#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC9	10060	hgsc.bcm.edu;ucsc.edu	37	12	22065833	22065833	+	Silent	SNP	G	G	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr12:22065833G>T	ENST00000261201.4	-	6	983	c.984C>A	c.(982-984)acC>acA	p.T328T	ABCC9_ENST00000345162.2_Silent_p.T328T|ABCC9_ENST00000261200.4_Silent_p.T328T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	328	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TCCCATTCTGGGTTTCATTCA	0.368																																																	0													78.0	74.0	75.0					12																	22065833		2203	4299	6502	SO:0001819	synonymous_variant	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.984C>A	12.37:g.22065833G>T		Somatic		WXS	SOLID	Phase_I	O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																				0.368	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1		NM_005691	
AFAP1L2	84632	hgsc.bcm.edu	37	10	116057098	116057098	+	Missense_Mutation	SNP	G	G	A	rs201900085		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr10:116057098G>A	ENST00000304129.4	-	17	2217	c.2188C>T	c.(2188-2190)Cgc>Tgc	p.R730C	AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000369271.3_Missense_Mutation_p.R730C|AFAP1L2_ENST00000545353.1_Missense_Mutation_p.R783C			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	730					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		AGGTCCACGCGCCTGCTCTCC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		17825	0.001		0.0	False		,,,				2504	0.0																0								G	CYS/ARG,CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	53.0	43.0	47.0		2188,2188	4.5	1.0	10		47	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	AFAP1L2	NM_001001936.1,NM_032550.2	180,180	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	probably-damaging,probably-damaging	730/819,730/815	116057098	4,13002	2203	4300	6503	SO:0001583	missense	84632			BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.2188C>T	10.37:g.116057098G>A	ENSP00000303042:p.Arg730Cys	Somatic		WXS	SOLID	Phase_I	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	ENST00000304129.4	37	CCDS31286.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731924	0.69189	4.54E-4	2.33E-4	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000545353	T;T;T	0.26373	1.85;1.78;1.74	5.41	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	M	0.84326	2.69	0.80722	D	1	D;P;D;D;D;D	0.89917	1.0;0.76;1.0;0.997;1.0;1.0	D;B;D;P;D;D	0.85130	0.983;0.105;0.997;0.802;0.975;0.944	T	0.56062	-0.8041	10	0.87932	D	0	-5.972	9.9451	0.41604	0.0742:0.0:0.7798:0.146	.	783;296;252;758;730;730	F5GZE1;B7Z363;Q8N4X5-3;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;.;AF1L2_HUMAN	C	730;730;757;783	ENSP00000358276:R730C;ENSP00000303042:R730C;ENSP00000444511:R783C	ENSP00000303042:R730C	R	-	1	0	AFAP1L2	116047088	1.000000	0.71417	0.990000	0.47175	0.784000	0.44337	4.032000	0.57274	1.298000	0.44778	0.456000	0.33151	CGC		0.592	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1		NM_032550	
ANAPC7	51434	hgsc.bcm.edu	37	12	110825591	110825591	+	Silent	SNP	A	A	G	rs61754907	byFrequency	TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr12:110825591A>G	ENST00000455511.3	-	5	729	c.729T>C	c.(727-729)taT>taC	p.Y243Y	ANAPC7_ENST00000450008.2_Silent_p.Y243Y|RP11-478C19.2_ENST00000550231.1_RNA	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	243					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						GCACAAAAGCATACGCTTTGA	0.473													A|||	65	0.0129792	0.0469	0.0043	5008	,	,		20711	0.0		0.0	False		,,,				2504	0.0																0								A	,	160,4246	109.5+/-147.8	3,154,2046	138.0	109.0	119.0		729,729	2.4	1.0	12	dbSNP_129	119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ANAPC7	NM_001137664.1,NM_016238.2	,	3,154,6346	GG,GA,AA		0.0,3.6314,1.2302	,	243/538,243/600	110825591	160,12846	2203	4300	6503	SO:0001819	synonymous_variant	51434			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.729T>C	12.37:g.110825591A>G		Somatic		WXS	SOLID	Phase_I	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Silent	SNP	ENST00000455511.3	37	CCDS9145.2																																																																																				0.473	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3		NM_016238	
ANGPT1	284	hgsc.bcm.edu;ucsc.edu	37	8	108334182	108334182	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr8:108334182C>A	ENST00000520734.1	-	3	435	c.150G>T	c.(148-150)caG>caT	p.Q50H	ANGPT1_ENST00000520052.1_Missense_Mutation_p.Q50H|ANGPT1_ENST00000518386.1_5'UTR			Q15389	ANGP1_HUMAN	angiopoietin 1	250					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			GCTCCAGTTGCTGCTTCTGAA	0.403																																																	0													199.0	181.0	187.0					8																	108334182		2203	4300	6503	SO:0001583	missense	284			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.150G>T	8.37:g.108334182C>A	ENSP00000430750:p.Gln50His	Somatic		WXS	SOLID	Phase_I	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37		.	.	.	.	.	.	.	.	.	.	C	16.87	3.240744	0.58995	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820;ENST00000520734;ENST00000520052	T;T;T;T	0.55930	0.96;0.96;0.49;0.5	5.36	0.869	0.19096	.	0.000000	0.85682	D	0.000000	T	0.67730	0.2924	M	0.77486	2.375	0.58432	D	0.99999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74023	0.979;0.982;0.982	T	0.68127	-0.5491	10	0.72032	D	0.01	.	9.781	0.40649	0.0:0.5589:0.0:0.4411	.	50;250;250	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	H	250;250;62;50;50	ENSP00000428340:Q250H;ENSP00000297450:Q250H;ENSP00000430750:Q50H;ENSP00000429349:Q50H	ENSP00000297450:Q250H	Q	-	3	2	ANGPT1	108403358	0.997000	0.39634	1.000000	0.80357	0.968000	0.65278	0.455000	0.21843	0.232000	0.21100	0.655000	0.94253	CAG		0.403	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2		NM_001146, NM_139290	
ANKRD27	84079	hgsc.bcm.edu;ucsc.edu	37	19	33133044	33133044	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr19:33133044T>C	ENST00000306065.4	-	10	948	c.790A>G	c.(790-792)Ata>Gta	p.I264V	ANKRD27_ENST00000587352.1_Missense_Mutation_p.I264V	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	264	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					GCACGAGGTATGTTAAAGCTG	0.463																																																	0													118.0	107.0	110.0					19																	33133044		2203	4300	6503	SO:0001583	missense	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.790A>G	19.37:g.33133044T>C	ENSP00000304292:p.Ile264Val	Somatic		WXS	SOLID	Phase_I	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.261603	0.23051	.	.	ENSG00000105186	ENST00000306065	T	0.29397	1.57	5.43	5.43	0.79202	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (1);	0.000000	0.64402	D	0.000003	T	0.24967	0.0606	L	0.31420	0.93	0.39183	D	0.962813	B	0.27068	0.167	B	0.30646	0.118	T	0.09422	-1.0675	10	0.16420	T	0.52	-25.1089	15.4933	0.75629	0.0:0.0:0.0:1.0	.	264	Q96NW4	ANR27_HUMAN	V	264	ENSP00000304292:I264V	ENSP00000304292:I264V	I	-	1	0	ANKRD27	37824884	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	3.964000	0.56780	2.064000	0.61679	0.460000	0.39030	ATA		0.463	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1		NM_032139	
ARAP3	64411	hgsc.bcm.edu	37	5	141046056	141046056	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr5:141046056G>T	ENST00000239440.4	-	17	2572	c.2507C>A	c.(2506-2508)tCa>tAa	p.S836*	ARAP3_ENST00000513878.1_Nonsense_Mutation_p.S498*|ARAP3_ENST00000508305.1_Nonsense_Mutation_p.S738*|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	836					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.S836*(2)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GCCCGGCGCTGAGCACAGGAA	0.677																																																	2	Substitution - Nonsense(2)	breast(2)											19.0	25.0	23.0					5																	141046056		2201	4292	6493	SO:0001587	stop_gained	64411			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.2507C>A	5.37:g.141046056G>T	ENSP00000239440:p.Ser836*	Somatic		WXS	SOLID	Phase_I	B4DIT1|D3DQE3	Nonsense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	G	40	8.500045	0.98838	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	.	.	.	5.53	5.53	0.82687	.	0.057711	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.0492	0.93036	0.0:0.0:1.0:0.0	.	.	.	.	X	738;836;498	.	ENSP00000239440:S836X	S	-	2	0	ARAP3	141026240	1.000000	0.71417	0.992000	0.48379	0.309000	0.27889	8.156000	0.89645	2.593000	0.87608	0.655000	0.94253	TCA		0.677	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1		NM_022481	
