.802648	0.70682|0.70682	.|.	.|.	ENSG00000196290|ENSG00000196290	ENST00000409588|ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357	.|T;T;T;T	.|0.37752	.|1.18;1.18;1.18;1.18	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.034595	.|0.85682	.|D	.|0.000000	T|T	0.35219|0.35219	0.0924|0.0924	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|P	0.89917|0.48230	1.0|0.907	D|P	0.87578|0.47981	0.998|0.563	T|T	0.03384|0.03384	-1.1042|-1.1042	7|9	0.46703|0.08179	T|T	0.11|0.78	-18.7442|-18.7442	19.3851|19.3851	0.94553|0.94553	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	273|319	Q6X735|Q9GZT8	.|NIF3L_HUMAN	F|I	273|319;319;292;319	.|ENSP00000400787:M319I;ENSP00000386394:M319I;ENSP00000352711:M292I;ENSP00000387315:M319I	ENSP00000387021:C273F|ENSP00000352711:M292I	C|M	+|+	2|3	0|0	NIF3L1|NIF3L1	201476469|201476469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	9.301000|9.301000	0.96167|0.96167	2.656000|2.656000	0.90262|0.90262	0.557000|0.557000	0.71058|0.71058	TGT|ATG		0.398	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1		NM_021824	
NOP2	4839	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6672820	6672820	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr12:6672820C>A	ENST00000322166.5	-	7	769	c.648G>T	c.(646-648)gaG>gaT	p.E216D	NOP2_ENST00000382421.3_Missense_Mutation_p.E249D|NOP2_ENST00000545200.1_Missense_Mutation_p.E212D|NOP2_ENST00000399466.2_Missense_Mutation_p.E212D|NOP2_ENST00000542015.1_Intron|NOP2_ENST00000537442.1_Missense_Mutation_p.E216D|NOP2_ENST00000541778.1_Missense_Mutation_p.E212D	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	216					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.E212D(1)		breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						CAAATGGTTCCTCATCCACAT	0.572											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											49.0	51.0	50.0					12																	6672820		1974	4140	6114	SO:0001583	missense	4839				CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.648G>T	12.37:g.6672820C>A	ENSP00000313272:p.Glu216Asp	Somatic	635	WXS	Illumina HiSeq	Phase_I	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	37	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064626	0.36470	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944;ENST00000542867	T;T;T;T;T;T;T;T	0.52526	2.47;2.41;2.5;2.46;2.47;2.46;0.85;0.66	5.84	3.02	0.34903	.	0.524779	0.21862	N	0.068015	T	0.31389	0.0795	L	0.35341	1.055	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.10450	0.003;0.005	T	0.07790	-1.0754	10	0.33940	T	0.23	-22.58	4.4629	0.11675	0.1472:0.5568:0.0:0.296	.	249;212	Q3KQS4;P46087-2	.;.	D	216;249;212;212;216;212;92;212	ENSP00000444437:E216D;ENSP00000371858:E249D;ENSP00000439422:E212D;ENSP00000382392:E212D;ENSP00000313272:E216D;ENSP00000443150:E212D;ENSP00000440754:E92D;ENSP00000443035:E212D	ENSP00000313272:E216D	E	-	3	2	NOP2	6543081	0.125000	0.22332	0.933000	0.37362	0.778000	0.44026	0.079000	0.14782	0.368000	0.24481	0.563000	0.77884	GAG		0.572	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1		NM_006170	
NPAS4	266743	broad.mit.edu	37	11	66192144	66192144	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr11:66192144C>T	ENST00000311034.2	+	7	1959	c.1783C>T	c.(1783-1785)Cgg>Tgg	p.R595W		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	595					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.R595W(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						AGCCCAGCTCCGGGGCCCCCT	0.592																																																	1	Substitution - Missense(1)	kidney(1)											66.0	76.0	73.0					11																	66192144		2200	4295	6495	SO:0001583	missense	266743			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1783C>T	11.37:g.66192144C>T	ENSP00000311196:p.Arg595Trp	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860789	0.71834	.	.	ENSG00000174576	ENST00000311034	T	0.60548	0.18	4.69	4.69	0.59074	.	0.000000	0.50627	D	0.000112	T	0.63604	0.2525	N	0.24115	0.695	0.58432	D	0.999992	D	0.89917	1.0	D	0.77557	0.99	T	0.68243	-0.5460	10	0.72032	D	0.01	-13.1114	15.1587	0.72764	0.0:1.0:0.0:0.0	.	595	Q8IUM7	NPAS4_HUMAN	W	595	ENSP00000311196:R595W	ENSP00000311196:R595W	R	+	1	2	NPAS4	65948720	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	2.649000	0.46656	2.443000	0.82685	0.655000	0.94253	CGG		0.592	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1		NM_178864	
PABPC1	26986	hgsc.bcm.edu	37	8	101721933	101721933	+	Frame_Shift_Del	DEL	T	T	-	rs112966887		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr8:101721933delT	ENST00000318607.5	-	8	2127	c.999delA	c.(997-999)aaafs	p.K333fs	PABPC1_ENST00000519004.1_Frame_Shift_Del_p.K288fs|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000522387.1_Frame_Shift_Del_p.K301fs	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	333	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			AACCAAACCCTTTGCTGCGAC	0.383																																																	0													58.0	53.0	54.0					8																	101721933		2203	4300	6503	SO:0001589	frameshift_variant	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.999delA	8.37:g.101721933delT	ENSP00000313007:p.Lys333fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Frame_Shift_Del	DEL	ENST00000318607.5	37	CCDS6289.1																																																																																				0.383	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PABPC1P2	728773	broad.mit.edu	37	2	147346243	147346243	+	IGR	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr2:147346243C>T								RNU7-2P (443458 upstream) : AC103881.1 (249073 downstream)														p.Q235*(1)									AGCTATCCCACAGACCCAGAA	0.512																																																	1	Substitution - Nonsense(1)	kidney(1)																																								SO:0001628	intergenic_variant	728773																															2.37:g.147346243C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Nonsense_Mutation	SNP		37																																																																																				0	0.512									
PELI2	57161	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	56757030	56757030	+	Silent	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr14:56757030G>T	ENST00000267460.4	+	5	838	c.552G>T	c.(550-552)ggG>ggT	p.G184G		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	184	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)	p.G184G(1)		kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						ACATGGATGGGCTCACTACTA	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											92.0	98.0	96.0					14																	56757030		2203	4300	6503	SO:0001819	synonymous_variant	57161			AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.552G>T	14.37:g.56757030G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RDY5	Silent	SNP	ENST00000267460.4	37	CCDS9726.1																																																																																				0.532	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1			
PAPLN	89932	broad.mit.edu	37	14	73721593	73721593	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr14:73721593G>C	ENST00000554301.1	+	13	1657	c.1494G>C	c.(1492-1494)aaG>aaC	p.K498N	PAPLN_ENST00000555445.1_Missense_Mutation_p.K498N|PAPLN_ENST00000340738.5_Missense_Mutation_p.K471N|PAPLN_ENST00000427855.1_Missense_Mutation_p.K498N|PAPLN_ENST00000381166.3_Missense_Mutation_p.K498N			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	498	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)	p.K471N(1)|p.K498N(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		AGTGCTCCAAGAGCTGCAGCT	0.672																																																	2	Substitution - Missense(2)	kidney(2)											29.0	32.0	31.0					14																	73721593		2203	4300	6503	SO:0001583	missense	89932			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1494G>C	14.37:g.73721593G>C	ENSP00000451803:p.Lys498Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	37		.	.	.	.	.	.	.	.	.	.	G	15.65	2.895030	0.52121	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	4.4	1.52	0.23074	.	.	.	.	