ASAP3	55616	hgsc.bcm.edu	37	1	23756377	23756377	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr1:23756377G>C	ENST00000336689.3	-	25	2728	c.2684C>G	c.(2683-2685)gCa>gGa	p.A895G	ASAP3_ENST00000437606.2_Missense_Mutation_p.A886G|ASAP3_ENST00000495646.1_Missense_Mutation_p.A399G	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	895					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CACAGAACTTGCTGGGAGACT	0.507																																																	0													82.0	69.0	73.0					1																	23756377		2203	4300	6503	SO:0001583	missense	55616			AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2684C>G	1.37:g.23756377G>C	ENSP00000338769:p.Ala895Gly	Somatic		WXS	SOLID	Phase_I	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	37	CCDS235.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859663	0.51376	.	.	ENSG00000088280	ENST00000495646;ENST00000336689;ENST00000465372;ENST00000437606	T;T;T	0.55234	1.89;0.53;0.53	4.3	3.35	0.38373	.	0.304822	0.26525	N	0.023886	T	0.31918	0.0812	N	0.08118	0	0.09310	N	0.999995	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.001;0.001	T	0.33828	-0.9853	10	0.87932	D	0	.	11.3362	0.49505	0.0:0.1848:0.8152:0.0	.	886;785;895	Q8TDY4-3;B4DRP2;Q8TDY4	.;.;ASAP3_HUMAN	G	399;895;195;886	ENSP00000436150:A399G;ENSP00000338769:A895G;ENSP00000408826:A886G	ENSP00000338769:A895G	A	-	2	0	ASAP3	23628964	0.999000	0.42202	0.346000	0.25655	0.635000	0.38103	3.078000	0.50096	1.112000	0.41740	0.561000	0.74099	GCA		0.507	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2		NM_017707	
ARFGAP2	84364	hgsc.bcm.edu	37	11	47185748	47185748	+	IGR	SNP	T	T	A	rs548230030		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:47185748T>A	ENST00000524782.1	-	0	2976				ARFGAP2_ENST00000395449.3_5'Flank|C11orf49_ENST00000378618.2_Missense_Mutation_p.V309E	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTGGAGAGAGTGTCCTCAGCT	0.642																																																	0													54.0	54.0	54.0					11																	47185748		2201	4299	6500	SO:0001628	intergenic_variant	79096			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773		11.37:g.47185748T>A		Somatic		WXS	SOLID	Phase_I	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	37	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	T	9.391	1.075448	0.20227	.	.	ENSG00000149179	ENST00000378618	.	.	.	4.89	2.44	0.29823	.	.	.	.	.	T	0.07007	0.0178	N	0.00146	-1.995	0.27627	N	0.948164	B	0.02656	0.0	B	0.01281	0.0	T	0.25572	-1.0128	8	0.72032	D	0.01	.	4.5128	0.11919	0.1697:0.0943:0.0:0.736	.	309	E9PAX7	.	E	309	.	ENSP00000367881:V309E	V	+	2	0	C11orf49	47142324	0.003000	0.15002	0.807000	0.32361	0.203000	0.24098	-0.074000	0.11450	0.262000	0.21774	0.533000	0.62120	GTG		0.642	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1		NM_032389	
C17orf74	201243	hgsc.bcm.edu	37	17	7330114	7330114	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr17:7330114G>A	ENST00000333870.3	+	3	878	c.804G>A	c.(802-804)tgG>tgA	p.W268*	C17orf74_ENST00000574034.1_3'UTR|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	268						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				CCCGACTGTGGGGCAATGTGG	0.662																																																	0													42.0	46.0	45.0					17																	7330114		2111	4226	6337	SO:0001587	stop_gained	201243			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.804G>A	17.37:g.7330114G>A	ENSP00000328061:p.Trp268*	Somatic		WXS	SOLID	Phase_I		Nonsense_Mutation	SNP	ENST00000333870.3	37	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	g	16.31	3.088426	0.55968	.	.	ENSG00000184560	ENST00000333870	.	.	.	4.06	1.93	0.25924	.	0.231698	0.22651	N	0.057328	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3402	6.9311	0.24442	0.0:0.1923:0.6091:0.1986	.	.	.	.	X	268	.	ENSP00000328061:W268X	W	+	3	0	C17orf74	7270838	0.933000	0.31639	0.975000	0.42487	0.474000	0.32979	0.863000	0.27913	0.417000	0.25871	0.486000	0.48141	TGG		0.662	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2		NM_175734	
MROH8	140699	hgsc.bcm.edu	37	20	35776260	35776260	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr20:35776260A>T	ENST00000400441.3	-	10	1126	c.1127T>A	c.(1126-1128)cTc>cAc	p.L376H	MROH8_ENST00000217333.8_Missense_Mutation_p.L256H|MROH8_ENST00000441008.2_Missense_Mutation_p.L362H			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	261																	GTCCCCACAGAGCAGTGCCAT	0.498																																																	0													52.0	56.0	55.0					20																	35776260		1976	4149	6125	SO:0001583	missense	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1127T>A	20.37:g.35776260A>T	ENSP00000383291:p.Leu376His	Somatic		WXS	SOLID	Phase_I	Q5JYQ6	Missense_Mutation	SNP	ENST00000400441.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.28|19.28	3.797749|3.797749	0.70567|0.70567	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441;ENST00000217333|ENST00000343811;ENST00000400440	T;T;T|.	0.05319|.	3.46;3.46;3.46|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.226023|.	0.31312|.	N|.	0.007867|.	T|T	0.61211|0.61211	0.2329|0.2329	L|L	0.50333|0.50333	1.59|1.59	0.35456|0.35456	D|D	0.796104|0.796104	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.998;0.999;0.999;0.999|.	T|T	0.68830|0.68830	-0.5305|-0.5305	10|5	0.14252|.	T|.	0.57|.	-10.3855|-10.3855	12.3215|12.3215	0.54987|0.54987	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	376;261;386;261|.	E7ETR9;Q9H579;Q6PF12;Q9H579-2|.	.;CT132_HUMAN;.;.|.	H|T	362;376;256|403;407	ENSP00000392144:L362H;ENSP00000383291:L376H;ENSP00000217333:L256H|.	ENSP00000217333:L256H|.	L|S	-|-	2|1	0|0	C20orf132|C20orf132	35209674|35209674	0.994000|0.994000	0.37717|0.37717	0.980000|0.980000	0.43619|0.43619	0.835000|0.835000	0.47333|0.47333	4.207000|4.207000	0.58480|0.58480	2.178000|2.178000	0.69098|0.69098	0.528000|0.528000	0.53228|0.53228	CTC|TCT		0.498	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_152503	
C3orf27	23434	hgsc.bcm.edu	37	3	128292319	128292320	+	Frame_Shift_Del	DEL	TC	TC	-	rs147519916		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr3:128292319_128292320delTC	ENST00000356020.2	-	3	1219_1220	c.253_254delGA	c.(253-255)gatfs	p.D86fs		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	86										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		GAGCTCGTCATCTCTCTCTCTC	0.599																																																	0																																										SO:0001589	frameshift_variant	23434			AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.253_254delGA	3.37:g.128292329_128292330delTC	ENSP00000348302:p.Asp86fs	Somatic		WXS	SOLID	Phase_I		Frame_Shift_Del	DEL	ENST00000356020.2	37	CCDS3050.1																																																																																				0.599	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356924.1		NM_007354	
CCDC160	347475	hgsc.bcm.edu;ucsc.edu	37	X	133378953	133378953	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chrX:133378953C>A	ENST00000517294.1	+	3	506	c.123C>A	c.(121-123)agC>agA	p.S41R	CCDC160_ENST00000370809.4_Missense_Mutation_p.S41R			A6NGH7	CC160_HUMAN	coiled-coil domain containing 160	41										endometrium(1)|kidney(2)|large_intestine(10)|lung(2)|prostate(1)|skin(1)	17						CAGATAGCAGCAAGGGAATGG	0.333																																																	0													25.0	23.0	24.0					X																	133378953		1807	4067	5874	SO:0001583	missense	347475			BC017958	CCDS48171.1	Xq26.2	2010-02-17			ENSG00000203952	ENSG00000203952			37286	protein-coding gene	gene with protein product							Standard	NM_001101357		Approved		uc011mvj.2	A6NGH7	OTTHUMG00000164183	ENST00000517294.1:c.123C>A	X.37:g.133378953C>A	ENSP00000427951:p.Ser41Arg	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000517294.1	37	CCDS48171.1	.	.	.	.	.	.	.	.	.	.	C	5.068	0.198215	0.09652	.	.	ENSG00000203952	ENST00000517294;ENST00000370809	.	.	.	5.16	1.79	0.24919	.	1.104550	0.07021	N	0.826822	T	0.20251	0.0487	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.26416	0.069	T	0.30238	-0.9985	9	0.30078	T	0.28	1.2662	7.8807	0.29621	0.5863:0.286:0.1278:0.0	.	41	A6NGH7	CC160_HUMAN	R	41	.	ENSP00000359845:S41R	S	+	3	2	CCDC160	133206619	0.003000	0.15002	0.019000	0.16419	0.004000	0.04260	0.141000	0.16076	0.460000	0.27045	-0.213000	0.12676	AGC		0.333	CCDC160-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377679.1		NM_001101357	
CENPT	80152	hgsc.bcm.edu	37	16	67863680	67863680	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr16:67863680A>G	ENST00000562787.1	-	12	1722	c.1174T>C	c.(1174-1176)Tct>Cct	p.S392P	CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000564817.1_Intron|CENPT_ENST00000219172.3_Missense_Mutation_p.S392P|CENPT_ENST00000440851.2_Missense_Mutation_p.S392P	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	392	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GCCCTGCCAGAGGCATCCTCA	0.602																																																	0													97.0	104.0	102.0					16																	67863680		2090	4223	6313	SO:0001583	missense	80152			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.1174T>C	16.37:g.67863680A>G	ENSP00000457810:p.Ser392Pro	Somatic		WXS	SOLID	Phase_I	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951614	0.53186	.	.	ENSG00000102901	ENST00000440851;ENST00000436104;ENST00000219172	T;T	0.49720	0.77;0.77	5.65	0.42	0.16444	.	0.817091	0.11145	N	0.594820	T	0.40694	0.1127	M	0.73598	2.24	0.09310	N	1	B;B	0.21381	0.055;0.019	B;B	0.18561	0.022;0.022	T	0.36383	-0.9750	10	0.31617	T	0.26	-1.0953	2.3246	0.04220	0.4637:0.3064:0.0823:0.1476	.	150;392	F5H5A6;Q96BT3	.;CENPT_HUMAN	P	392;150;392	ENSP00000400140:S392P;ENSP00000219172:S392P	ENSP00000219172:S392P	S	-	1	0	CENPT	66421181	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.042000	0.13949	0.128000	0.18479	0.533000	0.62120	TCT		0.602	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1		NM_025082	