.	T	0.71264	0.3319	H	0.94222	3.51	0.36774	D	0.883941	D;D;D	0.59767	0.982;0.986;0.985	P;P;P	0.59948	0.79;0.866;0.795	T	0.74134	-0.3763	9	0.19147	T	0.46	.	8.9038	0.35510	0.2492:0.0:0.7508:0.0	.	498;498;471	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	N	471;498;498;498;498	ENSP00000345395:K471N;ENSP00000403403:K498N;ENSP00000370558:K498N;ENSP00000451803:K498N;ENSP00000451729:K498N	ENSP00000216658:K498N	K	+	3	2	PAPLN	72791346	1.000000	0.71417	0.997000	0.53966	0.600000	0.36913	3.162000	0.50755	0.122000	0.18314	0.655000	0.94253	AAG		0.672	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1		NM_173462	
RNF40	9810	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	30776560	30776560	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr16:30776560C>T	ENST00000324685.6	+	7	1265	c.830C>T	c.(829-831)aCa>aTa	p.T277I	RNF40_ENST00000563683.1_Missense_Mutation_p.T277I|RNF40_ENST00000357890.5_Missense_Mutation_p.T277I|C16orf93_ENST00000543610.1_5'Flank|RNF40_ENST00000402121.3_Intron	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	277					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T277I(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GAGATGGAGACAACAGTGGAG	0.567																																																	1	Substitution - Missense(1)	kidney(1)											108.0	105.0	106.0					16																	30776560		2197	4300	6497	SO:0001583	missense	9810			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.830C>T	16.37:g.30776560C>T	ENSP00000325677:p.Thr277Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	37	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696013	0.68386	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000452273	T;T	0.34072	1.52;1.38	5.79	5.79	0.91817	.	0.049290	0.85682	D	0.000000	T	0.51024	0.1650	M	0.62723	1.935	0.80722	D	1	D;B;B	0.55385	0.971;0.262;0.444	P;B;B	0.55455	0.776;0.266;0.215	T	0.50482	-0.8823	10	0.62326	D	0.03	-19.3399	14.416	0.67151	0.0:0.8523:0.1477:0.0	.	277;277;277	O75150-4;A8K6K1;O75150	.;.;BRE1B_HUMAN	I	277;277;126	ENSP00000325677:T277I;ENSP00000350563:T277I	ENSP00000325677:T277I	T	+	2	0	RNF40	30684061	1.000000	0.71417	0.964000	0.40570	0.862000	0.49288	5.492000	0.66893	2.735000	0.93741	0.655000	0.94253	ACA		0.567	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2		NM_014771	
RPL19	6143	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	37357533	37357533	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr17:37357533G>C	ENST00000225430.4	+	2	135	c.73G>C	c.(73-75)Gac>Cac	p.D25H	RPL19_ENST00000579260.1_Missense_Mutation_p.D23H|RPL19_ENST00000579374.1_Missense_Mutation_p.D22H|RPL19_ENST00000582193.1_Missense_Mutation_p.D23H	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	25					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.D25H(1)		kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						GGTCTGGTTAGACCCCAATGA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											89.0	87.0	88.0					17																	37357533		1910	4129	6039	SO:0001583	missense	6143				CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.73G>C	17.37:g.37357533G>C	ENSP00000225430:p.Asp25His	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Missense_Mutation	SNP	ENST00000225430.4	37	CCDS42312.1	.	.	.	.	.	.	.	.	.	.	g	25.1	4.599380	0.87055	.	.	ENSG00000108298	ENST00000225430	.	.	.	4.7	4.7	0.59300	Ribosomal protein L19/L19e conserved site (1);Ribosomal protein L19/L19e (2);Ribosomal protein L19/L19e, domain 1 (1);	0.063077	0.64402	N	0.000013	D	0.87641	0.6228	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.92105	0.5691	9	0.87932	D	0	.	17.6176	0.88072	0.0:0.0:1.0:0.0	.	25	P84098	RL19_HUMAN	H	25	.	ENSP00000225430:D25H	D	+	1	0	RPL19	34611059	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	9.465000	0.97660	2.169000	0.68431	0.313000	0.20887	GAC		0.483	RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444190.1		NM_000981	
RPL31P11	641311	broad.mit.edu	37	1	161654816	161654816	+	RNA	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:161654816G>T	ENST00000426558.1	-	0	226					NR_002595.1				ribosomal protein L31 pseudogene 11																		ATCAATGCGCGCATCTGGAGT	0.507																																																	0																																												641311					1q23.3	2010-06-16			ENSG00000213075	ENSG00000213075			35849	pseudogene	pseudogene						19123937	Standard	NR_002595		Approved		uc001gbc.3		OTTHUMG00000034536		1.37:g.161654816G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000426558.1	37																																																																																					0.507	RPL31P11-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347090.2		NR_002595	
RRP12	23223	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	99125881	99125881	+	Silent	SNP	T	T	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr10:99125881T>C	ENST00000370992.4	-	29	3612	c.3501A>G	c.(3499-3501)gaA>gaG	p.E1167E	RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000536831.1_Silent_p.E885E|RRP12_ENST00000315563.6_Silent_p.E1067E|RRP12_ENST00000414986.1_Silent_p.E1106E	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1167						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.E1167E(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CACCTTCCTCTTCCTCCATCT	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											231.0	179.0	196.0					10																	99125881		2203	4300	6503	SO:0001819	synonymous_variant	23223				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3501A>G	10.37:g.99125881T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	37	CCDS7457.1																																																																																				0.577	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4		NM_015179	
SHMT1	6470	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	18243556	18243556	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr17:18243556G>T	ENST00000316694.3	-	7	749	c.615C>A	c.(613-615)taC>taA	p.Y205*	SHMT1_ENST00000352886.6_Nonsense_Mutation_p.Y205*|SHMT1_ENST00000354098.3_Nonsense_Mutation_p.Y205*|SHMT1_ENST00000539052.1_Nonsense_Mutation_p.Y67*	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	205					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.Y205*(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	GGTTTCGGGAGTAGCAGCTGG	0.577																																																	1	Substitution - Nonsense(1)	kidney(1)											74.0	67.0	69.0					17																	18243556		2203	4300	6503	SO:0001587	stop_gained	6470				CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.615C>A	17.37:g.18243556G>T	ENSP00000318868:p.Tyr205*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Nonsense_Mutation	SNP	ENST00000316694.3	37	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	G	34	5.358154	0.95854	.	.	ENSG00000176974	ENST00000316694;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	.	.	.	5.65	2.56	0.30785	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.1151	10.6693	0.45749	0.2692:0.0:0.7308:0.0	.	.	.	.	X	205;205;67;205;205	.	ENSP00000318868:Y205X	Y	-	3	2	SHMT1	18184281	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.886000	0.28241	0.861000	0.35504	0.655000	0.94253	TAC		0.577	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2		NM_004169	
SIGLEC8	27181	broad.mit.edu;ucsc.edu	37	19	51961425	51961425	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:51961425G>T	ENST00000321424.3	-	1	283	c.217C>A	c.(217-219)Cca>Aca	p.P73T	SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.P73T|SIGLEC8_ENST00000430817.1_Missense_Mutation_p.P73T	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	73	Ig-like V-type.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.P73T(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TCTTGGTATGGTCTGTCTCCT	0.587																																																	1	Substitution - Missense(1)	kidney(1)											154.0	131.0	139.0					19																	51961425		2203	4300	6503	SO:0001583	missense	27181			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.217C>A	19.37:g.51961425G>T	ENSP00000321077:p.Pro73Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.318887	0.00232	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.64085	-0.08;-0.08;-0.08	2.04	-2.37	0.06643	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	3.022220	0.01975	N	0.044434	T	0.29588	0.0738	N	0.02315	-0.6	0.09310	N	1	B;B;B	0.11235	0.003;0.002;0.004	B;B;B	0.17722	0.015;0.002;0.019	T	0.40117	-0.9580	10	0.02654	T	1	.	