CNGA4	1262	hgsc.bcm.edu;ucsc.edu	37	11	6262905	6262905	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:6262905A>C	ENST00000379936.2	+	5	1277	c.1162A>C	c.(1162-1164)Atc>Ctc	p.I388L	CNGA4_ENST00000533426.1_Missense_Mutation_p.I157L	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	388					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATGTACATCATCCGAGAGGG	0.542																																																	0													278.0	237.0	251.0					11																	6262905		2201	4296	6497	SO:0001583	missense	1262			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1162A>C	11.37:g.6262905A>C	ENSP00000369268:p.Ile388Leu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000379936.2	37	CCDS31408.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.327464	0.81690	.	.	ENSG00000132259	ENST00000533426;ENST00000379936	D;D	0.97791	-4.54;-4.54	5.0	5.0	0.66597	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.97794	0.9276	L	0.49455	1.56	0.47441	D	0.999428	P;D;P	0.65815	0.561;0.995;0.812	P;D;B	0.67382	0.587;0.951;0.421	D	0.97953	1.0333	10	0.49607	T	0.09	.	13.6811	0.62487	1.0:0.0:0.0:0.0	.	157;388;348	B4DYQ8;Q8IV77;Q8IV77-2	.;CNGA4_HUMAN;.	L	157;388	ENSP00000433399:I157L;ENSP00000369268:I388L	ENSP00000369268:I388L	I	+	1	0	CNGA4	6219481	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.992000	0.76238	2.092000	0.63282	0.533000	0.62120	ATC		0.542	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2		NM_001037329	
DDX1	1653	hgsc.bcm.edu	37	2	15746321	15746321	+	Silent	SNP	A	A	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr2:15746321A>C	ENST00000381341.2	+	13	1139	c.750A>C	c.(748-750)ccA>ccC	p.P250P	DDX1_ENST00000233084.3_Silent_p.P250P			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	250	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TTAAGTTTCCACCAAAAGATG	0.368																																																	0													82.0	77.0	79.0					2																	15746321		2203	4300	6503	SO:0001819	synonymous_variant	1653			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.750A>C	2.37:g.15746321A>C		Somatic		WXS	SOLID	Phase_I	B4DME8|B4DPN6	Silent	SNP	ENST00000381341.2	37	CCDS1686.1																																																																																				0.368	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2		NM_004939	
DDX31	64794	hgsc.bcm.edu;ucsc.edu	37	9	135538026	135538026	+	Silent	SNP	T	T	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr9:135538026T>C	ENST00000372159.3	-	2	598	c.447A>G	c.(445-447)aaA>aaG	p.K149K	DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000310532.2_Silent_p.K149K|DDX31_ENST00000372153.1_Silent_p.K149K|DDX31_ENST00000438527.3_Silent_p.K20K|DDX31_ENST00000544003.1_Silent_p.K53K	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	149						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		CGTTCCTCCGTTTCGCTGGGG	0.438																																																	0													104.0	98.0	100.0					9																	135538026		2203	4300	6503	SO:0001819	synonymous_variant	64794			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.447A>G	9.37:g.135538026T>C		Somatic		WXS	SOLID	Phase_I	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Silent	SNP	ENST00000372159.3	37	CCDS6951.1																																																																																				0.438	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1		NM_138620	
DYDC1	143241	hgsc.bcm.edu;ucsc.edu	37	10	82112316	82112316	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr10:82112316T>G	ENST00000372204.3	-	3	206	c.42A>C	c.(40-42)ttA>ttC	p.L14F	DYDC2_ENST00000372199.1_5'UTR|DYDC1_ENST00000372202.1_Missense_Mutation_p.L14F|DYDC2_ENST00000372197.1_Intron|DYDC2_ENST00000372198.1_Intron|DYDC1_ENST00000421924.2_Missense_Mutation_p.L14F	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	14										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			GACCTTGAGTTAAACAGGCCC	0.378																																																	0													67.0	66.0	67.0					10																	82112316		2203	4300	6503	SO:0001583	missense	143241			BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.42A>C	10.37:g.82112316T>G	ENSP00000361278:p.Leu14Phe	Somatic		WXS	SOLID	Phase_I	A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	37	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.058033	0.55325	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362;ENST00000453477	.	.	.	5.97	0.695	0.18070	Dpy-30 motif (1);	0.000000	0.64402	D	0.000019	T	0.80031	0.4549	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74408	-0.3675	9	0.87932	D	0	-14.3635	0.6525	0.00829	0.1676:0.187:0.1751:0.4703	.	14;14	A8K927;Q8WWB3	.;DYDC1_HUMAN	F	14	.	ENSP00000361276:L14F	L	-	3	2	DYDC1	82102296	0.236000	0.23804	0.999000	0.59377	0.419000	0.31324	-0.558000	0.05978	0.492000	0.27815	0.533000	0.62120	TTA		0.378	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1		NM_138812	
FAM179A	165186	hgsc.bcm.edu;ucsc.edu	37	2	29256422	29256422	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr2:29256422A>G	ENST00000379558.4	+	16	2569	c.2218A>G	c.(2218-2220)Aag>Gag	p.K740E	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Missense_Mutation_p.K685E	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	740										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GCTGCCCATCAAGGAGGGGTA	0.532																																																	0													92.0	82.0	86.0					2																	29256422		2203	4300	6503	SO:0001583	missense	165186			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2218A>G	2.37:g.29256422A>G	ENSP00000368876:p.Lys740Glu	Somatic		WXS	SOLID	Phase_I	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	37	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	A	0.281	-0.986625	0.02180	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.13538	2.58;2.58	4.47	-1.25	0.09405	Armadillo-type fold (1);	2.039490	0.02201	N	0.062280	T	0.04679	0.0127	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33803	-0.9854	10	0.02654	T	1	.	5.8888	0.18896	0.2514:0.4266:0.322:0.0	.	685;740;38	F8W8E4;Q6ZUX3;Q6ZUX3-3	.;F179A_HUMAN;.	E	740;685	ENSP00000368876:K740E;ENSP00000384699:K685E	ENSP00000368876:K740E	K	+	1	0	FAM179A	29109926	0.000000	0.05858	0.000000	0.03702	0.850000	0.48378	-0.077000	0.11394	-0.211000	0.10124	-0.411000	0.06167	AAG		0.532	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4		NM_199280	
FOXP2	93986	hgsc.bcm.edu	37	7	114284748	114284748	+	Missense_Mutation	SNP	A	A	T	rs372704196		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr7:114284748A>T	ENST00000393494.2	+	8	1277	c.998A>T	c.(997-999)cAt>cTt	p.H333L	FOXP2_ENST00000393498.2_Missense_Mutation_p.H312L|FOXP2_ENST00000408937.3_Missense_Mutation_p.H358L|FOXP2_ENST00000360232.4_Missense_Mutation_p.H333L|FOXP2_ENST00000393500.3_Missense_Mutation_p.H258L|FOXP2_ENST00000393491.3_Missense_Mutation_p.H241L|FOXP2_ENST00000393489.3_Missense_Mutation_p.H241L|FOXP2_ENST00000378237.3_Missense_Mutation_p.H333L|FOXP2_ENST00000390668.3_Missense_Mutation_p.H357L|FOXP2_ENST00000350908.4_Missense_Mutation_p.H333L|FOXP2_ENST00000403559.4_Missense_Mutation_p.H350L			O15409	FOXP2_HUMAN	forkhead box P2	333					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						AGCTCGTCACATGAGGAGACT	0.463																																																	0								A	LEU/HIS,LEU/HIS,LEU/HIS,LEU/HIS,LEU/HIS,LEU/HIS	1,4405	2.1+/-5.4	0,1,2202	83.0	77.0	79.0		1049,998,1073,998,1073,995	4.5	1.0	7		79	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	FOXP2	NM_148900.3,NM_148899.3,NM_148898.3,NM_014491.3,NM_001172767.2,NM_001172766.2	99,99,99,99,99,99	0,1,6502	TT,TA,AA		0.0,0.0227,0.0077	benign,benign,benign,benign,benign,benign	350/733,333/433,358/741,333/716,358/458,332/715	114284748	1,13005	2203	4300	6503	SO:0001583	missense	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.998A>T	7.37:g.114284748A>T	ENSP00000377132:p.His333Leu	Somatic		WXS	SOLID	Phase_I	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.991094	0.74703	2.27E-4	0.0	ENSG00000128573	ENST00000393500;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000390668;ENST00000393491	T;T;T;T;T;T;T;T;T;T	0.19669	2.14;2.14;2.14;2.14;2.14;2.13;2.14;2.14;2.14;2.14	5.64	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.24774	0.0601	M	0.69358	2.11	0.80722	D	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001;0.0;0.0	T	0.03086	-1.1074	10	0.59425	D	0.04	.	12.0276	0.53380	0.8704:0.0:0.0:0.1295	.	332;350;241;333;357;333;358	B7ZLK5;B4DLD9;Q0PRL4;O15409-6;Q8N6B5;O15409;O15409-4	.;.;.;.;.;FOXP2_HUMAN;.	L	258;333;358;350;333;310;333;241;333;357;241	ENSP00000377137:H258L;ENSP00000377132:H333L;ENSP00000386200:H358L;ENSP00000385069:H350L;ENSP00000265436:H333L;ENSP00000367482:H333L;ENSP00000377129:H241L;ENSP00000353367:H333L;ENSP00000375084:H357L;ENSP00000377130:H241L	ENSP00000265436:H333L	H	+	2	0	FOXP2	114071984	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.910000	0.92685	0.957000	0.37930	-0.468000	0.05107	CAT		0.463	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1		NM_014491	