3.7485	0.08558	0.0:0.2024:0.4819:0.3157	.	73;73;73	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	T	73	ENSP00000389142:P73T;ENSP00000321077:P73T;ENSP00000339448:P73T	ENSP00000321077:P73T	P	-	1	0	SIGLEC8	56653237	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.449000	0.00232	-0.664000	0.05324	-0.604000	0.04097	CCA		0.587	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2		NM_014442	
SNX33	257364	broad.mit.edu;ucsc.edu	37	15	75942381	75942381	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr15:75942381G>T	ENST00000308527.5	+	1	2135	c.938G>T	c.(937-939)tGg>tTg	p.W313L	IMP3_ENST00000565349.1_5'Flank|IMP3_ENST00000314852.2_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	313	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.W313L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						CTCATCCTCTGGATGGACCAC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											100.0	102.0	101.0					15																	75942381		2197	4294	6491	SO:0001583	missense	257364			AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.938G>T	15.37:g.75942381G>T	ENSP00000311427:p.Trp313Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B1NM17	Missense_Mutation	SNP	ENST00000308527.5	37	CCDS10283.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527330	0.44969	.	.	ENSG00000173548	ENST00000308527	T	0.29397	1.57	5.68	5.68	0.88126	Phox homologous domain (5);	0.196250	0.50627	D	0.000108	T	0.56381	0.1981	M	0.75884	2.315	0.80722	D	1	D	0.56035	0.974	P	0.62885	0.908	T	0.58429	-0.7638	10	0.87932	D	0	-14.9106	18.7773	0.91916	0.0:0.0:1.0:0.0	.	313	Q8WV41	SNX33_HUMAN	L	313	ENSP00000311427:W313L	ENSP00000311427:W313L	W	+	2	0	SNX33	73729436	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.867000	0.99620	2.692000	0.91855	0.561000	0.74099	TGG		0.577	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286471.1		NM_153271	
SRRT	51593	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	100483954	100483954	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr7:100483954G>C	ENST00000347433.4	+	13	1703	c.1545G>C	c.(1543-1545)caG>caC	p.Q515H	SRRT_ENST00000388793.4_Missense_Mutation_p.Q514H|SRRT_ENST00000432932.1_Missense_Mutation_p.Q514H|SRRT_ENST00000457580.2_Missense_Mutation_p.Q515H			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	515					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.Q515H(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGCACAAGCAGATTGTGCGCA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											106.0	82.0	90.0					7																	100483954		2203	4300	6503	SO:0001583	missense	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.1545G>C	7.37:g.100483954G>C	ENSP00000314491:p.Gln515His	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527439	0.85706	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000448764	.	.	.	5.64	5.64	0.86602	.	0.063421	0.64402	D	0.000003	T	0.69459	0.3113	M	0.67397	2.05	0.58432	D	0.999999	D;D;D;D	0.60160	0.987;0.986;0.986;0.976	P;P;P;P	0.59825	0.773;0.864;0.864;0.735	T	0.70149	-0.4951	9	0.49607	T	0.09	.	12.8502	0.57852	0.0:0.1641:0.8359:0.0	.	514;514;515;515	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	H	515;514;514;515;145	.	ENSP00000314491:Q515H	Q	+	3	2	SRRT	100321890	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.381000	0.59587	2.651000	0.90000	0.655000	0.94253	CAG		0.622	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1		NM_015908	
TMEM222	84065	broad.mit.edu;hgsc.bcm.edu	37	1	27648817	27648817	+	Silent	SNP	C	C	T			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr1:27648817C>T	ENST00000374076.4	+	1	167	c.129C>T	c.(127-129)gtC>gtT	p.V43V	RNU6-48P_ENST00000384161.1_RNA|TMEM222_ENST00000608611.1_Silent_p.V10V	NM_032125.2	NP_115501.2	Q9H0R3	TM222_HUMAN	transmembrane protein 222	43						integral component of membrane (GO:0016021)		p.V43V(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						CCGGCGGCGTCGCCATGGATG	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											36.0	32.0	33.0					1																	27648817		2202	4300	6502	SO:0001819	synonymous_variant	84065			AL136683	CCDS297.2	1p36.11	2008-07-07	2008-07-07	2008-07-07	ENSG00000186501	ENSG00000186501			25363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 160"""	C1orf160		11230166	Standard	NM_032125		Approved	DKFZP564D0478	uc001bnr.4	Q9H0R3	OTTHUMG00000004410	ENST00000374076.4:c.129C>T	1.37:g.27648817C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DPL6|Q53HD8|Q5FVE9	Silent	SNP	ENST00000374076.4	37	CCDS297.2	.	.	.	.	.	.	.	.	.	.	C	2.607	-0.291657	0.05568	.	.	ENSG00000186501	ENST00000466759;ENST00000464813	.	.	.	4.41	3.48	0.39840	.	.	.	.	.	T	0.39462	0.1079	.	.	.	0.20873	N	0.999834	.	.	.	.	.	.	T	0.21759	-1.0236	4	.	.	.	.	10.8196	0.46597	0.0:0.9086:0.0:0.0914	.	.	.	.	C	25;16	.	.	R	+	1	0	TMEM222	27521404	0.223000	0.23663	0.268000	0.24571	0.131000	0.20780	0.258000	0.18387	1.050000	0.40346	0.561000	0.74099	CGC		0.677	TMEM222-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000012809.2		NM_032125	
TMPPE	643853	broad.mit.edu	37	3	33135687	33135687	+	Start_Codon_Del	DEL	T	T	-			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr3:33135687delT	ENST00000342462.4	-	0	191				GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Intron|GLB1_ENST00000399402.3_Intron|GLB1_ENST00000445488.2_Intron|TMPPE_ENST00000416695.2_Intron	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain							integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						AAGATGGCCATTTTCTCTGCT	0.572																																																	0													46.0	46.0	46.0					3																	33135687		2198	4282	6480	SO:0001582	initiator_codon_variant	643853			AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779		3.37:g.33135687delT		Somatic		WXS	Illumina GAIIx	Phase_I	B2RNG5|Q6ZRG1	Frame_Shift_Del	DEL	ENST00000342462.4	37	CCDS33732.1																																																																																				0.572	TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341566.1		NM_001039770	
TRIM25	7706	broad.mit.edu;ucsc.edu	37	17	54981679	54981679	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr17:54981679G>C	ENST00000316881.4	-	3	913	c.864C>G	c.(862-864)atC>atG	p.I288M	TRIM25_ENST00000537230.1_Missense_Mutation_p.I288M	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	288	Interaction with influenza A virus NS1.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I288M(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					TCAAGGTCTGGATCTCACTCT	0.453																																																	1	Substitution - Missense(1)	kidney(1)											236.0	219.0	225.0					17																	54981679		2203	4300	6503	SO:0001583	missense	7706			D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.864C>G	17.37:g.54981679G>C	ENSP00000323889:p.Ile288Met	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000316881.4	37	CCDS11591.1	.	.	.	.	.	.	.	.	.	.	G	6.340	0.430880	0.12045	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.47177	0.85;0.85	5.76	-0.0428	0.13862	.	0.178176	0.39687	N	0.001285	T	0.29223	0.0727	L	0.33485	1.01	0.28183	N	0.928063	B	0.27951	0.195	B	0.27076	0.076	T	0.12142	-1.0559	10	0.26408	T	0.33	.	6.4071	0.21670	0.2289:0.4101:0.361:0.0	.	288	Q14258	TRI25_HUMAN	M	288	ENSP00000323889:I288M;ENSP00000445961:I288M	ENSP00000323889:I288M	I	-	3	3	TRIM25	52336678	1.000000	0.71417	0.999000	0.59377	0.870000	0.49936	0.827000	0.27421	0.417000	0.25871	-0.136000	0.14681	ATC		0.453	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1		NM_005082	