FRMPD1	22844	hgsc.bcm.edu	37	9	37740099	37740099	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr9:37740099A>G	ENST00000539465.1	+	15	2167	c.1574A>G	c.(1573-1575)gAc>gGc	p.D525G	FRMPD1_ENST00000541302.1_Missense_Mutation_p.D394G|FRMPD1_ENST00000536622.1_Missense_Mutation_p.D347G|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.D525G			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	525						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GCCTGCAGTGACTCAGAGGAG	0.547																																																	0													99.0	105.0	103.0					9																	37740099		2203	4300	6503	SO:0001583	missense	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1574A>G	9.37:g.37740099A>G	ENSP00000444411:p.Asp525Gly	Somatic		WXS	SOLID	Phase_I	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.455872	0.84209	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.23552	2.79;2.79;1.9;1.94	5.65	5.65	0.86999	.	0.165528	0.52532	D	0.000075	T	0.46347	0.1388	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.28808	-1.0032	10	0.24483	T	0.36	-24.6991	13.8157	0.63290	1.0:0.0:0.0:0.0	.	394;525	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	G	525;525;347;394	ENSP00000366995:D525G;ENSP00000444411:D525G;ENSP00000437762:D347G;ENSP00000444804:D394G	ENSP00000366995:D525G	D	+	2	0	FRMPD1	37730099	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	8.032000	0.88838	2.150000	0.67090	0.533000	0.62120	GAC		0.547	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1		NM_014907	
GPR98	84059	hgsc.bcm.edu;ucsc.edu	37	5	90000251	90000252	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr5:90000251_90000252insT	ENST00000405460.2	+	36	8428_8429	c.8332_8333insT	c.(8332-8334)attfs	p.I2778fs		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2778	Calx-beta 19. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGATGACAACATTCCTGAGGAG	0.332																																																	0																																										SO:0001589	frameshift_variant	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8334dupT	5.37:g.90000253_90000253dupT	ENSP00000384582:p.Ile2778fs	Somatic		WXS	SOLID	Phase_I	O75171|Q8TF58|Q9H0X5|Q9UL61	Frame_Shift_Ins	INS	ENST00000405460.2	37	CCDS47246.1																																																																																				0.332	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2		NM_032119	
GEMIN5	25929	hgsc.bcm.edu;ucsc.edu	37	5	154271054	154271054	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr5:154271054T>A	ENST00000285873.7	-	26	4084	c.4009A>T	c.(4009-4011)Agg>Tgg	p.R1337W		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1337					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCTGAAGGCCTGTTTGGCTCT	0.488																																																	0													174.0	166.0	169.0					5																	154271054		2203	4300	6503	SO:0001583	missense	25929			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.4009A>T	5.37:g.154271054T>A	ENSP00000285873:p.Arg1337Trp	Somatic		WXS	SOLID	Phase_I	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.859220	0.32884	.	.	ENSG00000082516	ENST00000285873	T	0.71103	-0.54	5.7	-11.4	0.00090	.	1.393920	0.04174	N	0.325351	T	0.42471	0.1204	N	0.22421	0.69	0.09310	N	1	P;P	0.44044	0.825;0.825	B;B	0.36289	0.221;0.221	T	0.55082	-0.8196	10	0.72032	D	0.01	1.4661	0.4331	0.00474	0.3935:0.1831:0.202:0.2214	.	1336;1337	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	W	1337	ENSP00000285873:R1337W	ENSP00000285873:R1337W	R	-	1	2	GEMIN5	154251247	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.954000	0.03873	-1.909000	0.01085	-0.333000	0.08304	AGG		0.488	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1			
IGSF10	285313	hgsc.bcm.edu;ucsc.edu	37	3	151160902	151160902	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr3:151160902C>T	ENST00000282466.3	-	5	5832	c.5833G>A	c.(5833-5835)Gct>Act	p.A1945T	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1945	Ig-like C2-type 6.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGGGATGCAGCTTCTATCCTG	0.493																																																	0													137.0	136.0	137.0					3																	151160902		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5833G>A	3.37:g.151160902C>T	ENSP00000282466:p.Ala1945Thr	Somatic		WXS	SOLID	Phase_I	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.653456	0.00779	.	.	ENSG00000152580	ENST00000489791;ENST00000282466;ENST00000544042	T;T	0.65549	-0.16;-0.16	5.38	-2.84	0.05751	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.744670	0.03353	N	0.196527	T	0.31544	0.0800	N	0.01771	-0.73	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20174	-1.0283	10	0.13853	T	0.58	.	7.3472	0.26670	0.3387:0.4797:0.0:0.1816	.	1945	Q6WRI0	IGS10_HUMAN	T	13;1945;572	ENSP00000417627:A13T;ENSP00000282466:A1945T	ENSP00000282466:A1945T	A	-	1	0	IGSF10	152643592	0.000000	0.05858	0.030000	0.17652	0.049000	0.14656	-0.355000	0.07671	-0.354000	0.08212	-0.189000	0.12847	GCT		0.493	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1		NM_178822	
LBH	81606	hgsc.bcm.edu	37	2	30480413	30480413	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr2:30480413C>T	ENST00000395323.3	+	3	452	c.244C>T	c.(244-246)Cct>Tct	p.P82S	LBH_ENST00000406087.1_3'UTR|LBH_ENST00000401506.1_Missense_Mutation_p.P88S|LBH_ENST00000467242.1_3'UTR|LBH_ENST00000407930.2_Missense_Mutation_p.P65S|LBH_ENST00000404397.1_Intron	NM_030915.3	NP_112177.2	Q53QV2	LBH_HUMAN	limb bud and heart development	82					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(172;0.155)					CCGGTGGCCCCCTGAGGAGTT	0.562																																																	0													50.0	56.0	54.0					2																	30480413		2203	4300	6503	SO:0001583	missense	81606			AF110224	CCDS33173.1	2p23.1	2012-12-07	2012-12-07		ENSG00000213626	ENSG00000213626			29532	protein-coding gene	gene with protein product		611763	"""limb bud and heart development homolog (mouse)"""			11230166, 11336496	Standard	NM_030915		Approved		uc002rne.2	Q53QV2	OTTHUMG00000152051	ENST00000395323.3:c.244C>T	2.37:g.30480413C>T	ENSP00000378733:p.Pro82Ser	Somatic		WXS	SOLID	Phase_I	B2RBC2|Q9H0Q1	Missense_Mutation	SNP	ENST00000395323.3	37	CCDS33173.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888342	0.91814	.	.	ENSG00000213626	ENST00000395323;ENST00000401506;ENST00000407930	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.78528	0.4297	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81720	-0.0804	9	0.87932	D	0	-13.5752	16.8327	0.85949	0.0:1.0:0.0:0.0	.	82	Q53QV2	LBH_HUMAN	S	82;88;65	.	ENSP00000378733:P82S	P	+	1	0	LBH	30333917	1.000000	0.71417	0.977000	0.42913	0.988000	0.76386	7.495000	0.81514	2.211000	0.71520	0.549000	0.68633	CCT		0.562	LBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325091.1		NM_030915	
LCE1B	353132	hgsc.bcm.edu	37	1	152785261	152785261	+	Missense_Mutation	SNP	C	C	G	rs76754774	byFrequency	TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr1:152785261C>G	ENST00000360090.3	+	1	815	c.339C>G	c.(337-339)caC>caG	p.H113Q		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	113	Gly-rich.				keratinization (GO:0031424)					breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGGCCAGCACTCTGGAGGCT	0.607													C|||	132	0.0263578	0.0961	0.0072	5008	,	,		17023	0.0		0.0	False		,,,				2504	0.0																0								C	GLN/HIS	416,3988		22,372,1808	36.0	45.0	42.0		339	0.3	1.0	1	dbSNP_131	42	0,8598		0,0,4299	yes	missense	LCE1B	NM_178349.1	24	22,372,6107	GG,GC,CC		0.0,9.446,3.1995	benign	113/119	152785261	416,12586	2202	4299	6501	SO:0001583	missense	353132			BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.339C>G	1.37:g.152785261C>G	ENSP00000353203:p.His113Gln	Somatic		WXS	SOLID	Phase_I	A4IF40	Missense_Mutation	SNP	ENST00000360090.3	37	CCDS1027.1	45	0.020604395604395604	44	0.08943089430894309	1	0.0027624309392265192	0	0.0	0	0.0	C	9.256	1.042039	0.19748	0.09446	0.0	ENSG00000196734	ENST00000360090;ENST00000439693	T	0.03358	3.96	4.68	0.347	0.16022	.	1.948520	0.02941	N	0.140410	T	0.00875	0.0029	N	0.08118	0	0.20307	N	0.999914	B	0.02656	0.0	B	0.04013	0.001	T	0.48364	-0.9042	10	0.87932	D	0	.	8.6999	0.34318	0.1582:0.3068:0.535:0.0	.	113	Q5T7P3	LCE1B_HUMAN	Q	113;105	ENSP00000353203:H113Q	ENSP00000353203:H113Q	H	+	3	2	LCE1B	151051885	0.806000	0.28996	0.989000	0.46669	0.886000	0.51366	-0.089000	0.11180	-0.016000	0.14127	-0.181000	0.13052	CAC		0.607	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1		NM_178349	