CFAP70	118491	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	75095189	75095189	+	Splice_Site	SNP	T	T	C			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr10:75095189T>C	ENST00000310715.3	-	8	1006	c.886A>G	c.(886-888)Agt>Ggt	p.S296G	TTC18_ENST00000401621.2_Splice_Site_p.S296G|TTC18_ENST00000394865.1_Splice_Site_p.S296G|TTC18_ENST00000340329.3_Intron|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_5'UTR	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		296						extracellular vesicular exosome (GO:0070062)		p.S296G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TCTTCTTACCTGACCACTGCA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											106.0	96.0	100.0					10																	75095189		2203	4300	6503	SO:0001630	splice_region_variant	118491																														ENST00000310715.3:c.887+1A>G	10.37:g.75095189T>C		Somatic		WXS	Illumina HiSeq	Phase_I	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	ENST00000310715.3	37	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	T	14.76	2.631651	0.46944	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000372928;ENST00000394865	T;T;T	0.33865	1.8;1.8;1.39	5.3	5.3	0.74995	.	0.206492	0.49916	D	0.000135	T	0.35682	0.0940	M	0.61703	1.905	0.42608	D	0.993301	P;P	0.48911	0.804;0.917	B;B	0.39185	0.242;0.293	T	0.38045	-0.9679	10	0.56958	D	0.05	-10.7501	13.1716	0.59602	0.0:0.0:0.0:1.0	.	296;296	Q5T0N1-2;Q5T0N1	.;TTC18_HUMAN	G	296	ENSP00000310829:S296G;ENSP00000384479:S296G;ENSP00000378334:S296G	ENSP00000310829:S296G	S	-	1	0	TTC18	74765195	1.000000	0.71417	0.995000	0.50966	0.893000	0.52053	2.062000	0.41413	2.001000	0.58596	0.397000	0.26171	AGT		0.383	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				Missense_Mutation
UMOD	7369	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	20355352	20355352	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr16:20355352A>G	ENST00000570689.1	-	6	1471	c.1325T>C	c.(1324-1326)aTg>aCg	p.M442T	UMOD_ENST00000396134.2_Missense_Mutation_p.M475T|UMOD_ENST00000302509.4_Missense_Mutation_p.M442T|UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000396142.2_Missense_Mutation_p.M442T|UMOD_ENST00000424589.1_Missense_Mutation_p.M475T|UMOD_ENST00000396138.4_Missense_Mutation_p.M491T			P07911	UROM_HUMAN	uromodulin	442	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.M442T(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						ACACCTGACCATTGGCTGTAG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											96.0	85.0	88.0					16																	20355352		2203	4300	6503	SO:0001583	missense	7369			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1325T>C	16.37:g.20355352A>G	ENSP00000460548:p.Met442Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	A	9.834	1.189214	0.21954	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	5.66	4.56	0.56223	Zona pellucida sperm-binding protein (3);	0.641141	0.15332	N	0.267922	T	0.67411	0.2890	N	0.12961	0.28	0.24132	N	0.995766	B;B	0.17465	0.022;0.002	B;B	0.19946	0.024;0.027	T	0.58498	-0.7626	10	0.49607	T	0.09	-8.1738	11.1604	0.48512	0.8453:0.1547:0.0:0.0	.	475;442	E9PEA4;P07911	.;UROM_HUMAN	T	442;475;475;442;420;442	ENSP00000379438:M475T;ENSP00000416346:M475T;ENSP00000306279:M442T;ENSP00000379446:M442T	ENSP00000306279:M442T	M	-	2	0	UMOD	20262853	0.360000	0.24964	0.580000	0.28601	0.515000	0.34225	5.093000	0.64517	0.958000	0.37956	0.533000	0.62120	ATG		0.547	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1			
ZCCHC8	55596	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	122967187	122967187	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr12:122967187G>A	ENST00000336229.4	-	8	857	c.727C>T	c.(727-729)Cca>Tca	p.P243S	ZCCHC8_ENST00000536306.1_Missense_Mutation_p.P5S|ZCCHC8_ENST00000543897.1_Missense_Mutation_p.P5S	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	243					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P243S(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TTTACCATTGGGCAATCTTTC	0.303																																																	1	Substitution - Missense(1)	kidney(1)											38.0	39.0	38.0					12																	122967187		1810	4054	5864	SO:0001583	missense	55596			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.727C>T	12.37:g.122967187G>A	ENSP00000337313:p.Pro243Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	ENST00000336229.4	37		.	.	.	.	.	.	.	.	.	.	G	17.82	3.482416	0.63962	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000544054;ENST00000536663;ENST00000540586	T;T;T	0.56776	0.56;0.56;0.44	5.48	4.59	0.56863	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (3);	0.047258	0.85682	N	0.000000	T	0.57431	0.2053	M	0.77486	2.375	0.58432	D	0.999999	B	0.30542	0.284	B	0.33690	0.168	T	0.61486	-0.7053	10	0.62326	D	0.03	-8.0519	14.2511	0.66021	0.072:0.0:0.928:0.0	.	243	Q6NZY4	ZCHC8_HUMAN	S	5;5;243;5;5;5	ENSP00000441423:P5S;ENSP00000438993:P5S;ENSP00000337313:P243S	ENSP00000337313:P243S	P	-	1	0	ZCCHC8	121533140	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.455000	0.73497	1.317000	0.45149	0.455000	0.32223	CCA		0.303	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_017612	
ZNF714	148206	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	21299645	21299645	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:21299645C>A	ENST00000596143.1	+	5	500	c.175C>A	c.(175-177)Cca>Aca	p.P59T	ZNF714_ENST00000291770.7_Silent_p.G51G|ZNF714_ENST00000601416.1_Missense_Mutation_p.A65D|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	59					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P59T(1)|p.P164T(1)		endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						AGACCTTTGGCCAGAGCAAGA	0.333																																																	2	Substitution - Missense(2)	kidney(2)											58.0	58.0	58.0					19																	21299645		2183	4295	6478	SO:0001583	missense	148206			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.175C>A	19.37:g.21299645C>A	ENSP00000472368:p.Pro59Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	37	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	9.142	1.014098	0.19277	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.601	0.601	0.17529	.	.	.	.	.	T	0.47857	0.1468	L	0.42487	1.325	0.22142	N	0.999333	D;P	0.63046	0.992;0.931	P;B	0.59948	0.866;0.376	T	0.32188	-0.9916	7	0.66056	D	0.02	.	.	.	.	.	59;59	Q96N38-2;A6NEM4	.;.	T	59	.	ENSP00000291770:P59T	P	+	1	0	ZNF714	21091485	0.321000	0.24625	0.015000	0.15790	0.060000	0.15804	1.561000	0.36342	0.602000	0.29896	0.456000	0.33151	CCA		0.333	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1		NM_182515	
ZNF132	7691	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	58945135	58945135	+	Missense_Mutation	SNP	A	A	T	rs185952330		TCGA-CJ-4640-01A-02D-1386-10	TCGA-CJ-4640-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e406036a-eecb-474e-8c76-0fa8b64225be	60836f30-bbab-459c-8b8d-a12902fbcf4e	g.chr19:58945135A>T	ENST00000254166.3	-	3	2076	c.1676T>A	c.(1675-1677)aTt>aAt	p.I559N	CTD-2619J13.17_ENST00000594816.1_lincRNA	NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I559N(2)		NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		CCAGTGTTCAATGAGAGTGGA	0.448																																																	2	Substitution - Missense(2)	kidney(1)|skin(1)											89.0	89.0	89.0					19																	58945135		2203	4300	6503	SO:0001583	missense	7691			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1676T>A	19.37:g.58945135A>T	ENSP00000254166:p.Ile559Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MI9	Missense_Mutation	SNP	ENST00000254166.3	37	CCDS12980.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.351167	0.41700	.	.	ENSG00000131849	ENST00000254166;ENST00000391695	T	0.07216	3.21	3.69	-2.92	0.05615	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03390	0.0098	N	0.16903	0.455	0.09310	N	1	B	0.25850	0.136	B	0.20577	0.03	T	0.45396	-0.9264	9	0.18710	T	0.47	.	1.2864	0.02052	0.3244:0.2649:0.2804:0.1303	.	559	P52740	ZN132_HUMAN	N	559;274	ENSP00000254166:I559N	ENSP00000254166:I559N	I	-	2	0	ZNF132	63636947	0.000000	0.05858	0.006000	0.13384	0.957000	0.61999	-0.874000	0.04210	-0.286000	0.09076	0.533000	0.62120	ATT		0.448	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1		NM_003433	