MAGEB2	4113	hgsc.bcm.edu	37	X	30236766	30236766	+	Silent	SNP	G	G	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chrX:30236766G>A	ENST00000378988.4	+	2	170	c.69G>A	c.(67-69)cgG>cgA	p.R23R		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	23										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						ATGAGACCCGGGGTCTCAATG	0.572																																																	0													37.0	36.0	36.0					X																	30236766		2202	4300	6502	SO:0001819	synonymous_variant	4113			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.69G>A	X.37:g.30236766G>A		Somatic		WXS	SOLID	Phase_I	O75860	Silent	SNP	ENST00000378988.4	37	CCDS14219.1																																																																																				0.572	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1		NM_002364	
MAML2	84441	hgsc.bcm.edu	37	11	95825797	95825797	+	Silent	SNP	A	A	G	rs7931870	byFrequency	TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:95825797A>G	ENST00000524717.1	-	2	2682	c.1398T>C	c.(1396-1398)tcT>tcC	p.S466S		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	466					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				GTCCAGCAGAAGAGGGCAAGG	0.587			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								A|||	2531	0.505391	0.7224	0.464	5008	,	,		19396	0.2014		0.5736	False		,,,				2504	0.4847							Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0								A		3061,1279		1112,837,221	59.0	62.0	61.0		1398	-8.5	0.0	11	dbSNP_116	61	4951,3611		1461,2029,791	no	coding-synonymous	MAML2	NM_032427.1		2573,2866,1012	GG,GA,AA		42.1747,29.47,37.9011		466/1157	95825797	8012,4890	2170	4281	6451	SO:0001819	synonymous_variant	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1398T>C	11.37:g.95825797A>G		Somatic		WXS	SOLID	Phase_I	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																				0.587	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1			
MAP2	4133	hgsc.bcm.edu	37	2	210559405	210559405	+	Missense_Mutation	SNP	G	G	C	rs543596001		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr2:210559405G>C	ENST00000360351.4	+	7	3017	c.2511G>C	c.(2509-2511)gaG>gaC	p.E837D	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E833D|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	837					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCCCATCAGAGACTGTGGTTG	0.507																																					Pancreas(27;423 979 28787 29963)												0													119.0	118.0	118.0					2																	210559405		2203	4300	6503	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2511G>C	2.37:g.210559405G>C	ENSP00000353508:p.Glu837Asp	Somatic		WXS	SOLID	Phase_I	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	6.100	0.386721	0.11524	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.24723	1.84;1.84	5.67	4.74	0.60224	MAP2/Tau projection (1);	0.308471	0.27856	N	0.017573	T	0.15262	0.0368	L	0.29908	0.895	0.09310	N	0.999998	B;B	0.10296	0.002;0.003	B;B	0.12156	0.004;0.007	T	0.12041	-1.0563	10	0.21540	T	0.41	-7.6105	5.0917	0.14711	0.0732:0.1257:0.5585:0.2426	.	833;837	P11137-3;P11137	.;MAP2_HUMAN	D	837;833	ENSP00000353508:E837D;ENSP00000392164:E833D	ENSP00000353508:E837D	E	+	3	2	MAP2	210267650	0.213000	0.23551	0.990000	0.47175	0.890000	0.51754	0.241000	0.18065	2.683000	0.91414	0.557000	0.71058	GAG		0.507	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2		NM_001039538	
MPDZ	8777	hgsc.bcm.edu	37	9	13192294	13192294	+	Splice_Site	SNP	C	C	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr9:13192294C>G	ENST00000319217.7	-	15	2051	c.1804G>C	c.(1804-1806)Gta>Cta	p.V602L	MPDZ_ENST00000381015.4_Splice_Site_p.V602L|MPDZ_ENST00000536827.1_Splice_Site_p.V602L|MPDZ_ENST00000546205.1_Splice_Site_p.V602L|MPDZ_ENST00000381022.2_Splice_Site_p.V602L|MPDZ_ENST00000541718.1_Splice_Site_p.V602L|MPDZ_ENST00000447879.1_Splice_Site_p.V602L	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	602	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		ATGCCATTTACCTGTGAAAAA	0.308																																																	0													64.0	58.0	60.0					9																	13192294		1858	4084	5942	SO:0001630	splice_region_variant	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1804-1G>C	9.37:g.13192294C>G		Somatic		WXS	SOLID	Phase_I	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	C	22.4	4.283157	0.80803	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.77	5.77	0.91146	.	0.178185	0.26727	N	0.022811	T	0.69744	0.3145	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.996	T	0.75107	-0.3434	10	0.72032	D	0.01	.	19.9915	0.97366	0.0:1.0:0.0:0.0	.	602;602;602	B7ZMI4;O75970-3;O75970-2	.;.;.	L	602	ENSP00000320006:V602L;ENSP00000439807:V602L;ENSP00000370410:V602L;ENSP00000444151:V602L;ENSP00000415208:V602L;ENSP00000370403:V602L;ENSP00000446358:V602L	ENSP00000320006:V602L	V	-	1	0	MPDZ	13182294	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	7.487000	0.81328	2.723000	0.93209	0.655000	0.94253	GTA		0.308	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2		NM_003829	Missense_Mutation
MUC2	4583	hgsc.bcm.edu	37	11	1082315	1082315	+	Silent	SNP	C	C	T	rs58179195	byFrequency	TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:1082315C>T	ENST00000441003.2	+	14	1797	c.1770C>T	c.(1768-1770)ctC>ctT	p.L590L	MUC2_ENST00000359061.5_Silent_p.L590L	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	590	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGTGCTCCCTCCTGAAGAAGA	0.672													C|||	24	0.00479233	0.0166	0.0029	5008	,	,		15365	0.0		0.0	False		,,,				2504	0.0																0										47,3791		1,45,1873	27.0	30.0	29.0		1770	-3.0	1.0	11	dbSNP_129	29	0,8182		0,0,4091	no	coding-synonymous	MUC2	NM_002457.2		1,45,5964	TT,TC,CC		0.0,1.2246,0.391		590/2813	1082315	47,11973	1919	4091	6010	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.1770C>T	11.37:g.1082315C>T		Somatic		WXS	SOLID	Phase_I	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.672	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
NUP160	23279	hgsc.bcm.edu;ucsc.edu	37	11	47861527	47861527	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:47861527C>G	ENST00000378460.2	-	4	662	c.616G>C	c.(616-618)Gca>Cca	p.A206P	NUP160_ENST00000526870.1_3'UTR|NUP160_ENST00000530326.1_Missense_Mutation_p.A92P|NUP160_ENST00000532747.1_Intron|NUP160_ENST00000528071.1_Missense_Mutation_p.A92P	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	206					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CCAGGTACTGCTGGAATTAAC	0.463																																																	0													115.0	109.0	111.0					11																	47861527		2201	4298	6499	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.616G>C	11.37:g.47861527C>G	ENSP00000367721:p.Ala206Pro	Somatic		WXS	SOLID	Phase_I	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.059427	0.36373	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.40476	1.03;1.03;1.03	5.44	-3.9	0.04181	.	0.846890	0.10827	N	0.629757	T	0.37571	0.1008	L	0.44542	1.39	0.09310	N	0.999999	B	0.28350	0.208	B	0.42112	0.376	T	0.51679	-0.8675	10	0.27082	T	0.32	.	8.1471	0.31119	0.1035:0.3362:0.0:0.5603	.	206	Q12769	NU160_HUMAN	P	206;92;92	ENSP00000367721:A206P;ENSP00000433590:A92P;ENSP00000432367:A92P	ENSP00000367721:A206P	A	-	1	0	NUP160	47818103	0.000000	0.05858	0.896000	0.35187	0.857000	0.48899	-1.405000	0.02492	-0.616000	0.05671	-0.150000	0.13652	GCA		0.463	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2		NM_015231	
OSBPL10	114884	hgsc.bcm.edu	37	3	31712424	31712424	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr3:31712424C>A	ENST00000396556.2	-	9	1900	c.1778G>T	c.(1777-1779)aGt>aTt	p.S593I	OSBPL10_ENST00000438237.2_Missense_Mutation_p.S529I	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	593					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GGCGTAGGCACTAGGCAGGGT	0.562																																																	0													119.0	106.0	110.0					3																	31712424		2203	4300	6503	SO:0001583	missense	114884			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1778G>T	3.37:g.31712424C>A	ENSP00000379804:p.Ser593Ile	Somatic		WXS	SOLID	Phase_I	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.97|13.97	2.396832|2.396832	0.42512|0.42512	.|.	.|.	ENSG00000144645|ENSG00000144645	ENST00000396556;ENST00000438237|ENST00000429492	T;T|.	0.32023|.	1.47;1.47|.	5.47|5.47	4.59|4.59	0.56863|0.56863	.|.	0.176017|.	0.64402|.	D|.	0.000008|.	T|T	0.70395|0.70395	0.3219|0.3219	M|M	0.85777|0.85777	2.775|2.775	0.27069|0.27069	N|N	0.96335|0.96335	D;D;D|.	0.76494|.	0.999;0.958;0.98|.	D;P;D|.	0.68765|.	0.96;0.821;0.936|.	T|T	0.65450|0.65450	-0.6165|-0.6165	10|5	0.62326|.	D|.	0.03|.	-11.8149|-11.8149	14.6358|14.6358	0.68689|0.68689	0.0:0.9284:0.0:0.0716|0.0:0.9284:0.0:0.0716	.|.	529;593;361|.	B4E212;Q9BXB5;Q59ED9|.	.;OSB10_HUMAN;.|.	I|L	593;529|362	ENSP00000379804:S593I;ENSP00000406124:S529I|.	ENSP00000379804:S593I|.	S|V	-|-	2|1	0|0	OSBPL10|OSBPL10	31687428|31687428	1.000000|1.000000	0.71417|0.71417	0.254000|0.254000	0.24359|0.24359	0.019000|0.019000	0.09904|0.09904	3.795000|3.795000	0.55499|0.55499	2.550000|2.550000	0.86006|0.86006	0.557000|0.557000	0.71058|0.71058	AGT|GTG		0.562	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2			
P2RY10	27334	hgsc.bcm.edu;ucsc.edu	37	X	78216453	78216453	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chrX:78216453C>T	ENST00000171757.2	+	4	716	c.436C>T	c.(436-438)Cgt>Tgt	p.R146C	P2RY10_ENST00000544091.1_Missense_Mutation_p.R146C|P2RY10_ENST00000475374.1_3'UTR	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.R146G(1)|p.R146C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						AGACTGGAAGCGTAGGTACGA	0.488																																																	2	Substitution - Missense(2)	lung(1)|breast(1)											105.0	95.0	98.0					X																	78216453		2203	4300	6503	SO:0001583	missense	27334			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.436C>T	X.37:g.78216453C>T	ENSP00000171757:p.Arg146Cys	Somatic		WXS	SOLID	Phase_I	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949730	0.34377	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.73047	-0.71;-0.71	4.6	4.6	0.57074	GPCR, rhodopsin-like superfamily (1);	0.129634	0.52532	D	0.000064	T	0.78220	0.4249	M	0.90705	3.14	0.58432	D	0.999996	P	0.39831	0.69	B	0.41236	0.351	D	0.83716	0.0190	10	0.66056	D	0.02	.	15.1859	0.73002	0.0:1.0:0.0:0.0	.	146	O00398	P2Y10_HUMAN	C	146	ENSP00000443138:R146C;ENSP00000171757:R146C	ENSP00000171757:R146C	R	+	1	0	P2RY10	78103109	1.000000	0.71417	0.999000	0.59377	0.002000	0.02628	4.557000	0.60782	2.142000	0.66516	0.287000	0.19450	CGT		0.488	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			
PLEKHH3	79990	hgsc.bcm.edu	37	17	40825443	40825443	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr17:40825443T>C	ENST00000591022.1	-	5	1009	c.622A>G	c.(622-624)Acc>Gcc	p.T208A	PLEKHH3_ENST00000456950.2_5'UTR|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.T208A|PLEKHH3_ENST00000412503.1_Missense_Mutation_p.T208A	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	208					signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		AGTAGCTGGGTGGGGGTCTCC	0.632																																																	0													45.0	51.0	49.0					17																	40825443		2203	4300	6503	SO:0001583	missense	79990			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.622A>G	17.37:g.40825443T>C	ENSP00000468678:p.Thr208Ala	Somatic		WXS	SOLID	Phase_I	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	ENST00000591022.1	37	CCDS11434.1	.	.	.	.	.	.	.	.	.	.	T	18.72	3.685067	0.68157	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	T;T	0.47528	0.84;0.84	5.2	5.2	0.72013	.	0.000000	0.53938	D	0.000059	T	0.58637	0.2136	M	0.61703	1.905	0.45227	D	0.998231	D;D	0.65815	0.995;0.991	P;P	0.59424	0.857;0.723	T	0.54549	-0.8277	10	0.14656	T	0.56	-17.2757	14.1881	0.65620	0.0:0.0:0.0:1.0	.	208;208	Q7Z736-2;Q7Z736	.;PKHH3_HUMAN	A	208	ENSP00000293349:T208A;ENSP00000411885:T208A	ENSP00000293349:T208A	T	-	1	0	PLEKHH3	38078969	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.832000	0.86757	2.184000	0.69523	0.533000	0.62120	ACC		0.632	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1		NM_024927	
POR	5447	hgsc.bcm.edu	37	7	75614139	75614139	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr7:75614139C>T	ENST00000461988.1	+	11	1216	c.1111C>T	c.(1111-1113)Cgc>Tgc	p.R371C	POR_ENST00000419840.1_Missense_Mutation_p.R185C|POR_ENST00000394893.1_Missense_Mutation_p.R371C|POR_ENST00000439269.1_Missense_Mutation_p.R109C|POR_ENST00000450476.1_Missense_Mutation_p.R270C|POR_ENST00000545601.1_Missense_Mutation_p.R179C|TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	368	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	TACGTCCTACCGCACGGCCCT	0.647																																																	0													87.0	94.0	91.0					7																	75614139		2177	4274	6451	SO:0001583	missense	5447			AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1111C>T	7.37:g.75614139C>T	ENSP00000419970:p.Arg371Cys	Somatic		WXS	SOLID	Phase_I	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	37	CCDS5579.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.376342|4.376342	0.82682|0.82682	.|.	.|.	ENSG00000127948|ENSG00000127948	ENST00000447222|ENST00000461988;ENST00000419840;ENST00000394893;ENST00000545601;ENST00000450476;ENST00000439269	.|D;D;D;D;D;D	.|0.84944	.|-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	5.22|5.22	4.31|4.31	0.51392|0.51392	.|Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	.|0.103888	.|0.64402	.|D	.|0.000002	D|D	0.94840|0.94840	0.8333|0.8333	H|H	0.96720|0.96720	3.87|3.87	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.987;0.999;0.998;0.999	D|D	0.96162|0.96162	0.9116|0.9116	5|10	.|0.87932	.|D	.|0	-29.9169|-29.9169	14.5495|14.5495	0.68057|0.68057	0.0:0.8527:0.1473:0.0|0.0:0.8527:0.1473:0.0	.|.	.|368;270;179;377	.|P16435;E7EVY7;F5H468;Q59ED7	.|NCPR_HUMAN;.;.;.	L|C	421|371;185;371;179;270;109	.|ENSP00000419970:R371C;ENSP00000414244:R185C;ENSP00000378355:R371C;ENSP00000446149:R179C;ENSP00000416572:R270C;ENSP00000412490:R109C	.|ENSP00000378355:R371C	P|R	+|+	2|1	0|0	POR|POR	75452075|75452075	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.026000|6.026000	0.70873|0.70873	1.140000|1.140000	0.42260|0.42260	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.647	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7		NM_000941	
PPM1B	5495	hgsc.bcm.edu;ucsc.edu	37	2	44429133	44429133	+	Silent	SNP	T	T	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr2:44429133T>A	ENST00000282412.4	+	2	1207	c.795T>A	c.(793-795)tcT>tcA	p.S265S	PPM1B_ENST00000345249.4_Intron|PPM1B_ENST00000409432.3_Silent_p.S265S|PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000378551.2_Silent_p.S265S|PPM1B_ENST00000409895.4_Silent_p.S265S	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	265					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TTGAGGTATCTGATGACCTGG	0.353																																																	0													109.0	106.0	107.0					2																	44429133		2203	4300	6503	SO:0001819	synonymous_variant	5495			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.795T>A	2.37:g.44429133T>A		Somatic		WXS	SOLID	Phase_I	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Silent	SNP	ENST00000282412.4	37	CCDS1817.1																																																																																				0.353	PPM1B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250672.1		NM_002706	
PPP4R4	57718	hgsc.bcm.edu;ucsc.edu	37	14	94697034	94697034	+	Silent	SNP	C	C	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr14:94697034C>A	ENST00000304338.3	+	4	559	c.405C>A	c.(403-405)ctC>ctA	p.L135L	PPP4R4_ENST00000555690.1_3'UTR	NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	135					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						ACTCATTCCTCCAAGTCATTC	0.443																																																	0													140.0	125.0	130.0					14																	94697034		2203	4300	6503	SO:0001819	synonymous_variant	57718			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.405C>A	14.37:g.94697034C>A		Somatic		WXS	SOLID	Phase_I	Q9BUF8|Q9HCF0	Silent	SNP	ENST00000304338.3	37	CCDS9921.1																																																																																				0.443	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1		NM_058237	
PTCHD3	374308	hgsc.bcm.edu;ucsc.edu	37	10	27688016	27688016	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr10:27688016C>T	ENST00000438700.3	-	4	1628	c.1511G>A	c.(1510-1512)gGg>gAg	p.G504E		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	504	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GCTCATAATCCCTGTATATAA	0.388																																																	0													98.0	90.0	93.0					10																	27688016		2203	4299	6502	SO:0001583	missense	374308			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1511G>A	10.37:g.27688016C>T	ENSP00000417658:p.Gly504Glu	Somatic		WXS	SOLID	Phase_I	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560025	0.45590	.	.	ENSG00000182077	ENST00000438700	D	0.97378	-4.36	4.08	4.08	0.47627	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.98429	0.9477	M	0.84948	2.725	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.99636	1.0987	10	0.87932	D	0	-17.1935	16.0519	0.80769	0.0:1.0:0.0:0.0	.	504	Q3KNS1	PTHD3_HUMAN	E	504	ENSP00000417658:G504E	ENSP00000417658:G504E	G	-	2	0	PTCHD3	27728022	0.999000	0.42202	0.808000	0.32385	0.184000	0.23303	4.522000	0.60539	2.100000	0.63781	0.484000	0.47621	GGG		0.388	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3		XM_370541	
REM1	28954	hgsc.bcm.edu	37	20	30064331	30064331	+	Missense_Mutation	SNP	A	A	G	rs1006459	byFrequency	TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr20:30064331A>G	ENST00000201979.2	+	2	376	c.83A>G	c.(82-84)cAc>cGc	p.H28R	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	28			H -> R (in dbSNP:rs1006459). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CCACGGGGCCACCAGCCTGGC	0.647													G|||	2277	0.454673	0.9024	0.3386	5008	,	,		15593	0.2659		0.3221	False		,,,				2504	0.2628																0								G	ARG/HIS	3545,861	334.7+/-303.5	1425,695,83	72.0	86.0	81.0		83	0.2	0.7	20	dbSNP_86	81	2700,5900	681.6+/-403.7	411,1878,2011	yes	missense	REM1	NM_014012.4	29	1836,2573,2094	GG,GA,AA		31.3953,19.5415,48.0163	benign	28/299	30064331	6245,6761	2203	4300	6503	SO:0001583	missense	28954			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.83A>G	20.37:g.30064331A>G	ENSP00000201979:p.His28Arg	Somatic		WXS	SOLID	Phase_I	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	ENST00000201979.2	37	CCDS13181.1	974	0.445970695970696	437	0.8882113821138211	137	0.3784530386740331	163	0.28496503496503495	237	0.31266490765171506	G	3.961	-0.010297	0.07727	0.804585	0.313953	ENSG00000088320	ENST00000201979	T	0.65364	-0.15	4.25	0.213	0.15244	.	1.023970	0.07776	N	0.952480	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31194	-0.9952	9	0.24483	T	0.36	.	5.039	0.14449	0.4557:0.1613:0.383:0.0	rs1006459;rs60259937	28	O75628	REM1_HUMAN	R	28	ENSP00000201979:H28R	ENSP00000201979:H28R	H	+	2	0	REM1	29527992	0.001000	0.12720	0.662000	0.29724	0.712000	0.41017	-0.783000	0.04638	-0.017000	0.14103	-0.119000	0.15052	CAC		0.647	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2		NM_014012	
RIN1	9610	hgsc.bcm.edu	37	11	66100043	66100043	+	Missense_Mutation	SNP	G	G	A	rs2282532	byFrequency	TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:66100043G>A	ENST00000311320.4	-	10	2182	c.2056C>T	c.(2056-2058)Cct>Tct	p.P686S	RIN1_ENST00000524804.1_5'Flank|RIN1_ENST00000530056.1_Missense_Mutation_p.P520S|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000424433.2_Intron	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	686	Ras and 14-3-3 protein binding region.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.P686S(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						AGGGCCCCAGGGGGCAGGCGG	0.667													G|||	136	0.0271565	0.0794	0.0029	5008	,	,		17291	0.0268		0.001	False		,,,				2504	0.001																1	Substitution - Missense(1)	lung(1)						G	SER/PRO	336,4064	174.8+/-204.3	15,306,1879	85.0	97.0	93.0		2056	4.0	0.5	11	dbSNP_100	93	1,8587		0,1,4293	yes	missense	RIN1	NM_004292.2	74	15,307,6172	AA,AG,GG		0.0116,7.6364,2.5947	probably-damaging	686/784	66100043	337,12651	2200	4294	6494	SO:0001583	missense	9610			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.2056C>T	11.37:g.66100043G>A	ENSP00000310406:p.Pro686Ser	Somatic		WXS	SOLID	Phase_I	O15010|Q00427|Q96CC8	Missense_Mutation	SNP	ENST00000311320.4	37	CCDS31614.1	53	0.024267399267399268	41	0.08333333333333333	0	0.0	10	0.017482517482517484	2	0.002638522427440633	G	19.86	3.905943	0.72868	0.076364	1.16E-4	ENSG00000174791	ENST00000311320;ENST00000530056	T;T	0.16457	2.34;2.34	4.93	3.99	0.46301	Ras-association (3);	0.455727	0.19525	N	0.112192	T	0.02380	0.0073	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.996	D;D;D	0.91635	0.975;0.999;0.952	T	0.00044	-1.2222	10	0.66056	D	0.02	-10.7891	11.2615	0.49085	0.0:0.1856:0.8144:0.0	rs2282532	520;317;686	E9PNR2;B4DW96;Q13671	.;.;RIN1_HUMAN	S	686;520	ENSP00000310406:P686S;ENSP00000432798:P520S	ENSP00000310406:P686S	P	-	1	0	RIN1	65856619	0.993000	0.37304	0.496000	0.27539	0.983000	0.72400	2.207000	0.42788	1.153000	0.42468	0.462000	0.41574	CCT		0.667	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2		NM_004292	
SERPINA6	866	hgsc.bcm.edu;ucsc.edu	37	14	94780531	94780531	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr14:94780531T>A	ENST00000341584.3	-	2	601	c.455A>T	c.(454-456)gAg>gTg	p.E152V		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	152					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	GACCTCTGACTCATAGTAGTG	0.473																																																	0													125.0	121.0	122.0					14																	94780531		2203	4300	6503	SO:0001583	missense	866			J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.455A>T	14.37:g.94780531T>A	ENSP00000342850:p.Glu152Val	Somatic		WXS	SOLID	Phase_I	A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	37	CCDS9924.1	.	.	.	.	.	.	.	.	.	.	T	8.665	0.901364	0.17760	.	.	ENSG00000170099	ENST00000341584	D	0.88124	-2.34	5.05	-5.16	0.02857	Serpin domain (3);	1.245440	0.05603	N	0.576766	D	0.88081	0.6341	M	0.86651	2.83	0.09310	N	1	B	0.28378	0.209	B	0.37692	0.256	T	0.77075	-0.2722	10	0.38643	T	0.18	.	6.5286	0.22314	0.0:0.3223:0.2204:0.4573	.	152	P08185	CBG_HUMAN	V	152	ENSP00000342850:E152V	ENSP00000342850:E152V	E	-	2	0	SERPINA6	93850284	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.006000	0.13152	-0.835000	0.04234	-0.313000	0.08912	GAG		0.473	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1		NM_001756	
SPEG	10290	hgsc.bcm.edu	37	2	220342464	220342464	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr2:220342464A>G	ENST00000312358.7	+	21	4915	c.4783A>G	c.(4783-4785)Agg>Ggg	p.R1595G	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1595					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCATCGAGGAAGGAGACTCAG	0.602																																																	0													92.0	100.0	97.0					2																	220342464		2036	4175	6211	SO:0001583	missense	10290			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4783A>G	2.37:g.220342464A>G	ENSP00000311684:p.Arg1595Gly	Somatic		WXS	SOLID	Phase_I	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.479332	0.26511	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.39406	1.08	4.84	2.3	0.28687	Protein kinase-like domain (1);	0.602886	0.13983	N	0.349370	T	0.35566	0.0936	N	0.25825	0.765	0.80722	D	1	P	0.47910	0.902	P	0.47528	0.549	T	0.09773	-1.0659	10	0.41790	T	0.15	.	10.7603	0.46261	0.4629:0.5371:0.0:0.0	.	1595	Q15772	SPEG_HUMAN	G	1595	ENSP00000311684:R1595G	ENSP00000265327:R1595G	R	+	1	2	SPEG	220050708	0.061000	0.20836	0.995000	0.50966	0.898000	0.52572	0.629000	0.24538	0.965000	0.38133	0.533000	0.62120	AGG		0.602	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2		NM_005876	
TAF1L	138474	hgsc.bcm.edu;ucsc.edu	37	9	32634567	32634567	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr9:32634567C>A	ENST00000242310.4	-	1	1100	c.1011G>T	c.(1009-1011)gaG>gaT	p.E337D	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	337					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AAAATTTGGACTCCACAGGAA	0.483																																																	0													197.0	175.0	183.0					9																	32634567		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1011G>T	9.37:g.32634567C>A	ENSP00000418379:p.Glu337Asp	Somatic		WXS	SOLID	Phase_I	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.386273	0.42308	.	.	ENSG00000122728	ENST00000242310	T	0.56444	0.46	1.04	1.04	0.20106	.	0.000000	0.85682	D	0.000000	T	0.44561	0.1299	M	0.73962	2.25	0.37702	D	0.924261	B	0.25850	0.136	B	0.25405	0.06	T	0.35822	-0.9773	10	0.35671	T	0.21	.	3.4007	0.07323	0.0:0.6968:0.0:0.3032	.	337	Q8IZX4	TAF1L_HUMAN	D	337	ENSP00000418379:E337D	ENSP00000418379:E337D	E	-	3	2	TAF1L	32624567	1.000000	0.71417	0.995000	0.50966	0.779000	0.44077	0.485000	0.22324	0.507000	0.28148	0.195000	0.17529	GAG		0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			
TRO	7216	hgsc.bcm.edu	37	X	54957281	54957281	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chrX:54957281T>C	ENST00000173898.7	+	12	4236	c.4124T>C	c.(4123-4125)gTt>gCt	p.V1375A	TRO_ENST00000319167.8_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Missense_Mutation_p.V978A|TRO_ENST00000420798.2_Missense_Mutation_p.V906A|TRO_ENST00000375022.4_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1375	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						AGCACTGGTGTTGGCTTCTGC	0.592																																																	0													81.0	83.0	82.0					X																	54957281		2057	4178	6235	SO:0001583	missense	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.4124T>C	X.37:g.54957281T>C	ENSP00000173898:p.Val1375Ala	Somatic		WXS	SOLID	Phase_I	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	T	0.153	-1.089759	0.01873	.	.	ENSG00000067445	ENST00000173898;ENST00000319179;ENST00000420798;ENST00000375041	T;T;T	0.04603	4.26;3.59;3.92	2.96	1.05	0.20165	.	.	.	.	.	T	0.01489	0.0048	N	0.01352	-0.895	0.09310	N	1	B;B	0.22346	0.068;0.068	B;B	0.25884	0.064;0.064	T	0.47995	-0.9073	9	0.06757	T	0.87	.	5.8111	0.18467	0.0:0.6819:0.0:0.3181	.	978;1375	B1AKE9;Q12816	.;TROP_HUMAN	A	1375;301;906;978	ENSP00000173898:V1375A;ENSP00000405126:V906A;ENSP00000364181:V978A	ENSP00000173898:V1375A	V	+	2	0	TRO	54974006	0.005000	0.15991	0.002000	0.10522	0.096000	0.18686	-0.235000	0.09016	0.397000	0.25310	0.153000	0.16174	GTT		0.592	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3		NM_016157	
TULP3	7289	hgsc.bcm.edu;ucsc.edu	37	12	3047337	3047337	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr12:3047337C>A	ENST00000448120.2	+	10	1132	c.1081C>A	c.(1081-1083)Ctg>Atg	p.L361M	TULP3_ENST00000397132.2_Missense_Mutation_p.L361M	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	361					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TCTGGTTGAGCTGCACAACAA	0.488																																																	0													118.0	109.0	112.0					12																	3047337		2203	4300	6503	SO:0001583	missense	7289			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1081C>A	12.37:g.3047337C>A	ENSP00000410051:p.Leu361Met	Somatic		WXS	SOLID	Phase_I	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.04|14.04	2.416564|2.416564	0.42918|0.42918	.|.	.|.	ENSG00000078246|ENSG00000078246	ENST00000541678;ENST00000538704|ENST00000228245;ENST00000544943;ENST00000542730;ENST00000448120;ENST00000397132	.|D;D;D	.|0.89681	.|-2.55;-2.55;-2.55	5.2|5.2	2.26|2.26	0.28386|0.28386	.|Tubby, C-terminal (4);	.|0.072303	.|0.56097	.|N	.|0.000025	D|D	0.91988|0.91988	0.7462|0.7462	M|M	0.75884|0.75884	2.315|2.315	0.52501|0.52501	D|D	0.999958|0.999958	.|D;D;D	.|0.71674	.|0.998;0.958;0.997	.|D;P;D	.|0.75484	.|0.986;0.903;0.968	D|D	0.89427|0.89427	0.3714|0.3714	5|10	.|0.54805	.|T	.|0.06	-8.3496|-8.3496	5.7283|5.7283	0.18024|0.18024	0.1415:0.6258:0.0:0.2326|0.1415:0.6258:0.0:0.2326	.|.	.|185;361;361	.|B7Z1E7;O75386;F8WBZ9	.|.;TULP3_HUMAN;.	D|M	37;26|361;88;185;361;361	.|ENSP00000442631:L88M;ENSP00000410051:L361M;ENSP00000380321:L361M	.|ENSP00000228245:L361M	A|L	+|+	2|1	0|2	TULP3|TULP3	2917598|2917598	0.982000|0.982000	0.34865|0.34865	0.950000|0.950000	0.38849|0.38849	0.388000|0.388000	0.30384|0.30384	0.722000|0.722000	0.25925|0.25925	0.539000|0.539000	0.28788|0.28788	-0.144000|-0.144000	0.13903|0.13903	GCT|CTG		0.488	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1		NM_003324	
VPS13B	157680	hgsc.bcm.edu	37	8	100133693	100133693	+	Intron	SNP	G	G	T			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr8:100133693G>T	ENST00000358544.2	+	8	1317				VPS13B_ENST00000441350.2_Missense_Mutation_p.C409F|VPS13B_ENST00000357162.2_Intron|VPS13B_ENST00000355155.1_Intron|VPS13B_ENST00000395996.1_Intron|CTD-2340D6.1_ENST00000523226.1_RNA	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)						protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTCTCTTGCTGTTTATATCTC	0.333																																					Colon(161;2205 2542 7338 31318)												0													135.0	138.0	137.0					8																	100133693		2203	4300	6503	SO:0001627	intron_variant	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1206+20G>T	8.37:g.100133693G>T		Somatic		WXS	SOLID	Phase_I	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	2.428	-0.331433	0.05314	.	.	ENSG00000132549	ENST00000441350	D	0.83163	-1.69	4.72	-7.74	0.01241	.	.	.	.	.	T	0.55049	0.1896	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46261	-0.9204	8	.	.	.	.	1.513	0.02500	0.4012:0.2873:0.119:0.1925	.	409	Q7Z7G8-5	.	F	409	ENSP00000398472:C409F	.	C	+	2	0	VPS13B	100202869	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-0.851000	0.04313	-1.656000	0.01495	-0.181000	0.13052	TGT		0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	
ZDHHC22	283576	hgsc.bcm.edu	37	14	77605834	77605834	+	Missense_Mutation	SNP	G	G	C	rs200313152		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr14:77605834G>C	ENST00000319374.4	-	2	450	c.248C>G	c.(247-249)tCg>tGg	p.S83W	AC007375.1_ENST00000600936.1_5'Flank|RP11-463C8.4_ENST00000557752.1_Intron	NM_174976.2	NP_777636.2	Q8N966	ZDH22_HUMAN	zinc finger, DHHC-type containing 22	83					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)|urinary_tract(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		CTTCCTGGCCGAGGCCCCCTG	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15094	0.0		0.0	False		,,,				2504	0.0																0								G	TRP/SER	8,4034		0,8,2013	20.0	23.0	22.0		248	3.4	0.0	14		22	0,8350		0,0,4175	yes	missense	ZDHHC22	NM_174976.2	177	0,8,6188	CC,CG,GG		0.0,0.1979,0.0646	possibly-damaging	83/264	77605834	8,12384	2021	4175	6196	SO:0001583	missense	283576			AK095612	CCDS45140.1	14q24.3	2008-08-06	2004-03-05	2004-03-10	ENSG00000177108	ENSG00000177108		"""Zinc fingers, DHHC-type"""	20106	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 59"""	C14orf59			Standard	NM_174976		Approved		uc010asp.3	Q8N966		ENST00000319374.4:c.248C>G	14.37:g.77605834G>C	ENSP00000318222:p.Ser83Trp	Somatic		WXS	SOLID	Phase_I	A6NH02|B7Z2L5|Q149P4	Missense_Mutation	SNP	ENST00000319374.4	37	CCDS45140.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139232	0.37728	0.001979	0.0	ENSG00000177108	ENST00000319374;ENST00000555389	T	0.57273	0.41	5.3	3.42	0.39159	.	1.196770	0.05929	N	0.634824	T	0.36635	0.0974	N	0.08118	0	0.09310	N	1	P	0.51449	0.945	P	0.45276	0.475	T	0.23013	-1.0200	10	0.66056	D	0.02	.	4.8975	0.13759	0.0828:0.1901:0.5966:0.1305	.	83	Q8N966	ZDH22_HUMAN	W	83	ENSP00000318222:S83W	ENSP00000318222:S83W	S	-	2	0	ZDHHC22	76675587	0.762000	0.28451	0.001000	0.08648	0.465000	0.32709	1.367000	0.34204	0.584000	0.29591	0.561000	0.74099	TCG		0.632	ZDHHC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414289.1		NM_174976	
ZNF214	7761	hgsc.bcm.edu;ucsc.edu	37	11	7022631	7022631	+	Missense_Mutation	SNP	G	G	C	rs578193586		TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr11:7022631G>C	ENST00000278314.4	-	3	598	c.283C>G	c.(283-285)Ctc>Gtc	p.L95V	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.L95V	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGCTGTGTGAGGTCTTTGGAA	0.448																																					Ovarian(22;251 657 736 21522 46864)												0													343.0	339.0	340.0					11																	7022631		2201	4295	6496	SO:0001583	missense	7761			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.283C>G	11.37:g.7022631G>C	ENSP00000278314:p.Leu95Val	Somatic		WXS	SOLID	Phase_I	B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	37	CCDS31418.1	.	.	.	.	.	.	.	.	.	.	G	0.045	-1.269254	0.01421	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.11169	2.8;2.8	3.9	-1.9	0.07665	.	0.582885	0.12986	N	0.422837	T	0.03783	0.0107	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.15052	0.012	T	0.43294	-0.9400	10	0.15066	T	0.55	.	3.617	0.08081	0.1601:0.2342:0.4865:0.1193	.	95	Q9UL59	ZN214_HUMAN	V	95	ENSP00000278314:L95V;ENSP00000445373:L95V	ENSP00000278314:L95V	L	-	1	0	ZNF214	6979207	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	0.341000	0.19909	-0.850000	0.04152	-2.086000	0.00376	CTC		0.448	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1			
ZNF500	26048	hgsc.bcm.edu	37	16	4812665	4812665	+	Silent	SNP	G	G	A			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr16:4812665G>A	ENST00000219478.6	-	3	806	c.507C>T	c.(505-507)tcC>tcT	p.S169S	ZNF500_ENST00000545009.1_Silent_p.S169S			O60304	ZN500_HUMAN	zinc finger protein 500	169					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S169S(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CTTCCTCCAGGGACAGATCCT	0.622																																																	1	Substitution - coding silent(1)	large_intestine(1)											84.0	92.0	90.0					16																	4812665		2197	4300	6497	SO:0001819	synonymous_variant	26048			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.507C>T	16.37:g.4812665G>A		Somatic		WXS	SOLID	Phase_I	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Silent	SNP	ENST00000219478.6	37	CCDS32383.1																																																																																				0.622	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1		XM_085507	
PI4KB	5298	hgsc.bcm.edu;ucsc.edu	37	1	151261955	151261955	+	IGR	SNP	T	T	G			TCGA-CJ-4870-01A-01D-1373-10	TCGA-CJ-4870-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72fffb6f-a58b-4f05-87fe-ccd28b4babff	80217c32-1ac8-4909-843d-2e351684dc95	g.chr1:151261955T>G	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Missense_Mutation_p.F858C			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTCAGTGTCTTTAAGTGCCCG	0.537																																					Colon(154;765 1838 9854 28443 37492)												0													168.0	145.0	153.0					1																	151261955		2203	4300	6503	SO:0001628	intergenic_variant	57592			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151261955T>G		Somatic		WXS	SOLID	Phase_I	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.9|20.9	4.067982|4.067982	0.76301|0.76301	.|.	.|.	ENSG00000143373|ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879|ENST00000426871	T;T;T|.	0.33654|.	1.4;1.4;1.4|.	5.13|5.13	5.13|5.13	0.70059|0.70059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);|.	0.000000|.	0.36002|.	N|.	0.002842|.	T|T	0.65228|0.65228	0.2671|0.2671	M|M	0.71206|0.71206	2.165|2.165	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.66744|0.66744	-0.5846|-0.5846	10|5	0.87932|.	D|.	0|.	-12.7306|-12.7306	14.0604|14.0604	0.64797|0.64797	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	858;858|.	Q8N1G0-2;Q8N1G0|.	.;ZN687_HUMAN|.	C|V	858|461	ENSP00000336620:F858C;ENSP00000319829:F858C;ENSP00000357874:F858C|.	ENSP00000319829:F858C|.	F|L	+|+	2|1	0|2	ZNF687|ZNF687	149528579|149528579	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	7.819000|7.819000	0.86621|0.86621	2.153000|2.153000	0.67306|0.67306	0.459000|0.459000	0.35465|0.35465	TTT|TTA		0.537	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3		NM_002651	
